changeset 0:91bf3f0d7455 draft

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/sklearn commit 76583c1fcd9d06a4679cc46ffaee44117b9e22cd
author bgruening
date Sat, 04 Aug 2018 12:31:24 -0400
parents
children f727f5ff7d60
files README.rst main_macros.xml search_model_validation.xml test-data/RF01704.fasta test-data/accuracy_score.txt test-data/auc.txt test-data/average_precision_score.txt test-data/blobs.txt test-data/brier_score_loss.txt test-data/circles.txt test-data/class.txt test-data/classification_report.txt test-data/cluster_result01.txt test-data/cluster_result02.txt test-data/cluster_result03.txt test-data/cluster_result04.txt test-data/cluster_result05.txt test-data/cluster_result06.txt test-data/cluster_result07.txt test-data/cluster_result08.txt test-data/cluster_result09.txt test-data/cluster_result10.txt test-data/cluster_result11.txt test-data/cluster_result12 test-data/cluster_result12.txt test-data/cluster_result13.txt test-data/cluster_result14.txt test-data/cluster_result15.txt test-data/cluster_result16.txt test-data/cluster_result17.txt test-data/cluster_result18.txt test-data/cluster_result19.txt test-data/cluster_result20.txt test-data/cluster_result21.txt test-data/confusion_matrix.txt test-data/converter_result01.json test-data/converter_result02.json test-data/csc_sparse1.mtx test-data/csc_sparse2.mtx test-data/csc_stack_result01.mtx test-data/csr_sparse1.mtx test-data/csr_sparse2.mtx test-data/csr_stack_result01.mtx test-data/empty_file.txt test-data/f1_score.txt test-data/fbeta_score.txt test-data/feature_selection_result01 test-data/feature_selection_result02 test-data/feature_selection_result03 test-data/feature_selection_result04 test-data/feature_selection_result05 test-data/feature_selection_result06 test-data/feature_selection_result07 test-data/feature_selection_result08 test-data/feature_selection_result09 test-data/feature_selection_result10 test-data/feature_selection_result11 test-data/feature_selection_result12 test-data/friedman1.txt test-data/friedman2.txt test-data/friedman3.txt test-data/gaus.txt test-data/gbc_model01 test-data/gbc_result01 test-data/gbr_model01 test-data/gbr_prediction_result01.tabular test-data/glm_model01 test-data/glm_model02 test-data/glm_model03 test-data/glm_model04 test-data/glm_model05 test-data/glm_model06 test-data/glm_model07 test-data/glm_model08 test-data/glm_result01 test-data/glm_result02 test-data/glm_result03 test-data/glm_result04 test-data/glm_result05 test-data/glm_result06 test-data/glm_result07 test-data/glm_result08 test-data/hamming_loss.txt test-data/hastie.txt test-data/hinge_loss.txt test-data/jaccard_similarity_score.txt test-data/lda_model01 test-data/lda_model02 test-data/lda_prediction_result01.tabular test-data/lda_prediction_result02.tabular test-data/log_loss.txt test-data/matthews_corrcoef.txt test-data/moons.txt test-data/mv_result01.tabular test-data/mv_result02.tabular test-data/mv_result03.tabular test-data/mv_result04.tabular test-data/mv_result05.tabular test-data/mv_result06.tabular test-data/nn_model01.txt test-data/nn_model02.txt test-data/nn_model03.txt test-data/nn_prediction_result01.tabular test-data/nn_prediction_result02.tabular test-data/nn_prediction_result03.tabular test-data/numeric_values.tabular test-data/pipeline01 test-data/pipeline02 test-data/pipeline03 test-data/pipeline04 test-data/pipeline05 test-data/pipeline06 test-data/pipeline07 test-data/pipeline08 test-data/precision_recall_curve.txt test-data/precision_recall_fscore_support.txt test-data/precision_score.txt test-data/prp_model01 test-data/prp_model02 test-data/prp_model03 test-data/prp_model04 test-data/prp_model05 test-data/prp_model06 test-data/prp_model07 test-data/prp_model08 test-data/prp_model09 test-data/prp_result01 test-data/prp_result02 test-data/prp_result03 test-data/prp_result04 test-data/prp_result05 test-data/prp_result06 test-data/prp_result07 test-data/prp_result08 test-data/prp_result09 test-data/pw_metric01.tabular test-data/pw_metric02.tabular test-data/pw_metric03.tabular test-data/qda_model01 test-data/qda_prediction_result01.tabular test-data/recall_score.txt test-data/regression.txt test-data/regression_X.tabular test-data/regression_metrics_result01 test-data/regression_metrics_result02 test-data/regression_metrics_result03 test-data/regression_metrics_result04 test-data/regression_metrics_result05 test-data/regression_metrics_result06 test-data/regression_test.tabular test-data/regression_test_X.tabular test-data/regression_test_y.tabular test-data/regression_train.tabular test-data/regression_y.tabular test-data/rfc_model01 test-data/rfc_result01 test-data/rfc_result02 test-data/rfr_model01 test-data/rfr_result01 test-data/roc_auc_score.txt test-data/roc_curve.txt test-data/scurve.txt test-data/searchCV01 test-data/sparse.mtx test-data/sparse_u.txt test-data/svc_model01.txt test-data/svc_model02.txt test-data/svc_model03.txt test-data/svc_prediction_result01.tabular test-data/svc_prediction_result02.tabular test-data/svc_prediction_result03.tabular test-data/swiss_r.txt test-data/test.tabular test-data/test2.tabular test-data/test3.tabular test-data/test_set.tabular test-data/train.tabular test-data/train_set.tabular test-data/vectorizer_result01.mtx test-data/vectorizer_result02.mtx test-data/vectorizer_result03.mtx test-data/vectorizer_result04.mtx test-data/y.tabular test-data/zero_one_loss.txt
diffstat 184 files changed, 60388 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/README.rst	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,150 @@
+***************
+Galaxy wrapper for scikit-learn library
+***************
+
+Contents
+========
+- `What is scikit-learn?`_
+	- `Scikit-learn main package groups`_
+	- `Tools offered by this wrapper`_
+
+- `Machine learning workflows`_
+	- `Supervised learning workflows`_
+	- `Unsupervised learning workflows`_
+
+
+____________________________
+
+
+.. _What is scikit-learn?
+
+What is scikit-learn?
+===========================
+
+Scikit-learn is an open-source machine learning library for the Python programming language. It offers various algorithms for performing supervised and unsupervised learning as well as data preprocessing and transformation, model selection and evaluation, and dataset utilities. It is built upon SciPy (Scientific Python) library.
+
+Scikit-learn source code can be accessed at https://github.com/scikit-learn/scikit-learn.
+Detailed installation instructions can be found at http://scikit-learn.org/stable/install.html
+
+
+.. _Scikit-learn main package groups:
+
+======
+Scikit-learn main package groups
+======
+
+Scikit-learn provides the users with several main groups of related operations.
+These are:
+
+- Classification
+    - Identifying to which category an object belongs.
+- Regression
+    - Predicting a continuous-valued attribute associated with an object.
+- Clustering
+    - Automatic grouping of similar objects into sets.
+- Preprocessing
+    - Feature extraction and normalization.
+- Model selection and evaluation
+    - Comparing, validating and choosing parameters and models.
+- Dimensionality reduction
+    - Reducing the number of random variables to consider.
+
+Each group consists of a number of well-known algorithms from the category. For example, one can find hierarchical, spectral, kmeans, and other clustering methods in sklearn.cluster package.
+
+
+.. _Tools offered by this wrapper:
+
+===================
+Available tools in the current wrapper
+===================
+
+The current release of the wrapper offers a subset of the packages from scikit-learn library. You can find:
+
+- A subset of classification metric functions
+- Linear and quadratic discriminant classifiers
+- Random forest and Ada boost classifiers and regressors
+- All the clustering methods
+- All support vector machine classifiers
+- A subset of data preprocessing estimator classes
+- Pairwise metric measurement functions
+
+In addition, several tools for performing matrix operations, generating problem-specific datasets, and encoding text and extracting features have been prepared to help the user with more advanced operations.
+
+.. _Machine learning workflows:
+
+Machine learning workflows
+===============
+
+Machine learning is about processes. No matter what machine learning algorithm we use, we can apply typical workflows and dataflows to produce more robust models and better predictions.
+Here we discuss supervised and unsupervised learning workflows.
+
+.. _Supervised learning workflows:
+
+===================
+Supervised machine learning workflows
+===================
+
+**What is supervised learning?**
+
+In this machine learning task, given sample data which are labeled, the aim is to build a model which can predict the labels for new observations.
+In practice, there are five steps which we can go through to start from raw input data and end up getting reasonable predictions for new samples:
+
+1. Preprocess the data::
+
+    * Change the collected data into the proper format and datatype.
+    * Adjust the data quality by filling the missing values, performing
+    required scaling and normalizations, etc.
+    * Extract features which are the most meaningfull for the learning task.
+    * Split the ready dataset into training and test samples.
+
+2. Choose an algorithm::
+
+    * These factors help one to choose a learning algorithm:
+        - Nature of the data (e.g. linear vs. nonlinear data)
+        - Structure of the predicted output (e.g. binary vs. multilabel classification)
+        - Memory and time usage of the training
+        - Predictive accuracy on new data
+        - Interpretability of the predictions
+
+3. Choose a validation method
+
+	Every machine learning model should be evaluated before being put into practicical use.
+	There are numerous performance metrics to evaluate machine learning models.
+	For supervised learning, usually classification or regression metrics are used.
+
+	A validation method helps to evaluate the performance metrics of a trained model in order
+	to optimize its performance or ultimately switch to a more efficient model.
+	Cross-validation is a known validation method.
+
+4. Fit a model
+
+   Given the learning algorithm, validation method, and performance metric(s)
+   repeat the following steps::
+
+    * Train the model.
+    * Evaluate based on metrics.
+    * Optimize unitl satisfied.
+
+5. Use fitted model for prediction::
+
+	This is a final evaluation in which, the optimized model is used to make predictions
+	on unseen (here test) samples. After this, the model is put into production.
+
+.. _Unsupervised learning workflows:
+
+=======================
+Unsupervised machine learning workflows
+=======================
+
+**What is unsupervised learning?**
+
+Unlike supervised learning and more liklely in real life, here the initial data is not labeled.
+The task is to extract the structure from the data and group the samples based on their similarities.
+Clustering and dimensionality reduction are two famous examples of unsupervised learning tasks.
+
+In this case, the workflow is as follows::
+
+    * Preprocess the data (without splitting to train and test).
+    * Train a model.
+    * Evaluate and tune parameters.
+    * Analyse the model and test on real data.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/main_macros.xml	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,1515 @@
+<macros>
+  <token name="@VERSION@">0.9</token>
+
+  <token name="@COLUMNS_FUNCTION@">
+def read_columns(f, c=None, c_option='by_index_number', return_df=False, **args):
+  data = pandas.read_csv(f, **args)
+  if c_option == 'by_index_number':
+    cols = list(map(lambda x: x - 1, c))
+    data = data.iloc[:,cols]
+  if c_option == 'all_but_by_index_number':
+    cols = list(map(lambda x: x - 1, c))
+    data.drop(data.columns[cols], axis=1, inplace=True)
+  if c_option == 'by_header_name':
+    cols = [e.strip() for e in c.split(',')]
+    data = data[cols]
+  if c_option == 'all_but_by_header_name':
+    cols = [e.strip() for e in c.split(',')]
+    data.drop(cols, axis=1, inplace=True)
+  y = data.values
+  if return_df:
+    return y, data
+  else:
+    return y
+  return y
+  </token>
+
+## generate an instance for one of sklearn.feature_selection classes
+  <token name="@FEATURE_SELECTOR_FUNCTION@">
+def feature_selector(inputs):
+  selector = inputs["selected_algorithm"]
+  selector = getattr(sklearn.feature_selection, selector)
+  options = inputs["options"]
+
+  if inputs['selected_algorithm'] == 'SelectFromModel':
+    if not options['threshold'] or options['threshold'] == 'None':
+      options['threshold'] = None
+    if inputs['model_inputter']['input_mode'] == 'prefitted':
+      model_file = inputs['model_inputter']['fitted_estimator']
+      with open(model_file, 'rb') as model_handler:
+        fitted_estimator = pickle.load(model_handler)
+      new_selector = selector(fitted_estimator, prefit=True, **options)
+    else:
+      estimator_json = inputs['model_inputter']["estimator_selector"]
+      estimator = get_estimator(estimator_json)
+      new_selector = selector(estimator, **options)
+
+  elif inputs['selected_algorithm'] in ['RFE', 'RFECV']:
+    if 'scoring' in options and (not options['scoring'] or options['scoring'] == 'None'):
+      options['scoring'] = None
+    estimator=get_estimator(inputs["estimator_selector"])
+    new_selector = selector(estimator, **options)
+
+  elif inputs['selected_algorithm'] == "VarianceThreshold":
+    new_selector = selector(**options)
+
+  else:
+    score_func = inputs["score_func"]
+    score_func = getattr(sklearn.feature_selection, score_func)
+    new_selector = selector(score_func, **options)
+
+  return new_selector
+  </token>
+
+  <token name="@GET_X_y_FUNCTION@">
+def get_X_y(params, file1, file2):
+  input_type = params["selected_tasks"]["selected_algorithms"]["input_options"]["selected_input"]
+  if input_type=="tabular":
+    header = 'infer' if params["selected_tasks"]["selected_algorithms"]["input_options"]["header1"] else None
+    column_option = params["selected_tasks"]["selected_algorithms"]["input_options"]["column_selector_options_1"]["selected_column_selector_option"]
+    if column_option in ["by_index_number", "all_but_by_index_number", "by_header_name", "all_but_by_header_name"]:
+      c = params["selected_tasks"]["selected_algorithms"]["input_options"]["column_selector_options_1"]["col1"]
+    else:
+      c = None
+    X = read_columns(
+      file1,
+      c = c,
+      c_option = column_option,
+      sep='\t',
+      header=header,
+      parse_dates=True
+    )
+  else:
+    X = mmread(file1)
+
+  header = 'infer' if params["selected_tasks"]["selected_algorithms"]["input_options"]["header2"] else None
+  column_option = params["selected_tasks"]["selected_algorithms"]["input_options"]["column_selector_options_2"]["selected_column_selector_option2"]
+  if column_option in ["by_index_number", "all_but_by_index_number", "by_header_name", "all_but_by_header_name"]:
+    c = params["selected_tasks"]["selected_algorithms"]["input_options"]["column_selector_options_2"]["col2"]
+  else:
+    c = None
+  y = read_columns(
+    file2,
+    c = c,
+    c_option = column_option,
+    sep='\t',
+    header=header,
+    parse_dates=True
+  )
+  y=y.ravel()
+  return X, y
+  </token>
+
+  <token name="@GET_SEARCH_PARAMS_FUNCTION@">
+def get_search_params(params_builder):
+  search_params = {}
+
+  def safe_eval(literal):
+
+    FROM_SCIPY_STATS = [  'bernoulli', 'binom', 'boltzmann', 'dlaplace', 'geom', 'hypergeom',
+                          'logser', 'nbinom', 'planck', 'poisson', 'randint', 'skellam', 'zipf' ]
+
+    FROM_NUMPY_RANDOM = [ 'beta', 'binomial', 'bytes', 'chisquare', 'choice', 'dirichlet', 'division',
+                          'exponential', 'f', 'gamma', 'geometric', 'gumbel', 'hypergeometric',
+                          'laplace', 'logistic', 'lognormal', 'logseries', 'mtrand', 'multinomial',
+                          'multivariate_normal', 'negative_binomial', 'noncentral_chisquare', 'noncentral_f',
+                          'normal', 'pareto', 'permutation', 'poisson', 'power', 'rand', 'randint',
+                          'randn', 'random', 'random_integers', 'random_sample', 'ranf', 'rayleigh',
+                          'sample', 'seed', 'set_state', 'shuffle', 'standard_cauchy', 'standard_exponential',
+                          'standard_gamma', 'standard_normal', 'standard_t', 'triangular', 'uniform',
+                          'vonmises', 'wald', 'weibull', 'zipf' ]
+
+    # File opening and other unneeded functions could be dropped
+    UNWANTED = ['open', 'type', 'dir', 'id', 'str', 'repr']
+
+    # Allowed symbol table. Add more if needed.
+    new_syms = {
+      'np_arange': getattr(np, 'arange'),
+      'ensemble_ExtraTreesClassifier': getattr(ensemble, 'ExtraTreesClassifier')
+    }
+
+    syms = make_symbol_table(use_numpy=False, **new_syms)
+
+    for method in FROM_SCIPY_STATS:
+      syms['scipy_stats_' + method] = getattr(scipy.stats, method)
+
+    for func in FROM_NUMPY_RANDOM:
+      syms['np_random_' + func] = getattr(np.random, func)
+
+    for key in UNWANTED:
+      syms.pop(key, None)
+
+    aeval = Interpreter(symtable=syms, use_numpy=False, minimal=False,
+                      no_if=True, no_for=True, no_while=True, no_try=True,
+                      no_functiondef=True, no_ifexp=True, no_listcomp=False,
+                      no_augassign=False, no_assert=True, no_delete=True,
+                      no_raise=True, no_print=True)
+
+    return aeval(literal)
+
+  for p in params_builder['param_set']:
+    search_p = p['search_param_selector']['search_p']
+    if search_p.strip() == '':
+      continue
+    param_type = p['search_param_selector']['selected_param_type']
+
+    lst = search_p.split(":")
+    assert (len(lst) == 2), "Error, make sure there is one and only one colon in search parameter input."
+    literal = lst[1].strip()
+    ev = safe_eval(literal)
+    if param_type == "final_estimator_p":
+      search_params["estimator__" + lst[0].strip()] = ev
+    else:
+      search_params["preprocessing_" + param_type[5:6] + "__" + lst[0].strip()] = ev
+
+  return search_params
+  </token>
+
+  <token name="@GET_ESTIMATOR_FUNCTION@">
+def get_estimator(estimator_json):
+  estimator_module = estimator_json['selected_module']
+  estimator_cls = estimator_json['selected_estimator']
+
+  if estimator_module == "xgboost":
+    cls = getattr(xgboost, estimator_cls)
+  else:
+    module = getattr(sklearn, estimator_module)
+    cls = getattr(module, estimator_cls)
+
+  estimator = cls()
+
+  estimator_params = estimator_json['text_params'].strip()
+  if estimator_params != "":
+    try:
+      params = ast.literal_eval('{' + estimator_params + '}')
+    except ValueError:
+      sys.exit("Unsupported parameter input: `%s`" %estimator_params)
+    estimator.set_params(**params)
+
+  return estimator
+  </token>
+
+  <xml name="python_requirements">
+      <requirements>
+          <requirement type="package" version="2.7">python</requirement>
+          <requirement type="package" version="0.19.1">scikit-learn</requirement>
+          <requirement type="package" version="0.22.0">pandas</requirement>
+          <requirement type="package" version="0.72.1">xgboost</requirement>
+          <yield />
+      </requirements>
+  </xml>
+
+  <xml name="macro_stdio">
+    <stdio>
+        <exit_code range="1:" level="fatal" description="Error occurred. Please check Tool Standard Error"/>
+    </stdio>
+  </xml>
+
+
+  <!--Generic interface-->
+
+  <xml name="sl_Conditional" token_train="tabular" token_data="tabular" token_model="txt">
+    <conditional name="selected_tasks">
+        <param name="selected_task" type="select" label="Select a Classification Task">
+            <option value="train" selected="true">Train a model</option>
+            <option value="load">Load a model and predict</option>
+        </param>
+        <when value="load">
+            <param name="infile_model" type="data" format="@MODEL@" label="Models" help="Select a model file."/>
+            <param name="infile_data" type="data" format="@DATA@" label="Data (tabular)" help="Select the dataset you want to classify."/>
+            <param name="header" type="boolean" optional="True" truevalue="booltrue" falsevalue="boolfalse" checked="False" label="Does the dataset contain header:" />
+            <conditional name="prediction_options">
+                <param name="prediction_option" type="select" label="Select the type of prediction">
+                    <option value="predict">Predict class labels</option>
+                    <option value="advanced">Include advanced options</option>
+                </param>
+                <when value="predict">
+                </when>
+                <when value="advanced">
+                </when>
+            </conditional>
+        </when>
+        <when value="train">
+            <conditional name="selected_algorithms">
+                <yield />
+            </conditional>
+        </when>
+    </conditional>
+  </xml>
+
+  <xml name="advanced_section">
+    <section name="options" title="Advanced Options" expanded="False">
+      <yield />
+    </section>
+  </xml>
+
+
+  <!--Generalized Linear Models-->
+  <xml name="loss" token_help=" " token_select="false">
+    <param argument="loss" type="select" label="Loss function"  help="@HELP@">
+        <option value="squared_loss" selected="@SELECT@">squared loss</option>
+        <option value="huber">huber</option>
+        <option value="epsilon_insensitive">epsilon insensitive</option>
+        <option value="squared_epsilon_insensitive">squared epsilon insensitive</option>
+        <yield/>
+    </param>
+  </xml>
+
+  <xml name="penalty" token_help=" ">
+    <param argument="penalty" type="select" label="Penalty (regularization term)"  help="@HELP@">
+        <option value="l2" selected="true">l2</option>
+        <option value="l1">l1</option>
+        <option value="elasticnet">elastic net</option>
+        <option value="none">none</option>
+        <yield/>
+    </param>
+  </xml>
+
+  <xml name="l1_ratio" token_default_value="0.15" token_help=" ">
+    <param argument="l1_ratio" type="float" value="@DEFAULT_VALUE@" label="Elastic Net mixing parameter" help="@HELP@"/>
+  </xml>
+
+  <xml name="epsilon" token_default_value="0.1" token_help="Used if loss is ‘huber’, ‘epsilon_insensitive’, or ‘squared_epsilon_insensitive’. ">
+    <param argument="epsilon" type="float" value="@DEFAULT_VALUE@" label="Epsilon (epsilon-sensitive loss functions only)" help="@HELP@"/>
+  </xml>
+
+  <xml name="learning_rate_s" token_help=" " token_selected1="false" token_selected2="false">
+    <param argument="learning_rate" type="select" optional="true" label="Learning rate schedule"  help="@HELP@">
+        <option value="optimal" selected="@SELECTED1@">optimal</option>
+        <option value="constant">constant</option>
+        <option value="invscaling" selected="@SELECTED2@">inverse scaling</option>
+        <yield/>
+    </param>
+  </xml>
+
+  <xml name="eta0" token_default_value="0.0" token_help="Used with ‘constant’ or ‘invscaling’ schedules. ">
+    <param argument="eta0" type="float" value="@DEFAULT_VALUE@" label="Initial learning rate" help="@HELP@"/>
+  </xml>
+
+  <xml name="power_t" token_default_value="0.5" token_help=" ">
+    <param argument="power_t" type="float" value="@DEFAULT_VALUE@" label="Exponent for inverse scaling learning rate" help="@HELP@"/>
+  </xml>
+
+  <xml name="normalize" token_checked="false" token_help=" ">
+    <param argument="normalize" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="@CHECKED@" label="Normalize samples before training" help=" "/>
+  </xml>
+
+  <xml name="copy_X" token_checked="true" token_help=" ">
+    <param argument="copy_X" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="@CHECKED@" label="Use a copy of samples" help="If false, samples would be overwritten. "/>
+  </xml>
+
+  <xml name="ridge_params">
+    <expand macro="normalize"/>
+    <expand macro="alpha" default_value="1.0"/>
+    <expand macro="fit_intercept"/>
+    <expand macro="max_iter" default_value=""/>
+    <expand macro="tol" default_value="0.001" help_text="Precision of the solution. "/>
+    <!--class_weight-->
+    <expand macro="copy_X"/>
+    <param argument="solver" type="select" value="" label="Solver to use in the computational routines" help=" ">
+        <option value="auto" selected="true">auto</option>
+        <option value="svd">svd</option>
+        <option value="cholesky">cholesky</option>
+        <option value="lsqr">lsqr</option>
+        <option value="sparse_cg">sparse_cg</option>
+        <option value="sag">sag</option>
+    </param>
+    <expand macro="random_state"/>
+  </xml>
+
+  <!--Ensemble methods-->
+  <xml name="n_estimators" token_default_value="10" token_help=" ">
+    <param argument="n_estimators" type="integer" optional="true" value="@DEFAULT_VALUE@" label="Number of trees in the forest" help="@HELP@"/>
+  </xml>
+
+  <xml name="max_depth" token_default_value="" token_help=" ">
+    <param argument="max_depth" type="integer" optional="true" value="@DEFAULT_VALUE@" label="Maximum depth of the tree" help="@HELP@"/>
+  </xml>
+
+  <xml name="min_samples_split" token_type="integer" token_default_value="2" token_help=" ">
+    <param argument="min_samples_split" type="@TYPE@" optional="true" value="@DEFAULT_VALUE@" label="Minimum number of samples required to split an internal node" help="@HELP@"/>
+  </xml>
+
+  <xml name="min_samples_leaf" token_type="integer" token_default_value="1" token_label="Minimum number of samples in newly created leaves" token_help=" ">
+    <param argument="min_samples_leaf" type="@TYPE@" optional="true" value="@DEFAULT_VALUE@" label="@LABEL@" help="@HELP@"/>
+  </xml>
+
+  <xml name="min_weight_fraction_leaf" token_default_value="0.0" token_help=" ">
+    <param argument="min_weight_fraction_leaf" type="float" optional="true" value="@DEFAULT_VALUE@" label="Minimum weighted fraction of the input samples required to be at a leaf node" help="@HELP@"/>
+  </xml>
+
+  <xml name="max_leaf_nodes" token_default_value="" token_help=" ">
+    <param argument="max_leaf_nodes" type="integer" optional="true" value="@DEFAULT_VALUE@" label="Maximum number of leaf nodes in best-first method" help="@HELP@"/>
+  </xml>
+
+  <xml name="min_impurity_decrease" token_default_value="0" token_help=" ">
+    <param argument="min_impurity_decrease" type="float" value="@DEFAULT_VALUE@" optional="true" label="The threshold value of impurity for stopping node splitting" help="@HELP@"/>
+  </xml>
+
+  <xml name="bootstrap" token_checked="true" token_help=" ">
+    <param argument="bootstrap" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolflase" checked="@CHECKED@" label="Use bootstrap samples for building trees." help="@HELP@"/>
+  </xml>
+
+  <xml name="criterion" token_help=" ">
+    <param argument="criterion" type="select" label="Function to measure the quality of a split"  help=" ">
+        <option value="gini" selected="true">Gini impurity</option>
+        <option value="entropy">Information gain</option>
+        <yield/>
+    </param>
+  </xml>
+
+  <xml name="criterion2" token_help="">
+    <param argument="criterion" type="select" label="Function to measure the quality of a split" >
+      <option value="mse">mse - mean squared error</option>
+      <option value="mae">mae - mean absolute error</option>
+      <yield/>
+    </param>
+  </xml>
+
+  <xml name="oob_score" token_checked="false" token_help=" ">
+    <param argument="oob_score" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="@CHECKED@" label="Use out-of-bag samples to estimate the generalization error" help="@HELP@"/>
+  </xml>
+
+  <xml name="max_features">
+    <conditional name="select_max_features">
+      <param argument="max_features" type="select" label="max_features">
+        <option value="auto" selected="true">auto - max_features=n_features</option>
+        <option value="sqrt">sqrt - max_features=sqrt(n_features)</option>
+        <option value="log2">log2 - max_features=log2(n_features)</option>
+        <option value="number_input">I want to type the number in or input None type</option>
+      </param>
+      <when value="auto">
+      </when>
+      <when value="sqrt">
+      </when>
+      <when value="log2">
+      </when>
+      <when value="number_input">
+        <param name="num_max_features" type="float" value="" optional="true" label="Input max_features number:" help="If int, consider the number of features at each split; If float, then max_features is a percentage and int(max_features * n_features) features are considered at each split."/>
+      </when>
+    </conditional>
+  </xml>
+
+  <xml name="verbose" token_default_value="0" token_help="If 1 then it prints progress and performance once in a while. If greater than 1 then it prints progress and performance for every tree.">
+    <param argument="verbose" type="integer" value="@DEFAULT_VALUE@" optional="true" label="Enable verbose output" help="@HELP@"/>
+  </xml>
+
+  <xml name="learning_rate" token_default_value="1.0" token_help=" ">
+    <param argument="learning_rate" type="float" optional="true" value="@DEFAULT_VALUE@" label="Learning rate" help="@HELP@"/>
+  </xml>
+
+  <xml name="subsample" token_help=" ">
+    <param argument="subsample" type="float" value="1.0" optional="true" label="The fraction of samples to be used for fitting the individual base learners" help="@HELP@"/>
+  </xml>
+
+  <xml name="presort">
+    <param argument="presort" type="select" label="Whether to presort the data to speed up the finding of best splits in fitting" >
+      <option value="auto" selected="true">auto</option>
+      <option value="true">true</option>
+      <option value="false">false</option>
+    </param>
+  </xml>
+
+  <!--Parameters-->
+  <xml name="tol" token_default_value="0.0" token_help_text="Early stopping heuristics based on the relative center changes. Set to default (0.0) to disable this convergence detection.">
+        <param argument="tol" type="float" optional="true" value="@DEFAULT_VALUE@" label="Tolerance" help="@HELP_TEXT@"/>
+  </xml>
+
+  <xml name="n_clusters" token_default_value="8">
+    <param argument="n_clusters" type="integer" optional="true" value="@DEFAULT_VALUE@" label="Number of clusters" help=" "/>
+  </xml>
+
+  <xml name="fit_intercept" token_checked="true">
+    <param argument="fit_intercept" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="@CHECKED@" label="Estimate the intercept" help="If false, the data is assumed to be already centered."/>
+  </xml>
+
+  <xml name="n_jobs" token_default_value="1" token_label="The number of jobs to run in parallel for both fit and predict">
+    <param argument="n_jobs" type="integer" value="@DEFAULT_VALUE@" optional="true" label="@LABEL@" help="If -1, then the number of jobs is set to the number of cores"/>
+  </xml>
+
+  <xml name="n_iter" token_default_value="5" token_help_text="The number of passes over the training data (aka epochs). ">
+    <param argument="n_iter" type="integer" optional="true" value="@DEFAULT_VALUE@" label="Number of iterations" help="@HELP_TEXT@"/>
+  </xml>
+
+  <xml name="shuffle" token_checked="true" token_help_text=" " token_label="Shuffle data after each iteration">
+    <param argument="shuffle" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="@CHECKED@" label="@LABEL@" help="@HELP_TEXT@"/>
+  </xml>
+
+  <xml name="random_state" token_default_value="" token_help_text="Integer number. The seed of the pseudo random number generator to use when shuffling the data. A fixed seed allows reproducible results.">
+    <param argument="random_state" type="integer" optional="true" value="@DEFAULT_VALUE@" label="Random seed number" help="@HELP_TEXT@"/>
+  </xml>
+
+  <xml name="warm_start" token_checked="true" token_help_text="When set to True, reuse the solution of the previous call to fit as initialization,otherwise, just erase the previous solution.">
+    <param argument="warm_start" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="@CHECKED@" label="Perform warm start" help="@HELP_TEXT@"/>
+  </xml>
+
+  <xml name="C" token_default_value="1.0" token_help_text="Penalty parameter C of the error term.">
+    <param argument="C" type="float" optional="true" value="@DEFAULT_VALUE@" label="Penalty parameter" help="@HELP_TEXT@"/>
+  </xml>
+
+  <!--xml name="class_weight" token_default_value="" token_help_text="">
+    <param argument="class_weight" type="" optional="true" value="@DEFAULT_VALUE@" label="" help="@HELP_TEXT@"/>
+  </xml-->
+
+  <xml name="alpha" token_default_value="0.0001" token_help_text="Constant that multiplies the regularization term if regularization is used. ">
+    <param argument="alpha" type="float" optional="true" value="@DEFAULT_VALUE@" label="Regularization coefficient" help="@HELP_TEXT@"/>
+  </xml>
+
+  <xml name="n_samples" token_default_value="100" token_help_text="The total number of points equally divided among clusters.">
+    <param argument="n_samples" type="integer" optional="true" value="@DEFAULT_VALUE@" label="Number of samples" help="@HELP_TEXT@"/>
+  </xml>
+
+  <xml name="n_features" token_default_value="2" token_help_text="Number of different numerical properties produced for each sample.">
+    <param argument="n_features" type="integer" optional="true" value="@DEFAULT_VALUE@" label="Number of features" help="@HELP_TEXT@"/>
+  </xml>
+
+  <xml name="noise" token_default_value="0.0" token_help_text="Floating point number. ">
+    <param argument="noise" type="float" optional="true" value="@DEFAULT_VALUE@" label="Standard deviation of the Gaussian noise added to the data" help="@HELP_TEXT@"/>
+  </xml>
+
+  <xml name="C" token_default_value="1.0" token_help_text="Penalty parameter C of the error term. ">
+      <param argument="C" type="float" optional="true" value="@DEFAULT_VALUE@" label="Penalty parameter" help="@HELP_TEXT@"/>
+  </xml>
+
+  <xml name="max_iter" token_default_value="300" token_label="Maximum number of iterations per single run" token_help_text=" ">
+      <param argument="max_iter" type="integer" optional="true" value="@DEFAULT_VALUE@" label="@LABEL@" help="@HELP_TEXT@"/>
+  </xml>
+
+  <xml name="n_init" token_default_value="10" >
+      <param argument="n_init" type="integer" optional="true" value="@DEFAULT_VALUE@" label="Number of runs with different centroid seeds" help=" "/>
+  </xml>
+
+  <xml name="init">
+      <param argument="init" type="select" label="Centroid initialization method"  help="''k-means++'' selects initial cluster centers that speed up convergence. ''random'' chooses k observations (rows) at random from data as initial centroids.">
+          <option value="k-means++">k-means++</option>
+          <option value="random">random</option>
+      </param>
+  </xml>
+
+  <xml name="gamma" token_default_value="1.0" token_label="Scaling parameter" token_help_text=" ">
+    <param argument="gamma" type="float" optional="true" value="@DEFAULT_VALUE@" label="@LABEL@" help="@HELP_TEXT@"/>
+  </xml>
+
+  <xml name="degree" token_default_value="3" token_label="Degree of the polynomial" token_help_text=" ">
+    <param argument="degree" type="integer" optional="true" value="@DEFAULT_VALUE@" label="@LABEL@" help="@HELP_TEXT@"/>
+  </xml>
+
+  <xml name="coef0" token_default_value="1" token_label="Zero coefficient" token_help_text=" ">
+    <param argument="coef0" type="integer" optional="true" value="@DEFAULT_VALUE@" label="@LABEL@" help="@HELP_TEXT@"/>
+  </xml>
+
+  <xml name="pos_label" token_default_value="">
+    <param argument="pos_label" type="integer" optional="true" value="@DEFAULT_VALUE@" label="Label of the positive class" help=" "/>
+  </xml>
+
+  <xml name="average">
+    <param argument="average" type="select" optional="true" label="Averaging type" help=" ">
+      <option value="micro">Calculate metrics globally by counting the total true positives, false negatives and false positives. (micro)</option>
+      <option value="samples">Calculate metrics for each instance, and find their average. Only meaningful for multilabel. (samples)</option>
+      <option value="macro">Calculate metrics for each label, and find their unweighted mean. This does not take label imbalance into account. (macro)</option>
+      <option value="weighted">Calculate metrics for each label, and find their average, weighted by support (the number of true instances for each label). This alters ‘macro’ to account for label imbalance; it can result in an F-score that is not between precision and recall. (weighted)</option>
+      <option value="None">None</option>
+      <yield/>
+    </param>
+  </xml>
+
+  <xml name="beta">
+    <param argument="beta" type="float" value="1.0" label="The strength of recall versus precision in the F-score" help=" "/>
+  </xml>
+
+
+  <!--Data interface-->
+
+  <xml name="samples_tabular" token_multiple1="false" token_multiple2="false">
+    <param name="infile1" type="data" format="tabular" label="Training samples dataset:"/>
+    <param name="header1" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="False" label="Does the dataset contain header:" />
+    <conditional name="column_selector_options_1">
+      <expand macro="samples_column_selector_options" multiple="@MULTIPLE1@"/>
+    </conditional>
+    <param name="infile2" type="data" format="tabular" label="Dataset containing class labels:"/>
+    <param name="header2" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="False" label="Does the dataset contain header:" />
+    <conditional name="column_selector_options_2">
+      <expand macro="samples_column_selector_options" column_option="selected_column_selector_option2" col_name="col2" multiple="@MULTIPLE2@" infile="infile2"/>
+    </conditional>
+    <yield/>
+  </xml>
+
+  <xml name="samples_column_selector_options" token_column_option="selected_column_selector_option" token_col_name="col1" token_multiple="False" token_infile="infile1">
+    <param name="@COLUMN_OPTION@" type="select" label="Choose how to select data by column:">
+      <option value="by_index_number" selected="true">Select columns by column index number(s)</option>
+      <option value="by_header_name">Select columns by column header name(s)</option>
+      <option value="all_but_by_index_number">All columns but by column index number(s)</option>
+      <option value="all_but_by_header_name">All columns but by column header name(s)</option>
+      <option value="all_columns">All columns</option>
+    </param>
+    <when value="by_index_number">
+      <param name="@COL_NAME@" multiple="@MULTIPLE@" type="data_column" data_ref="@INFILE@" label="Select target column(s):"/>
+    </when>
+    <when value="by_header_name">
+      <param name="@COL_NAME@" type="text" value="" label="Type header name(s):" help="Comma-separated string. For example: target1,target2"/>
+    </when>
+    <when value="all_but_by_index_number">
+      <param name="@COL_NAME@" multiple="@MULTIPLE@" type="data_column" data_ref="@INFILE@" label="Select target column(s):"/>
+    </when>
+    <when value="all_but_by_header_name">
+      <param name="@COL_NAME@" type="text" value="" label="Type header name(s):" help="Comma-separated string. For example: target1,target2"/>
+    </when>
+    <when value="all_columns">
+    </when>
+  </xml>
+
+  <xml name="clf_inputs_extended" token_label1=" " token_label2=" " token_multiple="False">
+    <conditional name="true_columns">
+      <param name="selected_input1" type="select" label="Select the input type of true labels dataset:">
+          <option value="tabular" selected="true">Tabular</option>
+          <option value="sparse">Sparse</option>
+      </param>
+      <when value="tabular">
+        <param name="infile1" type="data" label="@LABEL1@"/>
+        <param name="col1" type="data_column" data_ref="infile1" label="Select the target column:"/>
+      </when>
+      <when value="sparse">
+          <param name="infile1" type="data" format="txt" label="@LABEL1@"/>
+      </when>
+    </conditional>
+    <conditional name="predicted_columns">
+      <param name="selected_input2" type="select" label="Select the input type of predicted labels dataset:">
+          <option value="tabular" selected="true">Tabular</option>
+          <option value="sparse">Sparse</option>
+      </param>
+      <when value="tabular">
+        <param name="infile2" type="data" label="@LABEL2@"/>
+        <param name="col2" multiple="@MULTIPLE@" type="data_column" data_ref="infile2" label="Select target column(s):"/>
+      </when>
+      <when value="sparse">
+          <param name="infile2" type="data" format="txt" label="@LABEL1@"/>
+      </when>
+    </conditional>
+  </xml>
+
+  <xml name="clf_inputs" token_label1="Dataset containing true labels (tabular):" token_label2="Dataset containing predicted values (tabular):" token_multiple1="False" token_multiple="False">
+    <param name="infile1" type="data" format="tabular" label="@LABEL1@"/>
+    <param name="header1" type="boolean" optional="True" truevalue="booltrue" falsevalue="boolfalse" checked="False" label="Does the dataset contain header:" />
+    <conditional name="column_selector_options_1">
+      <expand macro="samples_column_selector_options" multiple="@MULTIPLE1@"/>
+    </conditional>
+    <param name="infile2" type="data" format="tabular" label="@LABEL2@"/>
+    <param name="header2" type="boolean" optional="True" truevalue="booltrue" falsevalue="boolfalse" checked="False" label="Does the dataset contain header:" />
+    <conditional name="column_selector_options_2">
+      <expand macro="samples_column_selector_options" column_option="selected_column_selector_option2" col_name="col2" multiple="@MULTIPLE@" infile="infile2"/>
+    </conditional>
+  </xml>
+
+  <xml name="multiple_input" token_name="input_files" token_max_num="10" token_format="txt" token_label="Sparse matrix file (.mtx, .txt)" token_help_text="Specify a sparse matrix file in .txt format.">
+    <repeat name="@NAME@" min="1" max="@MAX_NUM@" title="Select input file(s):">
+        <param name="input" type="data" format="@FORMAT@" label="@LABEL@" help="@HELP_TEXT@"/>
+    </repeat>
+  </xml>
+
+  <xml name="sparse_target" token_label1="Select a sparse matrix:" token_label2="Select the tabular containing true labels:" token_multiple="False" token_format1="txt" token_format2="tabular" token_help1="" token_help2="">
+    <param name="infile1" type="data" format="@FORMAT1@" label="@LABEL1@" help="@HELP1@"/>
+    <param name="infile2" type="data" format="@FORMAT2@" label="@LABEL2@" help="@HELP2@"/>
+    <param name="col2" multiple="@MULTIPLE@" type="data_column" data_ref="infile2" label="Select target column(s):"/>
+  </xml>
+
+  <xml name="sl_mixed_input">
+    <conditional name="input_options">
+      <param name="selected_input" type="select" label="Select input type:">
+          <option value="tabular" selected="true">tabular data</option>
+          <option value="sparse">sparse matrix</option>
+      </param>
+      <when value="tabular">
+          <expand macro="samples_tabular" multiple1="true"/>
+      </when>
+      <when value="sparse">
+          <expand macro="sparse_target"/>
+      </when>
+    </conditional>
+  </xml>
+
+  <!--Advanced options-->
+  <xml name="nn_advanced_options">
+    <section name="options" title="Advanced Options" expanded="False">
+      <yield/>
+      <param argument="weights" type="select" label="Weight function" help="Used in prediction.">
+          <option value="uniform" selected="true">Uniform weights. All points in each neighborhood are weighted equally. (Uniform)</option>
+          <option value="distance">Weight points by the inverse of their distance. (Distance)</option>
+      </param>
+      <param argument="algorithm" type="select" label="Neighbor selection algorithm" help=" ">
+          <option value="auto" selected="true">Auto</option>
+          <option value="ball_tree">BallTree</option>
+          <option value="kd_tree">KDTree</option>
+          <option value="brute">Brute-force</option>
+      </param>
+      <param argument="leaf_size" type="integer" value="30" label="Leaf size" help="Used with BallTree and KDTree. Affects the time and memory usage of the constructed tree."/>
+      <!--param name="metric"-->
+      <!--param name="p"-->
+      <!--param name="metric_params"-->
+    </section>
+  </xml>
+
+  <xml name="svc_advanced_options">
+    <section name="options" title="Advanced Options" expanded="False">
+        <yield/>
+        <param argument="kernel" type="select" optional="true" label="Kernel type" help="Kernel type to be used in the algorithm. If none is given, ‘rbf’ will be used.">
+            <option value="rbf" selected="true">rbf</option>
+            <option value="linear">linear</option>
+            <option value="poly">poly</option>
+            <option value="sigmoid">sigmoid</option>
+            <option value="precomputed">precomputed</option>
+        </param>
+        <param argument="degree" type="integer" optional="true" value="3" label="Degree of the polynomial (polynomial kernel only)" help="Ignored by other kernels. dafault : 3 "/>
+        <!--TODO: param argument="gamma" float, optional (default=’auto’) -->
+        <param argument="coef0" type="float" optional="true" value="0.0" label="Zero coefficient (polynomial and sigmoid kernels only)"
+            help="Independent term in kernel function. dafault: 0.0 "/>
+        <param argument="shrinking" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="true"
+            label="Use the shrinking heuristic" help=" "/>
+        <param argument="probability" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="false"
+            label="Enable probability estimates. " help="This must be enabled prior to calling fit, and will slow down that method."/>
+        <!-- param argument="cache_size"-->
+        <!--expand macro="class_weight"/-->
+        <expand macro="tol" default_value="0.001" help_text="Tolerance for stopping criterion. "/>
+        <expand macro="max_iter" default_value="-1" label="Solver maximum number of iterations" help_text="Hard limit on iterations within solver, or -1 for no limit."/>
+        <!--param argument="decision_function_shape"-->
+        <expand macro="random_state" help_text="Integer number. The seed of the pseudo random number generator to use when shuffling the data for probability estimation. A fixed seed allows reproducible results."/>
+    </section>
+  </xml>
+
+  <xml name="spectral_clustering_advanced_options">
+    <section name="options" title="Advanced Options" expanded="False">
+        <expand macro="n_clusters"/>
+        <param argument="eigen_solver" type="select" value="" label="Eigen solver" help="The eigenvalue decomposition strategy to use.">
+            <option value="arpack" selected="true">arpack</option>
+            <option value="lobpcg">lobpcg</option>
+            <option value="amg">amg</option>
+            <!--None-->
+        </param>
+        <expand macro="random_state"/>
+        <expand macro="n_init"/>
+        <param argument="gamma" type="float" optional="true" value="1.0" label="Kernel scaling factor" help="Scaling factor of RBF, polynomial, exponential chi^2 and sigmoid affinity kernel. Ignored for affinity=''nearest_neighbors''."/>
+        <param argument="affinity" type="select" label="Affinity" help="Affinity kernel to use. ">
+            <option value="rbf" selected="true">RBF</option>
+            <option value="precomputed">precomputed</option>
+            <option value="nearest_neighbors">Nearset neighbors</option>
+        </param>
+        <param argument="n_neighbors" type="integer" optional="true" value="10" label="Number of neighbors" help="Number of neighbors to use when constructing the affinity matrix using the nearest neighbors method. Ignored for affinity=''rbf''"/>
+        <!--param argument="eigen_tol"-->
+        <param argument="assign_labels" type="select" label="Assign labels" help="The strategy to use to assign labels in the embedding space.">
+            <option value="kmeans" selected="true">kmeans</option>
+            <option value="discretize">discretize</option>
+        </param>
+        <param argument="degree" type="integer" optional="true" value="3"
+            label="Degree of the polynomial (polynomial kernel only)" help="Ignored by other kernels. dafault : 3 "/>
+        <param argument="coef0" type="integer" optional="true" value="1"
+            label="Zero coefficient (polynomial and sigmoid kernels only)" help="Ignored by other kernels. dafault : 1 "/>
+        <!--param argument="kernel_params"-->
+    </section>
+  </xml>
+
+  <xml name="minibatch_kmeans_advanced_options">
+    <section name="options" title="Advanced Options" expanded="False">
+        <expand macro="n_clusters"/>
+        <expand macro="init"/>
+        <expand macro="n_init" default_value="3"/>
+        <expand macro="max_iter" default_value="100"/>
+        <expand macro="tol" help_text="Early stopping heuristics based on normalized center change. To disable set to 0.0 ."/>
+        <expand macro="random_state"/>
+        <param argument="batch_size" type="integer" optional="true" value="100" label="Batch size" help="Size of the mini batches."/>
+        <!--param argument="compute_labels"-->
+        <param argument="max_no_improvement" type="integer" optional="true" value="10" label="Maximum number of improvement attempts" help="
+        Convergence detection based on inertia (the consecutive number of mini batches that doe not yield an improvement on the smoothed inertia).
+        To disable, set max_no_improvement to None. "/>
+        <param argument="init_size" type="integer" optional="true" value="" label="Number of random initialization samples" help="Number of samples to randomly sample for speeding up the initialization . ( default: 3 * batch_size )"/>
+        <param argument="reassignment_ratio" type="float" optional="true" value="0.01" label="Re-assignment ratio" help="Controls the fraction of the maximum number of counts for a center to be reassigned. Higher values yield better clustering results."/>
+    </section>
+  </xml>
+
+  <xml name="kmeans_advanced_options">
+    <section name="options" title="Advanced Options" expanded="False">
+      <expand macro="n_clusters"/>
+      <expand macro="init"/>
+      <expand macro="n_init"/>
+      <expand macro="max_iter"/>
+      <expand macro="tol" default_value="0.0001" help_text="Relative tolerance with regards to inertia to declare convergence."/>
+      <!--param argument="precompute_distances"/-->
+      <expand macro="random_state"/>
+      <param argument="copy_x" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="true" label="Use a copy of data for precomputing distances" help="Mofifying the original data introduces small numerical differences caused by subtracting and then adding the data mean."/>
+    </section>
+  </xml>
+
+  <xml name="birch_advanced_options">
+    <section name="options" title="Advanced Options" expanded="False">
+      <param argument="threshold" type="float" optional="true" value="0.5" label="Subcluster radius threshold" help="The radius of the subcluster obtained by merging a new sample; the closest subcluster should be less than the threshold to avoid a new subcluster."/>
+      <param argument="branching_factor" type="integer" optional="true" value="50" label="Maximum number of subclusters per branch" help="Maximum number of CF subclusters in each node."/>
+      <expand macro="n_clusters" default_value="3"/>
+      <!--param argument="compute_labels"/-->
+    </section>
+  </xml>
+
+  <xml name="dbscan_advanced_options">
+    <section name="options" title="Advanced Options" expanded="False">
+      <param argument="eps" type="float" optional="true" value="0.5" label="Maximum neighborhood distance" help="The maximum distance between two samples for them to be considered as in the same neighborhood."/>
+      <param argument="min_samples" type="integer" optional="true" value="5" label="Minimal core point density" help="The number of samples (or total weight) in a neighborhood for a point (including the point itself) to be considered as a core point."/>
+      <param argument="metric" type="text" optional="true" value="euclidean" label="Metric" help="The metric to use when calculating distance between instances in a feature array."/>
+      <param argument="algorithm" type="select" label="Pointwise distance computation algorithm" help="The algorithm to be used by the NearestNeighbors module to compute pointwise distances and find nearest neighbors.">
+          <option value="auto" selected="true">auto</option>
+          <option value="ball_tree">ball_tree</option>
+          <option value="kd_tree">kd_tree</option>
+          <option value="brute">brute</option>
+      </param>
+      <param argument="leaf_size" type="integer" optional="true" value="30" label="Leaf size" help="Leaf size passed to BallTree or cKDTree. Memory and time efficieny factor in tree constrution and querying."/>
+    </section>
+  </xml>
+
+  <xml name="clustering_algorithms_options">
+    <conditional name="algorithm_options">
+      <param name="selected_algorithm" type="select" label="Clustering Algorithm">
+          <option value="KMeans" selected="true">KMeans</option>
+          <option value="SpectralClustering">Spectral Clustering</option>
+          <option value="MiniBatchKMeans">Mini Batch KMeans</option>
+          <option value="DBSCAN">DBSCAN</option>
+          <option value="Birch">Birch</option>
+      </param>
+      <when value="KMeans">
+          <expand macro="kmeans_advanced_options"/>
+      </when>
+      <when value="DBSCAN">
+          <expand macro="dbscan_advanced_options"/>
+      </when>
+      <when value="Birch">
+          <expand macro="birch_advanced_options"/>
+      </when>
+      <when value="SpectralClustering">
+          <expand macro="spectral_clustering_advanced_options"/>
+      </when>
+      <when value="MiniBatchKMeans">
+          <expand macro="minibatch_kmeans_advanced_options"/>
+      </when>
+    </conditional>
+  </xml>
+
+  <xml name="distance_metrics">
+    <param argument="metric" type="select" label="Distance metric" help=" ">
+      <option value="euclidean" selected="true">euclidean</option>
+      <option value="cityblock">cityblock</option>
+      <option value="cosine">cosine</option>
+      <option value="l1">l1</option>
+      <option value="l2">l2</option>
+      <option value="manhattan">manhattan</option>
+      <yield/>
+    </param>
+  </xml>
+
+  <xml name="distance_nonsparse_metrics">
+    <option value="braycurtis">braycurtis</option>
+    <option value="canberra">canberra</option>
+    <option value="chebyshev">chebyshev</option>
+    <option value="correlation">correlation</option>
+    <option value="dice">dice</option>
+    <option value="hamming">hamming</option>
+    <option value="jaccard">jaccard</option>
+    <option value="kulsinski">kulsinski</option>
+    <option value="mahalanobis">mahalanobis</option>
+    <option value="matching">matching</option>
+    <option value="minkowski">minkowski</option>
+    <option value="rogerstanimoto">rogerstanimoto</option>
+    <option value="russellrao">russellrao</option>
+    <option value="seuclidean">seuclidean</option>
+    <option value="sokalmichener">sokalmichener</option>
+    <option value="sokalsneath">sokalsneath</option>
+    <option value="sqeuclidean">sqeuclidean</option>
+    <option value="yule">yule</option>
+  </xml>
+
+  <xml name="pairwise_kernel_metrics">
+    <param argument="metric" type="select" label="Pirwise Kernel metric" help=" ">
+      <option value="rbf" selected="true">rbf</option>
+      <option value="sigmoid">sigmoid</option>
+      <option value="polynomial">polynomial</option>
+      <option value="linear" selected="true">linear</option>
+      <option value="chi2">chi2</option>
+      <option value="additive_chi2">additive_chi2</option>
+    </param>
+  </xml>
+
+  <xml name="sparse_pairwise_metric_functions">
+    <param name="selected_metric_function" type="select" label="Select the pairwise metric you want to compute:">
+      <option value="euclidean_distances" selected="true">Euclidean distance matrix</option>
+      <option value="pairwise_distances">Distance matrix</option>
+      <option value="pairwise_distances_argmin">Minimum distances between one point and a set of points</option>
+      <yield/>
+    </param>
+  </xml>
+
+  <xml name="pairwise_metric_functions">
+    <option value="additive_chi2_kernel" >Additive chi-squared kernel</option>
+    <option value="chi2_kernel">Exponential chi-squared kernel</option>
+    <option value="linear_kernel">Linear kernel</option>
+    <option value="manhattan_distances">L1 distances</option>
+    <option value="pairwise_kernels">Kernel</option>
+    <option value="polynomial_kernel">Polynomial kernel</option>
+    <option value="rbf_kernel">Gaussian (rbf) kernel</option>
+    <option value="laplacian_kernel">Laplacian kernel</option>
+  </xml>
+
+  <xml name="sparse_pairwise_condition">
+    <when value="pairwise_distances">
+      <section name="options" title="Advanced Options" expanded="False">
+          <expand macro="distance_metrics">
+              <yield/>
+          </expand>
+      </section>
+    </when>
+    <when value="euclidean_distances">
+      <section name="options" title="Advanced Options" expanded="False">
+          <param argument="squared" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="false"
+            label="Return squared Euclidean distances" help=" "/>
+      </section>
+    </when>
+  </xml>
+
+  <xml name="argmin_distance_condition">
+    <when value="pairwise_distances_argmin">
+      <section name="options" title="Advanced Options" expanded="False">
+          <param argument="axis" type="integer" optional="true" value="1" label="Axis" help="Axis along which the argmin and distances are to be computed."/>
+          <expand macro="distance_metrics">
+              <yield/>
+          </expand>
+          <param argument="batch_size" type="integer" optional="true" value="500" label="Batch size" help="Number of rows to be processed in each batch run."/>
+      </section>
+    </when>
+  </xml>
+
+  <xml name="sparse_preprocessors">
+    <param name="selected_pre_processor" type="select" label="Select a preprocessor:">
+      <option value="StandardScaler" selected="true">Standard Scaler (Standardizes features by removing the mean and scaling to unit variance)</option>
+      <option value="Binarizer">Binarizer (Binarizes data)</option>
+      <option value="Imputer">Imputer (Completes missing values)</option>
+      <option value="MaxAbsScaler">Max Abs Scaler (Scales features by their maximum absolute value)</option>
+      <option value="Normalizer">Normalizer (Normalizes samples individually to unit norm)</option>
+      <yield/>
+    </param>
+  </xml>
+
+  <xml name="sparse_preprocessors_ext">
+    <expand macro="sparse_preprocessors">
+      <option value="KernelCenterer">Kernel Centerer (Centers a kernel matrix)</option>
+      <option value="MinMaxScaler">Minmax Scaler (Scales features to a range)</option>
+      <option value="PolynomialFeatures">Polynomial Features (Generates polynomial and interaction features)</option>
+      <option value="RobustScaler">Robust Scaler (Scales features using outlier-invariance statistics)</option>
+    </expand>
+  </xml>
+
+  <xml name="sparse_preprocessor_options">
+    <when value="Binarizer">
+        <section name="options" title="Advanced Options" expanded="False">
+            <param argument="copy" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="true"
+                label="Use a copy of data for precomputing binarization" help=" "/>
+            <param argument="threshold" type="float" optional="true" value="0.0"
+                label="Threshold"
+                help="Feature values below or equal to this are replaced by 0, above it by 1. Threshold may not be less than 0 for operations on sparse matrices. "/>
+        </section>
+    </when>
+    <when value="Imputer">
+      <section name="options" title="Advanced Options" expanded="False">
+          <param argument="copy" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="true"
+            label="Use a copy of data for precomputing imputation" help=" "/>
+          <param argument="strategy" type="select" optional="true" label="Imputation strategy" help=" ">
+              <option value="mean" selected="true">Replace missing values using the mean along the axis</option>
+              <option value="median">Replace missing values using the median along the axis</option>
+              <option value="most_frequent">Replace missing using the most frequent value along the axis</option>
+          </param>
+          <param argument="missing_values" type="text" optional="true" value="NaN"
+                label="Placeholder for missing values" help="For missing values encoded as numpy.nan, use the string value “NaN”"/>
+          <param argument="axis" type="boolean" optional="true" truevalue="1" falsevalue="0"
+                label="Impute along axis = 1" help="If fasle, axis = 0 is selected for imputation. "/>
+          <!--param argument="axis" type="select" optional="true" label="The axis along which to impute" help=" ">
+              <option value="0" selected="true">Impute along columns</option>
+              <option value="1">Impute along rows</option>
+          </param-->
+      </section>
+    </when>
+    <when value="StandardScaler">
+      <section name="options" title="Advanced Options" expanded="False">
+        <param argument="copy" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="true"
+            label="Use a copy of data for performing inplace scaling" help=" "/>
+        <param argument="with_mean" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="true"
+            label="Center the data before scaling" help=" "/>
+        <param argument="with_std" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="true"
+            label="Scale the data to unit variance (or unit standard deviation)" help=" "/>
+      </section>
+    </when>
+    <when value="MaxAbsScaler">
+      <section name="options" title="Advanced Options" expanded="False">
+        <param argument="copy" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="true"
+            label="Use a copy of data for precomputing scaling" help=" "/>
+      </section>
+    </when>
+    <when value="Normalizer">
+      <section name="options" title="Advanced Options" expanded="False">
+        <param argument="norm" type="select" optional="true" label="The norm to use to normalize non zero samples" help=" ">
+          <option value="l1" selected="true">l1</option>
+          <option value="l2">l2</option>
+          <option value="max">max</option>
+        </param>
+        <param argument="copy" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="true"
+            label="Use a copy of data for precomputing row normalization" help=" "/>
+      </section>
+    </when>
+    <yield/>
+  </xml>
+
+  <xml name="sparse_preprocessor_options_ext">
+    <expand macro="sparse_preprocessor_options">
+      <when value="KernelCenterer">
+        <section name="options" title="Advanced Options" expanded="False">
+        </section>
+      </when>
+      <when value="MinMaxScaler">
+          <section name="options" title="Advanced Options" expanded="False">
+              <!--feature_range-->
+              <param argument="copy" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolflase" checked="true"
+                  label="Use a copy of data for precomputing normalization" help=" "/>
+          </section>
+      </when>
+      <when value="PolynomialFeatures">
+          <section name="options" title="Advanced Options" expanded="False">
+              <param argument="degree" type="integer" optional="true" value="2" label="The degree of the polynomial features " help=""/>
+              <param argument="interaction_only" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolflase" checked="false" label="Produce interaction features only" help="(Features that are products of at most degree distinct input features) "/>
+              <param argument="include_bias" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolflase" checked="true" label="Include a bias column" help="Feature in which all polynomial powers are zero "/>
+          </section>
+      </when>
+      <when value="RobustScaler">
+          <section name="options" title="Advanced Options" expanded="False">
+              <!--=True, =True, copy=True-->
+              <param argument="with_centering" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolflase" checked="true"
+                  label="Center the data before scaling" help=" "/>
+              <param argument="with_scaling" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolflase" checked="true"
+                  label="Scale the data to interquartile range" help=" "/>
+              <param argument="copy" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolflase" checked="true"
+                  label="Use a copy of data for inplace scaling" help=" "/>
+          </section>
+      </when>
+    </expand>
+  </xml>
+
+  <xml name="fs_selectfrommodel_prefitted">
+    <param name="input_mode" type="select" label="Construct a new estimator from a selection list?" >
+      <option value="new" selected="true">Yes</option>
+      <option value="prefitted">No. Load a prefitted estimator</option>
+    </param>
+    <when value="new">
+      <expand macro="estimator_selector_all"/>
+    </when>
+    <when value="prefitted">
+      <param name="fitted_estimator" type="data" format='zip' label="Load a prefitted estimator" />
+    </when>
+  </xml>
+
+  <xml name="fs_selectfrommodel_no_prefitted">
+    <param name="input_mode" type="select" label="Construct a new estimator from a selection list?" >
+      <option value="new" selected="true">Yes</option>
+    </param>
+    <when value="new">
+      <expand macro="estimator_selector_all"/>
+    </when>
+  </xml>
+
+  <xml name="feature_selection_all">
+    <conditional name="fs_algorithm_selector">
+      <param name="selected_algorithm" type="select" label="Select a feature selection algorithm">
+        <option value="SelectKBest" selected="true">SelectKBest - Select features according to the k highest scores</option>
+        <option value="SelectFromModel">SelectFromModel - Meta-transformer for selecting features based on importance weights</option>
+        <option value="GenericUnivariateSelect">GenericUnivariateSelect - Univariate feature selector with configurable strategy</option>
+        <option value="SelectPercentile">SelectPercentile - Select features according to a percentile of the highest scores</option>
+        <option value="SelectFpr">SelectFpr - Filter: Select the p-values below alpha based on a FPR test</option>
+        <option value="SelectFdr">SelectFdr - Filter: Select the p-values for an estimated false discovery rate</option>
+        <option value="SelectFwe">SelectFwe - Filter: Select the p-values corresponding to Family-wise error rate</option>
+        <option value="RFE">RFE - Feature ranking with recursive feature elimination</option>
+        <option value="RFECV">RFECV - Feature ranking with recursive feature elimination and cross-validated selection of the best number of features</option>
+        <option value="VarianceThreshold">VarianceThreshold - Feature selector that removes all low-variance features</option>
+      </param>
+      <when value="SelectFromModel">
+        <conditional name="model_inputter">
+          <yield/>
+        </conditional>
+        <section name="options" title="Advanced Options" expanded="False">
+          <param argument="threshold" type="text" value="" optional="true" label="threshold" help="The threshold value to use for feature selection. e.g. 'mean', 'median', '1.25*mean'." />
+          <param argument="norm_order" type="integer" value="1" label="norm_order" help="Order of the norm used to filter the vectors of coefficients below threshold in the case where the coef_ attribute of the estimator is of dimension 2. " />
+        </section>
+      </when>
+      <when value="GenericUnivariateSelect">
+        <expand macro="feature_selection_score_function" />
+        <section name="options" title="Advanced Options" expanded="False">
+          <param argument="mode" type="select" label="Feature selection mode">
+            <option value="percentile">percentile</option>
+            <option value="k_best">k_best</option>
+            <option value="fpr">fpr</option>
+            <option value="fdr">fdr</option>
+            <option value="fwe">fwe</option>
+          </param>
+          <param argument="param" type="float" value="" optional="true" label="Parameter of the corresponding mode" help="float or int depending on the feature selection mode" />
+        </section>
+      </when>
+      <when value="SelectPercentile">
+        <expand macro="feature_selection_score_function" />
+        <section name="options" title="Advanced Options" expanded="False">
+          <param argument="percentile" type="integer" value="10" optional="True" label="Percent of features to keep" />
+        </section>
+      </when>
+      <when value="SelectKBest">
+        <expand macro="feature_selection_score_function" />
+        <section name="options" title="Advanced Options" expanded="False">
+          <param argument="k" type="integer" value="10" optional="True" label="Number of top features to select" help="No 'all' option is supported." />
+        </section>
+      </when>
+      <when value="SelectFpr">
+        <expand macro="feature_selection_score_function" />
+        <section name="options" title="Advanced Options" expanded="False">
+          <param argument="alpha" type="float" value="" optional="True" label="Alpha" help="The highest p-value for features to be kept."/>
+        </section>
+      </when>
+      <when value="SelectFdr">
+        <expand macro="feature_selection_score_function" />
+        <section name="options" title="Advanced Options" expanded="False">
+          <param argument="alpha" type="float" value="" optional="True" label="Alpha" help="The highest uncorrected p-value for features to keep."/>
+        </section>
+      </when>
+      <when value="SelectFwe">
+        <expand macro="feature_selection_score_function" />
+        <section name="options" title="Advanced Options" expanded="False">
+          <param argument="alpha" type="float" value="" optional="True" label="Alpha" help="The highest uncorrected p-value for features to keep."/>
+        </section>
+      </when>
+      <when value="RFE">
+        <expand macro="estimator_selector_all"/>
+        <section name="options" title="Advanced Options" expanded="False">
+          <param argument="n_features_to_select" type="integer" value="" optional="true" label="n_features_to_select" help="The number of features to select. If None, half of the features are selected." />
+          <param argument="step" type="float" value="1" label="step" optional="true" help="Default = 1. " />
+          <param argument="verbose" type="integer" value="0" label="verbose" help="Controls verbosity of output." />
+        </section>
+      </when>
+      <when value="RFECV">
+        <expand macro="estimator_selector_all"/>
+        <section name="options" title="Advanced Options" expanded="False">
+          <param argument="step" type="float" value="1" label="step" optional="true" help="Default = 1. " />
+          <param argument="cv" type="integer" value="" optional="true" label="cv" help="Determines the cross-validation splitting strategy" />
+          <param argument="scoring" type="text" value="" optional="true" label="scoring" help="A string (see model evaluation documentation) or a scorer callable object / function with signature scorer(estimator, X, y)."/>
+          <param argument="verbose" type="integer" value="0" label="verbose" help="Controls verbosity of output." />
+          <param argument="n_jobs" type="integer" value="1" label="n_jobs" help="Number of cores to run in parallel while fitting across folds. Defaults to 1 core."/>
+        </section>
+      </when>
+      <when value="VarianceThreshold">
+        <section name="options" title="Options" expanded="False">
+          <param argument="threshold" type="float" value="" optional="True" label="Threshold" help="Features with a training-set variance lower than this threshold will be removed."/>
+        </section>
+      </when>
+      <!--when value="chi2">
+      </when>
+      <when value="f_classif">
+      </when>
+      <when value="f_regression">
+      </when>
+      <when value="mutual_info_classif">
+      </when>
+      <when value="mutual_info_regression">
+      </when-->
+    </conditional>
+  </xml>
+
+  <xml name="feature_selection_score_function">
+    <param argument="score_func" type="select" label="Select a score function">
+      <option value="chi2">chi2 - Compute chi-squared stats between each non-negative feature and class</option>
+      <option value="f_classif">f_classif - Compute the ANOVA F-value for the provided sample</option>
+      <option value="f_regression">f_regression - Univariate linear regression tests</option>
+      <option value="mutual_info_classif">mutual_info_classif - Estimate mutual information for a discrete target variable</option>
+      <option value="mutual_info_regression">mutual_info_regression - Estimate mutual information for a continuous target variable</option>
+    </param>
+  </xml>
+
+  <xml name="feature_selection_output_mothods">
+    <conditional name="output_method_selector">
+      <param name="selected_method" type="select" label="Select an output method:">
+          <option value="fit_transform">fit_transform - Fit to data, then transform it</option>
+          <option value="get_support">get_support - Get a mask, or integer index, of the features selected</option>
+      </param>
+      <when value="fit_transform">
+        <!--**fit_params-->
+      </when>
+      <when value="get_support">
+        <param name="indices" type="boolean" optional="true" truevalue="booltrue" falsevalue="boolfalse" checked="false" label="Indices" help="If True, the return value will be an array of integers, rather than a boolean mask."/>
+      </when>
+    </conditional>
+  </xml>
+
+  <xml name="model_validation_common_options">
+    <param argument="cv" type="integer" value="" optional="true" label="cv" help="The number of folds in a (Stratified)KFold" />
+    <expand macro="n_jobs"/>
+    <expand macro="verbose"/>
+    <yield/>
+  </xml>
+
+  <xml name="scoring">
+    <param argument="scoring" type="text" value="" optional="true" label="scoring" help="A metric used to evaluate the estimator"/>
+  </xml>
+
+  <xml name="pre_dispatch" token_type="hidden" token_default_value="all" token_help="Number of predispatched jobs for parallel execution">
+    <param argument="pre_dispatch" type="@TYPE@" value="@DEFAULT_VALUE@" optional="true" label="pre_dispatch" help="@HELP@"/>
+  </xml>
+
+  <xml name="search_cv_estimator">
+    <param name="infile_pipeline" type="data" format="zip" label="Choose the dataset containing pipeline object:"/>
+    <section name="search_params_builder" title="Search parameters Builder" expanded="true">
+      <repeat name="param_set" min="1" max="20" title="Parameter setting for search:">
+        <conditional name="search_param_selector">
+          <param name="selected_param_type" type="select" label="Choose the transformation the parameter belongs to">
+            <option value="final_estimator_p" selected="true">Final estimator</option>
+            <option value="prep_1_p">Pre-processing step #1</option>
+            <option value="prep_2_p">Pre-processing step #2</option>
+            <option value="prep_3_p">Pre-processing step #3</option>
+            <option value="prep_4_p">Pre-processing step #4</option>
+            <option value="prep_5_p">Pre-processing step #5</option>
+          </param>
+          <when value="final_estimator_p">
+            <expand macro="search_param_input" />
+          </when>
+          <when value="prep_1_p">
+            <expand macro="search_param_input" label="Pre_processing component #1  parameter:" help="One parameter per box. For example: with_centering: [True, False]."/>
+          </when>
+          <when value="prep_2_p">
+            <expand macro="search_param_input" label="Pre_processing component #2 parameter:" help="One parameter per box. For example: k: [3, 5, 7, 9]. See bottom for more examples"/>
+          </when>
+          <when value="prep_3_p">
+            <expand macro="search_param_input" label="Pre_processing component #3 parameter:" help="One parameter per box. For example: n_components: [1, 10, 100, 1000]. See bottom for more examples"/>
+          </when>
+          <when value="prep_4_p">
+            <expand macro="search_param_input" label="Pre_processing component #4 parameter:" help="One parameter per box. For example: n_components: [1, 10, 100, 1000]. See bottom for more examples"/>
+          </when>
+          <when value="prep_5_p">
+            <expand macro="search_param_input" label="Pre_processing component #5 parameter:" help="One parameter per box. For example: affinity: ['euclidean', 'l1', 'l2', 'manhattan']. See bottom for more examples"/>
+          </when>
+        </conditional>
+      </repeat>
+    </section>
+  </xml>
+
+  <xml name="search_param_input" token_label="Estimator parameter:" token_help="One parameter per box. For example: C: [1, 10, 100, 1000]. See bottom for more examples">
+    <param name="search_p" type="text" value="" size="100" optional="true" label="@LABEL@" help="@HELP@">
+      <sanitizer>
+        <valid initial="default">
+          <add value="&apos;"/>
+          <add value="&quot;"/>
+          <add value="["/>
+          <add value="]"/>
+        </valid>
+      </sanitizer>
+    </param>
+  </xml>
+
+  <xml name="search_cv_options">
+      <expand macro="scoring"/>
+      <expand macro="model_validation_common_options"/>
+      <expand macro="pre_dispatch" value="2*n_jobs" help="Controls the number of jobs that get dispatched during parallel execution"/>
+      <param argument="iid" type="boolean" truevalue="booltrue" falsevalue="boolfalse" checked="true" label="iid" help="If True, data is identically distributed across the folds"/>
+      <param argument="refit" type="boolean" truevalue="booltrue" falsevalue="boolfalse" checked="true" label="refit" help="Refit an estimator using the best found parameters on the whole dataset."/>
+      <!--error_score-->
+      <param argument="return_train_score" type="boolean" truevalue="booltrue" falsevalue="boolfalse" checked="false" label="return_train_score" help=""/>
+  </xml>
+
+  <xml name="estimator_selector_all">
+    <conditional name="estimator_selector">
+      <param name="selected_module" type="select" label="Choose the module that contains target estimator:" >
+        <option value="svm" selected="true">sklearn.svm</option>
+        <option value="linear_model">sklearn.linear_model</option>
+        <option value="ensemble">sklearn.ensemble</option>
+        <option value="naive_bayes">sklearn.naive_bayes</option>
+        <option value="tree">sklearn.tree</option>
+        <option value="neighbors">sklearn.neighbors</option>
+        <option value="xgboost">xgboost</option>
+        <!--more-->
+      </param>
+      <when value="svm">
+        <param name="selected_estimator" type="select" label="Choose estimator class:">
+          <option value="LinearSVC" selected="true">LinearSVC</option>
+          <option value="LinearSVR">LinearSVR</option>
+          <option value="NuSVC">NuSVC</option>
+          <option value="NuSVR">NuSVR</option>
+          <option value="OneClassSVM">OneClassSVM</option>
+          <option value="SVC">SVC</option>
+          <option value="SVR">SVR</option>
+        </param>
+        <expand macro="estimator_params_text"/>
+      </when>
+      <when value="linear_model">
+        <param name="selected_estimator" type="select" label="Choose estimator class:">
+          <option value="ARDRegression" selected="true">ARDRegression</option>
+          <option value="BayesianRidge">BayesianRidge</option>
+          <option value="ElasticNet">ElasticNet</option>
+          <option value="ElasticNetCV">ElasticNetCV</option>
+          <option value="HuberRegressor">HuberRegressor</option>
+          <option value="Lars">Lars</option>
+          <option value="LarsCV">LarsCV</option>
+          <option value="Lasso">Lasso</option>
+          <option value="LassoCV">LassoCV</option>
+          <option value="LassoLars">LassoLars</option>
+          <option value="LassoLarsCV">LassoLarsCV</option>
+          <option value="LassoLarsIC">LassoLarsIC</option>
+          <option value="LinearRegression">LinearRegression</option>
+          <option value="LogisticRegression">LogisticRegression</option>
+          <option value="LogisticRegressionCV">LogisticRegressionCV</option>
+          <option value="MultiTaskLasso">MultiTaskLasso</option>
+          <option value="MultiTaskElasticNet">MultiTaskElasticNet</option>
+          <option value="MultiTaskLassoCV">MultiTaskLassoCV</option>
+          <option value="MultiTaskElasticNetCV">MultiTaskElasticNetCV</option>
+          <option value="OrthogonalMatchingPursuit">OrthogonalMatchingPursuit</option>
+          <option value="OrthogonalMatchingPursuitCV">OrthogonalMatchingPursuitCV</option>
+          <option value="PassiveAggressiveClassifier">PassiveAggressiveClassifier</option>
+          <option value="PassiveAggressiveRegressor">PassiveAggressiveRegressor</option>
+          <option value="Perceptron">Perceptron</option>
+          <option value="RANSACRegressor">RANSACRegressor</option>
+          <option value="Ridge">Ridge</option>
+          <option value="RidgeClassifier">RidgeClassifier</option>
+          <option value="RidgeClassifierCV">RidgeClassifierCV</option>
+          <option value="RidgeCV">RidgeCV</option>
+          <option value="SGDClassifier">SGDClassifier</option>
+          <option value="SGDRegressor">SGDRegressor</option>
+          <option value="TheilSenRegressor">TheilSenRegressor</option>
+        </param>
+        <expand macro="estimator_params_text"/>
+      </when>
+      <when value="ensemble">
+        <param name="selected_estimator" type="select" label="Choose estimator class:">
+          <option value="AdaBoostClassifier" selected="true">AdaBoostClassifier</option>
+          <option value="AdaBoostRegressor">AdaBoostRegressor</option>
+          <option value="BaggingClassifier">BaggingClassifier</option>
+          <option value="BaggingRegressor">BaggingRegressor</option>
+          <option value="ExtraTreesClassifier">ExtraTreesClassifier</option>
+          <option value="ExtraTreesRegressor">ExtraTreesRegressor</option>
+          <option value="GradientBoostingClassifier">GradientBoostingClassifier</option>
+          <option value="GradientBoostingRegressor">GradientBoostingRegressor</option>
+          <option value="IsolationForest">IsolationForest</option>
+          <option value="RandomForestClassifier">RandomForestClassifier</option>
+          <option value="RandomForestRegressor">RandomForestRegressor</option>
+          <option value="RandomTreesEmbedding">RandomTreesEmbedding</option>
+          <option value="VotingClassifier">VotingClassifier</option>
+        </param>
+        <expand macro="estimator_params_text"/>
+      </when>
+      <when value="naive_bayes">
+        <param name="selected_estimator" type="select" label="Choose estimator class:">
+          <option value="BernoulliNB" selected="true">BernoulliNB</option>
+          <option value="GaussianNB">GaussianNB</option>
+          <option value="MultinomialNB">MultinomialNB</option>
+        </param>
+        <expand macro="estimator_params_text"/>
+      </when>
+      <when value="tree">
+        <param name="selected_estimator" type="select" label="Choose estimator class:">
+          <option value="DecisionTreeClassifier" selected="true">DecisionTreeClassifier</option>
+          <option value="DecisionTreeRegressor">DecisionTreeRegressor</option>
+          <option value="ExtraTreeClassifier">ExtraTreeClassifier</option>
+          <option value="ExtraTreeRegressor">ExtraTreeRegressor</option>
+        </param>
+        <expand macro="estimator_params_text"/>
+      </when>
+      <when value="neighbors">
+        <param name="selected_estimator" type="select" label="Choose estimator class:">
+          <option value="BallTree" selected="true">BallTree</option>
+          <option value="DistanceMetric">DistanceMetric</option>
+          <option value="KDTree">KDTree</option>
+          <option value="KernelDensity">KernelDensity</option>
+          <option value="KNeighborsClassifier">KNeighborsClassifier</option>
+          <option value="KNeighborsRegressor">KNeighborsRegressor</option>
+          <option value="LocalOutlierFactor">LocalOutlierFactor</option>
+          <option value="RadiusNeighborsClassifier">RadiusNeighborsClassifier</option>
+          <option value="RadiusNeighborsRegressor">RadiusNeighborsRegressor</option>
+          <option value="NearestCentroid">NearestCentroid</option>
+          <option value="NearestNeighbors">NearestNeighbors</option>
+        </param>
+        <expand macro="estimator_params_text"/>
+      </when>
+      <when value="xgboost">
+        <param name="selected_estimator" type="select" label="Choose estimator class:">
+          <option value="XGBRegressor" selected="true">XGBRegressor</option>
+          <option value="XGBClassifier">XGBClassifier</option>
+        </param>
+        <expand macro="estimator_params_text"/>
+      </when>
+    </conditional>
+  </xml>
+
+  <xml name="estimator_params_text" token_label="Type in estimator parameters:"
+        token_help="Parameters in dictionary without braces ('{}'), e.g., 'C': 1, 'kernel': 'linear'. No double quotes. Leave this box blank for default estimator.">
+    <param name="text_params" type="text" value="" size="50" optional="true" label="@LABEL@" help="@HELP@">
+      <sanitizer>
+        <valid initial="default">
+          <add value="&apos;"/>
+        </valid>
+      </sanitizer>
+    </param>
+  </xml>
+
+  <xml name="kernel_approximation_all">
+    <conditional name="kernel_approximation_selector">
+      <param name="select_algorithm" type="select" label="Choose a kernel approximation algorithm:">
+        <option value="Nystroem" selected="true">Nystroem</option>
+        <option value="RBFSampler">RBFSampler</option>
+        <option value="AdditiveChi2Sampler">AdditiveChi2Sampler</option>
+        <option value="SkewedChi2Sampler">SkewedChi2Sampler</option>
+      </param>
+      <when value="Nystroem">
+        <expand macro="estimator_params_text" label="Type in kernel approximater parameters:"
+              help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'kernel': 'rbf'. No double quotes. Leave this box blank for class default."/>
+      </when>
+      <when value="RBFSampler">
+        <expand macro="estimator_params_text" label="Type in kernel approximater parameters:"
+              help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'gamma': 1.0. No double quotes. Leave this box blank for class default."/>
+      </when>
+      <when value="AdditiveChi2Sampler">
+        <expand macro="estimator_params_text" label="Type in kernel approximater parameters:"
+              help="Parameters in dictionary without braces ('{}'), e.g., 'sample_steps': 2, 'sample_interval': None. No double quotes. Leave this box blank for class default."/>
+      </when>
+      <when value="SkewedChi2Sampler">
+        <expand macro="estimator_params_text" label="Type in kernel approximater parameters:"
+              help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'skewedness': 1.0. No double quotes. Leave this box blank for class default."/>
+      </when>
+    </conditional>
+  </xml>
+
+  <xml name="matrix_decomposition_all">
+    <conditional name="matrix_decomposition_selector">
+      <param name="select_algorithm" type="select" label="Choose a matrix decomposition algorithm:">
+        <option value="DictionaryLearning" selected="true">DictionaryLearning</option>
+        <option value="FactorAnalysis">FactorAnalysis</option>
+        <option value="FastICA">FastICA</option>
+        <option value="IncrementalPCA">IncrementalPCA</option>
+        <option value="KernelPCA">KernelPCA</option>
+        <option value="LatentDirichletAllocation">LatentDirichletAllocation</option>
+        <option value="MiniBatchDictionaryLearning">MiniBatchDictionaryLearning</option>
+        <option value="MiniBatchSparsePCA">MiniBatchSparsePCA</option>
+        <option value="NMF">NMF</option>
+        <option value="PCA">PCA</option>
+        <option value="SparsePCA">SparsePCA</option>
+        <option value="SparseCoder">SparseCoder</option>
+        <option value="TruncatedSVD">TruncatedSVD</option>
+      </param>
+      <when value="DictionaryLearning">
+        <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:"
+              help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': None, 'alpha': 1.0. No double quotes. Leave this box blank for class default."/>
+      </when>
+      <when value="FactorAnalysis">
+        <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:"
+              help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'random_state': 42. No double quotes. Leave this box blank for class default."/>
+      </when>
+      <when value="FastICA">
+        <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:"
+              help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'random_state': 42. No double quotes. Leave this box blank for class default."/>
+      </when>
+      <when value="IncrementalPCA">
+        <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:"
+              help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'whiten': False. No double quotes. Leave this box blank for class default."/>
+      </when>
+      <when value="KernelPCA">
+        <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:"
+              help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'random_state': 42. No double quotes. Leave this box blank for class default."/>
+      </when>
+      <when value="LatentDirichletAllocation">
+        <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:"
+              help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'random_state': 42. No double quotes. Leave this box blank for class default."/>
+      </when>
+      <when value="MiniBatchDictionaryLearning">
+        <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:"
+              help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'random_state': 42. No double quotes. Leave this box blank for class default."/>
+      </when>
+      <when value="MiniBatchSparsePCA">
+        <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:"
+              help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'random_state': 42. No double quotes. Leave this box blank for class default."/>
+      </when>
+      <when value="NMF">
+        <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:"
+              help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'init': 'random'. No double quotes. Leave this box blank for class default."/>
+      </when>
+      <when value="PCA">
+        <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:"
+              help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'random_state': 42. No double quotes. Leave this box blank for class default."/>
+      </when>
+      <when value="SparsePCA">
+        <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:"
+              help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 100, 'random_state': 42. No double quotes. Leave this box blank for class default."/>
+      </when>
+      <when value="SparseCoder">
+        <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:"
+              help="Parameters in dictionary without braces ('{}'), e.g., 'transform_algorithm': 'omp', 'transform_alpha': 1.0. No double quotes. Leave this box blank for class default."/>
+      </when>
+      <when value="TruncatedSVD">
+        <expand macro="estimator_params_text" label="Type in maxtrix decomposition parameters:"
+              help="Parameters in dictionary without braces ('{}'), e.g., 'n_components': 2, 'algorithm': 'randomized'. No double quotes. Leave this box blank for default estimator."/>
+      </when>
+    </conditional>
+  </xml>
+
+  <xml name="FeatureAgglomeration">
+    <conditional name="FeatureAgglomeration_selector">
+      <param name="select_algorithm" type="select" label="Choose the algorithm:">
+        <option value="FeatureAgglomeration" selected="true">FeatureAgglomeration</option>
+      </param>
+      <when value="FeatureAgglomeration">
+        <expand macro="estimator_params_text" label="Type in parameters:"
+              help="Parameters in dictionary without braces ('{}'), e.g., 'n_clusters': 2, 'affinity': 'euclidean'. No double quotes. Leave this box blank for class default."/>
+      </when>
+    </conditional>
+  </xml>
+  <!-- Outputs -->
+
+  <xml name="output">
+    <outputs>
+      <data format="tabular" name="outfile_predict">
+          <filter>selected_tasks['selected_task'] == 'load'</filter>
+      </data>
+      <data format="zip" name="outfile_fit">
+          <filter>selected_tasks['selected_task'] == 'train'</filter>
+      </data>
+    </outputs>
+  </xml>
+
+  <!--Citations-->
+  <xml name="eden_citation">
+    <citations>
+        <citation type="doi">10.5281/zenodo.15094</citation>
+    </citations>
+  </xml>
+
+  <xml name="sklearn_citation">
+    <citations>
+        <citation type="bibtex">
+            @article{scikit-learn,
+             title={Scikit-learn: Machine Learning in {P}ython},
+             author={Pedregosa, F. and Varoquaux, G. and Gramfort, A. and Michel, V.
+                     and Thirion, B. and Grisel, O. and Blondel, M. and Prettenhofer, P.
+                     and Weiss, R. and Dubourg, V. and Vanderplas, J. and Passos, A. and
+                     Cournapeau, D. and Brucher, M. and Perrot, M. and Duchesnay, E.},
+             journal={Journal of Machine Learning Research},
+             volume={12},
+             pages={2825--2830},
+             year={2011}
+             url = {https://github.com/scikit-learn/scikit-learn}
+            }
+        </citation>
+    </citations>
+  </xml>
+
+  <xml name="scipy_citation">
+    <citations>
+        <citation type="bibtex">
+          @Misc{,
+          author =    {Eric Jones and Travis Oliphant and Pearu Peterson and others},
+          title =     {{SciPy}: Open source scientific tools for {Python}},
+          year =      {2001--},
+          url = "http://www.scipy.org/",
+          note = {[Online; accessed 2016-04-09]}
+        }
+        </citation>
+    </citations>
+  </xml>
+
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/search_model_validation.xml	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,401 @@
+<tool id="sklearn_searchcv" name="Hyperparameter Search" version="@VERSION@">
+    <description>using exhausitive or randomized search</description>
+    <macros>
+        <import>main_macros.xml</import>
+    </macros>
+    <expand macro="python_requirements">
+        <requirement type="package" version="0.9.12">asteval</requirement>
+    </expand>
+    <expand macro="macro_stdio"/>
+    <version_command>echo "@VERSION@"</version_command>
+    <command>
+        <![CDATA[
+        python "$sklearn_search_model_validation_script" '$inputs'
+        ]]>
+    </command>
+    <configfiles>
+        <inputs name="inputs" />
+        <configfile name="sklearn_search_model_validation_script">
+            <![CDATA[
+import sys
+import json
+import pandas
+import pickle
+import numpy as np
+import xgboost
+import scipy
+from asteval import Interpreter, make_symbol_table
+from sklearn import metrics, preprocessing, model_selection, ensemble
+from sklearn.pipeline import Pipeline
+
+@COLUMNS_FUNCTION@
+@GET_ESTIMATOR_FUNCTION@
+@GET_SEARCH_PARAMS_FUNCTION@
+
+input_json_path = sys.argv[1]
+with open(input_json_path, "r") as param_handler:
+    params = json.load(param_handler)
+
+#handle cheatah
+infile1 = "$input_options.infile1"
+infile2 = "$input_options.infile2"
+infile_pipeline = "$search_schemes.infile_pipeline"
+outfile_result = "$outfile_result"
+outfile_estimator = "$outfile_estimator"
+#if $search_schemes.selected_search_scheme == "RandomizedSearchCV":
+np.random.seed($search_schemes.random_seed)
+#end if
+
+params_builder = params['search_schemes']['search_params_builder']
+
+input_type = params["input_options"]["selected_input"]
+if input_type=="tabular":
+    header = 'infer' if params["input_options"]["header1"] else None
+    column_option = params["input_options"]["column_selector_options_1"]["selected_column_selector_option"]
+    if column_option in ["by_index_number", "all_but_by_index_number", "by_header_name", "all_but_by_header_name"]:
+        c = params["input_options"]["column_selector_options_1"]["col1"]
+    else:
+        c = None
+    X = read_columns(
+            infile1,
+            c = c,
+            c_option = column_option,
+            sep='\t',
+            header=header,
+            parse_dates=True
+    )
+else:
+    X = mmread(open("$input_options.infile1", 'r'))
+
+header = 'infer' if params["input_options"]["header2"] else None
+column_option = params["input_options"]["column_selector_options_2"]["selected_column_selector_option2"]
+if column_option in ["by_index_number", "all_but_by_index_number", "by_header_name", "all_but_by_header_name"]:
+    c = params["input_options"]["column_selector_options_2"]["col2"]
+else:
+    c = None
+y = read_columns(
+        infile2,
+        c = c,
+        c_option = column_option,
+        sep='\t',
+        header=header,
+        parse_dates=True
+)
+y=y.ravel()
+
+optimizers = params["search_schemes"]["selected_search_scheme"]
+optimizers = getattr(model_selection, optimizers)
+
+options = params["search_schemes"]["options"]
+if 'scoring' in options and options['scoring'] == '':
+    options['scoring'] = None
+if 'pre_dispatch' in options and options['pre_dispatch'] == '':
+    options['pre_dispatch'] = None
+
+with open(infile_pipeline, 'rb') as pipeline_handler:
+    pipeline = pickle.load(pipeline_handler)
+search_params = get_search_params(params_builder)
+searcher = optimizers(pipeline, search_params, **options)
+
+searcher.fit(X, y)
+
+cv_result = pandas.DataFrame(searcher.cv_results_)
+cv_result.to_csv(path_or_buf=outfile_result, sep='\t', header=True, index=False)
+
+#if $save:
+with open(outfile_estimator, "wb") as output_handler:
+    pickle.dump(searcher.best_estimator_, output_handler, pickle.HIGHEST_PROTOCOL)
+#end if
+
+            ]]>
+        </configfile>
+    </configfiles>
+    <inputs>
+        <conditional name="search_schemes">
+            <param name="selected_search_scheme" type="select" label="Select a model selection search scheme:">
+                <option value="GridSearchCV" selected="true">GridSearchCV - Exhaustive search over specified parameter values for an estimator </option>
+                <option value="RandomizedSearchCV">RandomizedSearchCV - Randomized search on hyper parameters for an estimator</option>
+            </param>
+            <when value="GridSearchCV">
+                <expand macro="search_cv_estimator"/>
+                <section name="options" title="Advanced Options for SearchCV" expanded="false">
+                    <expand macro="search_cv_options"/>
+                </section>
+            </when>
+            <when value="RandomizedSearchCV">
+                <param name="random_seed" type="integer" value="65535" min="0" max="65535" label="Set up random seed:"/>
+                <expand macro="search_cv_estimator"/>
+                <section name="options" title="Advanced Options for SearchCV" expanded="false">
+                    <expand macro="search_cv_options"/>
+                    <param argument="n_iter" type="integer" value="10" label="Number of parameter settings that are sampled"/>
+                    <expand macro="random_state"/>
+                </section>
+            </when>
+        </conditional>
+        <param name="save" type="boolean" truevalue="booltrue" falsevalue="boolflase" checked="true" label="Save the best estimator/pipeline?"/>
+        <expand macro="sl_mixed_input"/>
+    </inputs>
+    <outputs>
+        <data format="tabular" name="outfile_result"/>
+        <data format="zip" name="outfile_estimator">
+            <filter>save</filter>
+        </data>
+    </outputs>
+    <tests>
+        <test>
+            <param name="selected_search_scheme" value="GridSearchCV"/>
+            <param name="infile_pipeline" value="pipeline01"/>
+            <conditional name="search_param_selector">
+                <param name="search_p" value="C: [1, 10, 100, 1000]"/>
+                <param name="selected_param_type" value="final_estimator_p"/>
+            </conditional>
+            <conditional name="search_param_selector">
+                <param name="search_p" value="k: [3, 5, 7, 9]"/>
+                <param name="selected_param_type" value="prep_2_p"/>
+            </conditional>
+            <param name="infile1" value="regression_X.tabular" ftype="tabular"/>
+            <param name="header1" value="true" />
+            <param name="selected_column_selector_option" value="all_columns"/>
+            <param name="infile2" value="regression_y.tabular" ftype="tabular"/>
+            <param name="header2" value="true" />
+            <param name="selected_column_selector_option2" value="all_columns"/>
+            <output name="outfile_result" >
+                <assert_contents>
+                    <has_text_matching expression="[^/d]+0.7938837807353147[^/d]+{u'estimator__C': 1, u'preprocessing_2__k': 9}[^/d]+1" />
+                </assert_contents>
+            </output>
+        </test>
+        <test>
+            <param name="selected_search_scheme" value="RandomizedSearchCV"/>
+            <param name="infile_pipeline" value="pipeline01"/>
+            <conditional name="search_param_selector">
+                <param name="search_p" value="C: [1, 10, 100, 1000]"/>
+                <param name="selected_param_type" value="final_estimator_p"/>
+            </conditional>
+            <conditional name="search_param_selector">
+                <param name="search_p" value="kernel: ['linear', 'poly', 'rbf', 'sigmoid']"/>
+                <param name="selected_param_type" value="final_estimator_p"/>
+            </conditional>
+            <conditional name="search_param_selector">
+                <param name="search_p" value="k: [3, 5, 7, 9]"/>
+                <param name="selected_param_type" value="prep_2_p"/>
+            </conditional>
+            <conditional name="search_param_selector">
+                <param name="search_p" value="with_centering: [True, False]"/>
+                <param name="selected_param_type" value="prep_1_p"/>
+            </conditional>
+            <param name="infile1" value="regression_X.tabular" ftype="tabular"/>
+            <param name="header1" value="true" />
+            <param name="selected_column_selector_option" value="all_columns"/>
+            <param name="infile2" value="regression_y.tabular" ftype="tabular"/>
+            <param name="header2" value="true" />
+            <param name="selected_column_selector_option2" value="all_columns"/>
+            <output name="outfile_result" >
+                <assert_contents>
+                    <has_n_columns n="15" />
+                    <has_text text="param_preprocessing_1__with_centering"/>
+                </assert_contents>
+            </output>
+        </test>
+        <test>
+            <param name="selected_search_scheme" value="RandomizedSearchCV"/>
+            <param name="infile_pipeline" value="pipeline03"/>
+            <conditional name="search_param_selector">
+                <param name="search_p" value="n_estimators: np_arange(50, 1001, 50)"/>
+                <param name="selected_param_type" value="final_estimator_p"/>
+            </conditional>
+            <conditional name="search_param_selector">
+                <param name="search_p" value="max_depth: scipy_stats_randint(1, 51)"/>
+                <param name="selected_param_type" value="final_estimator_p"/>
+            </conditional>
+            <conditional name="search_param_selector">
+                <param name="search_p" value="gamma: np_random_uniform(low=0., high=1., size=2)"/>
+                <param name="selected_param_type" value="final_estimator_p"/>
+            </conditional>
+            <conditional name="search_param_selector">
+                <param name="search_p" value="random_state: [324089]"/>
+                <param name="selected_param_type" value="final_estimator_p"/>
+            </conditional>
+            <param name="infile1" value="regression_X.tabular" ftype="tabular"/>
+            <param name="header1" value="true" />
+            <param name="selected_column_selector_option" value="all_columns"/>
+            <param name="infile2" value="regression_y.tabular" ftype="tabular"/>
+            <param name="header2" value="true" />
+            <param name="selected_column_selector_option2" value="all_columns"/>
+            <output name="outfile_result" >
+                <assert_contents>
+                    <has_n_columns n="15" />
+                    <has_text text="param_estimator__max_depth"/>
+                </assert_contents>
+            </output>
+        </test>
+        <test>
+            <param name="selected_search_scheme" value="GridSearchCV"/>
+            <param name="infile_pipeline" value="pipeline04"/>
+            <conditional name="search_param_selector">
+                <param name="search_p" value="random_state: list(range(100, 1001, 100))"/>
+                <param name="selected_param_type" value="final_estimator_p"/>
+            </conditional>
+            <conditional name="search_param_selector">
+                <param name="search_p" value="estimator: [ensemble_ExtraTreesClassifier(n_estimators=100, random_state=324089)]"/>
+                <param name="selected_param_type" value="prep_1_p"/>
+            </conditional>
+            <param name="infile1" value="regression_X.tabular" ftype="tabular"/>
+            <param name="header1" value="true" />
+            <param name="selected_column_selector_option" value="all_columns"/>
+            <param name="infile2" value="regression_y.tabular" ftype="tabular"/>
+            <param name="header2" value="true" />
+            <param name="selected_column_selector_option2" value="all_columns"/>
+            <output name="outfile_result">
+                <assert_contents>
+                    <has_n_columns n="13"/>
+                    <has_text text="0.05363984674329502"/>
+                </assert_contents>
+            </output>
+        </test>
+        <test>
+            <param name="selected_search_scheme" value="GridSearchCV"/>
+            <param name="infile_pipeline" value="pipeline01"/>
+            <conditional name="search_param_selector">
+                <param name="search_p" value="C: [1, 10, 100, 1000]"/>
+                <param name="selected_param_type" value="final_estimator_p"/>
+            </conditional>
+            <param name="infile1" value="regression_X.tabular" ftype="tabular"/>
+            <param name="header1" value="true" />
+            <param name="selected_column_selector_option" value="all_columns"/>
+            <param name="infile2" value="regression_y.tabular" ftype="tabular"/>
+            <param name="header2" value="true" />
+            <param name="selected_column_selector_option2" value="all_columns"/>
+            <output name="outfile_estimator" file="searchCV01" compare="sim_size" delta="1"/>
+        </test>
+        <test>
+            <param name="selected_search_scheme" value="GridSearchCV"/>
+            <param name="infile_pipeline" value="pipeline06"/>
+            <conditional name="search_param_selector">
+                <param name="search_p" value="n_estimators: [10, 50, 200, 1000]"/>
+                <param name="selected_param_type" value="final_estimator_p"/>
+            </conditional>
+            <conditional name="search_param_selector">
+                <param name="search_p" value="random_state: [324089]"/>
+                <param name="selected_param_type" value="final_estimator_p"/>
+            </conditional>
+            <param name="infile1" value="regression_X.tabular" ftype="tabular"/>
+            <param name="header1" value="true" />
+            <param name="selected_column_selector_option" value="all_columns"/>
+            <param name="infile2" value="regression_y.tabular" ftype="tabular"/>
+            <param name="header2" value="true" />
+            <param name="selected_column_selector_option2" value="all_columns"/>
+            <output name="outfile_result">
+                <assert_contents>
+                    <has_n_columns n="13"/>
+                    <has_text_matching expression=".+0.7772355090078996[^/w]+1000[^/d]" />
+                </assert_contents>
+            </output>
+        </test>
+        <test>
+            <param name="selected_search_scheme" value="GridSearchCV"/>
+            <param name="infile_pipeline" value="pipeline07"/>
+            <conditional name="search_param_selector">
+                <param name="search_p" value="n_estimators: [10, 50, 100, 200]"/>
+                <param name="selected_param_type" value="final_estimator_p"/>
+            </conditional>
+            <conditional name="search_param_selector">
+                <param name="search_p" value="random_state: [324089]"/>
+                <param name="selected_param_type" value="final_estimator_p"/>
+            </conditional>
+            <conditional name="search_param_selector">
+                <param name="search_p" value="gamma: [1.0, 2.0]"/>
+                <param name="selected_param_type" value="prep_1_p"/>
+            </conditional>
+            <param name="infile1" value="regression_X.tabular" ftype="tabular"/>
+            <param name="header1" value="true" />
+            <param name="selected_column_selector_option" value="all_columns"/>
+            <param name="infile2" value="regression_y.tabular" ftype="tabular"/>
+            <param name="header2" value="true" />
+            <param name="selected_column_selector_option2" value="all_columns"/>
+            <output name="outfile_result">
+                <assert_contents>
+                    <has_n_columns n="14"/>
+                    <has_text_matching expression=".+0.05747126436781609[^/d]" />
+                </assert_contents>
+            </output>
+        </test>
+        <test>
+            <param name="selected_search_scheme" value="GridSearchCV"/>
+            <param name="infile_pipeline" value="pipeline08"/>
+            <conditional name="search_param_selector">
+                <param name="search_p" value="n_estimators: [10, 50, 100, 200]"/>
+                <param name="selected_param_type" value="final_estimator_p"/>
+            </conditional>
+            <conditional name="search_param_selector">
+                <param name="search_p" value="random_state: [324089]"/>
+                <param name="selected_param_type" value="final_estimator_p"/>
+            </conditional>
+            <conditional name="search_param_selector">
+                <param name="search_p" value="linkage: ['ward', 'complete', 'average']"/>
+                <param name="selected_param_type" value="prep_1_p"/>
+            </conditional>
+            <param name="infile1" value="regression_X.tabular" ftype="tabular"/>
+            <param name="header1" value="true" />
+            <param name="selected_column_selector_option" value="all_columns"/>
+            <param name="infile2" value="regression_y.tabular" ftype="tabular"/>
+            <param name="header2" value="true" />
+            <param name="selected_column_selector_option2" value="all_columns"/>
+            <output name="outfile_result">
+                <assert_contents>
+                    <has_text_matching expression=".+0.08045977011494253[^/w]+10[^/w]" />
+                </assert_contents>
+            </output>
+        </test>
+    </tests>
+    <help>
+        <![CDATA[
+**What it does**
+Searches optimized parameter values for an estimator or pipeline through either exhaustive grid cross validation search or Randomized cross validation search.
+please refer to `Scikit-learn model_selection GridSearchCV`_, `Scikit-learn model_selection RandomizedSearchCV`_ and `Tuning hyper-parameters`_.
+
+**How to choose search patameters?**
+
+Please refer to `svm`_, `linear_model`_, `ensemble`_, `naive_bayes`_, `tree`_, `neighbors`_ and `xgboost`_ for estimator parameters.
+Refer to `sklearn.preprocessing`_, `feature_selection`_, `decomposition`_, `kernel_approximation`_ and `cluster.FeatureAgglomeration`_ for parameter in the pre-processing steps.
+
+**Search parameter input** accepts parameter and setting in key:value pair. One pair per input box. Setting can be list, numpy array, or distribution.
+The evaluation of settings supports operations in Math, list comprehension, numpy.arange(np_arange), most numpy.random(e.g., np_random_uniform) and some scipy.stats(e.g., scipy_stats_zipf) classes or functions, and others.
+
+**Examples:**
+
+- K: [3, 5, 7, 9]
+
+- n_estimators: list(range(50, 1001, 50))
+
+- gamma: np_arange(0.01, 1, 0.1)
+
+- alpha: np_random_choice(list(range(1, 51)) + [None], size=20)
+
+- max_depth: scipy_stats_randin(1, 11)
+
+- estimator: [ensemble_ExtraTreesClassifier(n_estimators=100, random_state=324089)]
+
+
+.. _`Scikit-learn model_selection GridSearchCV`: http://scikit-learn.org/stable/modules/generated/sklearn.model_selection.GridSearchCV.html
+.. _`Scikit-learn model_selection RandomizedSearchCV`: http://scikit-learn.org/stable/modules/generated/sklearn.model_selection.RandomizedSearchCV.html
+.. _`Tuning hyper-parameters`: http://scikit-learn.org/stable/modules/grid_search.html
+
+.. _`svm`: http://scikit-learn.org/stable/modules/classes.html#module-sklearn.svm
+.. _`linear_model`: http://scikit-learn.org/stable/modules/classes.html#module-sklearn.linear_model
+.. _`ensemble`: http://scikit-learn.org/stable/modules/classes.html#module-sklearn.ensemble
+.. _`naive_bayes`: http://scikit-learn.org/stable/modules/classes.html#module-sklearn.naive_bayes
+.. _`tree`: http://scikit-learn.org/stable/modules/classes.html#module-sklearn.tree
+.. _`neighbors`: http://scikit-learn.org/stable/modules/classes.html#module-sklearn.neighbors
+.. _`xgboost`: https://xgboost.readthedocs.io/en/latest/python/python_api.html
+
+.. _`sklearn.preprocessing`: http://scikit-learn.org/stable/modules/classes.html#module-sklearn.preprocessing
+.. _`feature_selection`: http://scikit-learn.org/stable/modules/classes.html#module-sklearn.feature_selection
+.. _`decomposition`: http://scikit-learn.org/stable/modules/classes.html#module-sklearn.decomposition
+.. _`kernel_approximation`: http://scikit-learn.org/stable/modules/classes.html#module-sklearn.kernel_approximation
+.. _`cluster.FeatureAgglomeration`: http://scikit-learn.org/stable/modules/generated/sklearn.cluster.FeatureAgglomeration.html
+
+        ]]>
+    </help>
+    <expand macro="sklearn_citation"/>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/RF01704.fasta	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,4 @@
+>CP000097.1/1411351-1411410
+CAACGUUCACCUCACAUUUGUGAGGCGCAGACAACCCAGGCCAAGGAACGGGGACCUGGA
+>ACNY01000002.1/278641-278580
+GAUCGUUCACUUCGCAUCGCGCGAAGCGCAGUUCGCCUCAGGCCAUGGAACGGGGACCUGAG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/accuracy_score.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,2 @@
+accuracy_score : 
+0.8461538461538461
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/auc.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,2 @@
+auc : 
+2.5
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/average_precision_score.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,2 @@
+average_precision_score : 
+1.0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/blobs.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,101 @@
+0	1	0
+0.3368184589673989	-3.402879612990731	0
+-9.48324265575857	-8.66266051536995	2
+-1.9333632849607592	5.709539081468901	1
+-10.031824059894126	-5.578343934583625	2
+0.5418607766170062	-4.3769362832693	0
+-8.129629290673781	-7.05554320549807	2
+-0.7308257856942714	7.323755516994815	1
+-1.8414253200701474	6.206304668308321	1
+0.4100718503166844	-3.997448810001185	0
+-8.735095893232405	-5.490905352087513	2
+1.8494196227705402	-3.918393456729695	0
+-9.152560688488569	-9.17805648051067	2
+-3.214299390778301	5.7592616395707115	1
+0.2845037854966439	-3.615765226438298	0
+-0.9290748492230643	5.79099955373578	1
+0.366925241944827	6.518619296229099	1
+1.5990991796541174	-3.0710561729787464	0
+-9.71270568435724	-7.917076514990086	2
+-10.080404430632045	-6.551353241086546	2
+1.1059434577429306	-4.419063749495465	0
+2.4870804964945683	-2.8910071236106702	0
+0.00587148930882897	-3.1831425553970982	0
+1.6185435973534872	-4.888559225592079	0
+-9.1585672210814	-7.138941148475106	2
+-3.0763357145957295	7.800496767864756	1
+0.11174653022487324	-3.6161582871047915	0
+-9.439323507823358	-7.298630345706627	2
+-1.6946622959144526	4.408371111175304	1
+1.0526175263832516	-3.495530097015125	0
+-10.505605921029415	-5.99245086001851	2
+1.5408196415289697	-4.537023441514705	0
+0.32228789680819747	6.898540080429289	1
+0.6162196966060958	-5.275048036375375	0
+-10.225453923298636	-8.716359184214301	2
+-10.610041075915571	-8.159992705422887	2
+-0.7454796670028672	-2.9618984315119485	0
+0.7884875899019093	-5.3223437793891115	0
+-10.420052767549333	-7.784677704340977	2
+-2.9066475299706225	5.798350661758252	1
+-10.321439212021199	-8.927120521097516	2
+-0.21338559861828132	7.847798272479965	1
+-0.07194732572545948	-5.260544662489948	0
+-7.606968935466872	-7.733827136978448	2
+-1.3772203838685648	6.917736574437465	1
+-3.215600190755509	7.26468660350508	1
+-10.361544895394568	-6.919444657083034	2
+-9.604573412392483	-9.253517546022897	2
+-2.7269023156583536	6.738257479022937	1
+-2.8060399921674897	6.990662089963528	1
+-0.8195267147926311	7.582412712536479	1
+-2.088474009808327	5.696071447204143	1
+-0.3199187614984107	-4.982358491659567	0
+-11.320665797033074	-8.209377507348288	2
+-7.962360612746552	-9.0160536966573	2
+2.1678469105746174	-6.165707921777358	0
+1.8950202752190992	-5.864802909183004	0
+-8.668714990990322	-7.798902262764823	2
+2.057721103848434	-6.123229124507681	0
+-9.31359960682017	-8.005681999989289	2
+-0.7674305635615133	-5.476822175833394	0
+-3.467729419225205	6.760721334408079	1
+1.0904984443746135	-5.875829293349414	0
+-0.11521126331032128	-4.075104544956712	0
+1.0892785050407092	-5.50265562869237	0
+-0.6150504792573254	7.65521576624828	1
+0.42996321311489133	-5.550930544379513	0
+-0.7591948546904975	5.588530307317255	1
+-9.125996572516852	-8.00673850068656	2
+-9.775374420827845	-6.619256719676729	2
+-3.017233345281725	7.003406777204688	1
+-0.9730894643674084	-4.066519071956773	0
+-0.488300213042004	-5.665046812039003	0
+-11.920811593303075	-7.6481581712718265	2
+-9.382625071659795	-7.584962987095203	2
+0.07652275340589654	7.588913304914662	1
+0.9769623036529882	-3.9248027076317573	0
+-7.830829708233982	-7.911915266520185	2
+-3.0073685661005083	5.7016366696061365	1
+-1.8751101776939656	5.624499605551414	1
+-9.6832320667351	-8.253539319584945	2
+-9.301199337591346	-8.475648001818415	2
+0.3236596741468444	-5.100784034937504	0
+-1.7483610543320183	5.466455747949784	1
+-0.5606434085120788	6.8761250604356094	1
+0.6786030049961334	-4.1776108538506955	0
+-8.201998888059842	-8.29076835439347	2
+-3.0502642095699524	8.942236614880212	1
+-8.811936226521826	-7.798135337577672	2
+-9.168627707162337	-7.132750331822805	2
+-4.482963659068224	6.928839924536938	1
+-10.522252247863742	-6.805433938277723	2
+-1.585671650741962	6.899480240385674	1
+-1.7585368520754465	6.445346211386424	1
+-9.914521539472657	-8.111815592744888	2
+-1.4007761951194242	6.923806281221148	1
+-1.1922802090762707	6.143108468673037	1
+0.8754133990482117	-5.04555103360224	0
+1.481137717506855	-3.6964070848002533	0
+0.5249593764875948	6.344808234483482	1
+-0.013699553663708786	-4.413973348636017	0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/brier_score_loss.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,2 @@
+brier_score_loss : 
+0.5641025641025641
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/circles.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,101 @@
+0	1	0
+-0.06279051952931321	-0.9980267284282716	0
+0.05023241562345065	0.7984213827426173	1
+-0.9921147013144779	-0.12533323356430429	0
+0.4257792915650726	-0.9048270524660196	0
+-0.30901699437494756	-0.9510565162951535	0
+-1.0	-3.216245299353273e-16	0
+-0.18738131458572463	-0.9822872507286887	0
+-0.5358267949789963	-0.8443279255020153	0
+-0.7748665289029049	-0.19895190973188404	1
+-0.8763066800438636	0.4817536741017152	0
+-0.24721359549995806	-0.7608452130361228	1
+0.8	0.0	1
+0.42866143598319745	-0.675462340401612	1
+-0.5831749019371294	0.5476376847429508	1
+0.7010453440350909	-0.38540293928137226	1
+-0.743821188710601	-0.29449964214774266	1
+-0.7438211887106012	0.2944996421477422	1
+0.8090169943749475	0.5877852522924731	0
+0.30901699437494723	-0.9510565162951536	0
+0.18738131458572452	0.9822872507286887	0
+-0.8763066800438635	-0.4817536741017154	0
+-0.42866143598319706	-0.6754623404016122	1
+-0.5099391917989516	-0.6164105942206315	1
+0.63742398974869	-0.770513242775789	0
+-0.9297764858882512	-0.3681245526846783	0
+-0.9297764858882515	0.36812455268467775	0
+-0.9685831611286311	0.24868988716485482	0
+0.2472135954999578	-0.760845213036123	1
+-0.1499050516685797	-0.785829800582951	1
+-0.8090169943749473	0.5877852522924732	0
+-0.6374239897486895	-0.7705132427757894	0
+0.7289686274214116	0.6845471059286887	0
+0.9297764858882513	0.368124552684678	0
+0.0627905195293133	0.9980267284282716	0
+0.7936917610515823	0.1002665868514434	1
+-0.34062343325205774	-0.7238616419728159	1
+-0.7748665289029049	0.19895190973188387	1
+-0.14990505166857987	0.7858298005829509	1
+0.7010453440350909	0.38540293928137226	1
+-0.5099391917989519	0.6164105942206315	1
+-0.8	-2.572996239482619e-16	1
+-0.7936917610515823	0.10026658685144328	1
+0.5099391917989518	0.6164105942206315	1
+0.5358267949789968	-0.844327925502015	0
+-0.7936917610515823	-0.10026658685144343	1
+0.7936917610515823	-0.10026658685144303	1
+-0.5358267949789969	0.844327925502015	0
+0.509939191798952	-0.6164105942206313	1
+-0.050232415623450724	0.7984213827426173	1
+1.0	0.0	0
+-0.6374239897486897	0.7705132427757893	0
+0.7289686274214119	-0.6845471059286883	0
+0.06279051952931372	-0.9980267284282716	0
+0.8090169943749478	-0.5877852522924726	0
+0.18738131458572513	-0.9822872507286886	0
+-0.6472135954999579	0.4702282018339786	1
+0.5831749019371295	-0.5476376847429506	1
+-0.8090169943749472	-0.5877852522924734	0
+-0.7010453440350909	0.3854029392813722	1
+0.8763066800438636	-0.4817536741017153	0
+0.5831749019371293	0.547637684742951	1
+-0.6472135954999578	-0.47022820183397873	1
+0.3406234332520581	-0.7238616419728157	1
+0.05023241562345098	-0.7984213827426173	1
+-0.7289686274214117	0.6845471059286885	0
+-0.5831749019371293	-0.547637684742951	1
+0.647213595499958	0.4702282018339785	1
+0.14990505166858012	-0.7858298005829509	1
+0.14990505166857962	0.785829800582951	1
+-0.24721359549995806	0.7608452130361228	1
+0.9297764858882515	-0.36812455268467786	0
+0.9921147013144779	-0.1253332335643038	0
+0.6374239897486896	0.7705132427757893	0
+0.7438211887106012	-0.2944996421477423	1
+0.3406234332520581	0.7238616419728157	1
+0.6472135954999583	-0.47022820183397807	1
+-0.0627905195293134	0.9980267284282716	0
+0.9921147013144779	0.12533323356430426	0
+-0.7289686274214116	-0.6845471059286887	0
+0.8763066800438636	0.4817536741017153	0
+-0.9685831611286311	-0.24868988716485502	0
+0.9685831611286311	0.2486898871648548	0
+0.42577929156507266	0.9048270524660196	0
+-0.4257792915650727	0.9048270524660195	0
+0.4286614359831973	0.6754623404016121	1
+0.24721359549995797	0.7608452130361228	1
+-0.30901699437494756	0.9510565162951535	0
+0.774866528902905	-0.1989519097318836	1
+-0.42577929156507216	-0.9048270524660198	0
+-0.18738131458572482	0.9822872507286886	0
+-0.3406234332520582	0.7238616419728157	1
+0.7438211887106011	0.2944996421477424	1
+0.7748665289029049	0.19895190973188384	1
+0.30901699437494745	0.9510565162951535	0
+0.9685831611286312	-0.2486898871648545	0
+-0.7010453440350908	-0.3854029392813723	1
+-0.05023241562345057	-0.7984213827426173	1
+-0.4286614359831975	0.675462340401612	1
+-0.9921147013144779	0.1253332335643041	0
+0.5358267949789965	0.8443279255020151	0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/class.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,101 @@
+0	1	2	3	4	5	6	7	8	9	10	11	12	13	14	15	16	17	18	19	0
+1.103931098477063	1.1137324694427062	2.929660893432376	0.8263678474871072	-0.5024439301629023	-0.9778311716440287	-0.6702242261982462	-0.3783418745400049	-1.9100911341304148	0.41080891898717925	1.6359138753477174	-0.3544401787737543	-0.7776883945882607	-0.711126068648103	-1.1632958763488586	2.881523323585383	-0.3331610016599995	1.0249635446624175	-1.204722529676112	0.9686027151980944	1
+-0.5270034201986623	-2.4370266994140035	-0.46398126201591683	0.6724964425333426	0.32128693891873533	-1.4561055975293318	0.9733737109300644	1.2635448363305384	-0.9655190314614323	-0.30440284592936967	0.2928325635717791	-0.642481126749871	-0.17778292517384178	-0.23575096986827987	0.770818433376395	1.002493460919832	0.44402946209787597	0.38673364020325446	-1.0909759530149077	0.4374172416803542	1
+0.6343790937890923	-0.7044557030990274	-1.5479925634100813	-1.1375423986557498	0.7574995244231507	-0.2586895904715146	1.2113185073849615	0.8255591814670258	1.0488550790559334	-0.013557918030451043	-0.36824556412752163	-1.8422341740345995	0.9791413360462421	-0.23658235285975457	0.3758968273279556	-0.7379662029189028	-0.9558490082424093	-0.45167227065102006	-0.13587675227718632	-0.43481791249648283	0
+-0.2749398078895973	-0.602759369823714	-0.34817063773317436	1.2165805903649096	0.08822993442548502	-0.9828118947823061	1.1255554529825982	-0.5951138391567017	1.359567367140958	1.14745743851399	-2.2691569946862655	0.9270532988002531	-1.28390481061431	0.702184505359777	1.1599689740750685	-0.7022781266128805	-1.5820069707072104	-0.1640254026760564	-0.6268539047283007	-0.5343960171949464	0
+-0.8451664655381013	0.9592831641658773	0.29032122469609184	1.4456183940991385	-2.2668849557948265	0.49356800079005453	0.9973927328851383	-1.7077448427289017	-1.525140006218017	-0.2628130337984583	-0.6987088119151889	0.12372879270054708	-0.37829745272534815	-0.0010588423370812654	3.1974829539733727	1.7610392441369824	0.461991697252764	-0.8707192095484595	0.4949902726326138	0.7113500316301005	1
+-0.6479921130452116	-0.9442706004373587	0.20181386383006028	-1.0034745347115275	-0.9369221110721804	-1.003380717730042	-0.7275212508545039	-0.1820208348243829	0.869148773329888	-0.7855214383236936	0.1360612935062583	2.0654861372867295	-1.2399203282859266	-0.44615385943239716	1.7347311831934773	-0.6314619246803259	-0.76518919295205	1.2707549044789055	-0.7323378102483927	-0.3626096934734513	0
+-0.06451309551365764	-0.7249330776348837	0.5963143554325262	-1.379225616134922	1.1667980284973485	-2.274070053731467	0.7411405179848544	-0.6631329812615014	-1.567155162052582	-0.09527290234272089	-0.7316650418582739	-1.0020134142607244	-0.6953396335230776	1.5807860908438993	0.3379535699933314	1.8800551896643136	0.37962716233848903	0.5363444440333102	0.1390867505544731	0.7390508093906831	1
+0.7576049876525334	0.8726631262318649	0.8478637181249223	0.30198299200599726	1.0101338828657191	-1.3836221562341127	1.0376123351490436	1.0937481979752155	1.3929535047023875	0.8760511854123076	-1.2981174812942935	0.3025477016355275	-0.14253519602584672	1.2887025562956078	2.1562199933480133	-1.0111580468681463	-1.2275056029861684	-0.2688763993683175	-2.2719054986176683	-0.5810422898079113	0
+2.5394320331114613	0.46034921066168377	0.8315330299051433	-0.9396024430587621	-0.37614736761593637	-0.17996331764913345	1.455421460737774	1.5223077678776793	1.1770030840483332	0.40359841542535574	-0.03766667059723912	0.2415068878754467	-0.44558826380657596	1.2774520318648948	-1.8848343873195796	-0.23434224565939143	-1.8735210102773319	2.299369468755593	0.11182257854217889	-0.41968753568332984	0
+-1.1654317335035704	-0.23406889069910192	-1.3485118844184532	0.7912949804001552	-0.19206908223922012	-2.752037662677927	-1.6014139415281856	-0.5108631934878929	1.4041570989659866	0.5382460975045578	0.012866884184724063	0.7910261496852212	-0.5285056361126661	-2.874968879865529	-0.8428605517089753	-1.4276668142409976	-0.6865704170544349	0.8660591728218054	1.176952513690748	-0.6326584957221068	0
+0.9050654404010442	1.5248626005482613	0.0537117476660896	0.10714253527293145	0.5436279322698345	-0.9162199391704404	1.1974173477959238	-1.6813868155498577	0.465763145265903	1.6525856413988107	-2.023763530020729	-1.2225052973966217	0.48905360189011937	-0.06340532135397717	-0.8428196875999223	0.9810796287807456	-2.1897236651211855	-0.5362903624231383	0.6151521853927577	-0.042643618877945336	1
+0.2854489945462638	0.3530051834614323	0.1332902420274303	-2.066453723784956	-0.2645836803644654	0.5245478462345327	0.2238241190906629	-0.48256531456153773	0.13249140142592644	0.9127282586749043	2.6474189892831026	-0.37219899010144253	-1.548077411041423	0.662893215100046	-0.8853951972314839	1.183629012690877	-1.8429271907244553	0.8100978673990902	-0.3284080793917298	0.09184768542206719	1
+-1.3227165003614927	-0.7799983027126963	0.18479275551351085	-0.14231230753550203	-1.3945327153213618	-0.0758997670485449	0.6986307702990094	1.6282076357873105	0.18237029611060487	-0.7109024225989671	-0.2724518087709634	0.4729134646484038	0.5454540297228883	-1.0722422723792842	-0.606184110109761	0.8021132176384902	-1.4211379561267314	-0.3389835320929106	-1.44904592785806	0.031348504552504486	1
+-2.197691926666584	-1.7077148903852681	-0.6449885420999844	-0.06865025280146782	0.4202392504617797	0.968886848221698	-0.005924072251181685	-0.6511305169582245	0.3998134505861388	0.892257884749868	1.3521367585609907	-0.7404970062580767	-0.46898715506363886	1.275597323305137	0.14386099595965895	-1.838491122688009	1.7359354044223765	-0.1551428089500599	-0.43232000255589664	-0.3447470104944261	0
+-0.2670710335696844	1.7812245781622742	-1.1329343313282814	-0.24423451883692596	0.7548220931778789	-1.8862883675077626	0.6526294599846313	-0.3676598535224105	-0.2448455084452909	-0.6772836861850628	0.5942014265411584	0.2375037940405147	-1.1168006401508905	2.6256144457846546	-0.6716078230151616	-0.2989663691054665	0.8587286854080793	0.4974278727895833	1.0406815179638391	0.047335395957696466	0
+-0.4829965988829622	-0.8664172853019196	0.010536697447195188	-0.24957125769621874	-0.5053469214826972	-0.5661823837482267	1.397031114430776	0.9362535725466031	0.8494481273008917	-2.3689801750315524	-0.11515634319648775	-0.8619219742938617	0.5524984188665393	1.5190033138842483	-0.9215808226333405	-2.2309955927486342	1.4288742583770047	-0.5196163599941902	2.2436594507282206	-0.5399023920325723	0
+0.988208848486463	-2.585767588999438	-0.009847287471481413	0.30217682520827216	-2.221510823700524	0.9425068791712249	0.6889213621579444	-1.0110351209554707	1.3983331823298473	0.017600206923097966	-0.49772668445684926	0.041274574202699865	0.39315819224910903	0.687759695794799	0.8198061540197786	-1.6938202943901621	-0.31675443490083666	-0.5176603237193814	0.7734409975442094	-0.6613095000652233	0
+-1.6500251948243565	-0.5881887751399346	-0.008457486200020091	-1.0255372547670172	2.883969251775838	0.6841194893268114	0.36522540717596585	-0.4063786899313203	-0.4597632229684979	0.6689473090641462	0.5824042646735971	0.3231095013887879	0.59519151467352	0.40271751266444333	0.2803223035037342	1.1596486152072958	-0.7088028618998904	-1.7236514338073596	0.5349275937487872	0.28671842601834485	1
+0.30430567959512733	-0.6926221975020497	-0.3586531509541748	0.11220827271785544	-0.6418145875587414	0.40043811487947506	-0.5627558800719191	1.5870889370740489	-1.1979020496525155	0.9287687328933728	-0.9429787966287079	-0.4694866980716366	0.5476098176306101	0.9911844589581342	-1.890064241013992	0.810682748482377	1.135044917480963	0.5813591730005884	1.5988127102205738	0.4929116267678903	1
+0.40492907257520244	-0.6514435841992149	1.8847060544535634	0.25069797962239826	0.2098594845826785	-0.8699566545276876	0.7644150970416564	-0.5372191508425196	0.8513726693635947	-1.6024845301638289	-0.23003580655162623	-1.0594997311547119	0.1503781049950916	-0.697530591149039	-0.06048301501585981	-1.225374349155504	0.06893531119317442	-0.5498117799824236	0.2629482684151777	-0.42494833533236415	0
+-0.6938752020747251	-0.16425303413718284	-0.786824522255031	1.7668617516726024	0.1351177762474505	-0.6769151658288148	1.099720527820615	-0.2108673539727271	-0.09240517052244847	1.9753281712575461	1.0326537546555192	-0.5857366554551754	2.527070920782692	-1.1314983848532563	-1.2203869916654786	0.5386023310337225	-0.5545516579065658	1.617741961423047	0.026714277801613007	0.09274673011429316	1
+-1.2855738604138573	0.9527052435093047	-0.5393910228200474	0.1406950564673274	0.6278876784461687	2.2921936458109897	-0.8296277386100398	-0.8276017374999237	-0.5691114767876203	-0.7804341795136254	-0.3115251054922687	1.1604663708722944	-0.45823039827601697	0.096940343318409	-0.4661721263852442	0.7914638179665774	-0.008781526693367847	0.540432755366913	1.2382624131362387	0.2808835720014097	1
+0.01971106661270503	0.022725782621203446	-0.7171971284211488	-0.844608668797061	0.17759075527122256	0.32351256640857523	1.1092738552242762	0.8459134704189475	-1.0092620261375949	0.3312851879047735	0.8493202690407095	0.7463122829548583	2.2751079842809023	-0.365800592740796	1.392872207641418	0.2672220726832053	1.5171222642682722	0.6271956315522539	0.12548690045124972	0.3674941717644202	1
+-0.9272485993677742	-0.3992846345441018	1.0312821968019672	-1.0164811121806232	-0.5788411209471953	0.1621555997620361	1.4878944321336367	-2.305258151983712	1.0526886159889823	-1.1927713830291693	0.35643089395408944	-0.35781685235193555	0.24420707079596798	-0.7032369510661453	1.3748594175398903	-0.265531361494145	-1.6001897901099145	1.5225430928104695	1.1284147518659724	-0.38179068502908986	0
+0.8466872377493828	0.21453403707113433	0.6877174913431068	-0.4470343315836607	-0.9060867789442381	0.22357751470350606	-1.4313384494982322	0.7146958272683516	1.2868876187481681	0.6108180939736211	1.6680351279664263	-2.2704132021611114	-0.5699517962545901	-0.5390686415774785	-0.6652888855585158	-1.9249041040915857	0.2022499134735356	1.4692083028521956	0.9692133398427439	-0.650684739883086	0
+-0.601702497867707	0.03192366589002642	-1.0154893571166628	1.2277054932407083	-0.17345609362160444	1.3508013650170736	-0.8603704762851204	0.7158372997438407	0.609842377909055	0.26686482080895313	-0.21636159151507584	1.4178789398571483	0.07902571896854252	1.6204683987456092	-1.0280706824933712	-1.405364977188804	0.7610249189649491	-0.7259753124258116	-1.1264854630318841	-0.3650429101933015	0
+0.2407422845881994	2.8857517953922764	-0.023980761898605114	-0.45619206614093344	0.6177594707762792	-0.08768373982573438	1.7598211003608997	-0.031028697570925873	-0.49143266590475054	-0.05864391264016893	-2.2134606073911924	1.0913309075290665	0.9117965623133085	-0.12278570026442888	-0.8739999199474732	1.1171072920808645	-0.5925089707550872	1.2372535126873845	2.124745399513117	0.2923959583087956	1
+0.17584571165005292	-0.8511320881692872	-2.2051034645754948	-0.6116310759188245	-1.2047158798971238	0.66839521890313	0.8991245292770655	0.4741248277718854	0.1760900687774567	-0.6307555906525206	0.9535866516994639	0.9371915337062796	-1.4228495469631228	0.16029074988453906	1.8555455403701624	-1.869116730286061	2.1934384645923486	-2.281305792694086	2.8097011435732293	-0.2736139860084672	0
+0.5242236519537231	-0.06307879670506915	-1.3294456177962388	0.8242892015046335	-1.081258571215189	1.3449502719441988	-0.50356048600791	-0.38621990548929036	-0.05314119332051215	-0.45271329511708064	0.087257980752205	-2.050905763049373	1.1197161016785873	0.9167469515279244	0.687592786751324	0.8579972616602627	-1.0583875221093613	0.7563768879274201	0.37967322200031345	0.11635935179374274	1
+0.558346902284024	-0.9309696527726209	-2.0842708835548924	0.030877752980638058	1.0396388948858852	-0.3022844248616988	-1.277629080640249	-0.6294458606293386	1.238756470825371	0.13639753659343484	-0.3188074229604005	-0.9443200259389776	-0.41149095236240474	-1.337165050885127	-0.33733841113672913	-1.0953021286821771	-0.8271589650497895	1.2703115446925113	0.6531758521433048	-0.5392612125425414	0
+-0.7379887070817857	-1.2626042854762183	0.17912390469970796	0.32669169909966733	-0.5343938353030584	-0.8617991799058063	-1.0231988412194268	-2.38861407368411	-0.15825189124877934	1.3263448403293359	1.7165027742351253	0.5384660112416041	1.3283330921381156	0.21309224825039347	0.9270035239969678	0.9968859637509941	-1.0501783925356227	-0.4559683500449692	0.6819648840132921	0.16739862639293818	1
+1.4476040528943543	-0.6314322515594253	0.14853198602056514	0.1396675784886334	0.016672373423269438	0.16564178605539887	-1.0040158066788205	-0.5327923727826095	1.147051857581131	-1.1417786944082575	0.44682624679647864	-1.3120985315266447	0.7869814652437135	-0.46902780374760905	0.7464021537026985	-1.153959736241712	-0.5774434779881016	1.8363081603106133	-1.7651938506826501	-0.5154033311511862	0
+-0.694949123737318	1.4480014208760492	1.114733892631557	1.3552725615328403	0.32870245607283527	2.182275910834502	-0.43728724254382445	-0.32108899071015246	1.7059375939854156	-1.0144720406973653	-1.1268282836571295	0.9114744851303214	0.2876311214263635	-0.9194792276680201	0.8712160137184647	-1.6822107044034538	-0.9046542625496667	-1.2265674316518074	-0.08885766708388806	-0.7626183729066613	0
+-0.4951739548431622	3.075573893432424	0.7125389403746353	0.7127480011897636	3.85793967348964	-1.380114296433079	0.830819563694863	1.6659047027918155	1.692437606180482	0.132962280436304	0.13986220576101485	-0.8782681675417305	0.692696057131838	0.21421904746683115	-0.08289852500467178	-1.697739157869832	-0.8585956144545324	0.3596237434172795	1.0687856807518747	-0.7598986082131621	0
+-0.24659729953406678	0.48028838228527204	-0.021175774300496716	-0.3664962494470602	0.01003713940839754	-0.25227004044698087	-1.9569675522430627	-0.22013056376799153	1.0072449553370086	1.490533097267343	-1.163235822180662	-0.564484658307677	-0.6542808538079327	0.3252062923168107	-0.39939137701024663	-0.4953677656109705	-1.2056522392978473	0.33107168261445835	0.8604754069049109	-0.3930464701607799	0
+1.0901528926431487	-0.9453346120985947	-0.4729131940164531	1.443087583454784	-1.4130407277334363	0.24204583536789437	1.5221528599715186	-1.4925201736211136	-0.750070599045198	1.0925633619786013	-0.6563789851711918	2.000672024084738	1.9550554438780816	0.8237126081224749	-0.32415019818829954	0.3320842417897454	0.947459986817773	1.746256318275166	-0.9194491847633625	0.28846144012404507	0
+0.8621689184981023	0.07355255089438108	-0.8847286012386693	0.4796962084572591	0.5677535540962639	-2.5289475108846857	0.7483241867237762	2.288635291333243	-0.4638726726966315	-1.4726571262457677	1.2522315626273022	0.9146566431112833	1.3432368831212602	-0.1516899652786653	0.6523101983645719	0.8002795439355803	-0.2164492931029829	1.175609480746336	-0.5899674340661235	0.2467801870809084	1
+1.8327334301292564	2.7250208073497655	0.8850898918686639	2.02577923393804	1.1993328107538388	-0.6080810819389247	0.45076298555579936	-0.8695507065224324	1.4966446042512176	0.9689045577333327	-0.040195475275759104	-0.8394777244112416	1.3016102245353771	0.7079943796338916	0.170770931967963	-1.9468700714932357	-0.1583369501288343	1.5860651416439473	1.5303010308595233	-0.7232027745913409	0
+0.45675680055100876	1.6862402750755072	-0.3339099307005731	0.9727972485358709	1.5405555309799355	0.5095493726194038	-1.1769248912579864	0.14688445026802582	-1.8923413151325892	-0.3597035854371358	0.034288605346101064	-0.1895277822930986	-1.5451347924726995	1.2116386663488123	-0.8476549112820619	2.8325772842721397	-0.3001639683766244	-0.38212536558313037	0.30867526144867835	0.9570534912074047	1
+0.6675880922360743	0.061607686265927775	-0.5240201725381137	-0.2997158513385201	0.43035789354356024	0.36247267480026046	-2.8186530025073595	0.05633894424120396	-1.4240630471371363	0.9417552666999109	0.8621190134296215	0.827177562356735	1.276247945989341	2.297885578997527	-0.646962111575448	1.4674788351942492	0.6699042159445734	0.5558064722220939	-0.8570825503940438	0.6438772343953656	1
+-0.7230597875372071	0.7389509974901849	-1.93022327109422	-0.07844206283832174	-1.8155995691953226	0.4605439023890654	0.33409134205811086	0.27987375745446136	-2.1891803361957525	0.814324613537393	0.33687080618689497	-1.1366259127066474	0.38265856161425904	-1.6119503393696952	1.2140595171215174	3.690453997873541	-0.9050341895489411	0.9404548194318197	-0.6885408976578092	1.1547176268987822	1
+-0.20429550994058496	-0.7742446220627313	0.9314007484353164	2.565917360177608	-1.93736462781153	0.5384714676400842	0.9863681649066736	1.483178916134393	-0.9316097044806316	-0.5277830403219427	-1.328483968518206	1.1375377820834534	0.41535786515366985	-0.18726676450257188	-0.05624642393738156	0.046686315886620644	1.6701180226287295	0.4152987016284749	1.3110909185719273	0.31623204667724564	1
+-0.26759192177397656	1.2033205926353625	0.049037461548016935	-0.26722530141904327	0.9561499786482655	0.5229173631509835	-0.9762315218209106	-0.10777619396316224	1.6028516387787055	-0.4694062226879811	0.35280658284312694	-0.0751525704189141	1.3547691398570894	0.8054921061469411	-1.4257562814463445	-1.922437446100354	-0.38886964310660965	1.2860174671016282	1.3242380220962733	-0.7558340808429282	0
+-0.7430459223148423	-0.345025274037323	-0.6836501416815086	1.1810021618172988	0.4137586484133794	-1.0717355675879099	1.2401898182121198	0.7045354278052993	-0.9063430103781079	-0.8859252495127169	-2.1418516144035475	0.10342901781618742	-0.30175139488690217	0.527387687628702	-0.49581833514279516	1.0261169886240376	0.302080558087638	-1.1807980275906318	-1.0660552581621128	0.4203865372286456	1
+-0.8856978941958283	-0.5611773427197669	0.23925986087456783	0.0915712442891479	0.9195436457578192	-0.3182853136155345	-0.4101120092081721	-0.07936631605575531	0.5178580879150084	-1.645607964622266	-0.09891912036094928	0.06812570823584903	-0.07149411774529733	-0.1378586963310319	0.16979751913292426	0.9737023906726753	-2.2766864166854184	-1.2674959941594357	-0.16935301763051838	-0.06087500479564888	1
+-0.8347002345785401	-0.5852677365383244	-0.22290652406605962	-1.998282087632246	0.27650295204355396	-0.006598203487616498	2.2812721074024944	-0.7372621615773305	-0.5524691100306179	-0.8106258122291109	1.2972505366193468	1.1535198870555938	-0.9294976841312648	-0.2885403301648238	0.10382736210532115	-0.023326105815496323	1.059228248788412	0.34421346303858386	0.5515401814060694	0.1816700680401573	0
+-0.59892262579212	-1.6376756241371526	-0.378736298456714	-1.0418743710911664	2.5492856987737014	-0.6615569434901911	0.006317661817300752	-1.7976375781681988	0.046863996948282666	-0.3823403780460225	-0.13210003839031914	0.5417126512741955	-0.823533424001803	-1.3644765720109107	-0.9859808115749349	0.7527993867760319	-1.102540208655706	1.9406228046678644	-0.28559377932836866	0.07089647899954139	1
+1.3925260779906183	1.0778035873134737	0.07530237581078959	-1.6645104329617095	-0.05818985492234962	0.563949339433897	0.6791380636681086	0.5219979705833208	-0.6360766994468067	0.16841451395907342	-0.10405164557505987	0.49256225202705956	-0.5383113936858084	-0.30229931902300344	-0.3925687758796	-0.8161226282106238	2.2840703234313273	-0.38465598282466923	0.39058426076124503	0.11843675039187236	1
+1.1352016674683758	0.5648569127221107	2.397073067233959	-0.20268282272443056	-1.0917976649357448	-0.6601392708428152	-1.9445402822954807	-0.29178644639701495	0.2751710745518691	1.0097935422904265	1.5387536595031532	0.26393122365044175	-0.46273031364217426	-2.2292589330885986	-0.9134206948382958	0.8401731701415269	-1.645111014559415	1.5562083709832442	-0.1089062616381093	0.004757145532405901	1
+1.098875986566869	-0.4022899215971822	1.5175361283542563	-0.4806321621688906	-0.2984356710923274	0.6355011681954533	-0.5366404268123247	-1.2703180389254833	1.516758047371705	-2.132910373907718	0.025191903274544	0.8231244016664833	0.4804114112715212	-0.2851808701227014	0.7592043314019562	-1.6607300610426388	-0.5816933219806619	0.3696111506737348	1.0423327430213356	-0.6970225369060598	0
+0.8101916422542774	-0.6863958655184795	-0.5296495025503906	-2.593049387823186	1.3099523237532418	-0.5560681594651091	-1.1332472710708152	0.4487887875734142	1.3556075253585955	0.10193764725371153	1.0604911834109119	-0.16433173228337156	-0.24321111498677203	-0.5777727170864493	-0.2805096318513892	-2.591494319646014	0.9734907223316764	-0.4208166097429164	0.28768107786745795	-0.7502402390626048	0
+0.12340670941539608	-0.5283333516589073	-0.8105601159173703	-0.790472710889662	-0.4072015719616529	0.2499136810467275	0.7000452723146847	-0.7368148416525208	1.3152294000156877	-0.14471976544476078	-0.09180805144899466	0.07455981071053643	-1.7390992728519505	0.031047952046710476	0.06339992712334852	-2.68682916947328	1.1771921941427486	1.9998578404574014	1.2720349278692757	-0.7477253587693696	0
+-1.8463416145538356	0.9877470273404159	0.6090995914299342	-0.05454962931514019	1.5957629012804186	-0.7274708346047783	-0.4881110169164618	-0.10746411474278562	-0.22966924089385501	-0.41243382161399256	-0.4533996984310992	0.6296948056302356	-1.1360989745400003	-1.3017565892197434	-0.41546602951164513	1.0106305929502466	-0.9358580686121462	-0.8522489506584864	1.0907946273414781	0.1928095681182362	1
+-1.153885792720572	0.9710150739398405	1.2485130631114325	-0.922849593193101	0.40944806598520256	-1.2377573117811096	0.055893360103507414	-0.180323324487924	-0.9518528082448592	0.49790841207097386	-0.7935082792305357	-0.13442562190597213	0.6807164316349167	-0.7735959733304064	-2.338273386722357	0.09862297814391718	1.6377256011208965	-1.1446482896282357	-1.5573740255791648	0.32895701815399	1
+0.38416436496131556	-1.4737655176136435	0.09207904862564406	0.8282908984570213	-0.2281547965833843	-0.6788102101595077	-0.8116419957449114	-1.1963099714035128	-1.5560108513806363	0.7831220308214599	0.11250426233136833	-0.093173526942104	-0.22085148462505744	0.5748209312636592	-0.028677866459869465	1.8567762034490851	0.3902933933742653	-1.3867146526153864	0.009430420454783334	0.7326561834289222	1
+0.5333662646860791	1.2619572530223984	0.06886762106070753	0.8686502617410066	0.6091057104482803	-0.863695134710848	1.2455241795966359	-0.41089883250021403	-0.7780948095240008	0.2657401234141504	0.2092762944699149	-0.6045175428606584	1.1907316086258812	-0.6255334005329436	0.5106942988951843	-0.41078796254386396	2.001562705082795	0.920622863636502	0.11248681150043587	0.21241951185988145	1
+1.5038046653372112	-0.5482813446368637	-0.3641863572992026	-1.1327291781835451	-0.15806847832806897	-0.7192061272862257	-0.6950098823438737	-0.47009316461768835	-1.9377149832346678	-0.35779084437972	0.8451070985370979	-0.5080798628815741	0.5485566605075846	0.9761767931804848	0.43925107369417943	2.957596999924257	-0.3843783591548495	0.10415185780639113	0.9951843831205078	0.9865650926014994	1
+-1.9728640480783795	-0.584889332459948	-1.7115830531175702	2.1324867288289617	-0.5256451948154732	-0.13207671471324264	-0.9292471979014248	0.3506928143980163	1.3092760133267836	0.5398129189913056	-1.3559078555972999	0.39841641960968166	1.2537261342634507	0.9637445310773097	0.5431731800991407	-0.796177135299726	-1.3618004012670868	0.15859859636139104	2.7213336098665635	-0.5284081777192728	0
+0.41614597578860496	-0.1679131727874871	-0.18337459189215918	0.6847631554909649	1.4671555504106528	-1.0600082591583286	0.7597959068113311	-0.6926816136990898	0.5399648494662486	0.1429569524514458	-0.0482216355946755	-0.2086217318530937	0.6610574334671373	-0.31480674559033817	-0.06162756634039431	-0.7644973510153209	0.026631685382698556	1.2830307747086311	0.5078271760432795	-0.2680579423040609	0
+-0.012045236853271031	1.6925906279849425	-0.43238636618530835	-1.6847064151587414	2.2803112732391826	0.4504456177691022	0.8841718182048186	-1.1106346720321985	0.49231132027988483	-0.29108659019024025	-0.37667434221349183	-0.5384799446573829	0.2080936834521666	0.7315635547473112	0.5624562546330725	-1.0760533706627082	0.5355018164707845	1.580659829411814	2.135839579661295	-0.28797000142125845	0
+1.49961056170431	0.17185882517030615	-1.1299710458171193	-1.0986042355701349	0.2380742569517034	1.3281321131436516	1.1167682468088798	0.35564438892659067	-0.8928006143434813	0.14614254213307512	1.2829097566144694	-0.013688855208146944	-0.45706533906364627	-0.3062063943698761	1.9034164161920542	1.0929212167523317	0.1867834374796813	0.7587214440890531	-0.3029040483924579	0.42354677628115955	1
+-2.6545414330136725	1.8356854615940046	-0.5457976028267867	-0.9275320032879893	-1.3283248730961463	0.6232216740312264	0.596469164632437	-0.7210278452213854	-0.9118316286209408	-0.24928762363265858	0.952868090977543	1.11694972800202	0.5416161166668478	0.20604165648494577	-2.533714900686942	-0.016083961019089266	1.717987671558801	0.5450784715193229	0.5568882027647745	0.30241692371509693	1
+0.6668801993571806	-2.3053224234261527	0.48468627798385755	1.3546263068343696	0.11873192576862872	0.547052797574943	0.719991138685963	-0.524434980542717	-0.46901795027526905	-1.0137197024379423	1.3569787876682777	-1.2845045596199125	-1.5523887064375035	0.2108731700382351	0.19659506908435523	-0.953106011799891	2.1580484593930747	-0.2561154143302568	2.0759505803869307	0.04694527263670476	0
+1.1311811909202247	-0.6933878511104847	-1.265057694018798	0.5183435151558969	-0.07684033970519674	1.1988239385167685	-0.9469760525902353	0.5391724452767099	-0.23426383767301404	-0.1090739625676252	0.21359010083019977	-2.268619962246101	-0.7529456042925735	-0.8425159924738271	-0.05816611715256052	1.0977895592955997	-1.0448686711150859	0.9636968648987307	0.5900261263151266	0.2043616532143112	1
+0.3136974470241752	-0.8291825633597693	-1.0372415290485972	0.586065961267128	0.12771181052702799	-0.7640402478085184	-0.5004744114139862	1.6608354030583428	-1.5278423539544295	0.5708166717972424	1.5345529929213104	0.6876259510533493	-2.091922245950683	-0.3022998396168013	0.9114872277854996	1.766640084108124	0.4594646315912676	-1.1409669611458368	-0.7203819922636215	0.7128955852536363	1
+-0.0843840216296024	-1.3820347260227162	0.6397705674189378	1.0854940115848073	-0.8750993854125558	-0.5369047713298828	-2.6192806035910072	0.6701565503321437	-1.84641452901824	-0.10678367894303217	-0.7624907593835051	0.5861653271698655	-0.17704463664703687	0.7085263301324782	-0.8713026470236783	2.69143441504066	-0.19523201436527637	2.1560252861535147	-1.5795988238989795	0.9255039639597403	1
+0.6790203045104227	0.04209531864771717	-0.9611185195569437	-0.3493805390110045	0.3752751708285271	-0.28824269480756903	-0.0899568402734146	-0.7077880082031884	0.4219096981099068	-0.4093739891492758	-0.2055219060653654	1.3144282945889445	1.3487878682901	0.4293192866086668	-0.35331772809174306	-2.2826706845081164	2.29392855287745	-0.8770797047105753	0.6595634650916563	-0.4031787064662481	0
+0.6325447969724978	-1.5376848226493998	2.135545601595113	-0.7169675793179096	0.7929518975841817	-1.9315293250980572	1.3897142939008622	0.24930998597507595	-1.6440687479969183	-0.3704887551777182	-1.23787039502056	1.1836559269554183	-1.0938410824485512	-0.9895111468738925	-1.9260882651788052	2.109489705785208	0.21325468197813358	-0.1667210430129357	-0.4438538195629017	0.7910893416120955	1
+1.385783766454507	0.6443593624326104	-0.696350741910387	-0.823087860995007	-2.674354948547689	-0.49104596911569837	-0.14505356097389743	0.08649405653783686	0.32769430695483825	0.5845207431072055	-0.24481231922778438	0.8116910518786606	1.1430734254415746	0.32847783781427603	-0.24814981566368804	-2.8145262786887635	3.1865533860467052	0.44909883424446956	-0.402495596969506	-0.4328771627918769	0
+3.2529008023011587	-0.27166980167059496	-0.10473605798933078	-0.6534723222613076	-0.47729389928282157	0.19299500589830051	-0.24751855177125084	1.0219251961145952	-1.3171347334030596	-0.32230874972038603	-0.8110222905403106	-1.1322412716856916	-0.4661557022161254	-0.9471392661729446	-1.5958813690320397	1.160984081252255	0.8843769178013272	-0.035928362941471184	-0.8154578692172377	0.5729651158375776	1
+-0.9552158838227957	-0.3785028025591672	0.23351936921649144	-1.365343241823016	-0.6359698186412605	0.2872129861981349	0.01632286834064877	0.9912188508026412	-0.4305595490234799	-0.2605126207976518	0.3214442712943701	-0.20958795245614859	-1.4526406739111428	0.03730765585464991	-1.3274909827312888	1.1647254348024332	-0.769978389629172	1.0149522887472011	0.27653105409089324	0.27755713923924	1
+0.6551705283348923	-0.5615847942521986	-0.49519737438896855	0.23737629933432333	-0.4143994932544478	0.5167863504871545	0.3437170326220349	-0.7014811472600427	-1.6077015111257857	0.09451199914284816	0.5398998770150264	1.7475220863842662	-0.7767689612363475	-0.2216084475817371	1.183412573203491	2.0036214776598777	0.2883927875098986	0.46301689909689936	-0.5918632272605117	0.766784528636304	1
+-0.3361436284769567	0.1823427274870421	3.334203517597432	1.0128962309550167	-1.8811146489414055	-0.958168335581346	-0.5484922802752095	0.11760845626656423	1.1468147240921671	0.49875048880422795	3.1733905239619795	-0.0526349697724523	0.08652484860757291	0.5769340599430341	-1.0778260770671824	-0.8829578732735933	-0.9425233847712056	1.6033719963489919	1.8445232062556762	-0.48417251502812303	0
+0.9050528629328798	-0.012035767922212968	0.21306591909620448	1.0094897718684082	1.8398709351830922	-0.20939878024355807	1.544249561568332	-0.5558744255462802	-0.14830157676341127	-0.9129893226159165	-0.9052536407792096	-2.185153803257982	-0.7555250892846609	1.0407174952822522	-0.45036832301510676	0.8342667153934721	-0.849352027222355	-0.9657156624472774	-1.0122112207459872	0.1453852453196201	1
+1.178239159200306	-1.0652461548210312	0.32928250529485964	0.16713678370411497	0.12495397935004156	2.745117964775073	0.6030536979033265	-0.5722638992074314	0.9615416437730038	-0.44340798605665754	-1.5164304957203023	-1.0614676369216434	-0.08605564337254189	-0.15484845483449294	0.7389539007599524	0.7502907577776994	-2.800745114653922	-1.9836209428041778	-0.1788939995187421	-0.23460734202135813	0
+-0.022012467048051917	-0.2980589001770356	-0.9287657608462492	0.2022550669003972	1.3583611934492914	-0.3473542636872249	-0.08008290659022492	-1.094868489559057	0.3797735402439996	-1.9003696914644261	1.3733264119781319	0.49468129909971936	-0.5266982026448499	0.21506804700839205	-1.0239364192571805	0.08708817019212689	-0.8239609000108052	-1.0562806080043665	-0.6782509079000207	-0.11671445720024777	0
+-0.05535106725613376	1.897495684900051	-1.2961422703619865	-2.2362527882016288	0.6062782036825521	2.4944056179800698	-0.3652339819814644	-0.4307541449118705	-0.5320017432805376	0.42491286095294456	0.8968935558620045	-0.3501200079640903	-0.9035207258064066	-0.20458977846842988	0.6228215147539629	0.36595471824159787	0.4960995217769678	-0.7661022207718267	0.046327557310846944	0.21958825180654357	0
+0.4892337648335795	-0.887961134764646	-0.6575191404509574	-0.9041652092433549	-0.1504880604676619	-0.14829295739477777	0.28675094725200034	-0.5695736471796179	0.15975525591910827	-2.267876921091358	0.3074302518646544	0.2859729425182367	-0.12518243894874598	0.5923394212109696	-1.4363920287788075	-0.9059221277254496	0.9246917409852377	-0.1251848370827014	0.07971000908831376	-0.15744397774867594	0
+-1.7231933239653434	-0.24801134827199994	-1.9898222399382914	0.7656954261085819	-0.05483023725936617	1.6169399021897064	-0.3967249498631411	1.0323459107790158	0.9731895081194355	1.0303924263130786	1.0329180459160618	-0.033547027338664666	-1.0624411368884286	-0.9342158375564429	0.05971477069293665	0.25789653038454863	-2.1582838562759	-0.2780337171101295	0.7441495680026682	-0.2950948350858021	0
+0.16933309281863	-1.3713232471471188	-0.28145821900384405	-1.1300262257452833	0.5588657879489666	0.18393634027606567	-0.33064387147695085	-0.2728913561712938	-1.5796081028817355	-0.059698139612798386	-0.5305183143587244	0.4522332723500524	-0.35850443734187276	-0.6618912758728542	1.105836446597426	-0.8045286988938815	4.02369826067075	-0.6441278738693271	-1.1617665339422667	0.43461303247631455	0
+-1.8460295965152045	-0.255975214092637	1.0540424748134019	1.3190200056340993	-0.9984660716843727	0.1252126858419551	1.479116981117545	-0.07780687825586112	0.1755389386980704	-0.7247573669263252	-0.18580560212243427	0.4759463602670577	-1.079448951686073	0.5844426958957524	-0.013805770284701622	-1.7460392281016928	2.0284596495593634	-0.7858761582110539	-0.17228886477186073	-0.2592823117499626	0
+1.8771428706377922	1.954430088902813	-1.1616019467282765	0.5673334205644196	-0.08799540550164092	0.06644430233106957	0.5679433816499357	0.42441824827810354	0.1518278594250636	0.4306132751340653	0.0692509618345264	-0.1016379743818435	-0.5693165703158743	0.2262121311410064	-1.190784254860191	0.9589244192715091	-1.5758227297795224	0.32702615652721884	0.9015922583874204	0.05956556043266634	1
+0.15323002771333824	-0.3966186853856485	0.8421724903224964	-1.317627725338646	-0.33858048238968697	-0.4090657931046078	-1.4582418462866669	-0.6594840624629351	-0.4004108226455998	-0.7863950304118423	-0.7665729756746352	-0.010906592167949567	0.453194204359973	0.004008795533567026	1.3681052191345213	0.8285147180193451	-0.37259127080818166	0.7918792014178204	0.013153036557870796	0.22884946912013177	1
+-1.0926888646283135	0.7474034182399546	0.5070475019762871	-0.8560620219978579	2.019086116729861	2.7090019473659184	-0.5897085867477189	0.46800068820276425	1.1973925923016058	0.7580424981657605	-0.17689686434453186	-0.8134248245767957	-0.8757308415987771	0.1763704781550424	-1.199439969467994	-0.8989032076979058	-1.0151074498008397	-0.2667781642372559	1.5593148568891022	-0.5028825773221669	0
+-0.0696156591485477	-0.3955656348590421	-1.790003919076157	-3.209955381978046	1.7551741656764832	0.11653331605849324	-0.9325834567618385	-1.9081847831366037	1.5011366872997127	1.3655901991926498	0.714532047991697	-0.6735645547992268	2.4009183113212806	0.2753934759411781	-0.5586953357167566	-2.4248580602515304	0.4780055133333252	0.22430285295477725	1.5235848315795288	-0.779646482652198	0
+0.2383846452550063	-0.3130077315757537	1.0033975572213907	0.08864979057352633	1.6717911886146681	1.3347307577271426	0.12355262918532725	0.38378884838187516	1.0545758256277624	1.1966614601200112	-0.10788917679723521	1.5477291028255866	0.2484946248806814	-1.1366727112923867	-0.46484257027188	-0.6665072856921015	-1.062873534624194	0.8876717808262652	-1.3245780959402302	-0.4285126387910002	0
+-2.008942616762241	-0.8234988716333305	-0.15859132011071364	-0.5779462669917929	0.05687216122626013	-0.711741585516688	0.30663585257868975	-0.7322607097367665	-0.27918196650116295	0.23889598302964352	-2.89224040536514	-1.8338737352874381	-0.03502705018890768	-0.04826170379593097	-0.5084528851522548	1.0144555813357954	-0.8489078616442869	-1.5316018230959503	-1.9059055368464786	0.20977097201525036	1
+-0.1704564684096478	0.18971879197958597	-1.1844114274105708	-0.8546727892795731	0.09277642496734965	-0.1366293792823912	-2.048671922604096	-0.3357568385230854	1.4483592899951359	-1.0696662666401626	-0.2329845615794952	0.7837860781804775	0.41841523883774684	-0.8676594983663888	0.22583874577075078	-1.695720544464892	-0.4072557367301234	-0.1977972902611956	0.02359749586524577	-0.6782209637144826	0
+0.3239072506712229	0.7771447267055485	0.7529184295240164	-0.809273033397095	-0.5856061645692245	-0.6334300503835257	-0.7685061144460843	1.0110108162654712	-0.6307900736125656	1.0720688438114894	0.7375706675328788	-1.2970277152025405	-1.0622293344492408	0.12369973790391253	0.08645024003597679	-0.8294853204395023	2.2922588248961673	-2.306182941147614	-0.23693404546697278	0.11513663282079874	1
+-0.12031642840440407	-0.055598926892828825	0.29442208903978195	-0.08405908275243704	2.5707645107660437	-2.2724393778493805	-0.7091400944632673	-0.01527361681359736	-1.2630992116666893	-0.29672975912512006	-1.1604505895963486	-0.7448891733298583	-0.7216707082208504	1.6347076109296752	0.2543420370586476	0.9986464179201701	1.0028111182919377	-1.0099153635800724	0.6364125215344348	0.5362734706812686	1
+1.0759409181533681	0.6338708137850724	1.059455516811933	0.2736075032324234	-1.1004879462237114	0.8983820725024066	-0.9152704846639929	-0.8347039847535137	-1.3994538124984017	0.06937008395653746	-0.4322117530530746	-1.297471755359271	-0.9256383920977915	-1.5287869947378168	0.46665199638203264	1.3984163949968078	0.7172731124783118	-2.1595920504682318	0.2178924553288528	0.627726734926914	1
+1.1631257343736865	0.7161109143496656	1.165181781246556	-0.0970197604214342	1.770668260834617	0.09786380091576943	-0.25203469271235573	-0.07117035012372852	1.2621614052889216	-2.204226920077547	-0.833481645415412	1.668179441254334	0.6299876168291397	-0.4391047192362273	-0.12336287720355432	-2.4752753514344055	0.9905764766530935	0.16824138572933983	-1.108371640458861	-0.7056991628790823	0
+-0.4653767839296524	0.5706552646301977	-1.2510825198094822	-0.38542737502404606	0.5418393251037328	0.8696564647003973	-0.2677426807372017	1.3874400614164746	-1.6989225614176242	-0.8543980754353178	-0.7126300388983264	0.39242735549607893	0.7427861661062981	0.23731164772086588	0.17840259925316965	2.264950231927068	0.10561848543619334	1.7893962060023398	-0.33937719999794	0.8272635120183163	1
+1.0658262297925543	0.2245144207327693	1.9979515177687335	-1.3687162010707115	-1.1274591498928925	0.6453464430821444	0.10571095020938731	-0.04489492214522473	0.4070092579150457	-1.6549967992364703	-0.1861816445428681	-1.0013467840435817	0.13042091725382485	-0.9328609421342365	1.4771353822876396	1.0854915441340736	-2.221251309417225	0.5725567515972323	-1.1577200461261594	-0.011036089287608658	1
+-1.0583794427218747	2.576977679031155	-0.5895820679190702	0.13438281144361666	0.36102541634537905	1.5183620699261768	1.5873212424728582	-0.7273069057149364	0.4522026560345715	-0.02860552628379647	-0.018212347104613166	0.687677616154882	0.5422573331869172	0.10659762229930982	-1.2522775141080984	0.7277335248049872	-1.8227895144219035	-0.7301662802248373	0.9715535632493052	-0.0672408254641321	1
+-0.1099953959208559	1.6635363107373078	0.3272453529764515	-1.4246555886796946	1.2410820871966046	-0.15951736500333072	-0.661937714925914	0.4234572818376501	1.1246881843788494	0.9529594279919252	0.39143861927191975	3.465227148479317	-0.24134874955198468	-1.0945571896156956	-0.9833626436429376	-1.480187693017323	-0.09583127396217472	-0.31134706056867467	-0.6248721853412322	-0.5454408106982881	0
+0.9291001132966914	-0.1708304076874391	0.5364439368681257	0.2630766894332881	-0.1295965590136687	0.9929416493373554	0.7904280904722739	-0.01912275129904966	1.5057113544481104	-1.9314128569290476	-0.40508326392063543	1.0918159072154612	0.1881369570559398	-1.213691539345214	0.02421534060406341	-1.96631401509566	-0.14897841915958698	-2.1313146599852018	-1.2710579854942345	-0.7284633084773273	0
+0.6336131127287113	2.0333233170635046	-0.022356711144941453	-0.22007309599774338	0.9282123550423084	-0.787901129200937	0.5812629099886915	0.377426024051308	0.15067520175237897	-2.340925516401822	0.07371157701560777	1.560723423781778	-0.38910754054643126	1.0173191686261756	-0.4198460795464502	-0.4257545472403689	0.2939445657648525	0.6855820937261274	-2.068890495355913	-0.09921878204870066	0
+2.049778771444076	1.3048378295965286	1.563792608618236	-0.7047392202425459	0.5499305970570395	-0.04884518704139992	0.5223109585785488	-1.4893434370374596	1.3606389947395752	0.3899429971033616	0.055686488142052015	0.8438100462780511	1.6850310129308619	1.2652993760910154	-0.2279594058376745	-1.9365760629271713	0.0807919955941725	-0.6380407350109051	-1.0466273798176675	-0.6766362607223333	0
+0.630742979769623	-0.12660063112597814	-1.1219892377344292	-0.24320231504242704	-0.11846930012185257	0.35618373486097415	-0.35432027228237667	0.6830976831702715	-1.2988376519016114	-0.12917328933680922	0.4878147649765918	1.6226344780340827	0.46020710543895615	-0.9537377215409267	0.8308526010187456	1.1069055404414496	0.9232784698807094	-1.2718116679596179	-0.5666412777157238	0.5606432963172591	1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/classification_report.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,9 @@
+classification_report : 
+             precision    recall  f1-score   support
+
+          0       1.00      1.00      1.00        14
+          1       1.00      0.62      0.77        16
+          2       0.60      1.00      0.75         9
+
+avg / total       0.91      0.85      0.85        39
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cluster_result01.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,48 @@
+0	44	64	-76	0
+0	51	48	-73	0
+0	58	65	-49	0
+0	43	61	-49	0
+0	45	43	-79	0
+0	42	60	-98	0
+0	50	55	-59	0
+0	53	53	-56	0
+0	45	44	-61	0
+0	43	65	-84	0
+0	35	52	-75	0
+0	56	56	-70	0
+1	-61	86	43	2
+1	-67	93	15	2
+1	-59	94	36	2
+1	-50	92	62	2
+1	-78	91	70	2
+1	-35	87	47	2
+1	-56	91	52	2
+1	-61	81	46	2
+1	-83	78	34	2
+1	-50	87	45	2
+1	-67	73	50	2
+1	-50	97	45	2
+1	-61	111	45	2
+2	-109	23	-92	1
+2	-94	20	-96	1
+2	-85	26	-88	1
+2	-90	33	-114	1
+2	-63	9	-106	1
+2	-79	9	-93	1
+2	-99	26	-108	1
+2	-81	19	-110	1
+2	-108	21	-108	1
+2	-92	27	-106	1
+2	-88	2	-106	1
+2	-88	15	-103	1
+3	54	-74	4	3
+3	42	-92	31	3
+3	39	-99	-7	3
+3	48	-115	-5	3
+3	39	-96	2	3
+3	31	-109	9	3
+3	33	-96	-8	3
+3	23	-102	4	3
+3	38	-90	21	3
+3	34	-107	1	3
+3	35	-78	18	3
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cluster_result02.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,48 @@
+0	44	64	-76	3
+0	51	48	-73	3
+0	58	65	-49	3
+0	43	61	-49	3
+0	45	43	-79	3
+0	42	60	-98	3
+0	50	55	-59	3
+0	53	53	-56	3
+0	45	44	-61	3
+0	43	65	-84	3
+0	35	52	-75	3
+0	56	56	-70	3
+1	-61	86	43	2
+1	-67	93	15	2
+1	-59	94	36	2
+1	-50	92	62	2
+1	-78	91	70	2
+1	-35	87	47	2
+1	-56	91	52	2
+1	-61	81	46	2
+1	-83	78	34	2
+1	-50	87	45	2
+1	-67	73	50	2
+1	-50	97	45	2
+1	-61	111	45	2
+2	-109	23	-92	0
+2	-94	20	-96	0
+2	-85	26	-88	0
+2	-90	33	-114	0
+2	-63	9	-106	0
+2	-79	9	-93	0
+2	-99	26	-108	0
+2	-81	19	-110	0
+2	-108	21	-108	0
+2	-92	27	-106	0
+2	-88	2	-106	0
+2	-88	15	-103	0
+3	54	-74	4	1
+3	42	-92	31	1
+3	39	-99	-7	1
+3	48	-115	-5	1
+3	39	-96	2	1
+3	31	-109	9	1
+3	33	-96	-8	1
+3	23	-102	4	1
+3	38	-90	21	1
+3	34	-107	1	1
+3	35	-78	18	1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cluster_result03.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,48 @@
+0	44	64	-76	-1
+0	51	48	-73	-1
+0	58	65	-49	-1
+0	43	61	-49	-1
+0	45	43	-79	-1
+0	42	60	-98	-1
+0	50	55	-59	-1
+0	53	53	-56	-1
+0	45	44	-61	-1
+0	43	65	-84	-1
+0	35	52	-75	-1
+0	56	56	-70	-1
+1	-61	86	43	-1
+1	-67	93	15	-1
+1	-59	94	36	-1
+1	-50	92	62	-1
+1	-78	91	70	-1
+1	-35	87	47	-1
+1	-56	91	52	-1
+1	-61	81	46	-1
+1	-83	78	34	-1
+1	-50	87	45	-1
+1	-67	73	50	-1
+1	-50	97	45	-1
+1	-61	111	45	-1
+2	-109	23	-92	-1
+2	-94	20	-96	-1
+2	-85	26	-88	-1
+2	-90	33	-114	-1
+2	-63	9	-106	-1
+2	-79	9	-93	-1
+2	-99	26	-108	-1
+2	-81	19	-110	-1
+2	-108	21	-108	-1
+2	-92	27	-106	-1
+2	-88	2	-106	-1
+2	-88	15	-103	-1
+3	54	-74	4	-1
+3	42	-92	31	-1
+3	39	-99	-7	-1
+3	48	-115	-5	-1
+3	39	-96	2	-1
+3	31	-109	9	-1
+3	33	-96	-8	-1
+3	23	-102	4	-1
+3	38	-90	21	-1
+3	34	-107	1	-1
+3	35	-78	18	-1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cluster_result04.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,48 @@
+0	44	64	-76	1
+0	51	48	-73	1
+0	58	65	-49	1
+0	43	61	-49	1
+0	45	43	-79	1
+0	42	60	-98	1
+0	50	55	-59	1
+0	53	53	-56	1
+0	45	44	-61	1
+0	43	65	-84	1
+0	35	52	-75	1
+0	56	56	-70	1
+1	-61	86	43	2
+1	-67	93	15	2
+1	-59	94	36	2
+1	-50	92	62	2
+1	-78	91	70	2
+1	-35	87	47	2
+1	-56	91	52	2
+1	-61	81	46	2
+1	-83	78	34	2
+1	-50	87	45	2
+1	-67	73	50	2
+1	-50	97	45	2
+1	-61	111	45	2
+2	-109	23	-92	3
+2	-94	20	-96	3
+2	-85	26	-88	3
+2	-90	33	-114	3
+2	-63	9	-106	3
+2	-79	9	-93	3
+2	-99	26	-108	3
+2	-81	19	-110	3
+2	-108	21	-108	3
+2	-92	27	-106	3
+2	-88	2	-106	3
+2	-88	15	-103	3
+3	54	-74	4	0
+3	42	-92	31	0
+3	39	-99	-7	0
+3	48	-115	-5	0
+3	39	-96	2	0
+3	31	-109	9	0
+3	33	-96	-8	0
+3	23	-102	4	0
+3	38	-90	21	0
+3	34	-107	1	0
+3	35	-78	18	0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cluster_result05.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,48 @@
+0	44	64	-76	0
+0	51	48	-73	0
+0	58	65	-49	0
+0	43	61	-49	0
+0	45	43	-79	0
+0	42	60	-98	0
+0	50	55	-59	0
+0	53	53	-56	0
+0	45	44	-61	0
+0	43	65	-84	0
+0	35	52	-75	0
+0	56	56	-70	0
+1	-61	86	43	2
+1	-67	93	15	2
+1	-59	94	36	2
+1	-50	92	62	2
+1	-78	91	70	2
+1	-35	87	47	2
+1	-56	91	52	2
+1	-61	81	46	2
+1	-83	78	34	2
+1	-50	87	45	2
+1	-67	73	50	2
+1	-50	97	45	2
+1	-61	111	45	2
+2	-109	23	-92	0
+2	-94	20	-96	0
+2	-85	26	-88	0
+2	-90	33	-114	0
+2	-63	9	-106	0
+2	-79	9	-93	0
+2	-99	26	-108	0
+2	-81	19	-110	0
+2	-108	21	-108	0
+2	-92	27	-106	0
+2	-88	2	-106	0
+2	-88	15	-103	0
+3	54	-74	4	1
+3	42	-92	31	1
+3	39	-99	-7	1
+3	48	-115	-5	1
+3	39	-96	2	1
+3	31	-109	9	1
+3	33	-96	-8	1
+3	23	-102	4	1
+3	38	-90	21	1
+3	34	-107	1	1
+3	35	-78	18	1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cluster_result06.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,48 @@
+0	44	64	-76	0
+0	51	48	-73	0
+0	58	65	-49	0
+0	43	61	-49	0
+0	45	43	-79	0
+0	42	60	-98	0
+0	50	55	-59	0
+0	53	53	-56	0
+0	45	44	-61	0
+0	43	65	-84	0
+0	35	52	-75	0
+0	56	56	-70	0
+1	-61	86	43	1
+1	-67	93	15	1
+1	-59	94	36	1
+1	-50	92	62	1
+1	-78	91	70	1
+1	-35	87	47	1
+1	-56	91	52	1
+1	-61	81	46	1
+1	-83	78	34	1
+1	-50	87	45	1
+1	-67	73	50	1
+1	-50	97	45	1
+1	-61	111	45	1
+2	-109	23	-92	2
+2	-94	20	-96	2
+2	-85	26	-88	2
+2	-90	33	-114	2
+2	-63	9	-106	2
+2	-79	9	-93	2
+2	-99	26	-108	2
+2	-81	19	-110	2
+2	-108	21	-108	2
+2	-92	27	-106	2
+2	-88	2	-106	2
+2	-88	15	-103	2
+3	54	-74	4	3
+3	42	-92	31	3
+3	39	-99	-7	3
+3	48	-115	-5	3
+3	39	-96	2	3
+3	31	-109	9	3
+3	33	-96	-8	3
+3	23	-102	4	3
+3	38	-90	21	3
+3	34	-107	1	3
+3	35	-78	18	3
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cluster_result07.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,48 @@
+0	44	64	-76	0
+0	51	48	-73	0
+0	58	65	-49	0
+0	43	61	-49	0
+0	45	43	-79	0
+0	42	60	-98	0
+0	50	55	-59	0
+0	53	53	-56	0
+0	45	44	-61	0
+0	43	65	-84	0
+0	35	52	-75	0
+0	56	56	-70	0
+1	-61	86	43	1
+1	-67	93	15	1
+1	-59	94	36	1
+1	-50	92	62	1
+1	-78	91	70	1
+1	-35	87	47	1
+1	-56	91	52	1
+1	-61	81	46	1
+1	-83	78	34	1
+1	-50	87	45	1
+1	-67	73	50	1
+1	-50	97	45	1
+1	-61	111	45	1
+2	-109	23	-92	2
+2	-94	20	-96	2
+2	-85	26	-88	2
+2	-90	33	-114	2
+2	-63	9	-106	2
+2	-79	9	-93	2
+2	-99	26	-108	2
+2	-81	19	-110	2
+2	-108	21	-108	2
+2	-92	27	-106	2
+2	-88	2	-106	2
+2	-88	15	-103	2
+3	54	-74	4	3
+3	42	-92	31	3
+3	39	-99	-7	3
+3	48	-115	-5	3
+3	39	-96	2	3
+3	31	-109	9	3
+3	33	-96	-8	3
+3	23	-102	4	3
+3	38	-90	21	3
+3	34	-107	1	3
+3	35	-78	18	3
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cluster_result08.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,48 @@
+0	44	64	-76	0
+0	51	48	-73	0
+0	58	65	-49	0
+0	43	61	-49	0
+0	45	43	-79	0
+0	42	60	-98	0
+0	50	55	-59	0
+0	53	53	-56	0
+0	45	44	-61	0
+0	43	65	-84	0
+0	35	52	-75	0
+0	56	56	-70	0
+1	-61	86	43	0
+1	-67	93	15	0
+1	-59	94	36	0
+1	-50	92	62	0
+1	-78	91	70	0
+1	-35	87	47	0
+1	-56	91	52	0
+1	-61	81	46	0
+1	-83	78	34	0
+1	-50	87	45	0
+1	-67	73	50	0
+1	-50	97	45	0
+1	-61	111	45	0
+2	-109	23	-92	0
+2	-94	20	-96	0
+2	-85	26	-88	0
+2	-90	33	-114	0
+2	-63	9	-106	0
+2	-79	9	-93	0
+2	-99	26	-108	0
+2	-81	19	-110	0
+2	-108	21	-108	0
+2	-92	27	-106	0
+2	-88	2	-106	0
+2	-88	15	-103	0
+3	54	-74	4	1
+3	42	-92	31	1
+3	39	-99	-7	1
+3	48	-115	-5	1
+3	39	-96	2	1
+3	31	-109	9	1
+3	33	-96	-8	1
+3	23	-102	4	1
+3	38	-90	21	1
+3	34	-107	1	1
+3	35	-78	18	1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cluster_result09.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,48 @@
+0	44	64	-76	0
+0	51	48	-73	0
+0	58	65	-49	0
+0	43	61	-49	0
+0	45	43	-79	0
+0	42	60	-98	0
+0	50	55	-59	0
+0	53	53	-56	0
+0	45	44	-61	0
+0	43	65	-84	0
+0	35	52	-75	0
+0	56	56	-70	0
+1	-61	86	43	0
+1	-67	93	15	0
+1	-59	94	36	0
+1	-50	92	62	0
+1	-78	91	70	0
+1	-35	87	47	0
+1	-56	91	52	0
+1	-61	81	46	0
+1	-83	78	34	0
+1	-50	87	45	0
+1	-67	73	50	0
+1	-50	97	45	0
+1	-61	111	45	0
+2	-109	23	-92	0
+2	-94	20	-96	0
+2	-85	26	-88	0
+2	-90	33	-114	0
+2	-63	9	-106	0
+2	-79	9	-93	0
+2	-99	26	-108	0
+2	-81	19	-110	0
+2	-108	21	-108	0
+2	-92	27	-106	0
+2	-88	2	-106	0
+2	-88	15	-103	0
+3	54	-74	4	1
+3	42	-92	31	1
+3	39	-99	-7	1
+3	48	-115	-5	1
+3	39	-96	2	1
+3	31	-109	9	1
+3	33	-96	-8	1
+3	23	-102	4	1
+3	38	-90	21	1
+3	34	-107	1	1
+3	35	-78	18	1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cluster_result10.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,48 @@
+0	44	64	-76	3
+0	51	48	-73	3
+0	58	65	-49	3
+0	43	61	-49	3
+0	45	43	-79	3
+0	42	60	-98	3
+0	50	55	-59	3
+0	53	53	-56	3
+0	45	44	-61	3
+0	43	65	-84	3
+0	35	52	-75	3
+0	56	56	-70	3
+1	-61	86	43	0
+1	-67	93	15	0
+1	-59	94	36	0
+1	-50	92	62	0
+1	-78	91	70	0
+1	-35	87	47	0
+1	-56	91	52	0
+1	-61	81	46	0
+1	-83	78	34	0
+1	-50	87	45	0
+1	-67	73	50	0
+1	-50	97	45	0
+1	-61	111	45	0
+2	-109	23	-92	2
+2	-94	20	-96	2
+2	-85	26	-88	2
+2	-90	33	-114	2
+2	-63	9	-106	2
+2	-79	9	-93	2
+2	-99	26	-108	2
+2	-81	19	-110	2
+2	-108	21	-108	2
+2	-92	27	-106	2
+2	-88	2	-106	2
+2	-88	15	-103	2
+3	54	-74	4	1
+3	42	-92	31	1
+3	39	-99	-7	1
+3	48	-115	-5	1
+3	39	-96	2	1
+3	31	-109	9	1
+3	33	-96	-8	1
+3	23	-102	4	1
+3	38	-90	21	1
+3	34	-107	1	1
+3	35	-78	18	1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cluster_result11.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,48 @@
+0	44	64	-76	2
+0	51	48	-73	2
+0	58	65	-49	2
+0	43	61	-49	2
+0	45	43	-79	2
+0	42	60	-98	2
+0	50	55	-59	2
+0	53	53	-56	2
+0	45	44	-61	2
+0	43	65	-84	2
+0	35	52	-75	2
+0	56	56	-70	2
+1	-61	86	43	0
+1	-67	93	15	0
+1	-59	94	36	0
+1	-50	92	62	0
+1	-78	91	70	0
+1	-35	87	47	0
+1	-56	91	52	0
+1	-61	81	46	0
+1	-83	78	34	0
+1	-50	87	45	0
+1	-67	73	50	0
+1	-50	97	45	0
+1	-61	111	45	0
+2	-109	23	-92	1
+2	-94	20	-96	1
+2	-85	26	-88	1
+2	-90	33	-114	1
+2	-63	9	-106	1
+2	-79	9	-93	1
+2	-99	26	-108	1
+2	-81	19	-110	1
+2	-108	21	-108	1
+2	-92	27	-106	1
+2	-88	2	-106	1
+2	-88	15	-103	1
+3	54	-74	4	3
+3	42	-92	31	3
+3	39	-99	-7	3
+3	48	-115	-5	3
+3	39	-96	2	3
+3	31	-109	9	3
+3	33	-96	-8	3
+3	23	-102	4	3
+3	38	-90	21	3
+3	34	-107	1	3
+3	35	-78	18	3
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cluster_result12	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,48 @@
+0	44	64	-76	3
+0	51	48	-73	3
+0	58	65	-49	3
+0	43	61	-49	1
+0	45	43	-79	3
+0	42	60	-98	0
+0	50	55	-59	2
+0	53	53	-56	2
+0	45	44	-61	2
+0	43	65	-84	3
+0	35	52	-75	1
+0	56	56	-70	3
+1	-61	86	43	0
+1	-67	93	15	3
+1	-59	94	36	0
+1	-50	92	62	2
+1	-78	91	70	2
+1	-35	87	47	3
+1	-56	91	52	2
+1	-61	81	46	0
+1	-83	78	34	2
+1	-50	87	45	2
+1	-67	73	50	2
+1	-50	97	45	2
+1	-61	111	45	0
+2	-109	23	-92	0
+2	-94	20	-96	0
+2	-85	26	-88	0
+2	-90	33	-114	0
+2	-63	9	-106	2
+2	-79	9	-93	2
+2	-99	26	-108	0
+2	-81	19	-110	0
+2	-108	21	-108	0
+2	-92	27	-106	0
+2	-88	2	-106	0
+2	-88	15	-103	0
+3	54	-74	4	1
+3	42	-92	31	0
+3	39	-99	-7	2
+3	48	-115	-5	2
+3	39	-96	2	2
+3	31	-109	9	1
+3	33	-96	-8	2
+3	23	-102	4	1
+3	38	-90	21	0
+3	34	-107	1	1
+3	35	-78	18	0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cluster_result12.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,48 @@
+0	44	64	-76	1
+0	51	48	-73	1
+0	58	65	-49	1
+0	43	61	-49	0
+0	45	43	-79	1
+0	42	60	-98	1
+0	50	55	-59	1
+0	53	53	-56	1
+0	45	44	-61	0
+0	43	65	-84	1
+0	35	52	-75	1
+0	56	56	-70	1
+1	-61	86	43	2
+1	-67	93	15	1
+1	-59	94	36	1
+1	-50	92	62	0
+1	-78	91	70	1
+1	-35	87	47	1
+1	-56	91	52	0
+1	-61	81	46	2
+1	-83	78	34	1
+1	-50	87	45	0
+1	-67	73	50	1
+1	-50	97	45	0
+1	-61	111	45	1
+2	-109	23	-92	0
+2	-94	20	-96	3
+2	-85	26	-88	3
+2	-90	33	-114	3
+2	-63	9	-106	0
+2	-79	9	-93	1
+2	-99	26	-108	3
+2	-81	19	-110	3
+2	-108	21	-108	3
+2	-92	27	-106	3
+2	-88	2	-106	0
+2	-88	15	-103	3
+3	54	-74	4	1
+3	42	-92	31	3
+3	39	-99	-7	3
+3	48	-115	-5	1
+3	39	-96	2	3
+3	31	-109	9	3
+3	33	-96	-8	3
+3	23	-102	4	3
+3	38	-90	21	3
+3	34	-107	1	3
+3	35	-78	18	3
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cluster_result13.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,48 @@
+0	44	64	-76	4
+0	51	48	-73	0
+0	58	65	-49	0
+0	43	61	-49	1
+0	45	43	-79	0
+0	42	60	-98	0
+0	50	55	-59	2
+0	53	53	-56	2
+0	45	44	-61	0
+0	43	65	-84	4
+0	35	52	-75	1
+0	56	56	-70	0
+1	-61	86	43	0
+1	-67	93	15	0
+1	-59	94	36	0
+1	-50	92	62	0
+1	-78	91	70	1
+1	-35	87	47	0
+1	-56	91	52	0
+1	-61	81	46	0
+1	-83	78	34	0
+1	-50	87	45	0
+1	-67	73	50	1
+1	-50	97	45	0
+1	-61	111	45	0
+2	-109	23	-92	0
+2	-94	20	-96	0
+2	-85	26	-88	0
+2	-90	33	-114	1
+2	-63	9	-106	0
+2	-79	9	-93	1
+2	-99	26	-108	3
+2	-81	19	-110	0
+2	-108	21	-108	0
+2	-92	27	-106	3
+2	-88	2	-106	1
+2	-88	15	-103	0
+3	54	-74	4	0
+3	42	-92	31	1
+3	39	-99	-7	1
+3	48	-115	-5	1
+3	39	-96	2	1
+3	31	-109	9	1
+3	33	-96	-8	1
+3	23	-102	4	0
+3	38	-90	21	1
+3	34	-107	1	1
+3	35	-78	18	1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cluster_result14.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,48 @@
+0	44	64	-76	2
+0	51	48	-73	2
+0	58	65	-49	5
+0	43	61	-49	5
+0	45	43	-79	2
+0	42	60	-98	2
+0	50	55	-59	5
+0	53	53	-56	5
+0	45	44	-61	2
+0	43	65	-84	2
+0	35	52	-75	2
+0	56	56	-70	2
+1	-61	86	43	1
+1	-67	93	15	1
+1	-59	94	36	1
+1	-50	92	62	1
+1	-78	91	70	7
+1	-35	87	47	1
+1	-56	91	52	1
+1	-61	81	46	7
+1	-83	78	34	7
+1	-50	87	45	1
+1	-67	73	50	7
+1	-50	97	45	1
+1	-61	111	45	1
+2	-109	23	-92	6
+2	-94	20	-96	6
+2	-85	26	-88	6
+2	-90	33	-114	6
+2	-63	9	-106	3
+2	-79	9	-93	3
+2	-99	26	-108	6
+2	-81	19	-110	6
+2	-108	21	-108	6
+2	-92	27	-106	6
+2	-88	2	-106	3
+2	-88	15	-103	6
+3	54	-74	4	4
+3	42	-92	31	4
+3	39	-99	-7	0
+3	48	-115	-5	0
+3	39	-96	2	0
+3	31	-109	9	0
+3	33	-96	-8	0
+3	23	-102	4	0
+3	38	-90	21	4
+3	34	-107	1	0
+3	35	-78	18	4
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cluster_result15.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,48 @@
+0	44	64	-76	1
+0	51	48	-73	1
+0	58	65	-49	1
+0	43	61	-49	1
+0	45	43	-79	1
+0	42	60	-98	1
+0	50	55	-59	1
+0	53	53	-56	1
+0	45	44	-61	1
+0	43	65	-84	1
+0	35	52	-75	1
+0	56	56	-70	1
+1	-61	86	43	2
+1	-67	93	15	2
+1	-59	94	36	2
+1	-50	92	62	2
+1	-78	91	70	2
+1	-35	87	47	2
+1	-56	91	52	2
+1	-61	81	46	2
+1	-83	78	34	2
+1	-50	87	45	2
+1	-67	73	50	2
+1	-50	97	45	2
+1	-61	111	45	2
+2	-109	23	-92	3
+2	-94	20	-96	3
+2	-85	26	-88	3
+2	-90	33	-114	3
+2	-63	9	-106	3
+2	-79	9	-93	3
+2	-99	26	-108	3
+2	-81	19	-110	3
+2	-108	21	-108	3
+2	-92	27	-106	3
+2	-88	2	-106	3
+2	-88	15	-103	3
+3	54	-74	4	0
+3	42	-92	31	0
+3	39	-99	-7	0
+3	48	-115	-5	0
+3	39	-96	2	0
+3	31	-109	9	0
+3	33	-96	-8	0
+3	23	-102	4	0
+3	38	-90	21	0
+3	34	-107	1	0
+3	35	-78	18	0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cluster_result16.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,48 @@
+0	44	64	-76	0
+0	51	48	-73	0
+0	58	65	-49	0
+0	43	61	-49	0
+0	45	43	-79	0
+0	42	60	-98	0
+0	50	55	-59	0
+0	53	53	-56	0
+0	45	44	-61	0
+0	43	65	-84	0
+0	35	52	-75	0
+0	56	56	-70	0
+1	-61	86	43	2
+1	-67	93	15	2
+1	-59	94	36	2
+1	-50	92	62	2
+1	-78	91	70	2
+1	-35	87	47	2
+1	-56	91	52	2
+1	-61	81	46	2
+1	-83	78	34	2
+1	-50	87	45	2
+1	-67	73	50	2
+1	-50	97	45	2
+1	-61	111	45	2
+2	-109	23	-92	3
+2	-94	20	-96	3
+2	-85	26	-88	3
+2	-90	33	-114	3
+2	-63	9	-106	3
+2	-79	9	-93	3
+2	-99	26	-108	3
+2	-81	19	-110	3
+2	-108	21	-108	3
+2	-92	27	-106	3
+2	-88	2	-106	3
+2	-88	15	-103	3
+3	54	-74	4	1
+3	42	-92	31	1
+3	39	-99	-7	1
+3	48	-115	-5	1
+3	39	-96	2	1
+3	31	-109	9	1
+3	33	-96	-8	1
+3	23	-102	4	1
+3	38	-90	21	1
+3	34	-107	1	1
+3	35	-78	18	1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cluster_result17.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,4 @@
+0
+1
+0
+0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cluster_result18.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,4 @@
+-1
+-1
+-1
+-1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cluster_result19.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,4 @@
+0
+1
+0
+0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cluster_result20.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,4 @@
+0
+1
+0
+0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cluster_result21.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,4 @@
+0
+1
+0
+0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/confusion_matrix.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,4 @@
+confusion_matrix : 
+[[14  0  0]
+ [ 0 10  6]
+ [ 0  0  9]]
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/converter_result01.json	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,2 @@
+{"directed": false, "graph": {"info": "RNAfold", "id": "CP000097.1/1411351-1411410", "structure": "....((((.((((((....)))))).)..)))...(((((((..(...)..)).))))).", "sequence": "CAACGUUCACCUCACAUUUGUGAGGCGCAGACAACCCAGGCCAAGGAACGGGGACCUGGA"}, "nodes": [{"position": 0, "id": 0, "label": "C"}, {"position": 1, "id": 1, "label": "A"}, {"position": 2, "id": 2, "label": "A"}, {"position": 3, "id": 3, "label": "C"}, {"position": 4, "id": 4, "label": "G"}, {"position": 5, "id": 5, "label": "U"}, {"position": 6, "id": 6, "label": "U"}, {"position": 7, "id": 7, "label": "C"}, {"position": 8, "id": 8, "label": "A"}, {"position": 9, "id": 9, "label": "C"}, {"position": 10, "id": 10, "label": "C"}, {"position": 11, "id": 11, "label": "U"}, {"position": 12, "id": 12, "label": "C"}, {"position": 13, "id": 13, "label": "A"}, {"position": 14, "id": 14, "label": "C"}, {"position": 15, "id": 15, "label": "A"}, {"position": 16, "id": 16, "label": "U"}, {"position": 17, "id": 17, "label": "U"}, {"position": 18, "id": 18, "label": "U"}, {"position": 19, "id": 19, "label": "G"}, {"position": 20, "id": 20, "label": "U"}, {"position": 21, "id": 21, "label": "G"}, {"position": 22, "id": 22, "label": "A"}, {"position": 23, "id": 23, "label": "G"}, {"position": 24, "id": 24, "label": "G"}, {"position": 25, "id": 25, "label": "C"}, {"position": 26, "id": 26, "label": "G"}, {"position": 27, "id": 27, "label": "C"}, {"position": 28, "id": 28, "label": "A"}, {"position": 29, "id": 29, "label": "G"}, {"position": 30, "id": 30, "label": "A"}, {"position": 31, "id": 31, "label": "C"}, {"position": 32, "id": 32, "label": "A"}, {"position": 33, "id": 33, "label": "A"}, {"position": 34, "id": 34, "label": "C"}, {"position": 35, "id": 35, "label": "C"}, {"position": 36, "id": 36, "label": "C"}, {"position": 37, "id": 37, "label": "A"}, {"position": 38, "id": 38, "label": "G"}, {"position": 39, "id": 39, "label": "G"}, {"position": 40, "id": 40, "label": "C"}, {"position": 41, "id": 41, "label": "C"}, {"position": 42, "id": 42, "label": "A"}, {"position": 43, "id": 43, "label": "A"}, {"position": 44, "id": 44, "label": "G"}, {"position": 45, "id": 45, "label": "G"}, {"position": 46, "id": 46, "label": "A"}, {"position": 47, "id": 47, "label": "A"}, {"position": 48, "id": 48, "label": "C"}, {"position": 49, "id": 49, "label": "G"}, {"position": 50, "id": 50, "label": "G"}, {"position": 51, "id": 51, "label": "G"}, {"position": 52, "id": 52, "label": "G"}, {"position": 53, "id": 53, "label": "A"}, {"position": 54, "id": 54, "label": "C"}, {"position": 55, "id": 55, "label": "C"}, {"position": 56, "id": 56, "label": "U"}, {"position": 57, "id": 57, "label": "G"}, {"position": 58, "id": 58, "label": "G"}, {"position": 59, "id": 59, "label": "A"}], "links": [{"source": 0, "type": "backbone", "target": 1, "len": 1, "label": "-"}, {"source": 1, "type": "backbone", "target": 2, "len": 1, "label": "-"}, {"source": 2, "type": "backbone", "target": 3, "len": 1, "label": "-"}, {"source": 3, "type": "backbone", "target": 4, "len": 1, "label": "-"}, {"source": 4, "type": "backbone", "target": 5, "len": 1, "label": "-"}, {"source": 4, "type": "basepair", "target": 31, "len": 1, "label": "="}, {"source": 5, "type": "basepair", "target": 30, "len": 1, "label": "="}, {"source": 5, "type": "backbone", "target": 6, "len": 1, "label": "-"}, {"source": 6, "type": "basepair", "target": 29, "len": 1, "label": "="}, {"source": 6, "type": "backbone", "target": 7, "len": 1, "label": "-"}, {"source": 7, "type": "backbone", "target": 8, "len": 1, "label": "-"}, {"source": 7, "type": "basepair", "target": 26, "len": 1, "label": "="}, {"source": 8, "type": "backbone", "target": 9, "len": 1, "label": "-"}, {"source": 9, "type": "basepair", "target": 24, "len": 1, "label": "="}, {"source": 9, "type": "backbone", "target": 10, "len": 1, "label": "-"}, {"source": 10, "type": "backbone", "target": 11, "len": 1, "label": "-"}, {"source": 10, "type": "basepair", "target": 23, "len": 1, "label": "="}, {"source": 11, "type": "backbone", "target": 12, "len": 1, "label": "-"}, {"source": 11, "type": "basepair", "target": 22, "len": 1, "label": "="}, {"source": 12, "type": "backbone", "target": 13, "len": 1, "label": "-"}, {"source": 12, "type": "basepair", "target": 21, "len": 1, "label": "="}, {"source": 13, "type": "basepair", "target": 20, "len": 1, "label": "="}, {"source": 13, "type": "backbone", "target": 14, "len": 1, "label": "-"}, {"source": 14, "type": "basepair", "target": 19, "len": 1, "label": "="}, {"source": 14, "type": "backbone", "target": 15, "len": 1, "label": "-"}, {"source": 15, "type": "backbone", "target": 16, "len": 1, "label": "-"}, {"source": 16, "type": "backbone", "target": 17, "len": 1, "label": "-"}, {"source": 17, "type": "backbone", "target": 18, "len": 1, "label": "-"}, {"source": 18, "type": "backbone", "target": 19, "len": 1, "label": "-"}, {"source": 19, "type": "backbone", "target": 20, "len": 1, "label": "-"}, {"source": 20, "type": "backbone", "target": 21, "len": 1, "label": "-"}, {"source": 21, "type": "backbone", "target": 22, "len": 1, "label": "-"}, {"source": 22, "type": "backbone", "target": 23, "len": 1, "label": "-"}, {"source": 23, "type": "backbone", "target": 24, "len": 1, "label": "-"}, {"source": 24, "type": "backbone", "target": 25, "len": 1, "label": "-"}, {"source": 25, "type": "backbone", "target": 26, "len": 1, "label": "-"}, {"source": 26, "type": "backbone", "target": 27, "len": 1, "label": "-"}, {"source": 27, "type": "backbone", "target": 28, "len": 1, "label": "-"}, {"source": 28, "type": "backbone", "target": 29, "len": 1, "label": "-"}, {"source": 29, "type": "backbone", "target": 30, "len": 1, "label": "-"}, {"source": 30, "type": "backbone", "target": 31, "len": 1, "label": "-"}, {"source": 31, "type": "backbone", "target": 32, "len": 1, "label": "-"}, {"source": 32, "type": "backbone", "target": 33, "len": 1, "label": "-"}, {"source": 33, "type": "backbone", "target": 34, "len": 1, "label": "-"}, {"source": 34, "type": "backbone", "target": 35, "len": 1, "label": "-"}, {"source": 35, "type": "backbone", "target": 36, "len": 1, "label": "-"}, {"source": 35, "type": "basepair", "target": 58, "len": 1, "label": "="}, {"source": 36, "type": "basepair", "target": 57, "len": 1, "label": "="}, {"source": 36, "type": "backbone", "target": 37, "len": 1, "label": "-"}, {"source": 37, "type": "basepair", "target": 56, "len": 1, "label": "="}, {"source": 37, "type": "backbone", "target": 38, "len": 1, "label": "-"}, {"source": 38, "type": "basepair", "target": 55, "len": 1, "label": "="}, {"source": 38, "type": "backbone", "target": 39, "len": 1, "label": "-"}, {"source": 39, "type": "backbone", "target": 40, "len": 1, "label": "-"}, {"source": 39, "type": "basepair", "target": 54, "len": 1, "label": "="}, {"source": 40, "type": "backbone", "target": 41, "len": 1, "label": "-"}, {"source": 40, "type": "basepair", "target": 52, "len": 1, "label": "="}, {"source": 41, "type": "backbone", "target": 42, "len": 1, "label": "-"}, {"source": 41, "type": "basepair", "target": 51, "len": 1, "label": "="}, {"source": 42, "type": "backbone", "target": 43, "len": 1, "label": "-"}, {"source": 43, "type": "backbone", "target": 44, "len": 1, "label": "-"}, {"source": 44, "type": "basepair", "target": 48, "len": 1, "label": "="}, {"source": 44, "type": "backbone", "target": 45, "len": 1, "label": "-"}, {"source": 45, "type": "backbone", "target": 46, "len": 1, "label": "-"}, {"source": 46, "type": "backbone", "target": 47, "len": 1, "label": "-"}, {"source": 47, "type": "backbone", "target": 48, "len": 1, "label": "-"}, {"source": 48, "type": "backbone", "target": 49, "len": 1, "label": "-"}, {"source": 49, "type": "backbone", "target": 50, "len": 1, "label": "-"}, {"source": 50, "type": "backbone", "target": 51, "len": 1, "label": "-"}, {"source": 51, "type": "backbone", "target": 52, "len": 1, "label": "-"}, {"source": 52, "type": "backbone", "target": 53, "len": 1, "label": "-"}, {"source": 53, "type": "backbone", "target": 54, "len": 1, "label": "-"}, {"source": 54, "type": "backbone", "target": 55, "len": 1, "label": "-"}, {"source": 55, "type": "backbone", "target": 56, "len": 1, "label": "-"}, {"source": 56, "type": "backbone", "target": 57, "len": 1, "label": "-"}, {"source": 57, "type": "backbone", "target": 58, "len": 1, "label": "-"}, {"source": 58, "type": "backbone", "target": 59, "len": 1, "label": "-"}], "multigraph": false}
+{"directed": false, "graph": {"info": "RNAfold", "id": "ACNY01000002.1/278641-278580", "structure": "((.(...(.((((((.....)))))).)..).))..((((((((.........)).))))))", "sequence": "GAUCGUUCACUUCGCAUCGCGCGAAGCGCAGUUCGCCUCAGGCCAUGGAACGGGGACCUGAG"}, "nodes": [{"position": 0, "id": 0, "label": "G"}, {"position": 1, "id": 1, "label": "A"}, {"position": 2, "id": 2, "label": "U"}, {"position": 3, "id": 3, "label": "C"}, {"position": 4, "id": 4, "label": "G"}, {"position": 5, "id": 5, "label": "U"}, {"position": 6, "id": 6, "label": "U"}, {"position": 7, "id": 7, "label": "C"}, {"position": 8, "id": 8, "label": "A"}, {"position": 9, "id": 9, "label": "C"}, {"position": 10, "id": 10, "label": "U"}, {"position": 11, "id": 11, "label": "U"}, {"position": 12, "id": 12, "label": "C"}, {"position": 13, "id": 13, "label": "G"}, {"position": 14, "id": 14, "label": "C"}, {"position": 15, "id": 15, "label": "A"}, {"position": 16, "id": 16, "label": "U"}, {"position": 17, "id": 17, "label": "C"}, {"position": 18, "id": 18, "label": "G"}, {"position": 19, "id": 19, "label": "C"}, {"position": 20, "id": 20, "label": "G"}, {"position": 21, "id": 21, "label": "C"}, {"position": 22, "id": 22, "label": "G"}, {"position": 23, "id": 23, "label": "A"}, {"position": 24, "id": 24, "label": "A"}, {"position": 25, "id": 25, "label": "G"}, {"position": 26, "id": 26, "label": "C"}, {"position": 27, "id": 27, "label": "G"}, {"position": 28, "id": 28, "label": "C"}, {"position": 29, "id": 29, "label": "A"}, {"position": 30, "id": 30, "label": "G"}, {"position": 31, "id": 31, "label": "U"}, {"position": 32, "id": 32, "label": "U"}, {"position": 33, "id": 33, "label": "C"}, {"position": 34, "id": 34, "label": "G"}, {"position": 35, "id": 35, "label": "C"}, {"position": 36, "id": 36, "label": "C"}, {"position": 37, "id": 37, "label": "U"}, {"position": 38, "id": 38, "label": "C"}, {"position": 39, "id": 39, "label": "A"}, {"position": 40, "id": 40, "label": "G"}, {"position": 41, "id": 41, "label": "G"}, {"position": 42, "id": 42, "label": "C"}, {"position": 43, "id": 43, "label": "C"}, {"position": 44, "id": 44, "label": "A"}, {"position": 45, "id": 45, "label": "U"}, {"position": 46, "id": 46, "label": "G"}, {"position": 47, "id": 47, "label": "G"}, {"position": 48, "id": 48, "label": "A"}, {"position": 49, "id": 49, "label": "A"}, {"position": 50, "id": 50, "label": "C"}, {"position": 51, "id": 51, "label": "G"}, {"position": 52, "id": 52, "label": "G"}, {"position": 53, "id": 53, "label": "G"}, {"position": 54, "id": 54, "label": "G"}, {"position": 55, "id": 55, "label": "A"}, {"position": 56, "id": 56, "label": "C"}, {"position": 57, "id": 57, "label": "C"}, {"position": 58, "id": 58, "label": "U"}, {"position": 59, "id": 59, "label": "G"}, {"position": 60, "id": 60, "label": "A"}, {"position": 61, "id": 61, "label": "G"}], "links": [{"source": 0, "type": "backbone", "target": 1, "len": 1, "label": "-"}, {"source": 0, "type": "basepair", "target": 33, "len": 1, "label": "="}, {"source": 1, "type": "basepair", "target": 32, "len": 1, "label": "="}, {"source": 1, "type": "backbone", "target": 2, "len": 1, "label": "-"}, {"source": 2, "type": "backbone", "target": 3, "len": 1, "label": "-"}, {"source": 3, "type": "backbone", "target": 4, "len": 1, "label": "-"}, {"source": 3, "type": "basepair", "target": 30, "len": 1, "label": "="}, {"source": 4, "type": "backbone", "target": 5, "len": 1, "label": "-"}, {"source": 5, "type": "backbone", "target": 6, "len": 1, "label": "-"}, {"source": 6, "type": "backbone", "target": 7, "len": 1, "label": "-"}, {"source": 7, "type": "backbone", "target": 8, "len": 1, "label": "-"}, {"source": 7, "type": "basepair", "target": 27, "len": 1, "label": "="}, {"source": 8, "type": "backbone", "target": 9, "len": 1, "label": "-"}, {"source": 9, "type": "basepair", "target": 25, "len": 1, "label": "="}, {"source": 9, "type": "backbone", "target": 10, "len": 1, "label": "-"}, {"source": 10, "type": "basepair", "target": 24, "len": 1, "label": "="}, {"source": 10, "type": "backbone", "target": 11, "len": 1, "label": "-"}, {"source": 11, "type": "backbone", "target": 12, "len": 1, "label": "-"}, {"source": 11, "type": "basepair", "target": 23, "len": 1, "label": "="}, {"source": 12, "type": "backbone", "target": 13, "len": 1, "label": "-"}, {"source": 12, "type": "basepair", "target": 22, "len": 1, "label": "="}, {"source": 13, "type": "basepair", "target": 21, "len": 1, "label": "="}, {"source": 13, "type": "backbone", "target": 14, "len": 1, "label": "-"}, {"source": 14, "type": "basepair", "target": 20, "len": 1, "label": "="}, {"source": 14, "type": "backbone", "target": 15, "len": 1, "label": "-"}, {"source": 15, "type": "backbone", "target": 16, "len": 1, "label": "-"}, {"source": 16, "type": "backbone", "target": 17, "len": 1, "label": "-"}, {"source": 17, "type": "backbone", "target": 18, "len": 1, "label": "-"}, {"source": 18, "type": "backbone", "target": 19, "len": 1, "label": "-"}, {"source": 19, "type": "backbone", "target": 20, "len": 1, "label": "-"}, {"source": 20, "type": "backbone", "target": 21, "len": 1, "label": "-"}, {"source": 21, "type": "backbone", "target": 22, "len": 1, "label": "-"}, {"source": 22, "type": "backbone", "target": 23, "len": 1, "label": "-"}, {"source": 23, "type": "backbone", "target": 24, "len": 1, "label": "-"}, {"source": 24, "type": "backbone", "target": 25, "len": 1, "label": "-"}, {"source": 25, "type": "backbone", "target": 26, "len": 1, "label": "-"}, {"source": 26, "type": "backbone", "target": 27, "len": 1, "label": "-"}, {"source": 27, "type": "backbone", "target": 28, "len": 1, "label": "-"}, {"source": 28, "type": "backbone", "target": 29, "len": 1, "label": "-"}, {"source": 29, "type": "backbone", "target": 30, "len": 1, "label": "-"}, {"source": 30, "type": "backbone", "target": 31, "len": 1, "label": "-"}, {"source": 31, "type": "backbone", "target": 32, "len": 1, "label": "-"}, {"source": 32, "type": "backbone", "target": 33, "len": 1, "label": "-"}, {"source": 33, "type": "backbone", "target": 34, "len": 1, "label": "-"}, {"source": 34, "type": "backbone", "target": 35, "len": 1, "label": "-"}, {"source": 35, "type": "backbone", "target": 36, "len": 1, "label": "-"}, {"source": 36, "type": "backbone", "target": 37, "len": 1, "label": "-"}, {"source": 36, "type": "basepair", "target": 61, "len": 1, "label": "="}, {"source": 37, "type": "basepair", "target": 60, "len": 1, "label": "="}, {"source": 37, "type": "backbone", "target": 38, "len": 1, "label": "-"}, {"source": 38, "type": "basepair", "target": 59, "len": 1, "label": "="}, {"source": 38, "type": "backbone", "target": 39, "len": 1, "label": "-"}, {"source": 39, "type": "backbone", "target": 40, "len": 1, "label": "-"}, {"source": 39, "type": "basepair", "target": 58, "len": 1, "label": "="}, {"source": 40, "type": "backbone", "target": 41, "len": 1, "label": "-"}, {"source": 40, "type": "basepair", "target": 57, "len": 1, "label": "="}, {"source": 41, "type": "basepair", "target": 56, "len": 1, "label": "="}, {"source": 41, "type": "backbone", "target": 42, "len": 1, "label": "-"}, {"source": 42, "type": "backbone", "target": 43, "len": 1, "label": "-"}, {"source": 42, "type": "basepair", "target": 54, "len": 1, "label": "="}, {"source": 43, "type": "backbone", "target": 44, "len": 1, "label": "-"}, {"source": 43, "type": "basepair", "target": 53, "len": 1, "label": "="}, {"source": 44, "type": "backbone", "target": 45, "len": 1, "label": "-"}, {"source": 45, "type": "backbone", "target": 46, "len": 1, "label": "-"}, {"source": 46, "type": "backbone", "target": 47, "len": 1, "label": "-"}, {"source": 47, "type": "backbone", "target": 48, "len": 1, "label": "-"}, {"source": 48, "type": "backbone", "target": 49, "len": 1, "label": "-"}, {"source": 49, "type": "backbone", "target": 50, "len": 1, "label": "-"}, {"source": 50, "type": "backbone", "target": 51, "len": 1, "label": "-"}, {"source": 51, "type": "backbone", "target": 52, "len": 1, "label": "-"}, {"source": 52, "type": "backbone", "target": 53, "len": 1, "label": "-"}, {"source": 53, "type": "backbone", "target": 54, "len": 1, "label": "-"}, {"source": 54, "type": "backbone", "target": 55, "len": 1, "label": "-"}, {"source": 55, "type": "backbone", "target": 56, "len": 1, "label": "-"}, {"source": 56, "type": "backbone", "target": 57, "len": 1, "label": "-"}, {"source": 57, "type": "backbone", "target": 58, "len": 1, "label": "-"}, {"source": 58, "type": "backbone", "target": 59, "len": 1, "label": "-"}, {"source": 59, "type": "backbone", "target": 60, "len": 1, "label": "-"}, {"source": 60, "type": "backbone", "target": 61, "len": 1, "label": "-"}], "multigraph": false}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/converter_result02.json	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,4 @@
+{"directed": false, "graph": {"info": "RNAshapes shape_type=2 energy_range=4 max_num=3", "id": "CP000097.1/1411351-1411410_[_[]_][[]_]", "structure": "....(((..((((((....))))))....)))...(((((((.........)).))))).", "sequence": "CAACGUUCACCUCACAUUUGUGAGGCGCAGACAACCCAGGCCAAGGAACGGGGACCUGGA"}, "nodes": [{"position": 0, "id": 0, "label": "C"}, {"position": 1, "id": 1, "label": "A"}, {"position": 2, "id": 2, "label": "A"}, {"position": 3, "id": 3, "label": "C"}, {"position": 4, "id": 4, "label": "G"}, {"position": 5, "id": 5, "label": "U"}, {"position": 6, "id": 6, "label": "U"}, {"position": 7, "id": 7, "label": "C"}, {"position": 8, "id": 8, "label": "A"}, {"position": 9, "id": 9, "label": "C"}, {"position": 10, "id": 10, "label": "C"}, {"position": 11, "id": 11, "label": "U"}, {"position": 12, "id": 12, "label": "C"}, {"position": 13, "id": 13, "label": "A"}, {"position": 14, "id": 14, "label": "C"}, {"position": 15, "id": 15, "label": "A"}, {"position": 16, "id": 16, "label": "U"}, {"position": 17, "id": 17, "label": "U"}, {"position": 18, "id": 18, "label": "U"}, {"position": 19, "id": 19, "label": "G"}, {"position": 20, "id": 20, "label": "U"}, {"position": 21, "id": 21, "label": "G"}, {"position": 22, "id": 22, "label": "A"}, {"position": 23, "id": 23, "label": "G"}, {"position": 24, "id": 24, "label": "G"}, {"position": 25, "id": 25, "label": "C"}, {"position": 26, "id": 26, "label": "G"}, {"position": 27, "id": 27, "label": "C"}, {"position": 28, "id": 28, "label": "A"}, {"position": 29, "id": 29, "label": "G"}, {"position": 30, "id": 30, "label": "A"}, {"position": 31, "id": 31, "label": "C"}, {"position": 32, "id": 32, "label": "A"}, {"position": 33, "id": 33, "label": "A"}, {"position": 34, "id": 34, "label": "C"}, {"position": 35, "id": 35, "label": "C"}, {"position": 36, "id": 36, "label": "C"}, {"position": 37, "id": 37, "label": "A"}, {"position": 38, "id": 38, "label": "G"}, {"position": 39, "id": 39, "label": "G"}, {"position": 40, "id": 40, "label": "C"}, {"position": 41, "id": 41, "label": "C"}, {"position": 42, "id": 42, "label": "A"}, {"position": 43, "id": 43, "label": "A"}, {"position": 44, "id": 44, "label": "G"}, {"position": 45, "id": 45, "label": "G"}, {"position": 46, "id": 46, "label": "A"}, {"position": 47, "id": 47, "label": "A"}, {"position": 48, "id": 48, "label": "C"}, {"position": 49, "id": 49, "label": "G"}, {"position": 50, "id": 50, "label": "G"}, {"position": 51, "id": 51, "label": "G"}, {"position": 52, "id": 52, "label": "G"}, {"position": 53, "id": 53, "label": "A"}, {"position": 54, "id": 54, "label": "C"}, {"position": 55, "id": 55, "label": "C"}, {"position": 56, "id": 56, "label": "U"}, {"position": 57, "id": 57, "label": "G"}, {"position": 58, "id": 58, "label": "G"}, {"position": 59, "id": 59, "label": "A"}], "links": [{"source": 0, "type": "backbone", "target": 1, "len": 1, "label": "-"}, {"source": 1, "type": "backbone", "target": 2, "len": 1, "label": "-"}, {"source": 2, "type": "backbone", "target": 3, "len": 1, "label": "-"}, {"source": 3, "type": "backbone", "target": 4, "len": 1, "label": "-"}, {"source": 4, "type": "backbone", "target": 5, "len": 1, "label": "-"}, {"source": 4, "type": "basepair", "target": 31, "len": 1, "label": "="}, {"source": 5, "type": "basepair", "target": 30, "len": 1, "label": "="}, {"source": 5, "type": "backbone", "target": 6, "len": 1, "label": "-"}, {"source": 6, "type": "basepair", "target": 29, "len": 1, "label": "="}, {"source": 6, "type": "backbone", "target": 7, "len": 1, "label": "-"}, {"source": 7, "type": "backbone", "target": 8, "len": 1, "label": "-"}, {"source": 8, "type": "backbone", "target": 9, "len": 1, "label": "-"}, {"source": 9, "type": "basepair", "target": 24, "len": 1, "label": "="}, {"source": 9, "type": "backbone", "target": 10, "len": 1, "label": "-"}, {"source": 10, "type": "backbone", "target": 11, "len": 1, "label": "-"}, {"source": 10, "type": "basepair", "target": 23, "len": 1, "label": "="}, {"source": 11, "type": "backbone", "target": 12, "len": 1, "label": "-"}, {"source": 11, "type": "basepair", "target": 22, "len": 1, "label": "="}, {"source": 12, "type": "backbone", "target": 13, "len": 1, "label": "-"}, {"source": 12, "type": "basepair", "target": 21, "len": 1, "label": "="}, {"source": 13, "type": "basepair", "target": 20, "len": 1, "label": "="}, {"source": 13, "type": "backbone", "target": 14, "len": 1, "label": "-"}, {"source": 14, "type": "basepair", "target": 19, "len": 1, "label": "="}, {"source": 14, "type": "backbone", "target": 15, "len": 1, "label": "-"}, {"source": 15, "type": "backbone", "target": 16, "len": 1, "label": "-"}, {"source": 16, "type": "backbone", "target": 17, "len": 1, "label": "-"}, {"source": 17, "type": "backbone", "target": 18, "len": 1, "label": "-"}, {"source": 18, "type": "backbone", "target": 19, "len": 1, "label": "-"}, {"source": 19, "type": "backbone", "target": 20, "len": 1, "label": "-"}, {"source": 20, "type": "backbone", "target": 21, "len": 1, "label": "-"}, {"source": 21, "type": "backbone", "target": 22, "len": 1, "label": "-"}, {"source": 22, "type": "backbone", "target": 23, "len": 1, "label": "-"}, {"source": 23, "type": "backbone", "target": 24, "len": 1, "label": "-"}, {"source": 24, "type": "backbone", "target": 25, "len": 1, "label": "-"}, {"source": 25, "type": "backbone", "target": 26, "len": 1, "label": "-"}, {"source": 26, "type": "backbone", "target": 27, "len": 1, "label": "-"}, {"source": 27, "type": "backbone", "target": 28, "len": 1, "label": "-"}, {"source": 28, "type": "backbone", "target": 29, "len": 1, "label": "-"}, {"source": 29, "type": "backbone", "target": 30, "len": 1, "label": "-"}, {"source": 30, "type": "backbone", "target": 31, "len": 1, "label": "-"}, {"source": 31, "type": "backbone", "target": 32, "len": 1, "label": "-"}, {"source": 32, "type": "backbone", "target": 33, "len": 1, "label": "-"}, {"source": 33, "type": "backbone", "target": 34, "len": 1, "label": "-"}, {"source": 34, "type": "backbone", "target": 35, "len": 1, "label": "-"}, {"source": 35, "type": "backbone", "target": 36, "len": 1, "label": "-"}, {"source": 35, "type": "basepair", "target": 58, "len": 1, "label": "="}, {"source": 36, "type": "basepair", "target": 57, "len": 1, "label": "="}, {"source": 36, "type": "backbone", "target": 37, "len": 1, "label": "-"}, {"source": 37, "type": "basepair", "target": 56, "len": 1, "label": "="}, {"source": 37, "type": "backbone", "target": 38, "len": 1, "label": "-"}, {"source": 38, "type": "basepair", "target": 55, "len": 1, "label": "="}, {"source": 38, "type": "backbone", "target": 39, "len": 1, "label": "-"}, {"source": 39, "type": "backbone", "target": 40, "len": 1, "label": "-"}, {"source": 39, "type": "basepair", "target": 54, "len": 1, "label": "="}, {"source": 40, "type": "backbone", "target": 41, "len": 1, "label": "-"}, {"source": 40, "type": "basepair", "target": 52, "len": 1, "label": "="}, {"source": 41, "type": "backbone", "target": 42, "len": 1, "label": "-"}, {"source": 41, "type": "basepair", "target": 51, "len": 1, "label": "="}, {"source": 42, "type": "backbone", "target": 43, "len": 1, "label": "-"}, {"source": 43, "type": "backbone", "target": 44, "len": 1, "label": "-"}, {"source": 44, "type": "backbone", "target": 45, "len": 1, "label": "-"}, {"source": 45, "type": "backbone", "target": 46, "len": 1, "label": "-"}, {"source": 46, "type": "backbone", "target": 47, "len": 1, "label": "-"}, {"source": 47, "type": "backbone", "target": 48, "len": 1, "label": "-"}, {"source": 48, "type": "backbone", "target": 49, "len": 1, "label": "-"}, {"source": 49, "type": "backbone", "target": 50, "len": 1, "label": "-"}, {"source": 50, "type": "backbone", "target": 51, "len": 1, "label": "-"}, {"source": 51, "type": "backbone", "target": 52, "len": 1, "label": "-"}, {"source": 52, "type": "backbone", "target": 53, "len": 1, "label": "-"}, {"source": 53, "type": "backbone", "target": 54, "len": 1, "label": "-"}, {"source": 54, "type": "backbone", "target": 55, "len": 1, "label": "-"}, {"source": 55, "type": "backbone", "target": 56, "len": 1, "label": "-"}, {"source": 56, "type": "backbone", "target": 57, "len": 1, "label": "-"}, {"source": 57, "type": "backbone", "target": 58, "len": 1, "label": "-"}, {"source": 58, "type": "backbone", "target": 59, "len": 1, "label": "-"}], "multigraph": false}
+{"directed": false, "graph": {"info": "RNAshapes shape_type=2 energy_range=4 max_num=3", "id": "ACNY01000002.1/278641-278580_[_[]_][[]_]", "structure": "....((...((((((.....)))))).)).......((((((((.........)).))))))", "sequence": "GAUCGUUCACUUCGCAUCGCGCGAAGCGCAGUUCGCCUCAGGCCAUGGAACGGGGACCUGAG"}, "nodes": [{"position": 0, "id": 0, "label": "G"}, {"position": 1, "id": 1, "label": "A"}, {"position": 2, "id": 2, "label": "U"}, {"position": 3, "id": 3, "label": "C"}, {"position": 4, "id": 4, "label": "G"}, {"position": 5, "id": 5, "label": "U"}, {"position": 6, "id": 6, "label": "U"}, {"position": 7, "id": 7, "label": "C"}, {"position": 8, "id": 8, "label": "A"}, {"position": 9, "id": 9, "label": "C"}, {"position": 10, "id": 10, "label": "U"}, {"position": 11, "id": 11, "label": "U"}, {"position": 12, "id": 12, "label": "C"}, {"position": 13, "id": 13, "label": "G"}, {"position": 14, "id": 14, "label": "C"}, {"position": 15, "id": 15, "label": "A"}, {"position": 16, "id": 16, "label": "U"}, {"position": 17, "id": 17, "label": "C"}, {"position": 18, "id": 18, "label": "G"}, {"position": 19, "id": 19, "label": "C"}, {"position": 20, "id": 20, "label": "G"}, {"position": 21, "id": 21, "label": "C"}, {"position": 22, "id": 22, "label": "G"}, {"position": 23, "id": 23, "label": "A"}, {"position": 24, "id": 24, "label": "A"}, {"position": 25, "id": 25, "label": "G"}, {"position": 26, "id": 26, "label": "C"}, {"position": 27, "id": 27, "label": "G"}, {"position": 28, "id": 28, "label": "C"}, {"position": 29, "id": 29, "label": "A"}, {"position": 30, "id": 30, "label": "G"}, {"position": 31, "id": 31, "label": "U"}, {"position": 32, "id": 32, "label": "U"}, {"position": 33, "id": 33, "label": "C"}, {"position": 34, "id": 34, "label": "G"}, {"position": 35, "id": 35, "label": "C"}, {"position": 36, "id": 36, "label": "C"}, {"position": 37, "id": 37, "label": "U"}, {"position": 38, "id": 38, "label": "C"}, {"position": 39, "id": 39, "label": "A"}, {"position": 40, "id": 40, "label": "G"}, {"position": 41, "id": 41, "label": "G"}, {"position": 42, "id": 42, "label": "C"}, {"position": 43, "id": 43, "label": "C"}, {"position": 44, "id": 44, "label": "A"}, {"position": 45, "id": 45, "label": "U"}, {"position": 46, "id": 46, "label": "G"}, {"position": 47, "id": 47, "label": "G"}, {"position": 48, "id": 48, "label": "A"}, {"position": 49, "id": 49, "label": "A"}, {"position": 50, "id": 50, "label": "C"}, {"position": 51, "id": 51, "label": "G"}, {"position": 52, "id": 52, "label": "G"}, {"position": 53, "id": 53, "label": "G"}, {"position": 54, "id": 54, "label": "G"}, {"position": 55, "id": 55, "label": "A"}, {"position": 56, "id": 56, "label": "C"}, {"position": 57, "id": 57, "label": "C"}, {"position": 58, "id": 58, "label": "U"}, {"position": 59, "id": 59, "label": "G"}, {"position": 60, "id": 60, "label": "A"}, {"position": 61, "id": 61, "label": "G"}], "links": [{"source": 0, "type": "backbone", "target": 1, "len": 1, "label": "-"}, {"source": 1, "type": "backbone", "target": 2, "len": 1, "label": "-"}, {"source": 2, "type": "backbone", "target": 3, "len": 1, "label": "-"}, {"source": 3, "type": "backbone", "target": 4, "len": 1, "label": "-"}, {"source": 4, "type": "basepair", "target": 28, "len": 1, "label": "="}, {"source": 4, "type": "backbone", "target": 5, "len": 1, "label": "-"}, {"source": 5, "type": "basepair", "target": 27, "len": 1, "label": "="}, {"source": 5, "type": "backbone", "target": 6, "len": 1, "label": "-"}, {"source": 6, "type": "backbone", "target": 7, "len": 1, "label": "-"}, {"source": 7, "type": "backbone", "target": 8, "len": 1, "label": "-"}, {"source": 8, "type": "backbone", "target": 9, "len": 1, "label": "-"}, {"source": 9, "type": "basepair", "target": 25, "len": 1, "label": "="}, {"source": 9, "type": "backbone", "target": 10, "len": 1, "label": "-"}, {"source": 10, "type": "basepair", "target": 24, "len": 1, "label": "="}, {"source": 10, "type": "backbone", "target": 11, "len": 1, "label": "-"}, {"source": 11, "type": "backbone", "target": 12, "len": 1, "label": "-"}, {"source": 11, "type": "basepair", "target": 23, "len": 1, "label": "="}, {"source": 12, "type": "backbone", "target": 13, "len": 1, "label": "-"}, {"source": 12, "type": "basepair", "target": 22, "len": 1, "label": "="}, {"source": 13, "type": "basepair", "target": 21, "len": 1, "label": "="}, {"source": 13, "type": "backbone", "target": 14, "len": 1, "label": "-"}, {"source": 14, "type": "basepair", "target": 20, "len": 1, "label": "="}, {"source": 14, "type": "backbone", "target": 15, "len": 1, "label": "-"}, {"source": 15, "type": "backbone", "target": 16, "len": 1, "label": "-"}, {"source": 16, "type": "backbone", "target": 17, "len": 1, "label": "-"}, {"source": 17, "type": "backbone", "target": 18, "len": 1, "label": "-"}, {"source": 18, "type": "backbone", "target": 19, "len": 1, "label": "-"}, {"source": 19, "type": "backbone", "target": 20, "len": 1, "label": "-"}, {"source": 20, "type": "backbone", "target": 21, "len": 1, "label": "-"}, {"source": 21, "type": "backbone", "target": 22, "len": 1, "label": "-"}, {"source": 22, "type": "backbone", "target": 23, "len": 1, "label": "-"}, {"source": 23, "type": "backbone", "target": 24, "len": 1, "label": "-"}, {"source": 24, "type": "backbone", "target": 25, "len": 1, "label": "-"}, {"source": 25, "type": "backbone", "target": 26, "len": 1, "label": "-"}, {"source": 26, "type": "backbone", "target": 27, "len": 1, "label": "-"}, {"source": 27, "type": "backbone", "target": 28, "len": 1, "label": "-"}, {"source": 28, "type": "backbone", "target": 29, "len": 1, "label": "-"}, {"source": 29, "type": "backbone", "target": 30, "len": 1, "label": "-"}, {"source": 30, "type": "backbone", "target": 31, "len": 1, "label": "-"}, {"source": 31, "type": "backbone", "target": 32, "len": 1, "label": "-"}, {"source": 32, "type": "backbone", "target": 33, "len": 1, "label": "-"}, {"source": 33, "type": "backbone", "target": 34, "len": 1, "label": "-"}, {"source": 34, "type": "backbone", "target": 35, "len": 1, "label": "-"}, {"source": 35, "type": "backbone", "target": 36, "len": 1, "label": "-"}, {"source": 36, "type": "backbone", "target": 37, "len": 1, "label": "-"}, {"source": 36, "type": "basepair", "target": 61, "len": 1, "label": "="}, {"source": 37, "type": "basepair", "target": 60, "len": 1, "label": "="}, {"source": 37, "type": "backbone", "target": 38, "len": 1, "label": "-"}, {"source": 38, "type": "basepair", "target": 59, "len": 1, "label": "="}, {"source": 38, "type": "backbone", "target": 39, "len": 1, "label": "-"}, {"source": 39, "type": "backbone", "target": 40, "len": 1, "label": "-"}, {"source": 39, "type": "basepair", "target": 58, "len": 1, "label": "="}, {"source": 40, "type": "backbone", "target": 41, "len": 1, "label": "-"}, {"source": 40, "type": "basepair", "target": 57, "len": 1, "label": "="}, {"source": 41, "type": "basepair", "target": 56, "len": 1, "label": "="}, {"source": 41, "type": "backbone", "target": 42, "len": 1, "label": "-"}, {"source": 42, "type": "backbone", "target": 43, "len": 1, "label": "-"}, {"source": 42, "type": "basepair", "target": 54, "len": 1, "label": "="}, {"source": 43, "type": "backbone", "target": 44, "len": 1, "label": "-"}, {"source": 43, "type": "basepair", "target": 53, "len": 1, "label": "="}, {"source": 44, "type": "backbone", "target": 45, "len": 1, "label": "-"}, {"source": 45, "type": "backbone", "target": 46, "len": 1, "label": "-"}, {"source": 46, "type": "backbone", "target": 47, "len": 1, "label": "-"}, {"source": 47, "type": "backbone", "target": 48, "len": 1, "label": "-"}, {"source": 48, "type": "backbone", "target": 49, "len": 1, "label": "-"}, {"source": 49, "type": "backbone", "target": 50, "len": 1, "label": "-"}, {"source": 50, "type": "backbone", "target": 51, "len": 1, "label": "-"}, {"source": 51, "type": "backbone", "target": 52, "len": 1, "label": "-"}, {"source": 52, "type": "backbone", "target": 53, "len": 1, "label": "-"}, {"source": 53, "type": "backbone", "target": 54, "len": 1, "label": "-"}, {"source": 54, "type": "backbone", "target": 55, "len": 1, "label": "-"}, {"source": 55, "type": "backbone", "target": 56, "len": 1, "label": "-"}, {"source": 56, "type": "backbone", "target": 57, "len": 1, "label": "-"}, {"source": 57, "type": "backbone", "target": 58, "len": 1, "label": "-"}, {"source": 58, "type": "backbone", "target": 59, "len": 1, "label": "-"}, {"source": 59, "type": "backbone", "target": 60, "len": 1, "label": "-"}, {"source": 60, "type": "backbone", "target": 61, "len": 1, "label": "-"}], "multigraph": false}
+{"directed": false, "graph": {"info": "RNAshapes shape_type=2 energy_range=4 max_num=3", "id": "ACNY01000002.1/278641-278580_[_[_[]_]_][[]_]", "structure": "((..((...((((((.....)))))).))...))..((((((((.........)).))))))", "sequence": "GAUCGUUCACUUCGCAUCGCGCGAAGCGCAGUUCGCCUCAGGCCAUGGAACGGGGACCUGAG"}, "nodes": [{"position": 0, "id": 0, "label": "G"}, {"position": 1, "id": 1, "label": "A"}, {"position": 2, "id": 2, "label": "U"}, {"position": 3, "id": 3, "label": "C"}, {"position": 4, "id": 4, "label": "G"}, {"position": 5, "id": 5, "label": "U"}, {"position": 6, "id": 6, "label": "U"}, {"position": 7, "id": 7, "label": "C"}, {"position": 8, "id": 8, "label": "A"}, {"position": 9, "id": 9, "label": "C"}, {"position": 10, "id": 10, "label": "U"}, {"position": 11, "id": 11, "label": "U"}, {"position": 12, "id": 12, "label": "C"}, {"position": 13, "id": 13, "label": "G"}, {"position": 14, "id": 14, "label": "C"}, {"position": 15, "id": 15, "label": "A"}, {"position": 16, "id": 16, "label": "U"}, {"position": 17, "id": 17, "label": "C"}, {"position": 18, "id": 18, "label": "G"}, {"position": 19, "id": 19, "label": "C"}, {"position": 20, "id": 20, "label": "G"}, {"position": 21, "id": 21, "label": "C"}, {"position": 22, "id": 22, "label": "G"}, {"position": 23, "id": 23, "label": "A"}, {"position": 24, "id": 24, "label": "A"}, {"position": 25, "id": 25, "label": "G"}, {"position": 26, "id": 26, "label": "C"}, {"position": 27, "id": 27, "label": "G"}, {"position": 28, "id": 28, "label": "C"}, {"position": 29, "id": 29, "label": "A"}, {"position": 30, "id": 30, "label": "G"}, {"position": 31, "id": 31, "label": "U"}, {"position": 32, "id": 32, "label": "U"}, {"position": 33, "id": 33, "label": "C"}, {"position": 34, "id": 34, "label": "G"}, {"position": 35, "id": 35, "label": "C"}, {"position": 36, "id": 36, "label": "C"}, {"position": 37, "id": 37, "label": "U"}, {"position": 38, "id": 38, "label": "C"}, {"position": 39, "id": 39, "label": "A"}, {"position": 40, "id": 40, "label": "G"}, {"position": 41, "id": 41, "label": "G"}, {"position": 42, "id": 42, "label": "C"}, {"position": 43, "id": 43, "label": "C"}, {"position": 44, "id": 44, "label": "A"}, {"position": 45, "id": 45, "label": "U"}, {"position": 46, "id": 46, "label": "G"}, {"position": 47, "id": 47, "label": "G"}, {"position": 48, "id": 48, "label": "A"}, {"position": 49, "id": 49, "label": "A"}, {"position": 50, "id": 50, "label": "C"}, {"position": 51, "id": 51, "label": "G"}, {"position": 52, "id": 52, "label": "G"}, {"position": 53, "id": 53, "label": "G"}, {"position": 54, "id": 54, "label": "G"}, {"position": 55, "id": 55, "label": "A"}, {"position": 56, "id": 56, "label": "C"}, {"position": 57, "id": 57, "label": "C"}, {"position": 58, "id": 58, "label": "U"}, {"position": 59, "id": 59, "label": "G"}, {"position": 60, "id": 60, "label": "A"}, {"position": 61, "id": 61, "label": "G"}], "links": [{"source": 0, "type": "backbone", "target": 1, "len": 1, "label": "-"}, {"source": 0, "type": "basepair", "target": 33, "len": 1, "label": "="}, {"source": 1, "type": "basepair", "target": 32, "len": 1, "label": "="}, {"source": 1, "type": "backbone", "target": 2, "len": 1, "label": "-"}, {"source": 2, "type": "backbone", "target": 3, "len": 1, "label": "-"}, {"source": 3, "type": "backbone", "target": 4, "len": 1, "label": "-"}, {"source": 4, "type": "basepair", "target": 28, "len": 1, "label": "="}, {"source": 4, "type": "backbone", "target": 5, "len": 1, "label": "-"}, {"source": 5, "type": "basepair", "target": 27, "len": 1, "label": "="}, {"source": 5, "type": "backbone", "target": 6, "len": 1, "label": "-"}, {"source": 6, "type": "backbone", "target": 7, "len": 1, "label": "-"}, {"source": 7, "type": "backbone", "target": 8, "len": 1, "label": "-"}, {"source": 8, "type": "backbone", "target": 9, "len": 1, "label": "-"}, {"source": 9, "type": "basepair", "target": 25, "len": 1, "label": "="}, {"source": 9, "type": "backbone", "target": 10, "len": 1, "label": "-"}, {"source": 10, "type": "basepair", "target": 24, "len": 1, "label": "="}, {"source": 10, "type": "backbone", "target": 11, "len": 1, "label": "-"}, {"source": 11, "type": "backbone", "target": 12, "len": 1, "label": "-"}, {"source": 11, "type": "basepair", "target": 23, "len": 1, "label": "="}, {"source": 12, "type": "backbone", "target": 13, "len": 1, "label": "-"}, {"source": 12, "type": "basepair", "target": 22, "len": 1, "label": "="}, {"source": 13, "type": "basepair", "target": 21, "len": 1, "label": "="}, {"source": 13, "type": "backbone", "target": 14, "len": 1, "label": "-"}, {"source": 14, "type": "basepair", "target": 20, "len": 1, "label": "="}, {"source": 14, "type": "backbone", "target": 15, "len": 1, "label": "-"}, {"source": 15, "type": "backbone", "target": 16, "len": 1, "label": "-"}, {"source": 16, "type": "backbone", "target": 17, "len": 1, "label": "-"}, {"source": 17, "type": "backbone", "target": 18, "len": 1, "label": "-"}, {"source": 18, "type": "backbone", "target": 19, "len": 1, "label": "-"}, {"source": 19, "type": "backbone", "target": 20, "len": 1, "label": "-"}, {"source": 20, "type": "backbone", "target": 21, "len": 1, "label": "-"}, {"source": 21, "type": "backbone", "target": 22, "len": 1, "label": "-"}, {"source": 22, "type": "backbone", "target": 23, "len": 1, "label": "-"}, {"source": 23, "type": "backbone", "target": 24, "len": 1, "label": "-"}, {"source": 24, "type": "backbone", "target": 25, "len": 1, "label": "-"}, {"source": 25, "type": "backbone", "target": 26, "len": 1, "label": "-"}, {"source": 26, "type": "backbone", "target": 27, "len": 1, "label": "-"}, {"source": 27, "type": "backbone", "target": 28, "len": 1, "label": "-"}, {"source": 28, "type": "backbone", "target": 29, "len": 1, "label": "-"}, {"source": 29, "type": "backbone", "target": 30, "len": 1, "label": "-"}, {"source": 30, "type": "backbone", "target": 31, "len": 1, "label": "-"}, {"source": 31, "type": "backbone", "target": 32, "len": 1, "label": "-"}, {"source": 32, "type": "backbone", "target": 33, "len": 1, "label": "-"}, {"source": 33, "type": "backbone", "target": 34, "len": 1, "label": "-"}, {"source": 34, "type": "backbone", "target": 35, "len": 1, "label": "-"}, {"source": 35, "type": "backbone", "target": 36, "len": 1, "label": "-"}, {"source": 36, "type": "backbone", "target": 37, "len": 1, "label": "-"}, {"source": 36, "type": "basepair", "target": 61, "len": 1, "label": "="}, {"source": 37, "type": "basepair", "target": 60, "len": 1, "label": "="}, {"source": 37, "type": "backbone", "target": 38, "len": 1, "label": "-"}, {"source": 38, "type": "basepair", "target": 59, "len": 1, "label": "="}, {"source": 38, "type": "backbone", "target": 39, "len": 1, "label": "-"}, {"source": 39, "type": "backbone", "target": 40, "len": 1, "label": "-"}, {"source": 39, "type": "basepair", "target": 58, "len": 1, "label": "="}, {"source": 40, "type": "backbone", "target": 41, "len": 1, "label": "-"}, {"source": 40, "type": "basepair", "target": 57, "len": 1, "label": "="}, {"source": 41, "type": "basepair", "target": 56, "len": 1, "label": "="}, {"source": 41, "type": "backbone", "target": 42, "len": 1, "label": "-"}, {"source": 42, "type": "backbone", "target": 43, "len": 1, "label": "-"}, {"source": 42, "type": "basepair", "target": 54, "len": 1, "label": "="}, {"source": 43, "type": "backbone", "target": 44, "len": 1, "label": "-"}, {"source": 43, "type": "basepair", "target": 53, "len": 1, "label": "="}, {"source": 44, "type": "backbone", "target": 45, "len": 1, "label": "-"}, {"source": 45, "type": "backbone", "target": 46, "len": 1, "label": "-"}, {"source": 46, "type": "backbone", "target": 47, "len": 1, "label": "-"}, {"source": 47, "type": "backbone", "target": 48, "len": 1, "label": "-"}, {"source": 48, "type": "backbone", "target": 49, "len": 1, "label": "-"}, {"source": 49, "type": "backbone", "target": 50, "len": 1, "label": "-"}, {"source": 50, "type": "backbone", "target": 51, "len": 1, "label": "-"}, {"source": 51, "type": "backbone", "target": 52, "len": 1, "label": "-"}, {"source": 52, "type": "backbone", "target": 53, "len": 1, "label": "-"}, {"source": 53, "type": "backbone", "target": 54, "len": 1, "label": "-"}, {"source": 54, "type": "backbone", "target": 55, "len": 1, "label": "-"}, {"source": 55, "type": "backbone", "target": 56, "len": 1, "label": "-"}, {"source": 56, "type": "backbone", "target": 57, "len": 1, "label": "-"}, {"source": 57, "type": "backbone", "target": 58, "len": 1, "label": "-"}, {"source": 58, "type": "backbone", "target": 59, "len": 1, "label": "-"}, {"source": 59, "type": "backbone", "target": 60, "len": 1, "label": "-"}, {"source": 60, "type": "backbone", "target": 61, "len": 1, "label": "-"}], "multigraph": false}
+{"directed": false, "graph": {"info": "RNAshapes shape_type=2 energy_range=4 max_num=3", "id": "ACNY01000002.1/278641-278580_[][[]_]", "structure": ".........((((((.....))))))..........((((((((.........)).))))))", "sequence": "GAUCGUUCACUUCGCAUCGCGCGAAGCGCAGUUCGCCUCAGGCCAUGGAACGGGGACCUGAG"}, "nodes": [{"position": 0, "id": 0, "label": "G"}, {"position": 1, "id": 1, "label": "A"}, {"position": 2, "id": 2, "label": "U"}, {"position": 3, "id": 3, "label": "C"}, {"position": 4, "id": 4, "label": "G"}, {"position": 5, "id": 5, "label": "U"}, {"position": 6, "id": 6, "label": "U"}, {"position": 7, "id": 7, "label": "C"}, {"position": 8, "id": 8, "label": "A"}, {"position": 9, "id": 9, "label": "C"}, {"position": 10, "id": 10, "label": "U"}, {"position": 11, "id": 11, "label": "U"}, {"position": 12, "id": 12, "label": "C"}, {"position": 13, "id": 13, "label": "G"}, {"position": 14, "id": 14, "label": "C"}, {"position": 15, "id": 15, "label": "A"}, {"position": 16, "id": 16, "label": "U"}, {"position": 17, "id": 17, "label": "C"}, {"position": 18, "id": 18, "label": "G"}, {"position": 19, "id": 19, "label": "C"}, {"position": 20, "id": 20, "label": "G"}, {"position": 21, "id": 21, "label": "C"}, {"position": 22, "id": 22, "label": "G"}, {"position": 23, "id": 23, "label": "A"}, {"position": 24, "id": 24, "label": "A"}, {"position": 25, "id": 25, "label": "G"}, {"position": 26, "id": 26, "label": "C"}, {"position": 27, "id": 27, "label": "G"}, {"position": 28, "id": 28, "label": "C"}, {"position": 29, "id": 29, "label": "A"}, {"position": 30, "id": 30, "label": "G"}, {"position": 31, "id": 31, "label": "U"}, {"position": 32, "id": 32, "label": "U"}, {"position": 33, "id": 33, "label": "C"}, {"position": 34, "id": 34, "label": "G"}, {"position": 35, "id": 35, "label": "C"}, {"position": 36, "id": 36, "label": "C"}, {"position": 37, "id": 37, "label": "U"}, {"position": 38, "id": 38, "label": "C"}, {"position": 39, "id": 39, "label": "A"}, {"position": 40, "id": 40, "label": "G"}, {"position": 41, "id": 41, "label": "G"}, {"position": 42, "id": 42, "label": "C"}, {"position": 43, "id": 43, "label": "C"}, {"position": 44, "id": 44, "label": "A"}, {"position": 45, "id": 45, "label": "U"}, {"position": 46, "id": 46, "label": "G"}, {"position": 47, "id": 47, "label": "G"}, {"position": 48, "id": 48, "label": "A"}, {"position": 49, "id": 49, "label": "A"}, {"position": 50, "id": 50, "label": "C"}, {"position": 51, "id": 51, "label": "G"}, {"position": 52, "id": 52, "label": "G"}, {"position": 53, "id": 53, "label": "G"}, {"position": 54, "id": 54, "label": "G"}, {"position": 55, "id": 55, "label": "A"}, {"position": 56, "id": 56, "label": "C"}, {"position": 57, "id": 57, "label": "C"}, {"position": 58, "id": 58, "label": "U"}, {"position": 59, "id": 59, "label": "G"}, {"position": 60, "id": 60, "label": "A"}, {"position": 61, "id": 61, "label": "G"}], "links": [{"source": 0, "type": "backbone", "target": 1, "len": 1, "label": "-"}, {"source": 1, "type": "backbone", "target": 2, "len": 1, "label": "-"}, {"source": 2, "type": "backbone", "target": 3, "len": 1, "label": "-"}, {"source": 3, "type": "backbone", "target": 4, "len": 1, "label": "-"}, {"source": 4, "type": "backbone", "target": 5, "len": 1, "label": "-"}, {"source": 5, "type": "backbone", "target": 6, "len": 1, "label": "-"}, {"source": 6, "type": "backbone", "target": 7, "len": 1, "label": "-"}, {"source": 7, "type": "backbone", "target": 8, "len": 1, "label": "-"}, {"source": 8, "type": "backbone", "target": 9, "len": 1, "label": "-"}, {"source": 9, "type": "basepair", "target": 25, "len": 1, "label": "="}, {"source": 9, "type": "backbone", "target": 10, "len": 1, "label": "-"}, {"source": 10, "type": "basepair", "target": 24, "len": 1, "label": "="}, {"source": 10, "type": "backbone", "target": 11, "len": 1, "label": "-"}, {"source": 11, "type": "backbone", "target": 12, "len": 1, "label": "-"}, {"source": 11, "type": "basepair", "target": 23, "len": 1, "label": "="}, {"source": 12, "type": "backbone", "target": 13, "len": 1, "label": "-"}, {"source": 12, "type": "basepair", "target": 22, "len": 1, "label": "="}, {"source": 13, "type": "basepair", "target": 21, "len": 1, "label": "="}, {"source": 13, "type": "backbone", "target": 14, "len": 1, "label": "-"}, {"source": 14, "type": "basepair", "target": 20, "len": 1, "label": "="}, {"source": 14, "type": "backbone", "target": 15, "len": 1, "label": "-"}, {"source": 15, "type": "backbone", "target": 16, "len": 1, "label": "-"}, {"source": 16, "type": "backbone", "target": 17, "len": 1, "label": "-"}, {"source": 17, "type": "backbone", "target": 18, "len": 1, "label": "-"}, {"source": 18, "type": "backbone", "target": 19, "len": 1, "label": "-"}, {"source": 19, "type": "backbone", "target": 20, "len": 1, "label": "-"}, {"source": 20, "type": "backbone", "target": 21, "len": 1, "label": "-"}, {"source": 21, "type": "backbone", "target": 22, "len": 1, "label": "-"}, {"source": 22, "type": "backbone", "target": 23, "len": 1, "label": "-"}, {"source": 23, "type": "backbone", "target": 24, "len": 1, "label": "-"}, {"source": 24, "type": "backbone", "target": 25, "len": 1, "label": "-"}, {"source": 25, "type": "backbone", "target": 26, "len": 1, "label": "-"}, {"source": 26, "type": "backbone", "target": 27, "len": 1, "label": "-"}, {"source": 27, "type": "backbone", "target": 28, "len": 1, "label": "-"}, {"source": 28, "type": "backbone", "target": 29, "len": 1, "label": "-"}, {"source": 29, "type": "backbone", "target": 30, "len": 1, "label": "-"}, {"source": 30, "type": "backbone", "target": 31, "len": 1, "label": "-"}, {"source": 31, "type": "backbone", "target": 32, "len": 1, "label": "-"}, {"source": 32, "type": "backbone", "target": 33, "len": 1, "label": "-"}, {"source": 33, "type": "backbone", "target": 34, "len": 1, "label": "-"}, {"source": 34, "type": "backbone", "target": 35, "len": 1, "label": "-"}, {"source": 35, "type": "backbone", "target": 36, "len": 1, "label": "-"}, {"source": 36, "type": "backbone", "target": 37, "len": 1, "label": "-"}, {"source": 36, "type": "basepair", "target": 61, "len": 1, "label": "="}, {"source": 37, "type": "basepair", "target": 60, "len": 1, "label": "="}, {"source": 37, "type": "backbone", "target": 38, "len": 1, "label": "-"}, {"source": 38, "type": "basepair", "target": 59, "len": 1, "label": "="}, {"source": 38, "type": "backbone", "target": 39, "len": 1, "label": "-"}, {"source": 39, "type": "backbone", "target": 40, "len": 1, "label": "-"}, {"source": 39, "type": "basepair", "target": 58, "len": 1, "label": "="}, {"source": 40, "type": "backbone", "target": 41, "len": 1, "label": "-"}, {"source": 40, "type": "basepair", "target": 57, "len": 1, "label": "="}, {"source": 41, "type": "basepair", "target": 56, "len": 1, "label": "="}, {"source": 41, "type": "backbone", "target": 42, "len": 1, "label": "-"}, {"source": 42, "type": "backbone", "target": 43, "len": 1, "label": "-"}, {"source": 42, "type": "basepair", "target": 54, "len": 1, "label": "="}, {"source": 43, "type": "backbone", "target": 44, "len": 1, "label": "-"}, {"source": 43, "type": "basepair", "target": 53, "len": 1, "label": "="}, {"source": 44, "type": "backbone", "target": 45, "len": 1, "label": "-"}, {"source": 45, "type": "backbone", "target": 46, "len": 1, "label": "-"}, {"source": 46, "type": "backbone", "target": 47, "len": 1, "label": "-"}, {"source": 47, "type": "backbone", "target": 48, "len": 1, "label": "-"}, {"source": 48, "type": "backbone", "target": 49, "len": 1, "label": "-"}, {"source": 49, "type": "backbone", "target": 50, "len": 1, "label": "-"}, {"source": 50, "type": "backbone", "target": 51, "len": 1, "label": "-"}, {"source": 51, "type": "backbone", "target": 52, "len": 1, "label": "-"}, {"source": 52, "type": "backbone", "target": 53, "len": 1, "label": "-"}, {"source": 53, "type": "backbone", "target": 54, "len": 1, "label": "-"}, {"source": 54, "type": "backbone", "target": 55, "len": 1, "label": "-"}, {"source": 55, "type": "backbone", "target": 56, "len": 1, "label": "-"}, {"source": 56, "type": "backbone", "target": 57, "len": 1, "label": "-"}, {"source": 57, "type": "backbone", "target": 58, "len": 1, "label": "-"}, {"source": 58, "type": "backbone", "target": 59, "len": 1, "label": "-"}, {"source": 59, "type": "backbone", "target": 60, "len": 1, "label": "-"}, {"source": 60, "type": "backbone", "target": 61, "len": 1, "label": "-"}], "multigraph": false}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/csc_sparse1.mtx	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,9 @@
+%%MatrixMarket matrix coordinate integer general
+%
+3 3 6
+1 1 1
+3 1 2
+3 2 3
+1 3 4
+2 3 5
+3 3 6
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/csc_sparse2.mtx	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,9 @@
+%%MatrixMarket matrix coordinate real general
+%
+3 3 6
+1 1 1.5
+3 1 -2
+3 2 0.3
+1 3 41
+2 3 0.1235
+3 3 6
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/csc_stack_result01.mtx	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,15 @@
+%%MatrixMarket matrix coordinate real general
+%
+3 6 12
+1 1 1.000000000000000e+00
+3 1 2.000000000000000e+00
+3 2 3.000000000000000e+00
+1 3 4.000000000000000e+00
+2 3 5.000000000000000e+00
+3 3 6.000000000000000e+00
+1 4 1.500000000000000e+00
+3 4 -2.000000000000000e+00
+3 5 3.000000000000000e-01
+1 6 4.100000000000000e+01
+2 6 1.235000000000000e-01
+3 6 6.000000000000000e+00
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/csr_sparse1.mtx	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,9 @@
+%%MatrixMarket matrix coordinate integer general
+%
+3 3 6
+1 1 1
+1 3 2
+2 3 3
+3 1 4
+3 2 5
+3 3 6
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/csr_sparse2.mtx	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,9 @@
+%%MatrixMarket matrix coordinate real general
+%
+3 3 6
+1 1 1
+1 3 -0.2
+2 3 11
+3 1 0.04
+3 2 -5
+3 3 2.6
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/csr_stack_result01.mtx	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,15 @@
+%%MatrixMarket matrix coordinate real general
+%
+6 3 12
+1 1 1.000000000000000e+00
+1 3 2.000000000000000e+00
+2 3 3.000000000000000e+00
+3 1 4.000000000000000e+00
+3 2 5.000000000000000e+00
+3 3 6.000000000000000e+00
+4 1 1.000000000000000e+00
+4 3 -2.000000000000000e-01
+5 3 1.100000000000000e+01
+6 1 4.000000000000000e-02
+6 2 -5.000000000000000e+00
+6 3 2.600000000000000e+00
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/empty_file.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,48 @@
+0	44	64	-76	4
+0	51	48	-73	0
+0	58	65	-49	0
+0	43	61	-49	1
+0	45	43	-79	0
+0	42	60	-98	0
+0	50	55	-59	2
+0	53	53	-56	2
+0	45	44	-61	0
+0	43	65	-84	4
+0	35	52	-75	1
+0	56	56	-70	0
+1	-61	86	43	0
+1	-67	93	15	0
+1	-59	94	36	0
+1	-50	92	62	0
+1	-78	91	70	1
+1	-35	87	47	0
+1	-56	91	52	0
+1	-61	81	46	0
+1	-83	78	34	0
+1	-50	87	45	0
+1	-67	73	50	1
+1	-50	97	45	0
+1	-61	111	45	0
+2	-109	23	-92	0
+2	-94	20	-96	0
+2	-85	26	-88	0
+2	-90	33	-114	1
+2	-63	9	-106	0
+2	-79	9	-93	1
+2	-99	26	-108	3
+2	-81	19	-110	0
+2	-108	21	-108	0
+2	-92	27	-106	3
+2	-88	2	-106	1
+2	-88	15	-103	0
+3	54	-74	4	0
+3	42	-92	31	1
+3	39	-99	-7	1
+3	48	-115	-5	1
+3	39	-96	2	1
+3	31	-109	9	1
+3	33	-96	-8	1
+3	23	-102	4	0
+3	38	-90	21	1
+3	34	-107	1	1
+3	35	-78	18	1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/f1_score.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,2 @@
+f1_score : 
+0.8461538461538461
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fbeta_score.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,2 @@
+fbeta_score : 
+0.8461538461538461
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/feature_selection_result01	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,11 @@
+0	1
+143.762620712	-1.1796457192799998
+-88.5787166225	-2.5710918402200003
+-82.8452345578	-0.168636324107
+72.4951388149	0.991068834926
+11.805182128	-0.7096855607860001
+-63.9354970901	0.9841122108220001
+126.32584079600001	0.35353444883900004
+23.0341392692	1.03188231893
+67.6714937696	-0.8214378651719999
+47.39275848810001	-0.0942409319417
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/feature_selection_result02	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,262 @@
+temp_2	temp_1	forecast_noaa	friend
+68.0	69.0	65.0	88.0
+60.0	59.0	57.0	66.0
+85.0	88.0	75.0	70.0
+82.0	65.0	63.0	58.0
+54.0	50.0	44.0	58.0
+48.0	51.0	45.0	63.0
+49.0	52.0	45.0	41.0
+73.0	78.0	75.0	66.0
+39.0	35.0	43.0	38.0
+42.0	40.0	45.0	36.0
+42.0	47.0	41.0	58.0
+76.0	72.0	76.0	88.0
+69.0	76.0	73.0	72.0
+40.0	39.0	45.0	46.0
+71.0	78.0	70.0	84.0
+64.0	71.0	63.0	85.0
+54.0	48.0	44.0	61.0
+73.0	72.0	77.0	68.0
+56.0	57.0	50.0	70.0
+45.0	40.0	44.0	39.0
+50.0	54.0	47.0	53.0
+65.0	58.0	52.0	71.0
+60.0	68.0	58.0	54.0
+60.0	65.0	55.0	65.0
+48.0	47.0	46.0	51.0
+44.0	44.0	43.0	42.0
+64.0	64.0	64.0	69.0
+59.0	62.0	57.0	67.0
+68.0	66.0	64.0	74.0
+77.0	70.0	67.0	90.0
+59.0	57.0	54.0	70.0
+55.0	50.0	46.0	57.0
+58.0	55.0	49.0	71.0
+57.0	55.0	46.0	67.0
+42.0	42.0	41.0	47.0
+64.0	65.0	57.0	41.0
+64.0	63.0	63.0	73.0
+49.0	48.0	45.0	28.0
+40.0	42.0	44.0	62.0
+44.0	51.0	45.0	38.0
+67.0	64.0	65.0	64.0
+79.0	75.0	74.0	63.0
+50.0	52.0	42.0	39.0
+85.0	67.0	66.0	80.0
+67.0	68.0	65.0	56.0
+53.0	54.0	53.0	42.0
+62.0	62.0	52.0	70.0
+77.0	76.0	76.0	61.0
+74.0	73.0	71.0	93.0
+50.0	52.0	50.0	35.0
+75.0	70.0	71.0	68.0
+73.0	77.0	75.0	62.0
+69.0	60.0	52.0	72.0
+55.0	52.0	50.0	54.0
+81.0	79.0	71.0	85.0
+77.0	76.0	53.0	74.0
+66.0	66.0	64.0	85.0
+68.0	57.0	58.0	62.0
+76.0	66.0	57.0	60.0
+60.0	61.0	58.0	41.0
+56.0	55.0	52.0	65.0
+57.0	48.0	46.0	54.0
+53.0	49.0	46.0	63.0
+66.0	65.0	64.0	73.0
+74.0	60.0	58.0	56.0
+55.0	56.0	53.0	36.0
+62.0	59.0	56.0	44.0
+36.0	44.0	41.0	35.0
+77.0	82.0	62.0	83.0
+64.0	64.0	65.0	76.0
+44.0	43.0	41.0	46.0
+56.0	64.0	51.0	57.0
+61.0	63.0	49.0	49.0
+65.0	70.0	67.0	79.0
+63.0	71.0	48.0	42.0
+76.0	76.0	69.0	85.0
+64.0	68.0	58.0	55.0
+39.0	39.0	44.0	39.0
+79.0	71.0	70.0	52.0
+68.0	69.0	68.0	89.0
+70.0	74.0	71.0	82.0
+75.0	81.0	62.0	81.0
+49.0	51.0	49.0	34.0
+52.0	45.0	44.0	61.0
+80.0	87.0	73.0	73.0
+76.0	71.0	71.0	86.0
+65.0	55.0	56.0	77.0
+76.0	80.0	72.0	81.0
+71.0	67.0	65.0	76.0
+64.0	61.0	60.0	78.0
+49.0	46.0	43.0	65.0
+35.0	39.0	42.0	51.0
+68.0	67.0	67.0	61.0
+48.0	52.0	43.0	50.0
+60.0	67.0	68.0	87.0
+74.0	75.0	67.0	77.0
+68.0	68.0	73.0	79.0
+81.0	92.0	65.0	71.0
+68.0	67.0	69.0	56.0
+45.0	44.0	43.0	56.0
+60.0	61.0	56.0	73.0
+65.0	65.0	49.0	41.0
+68.0	68.0	72.0	70.0
+77.0	87.0	62.0	69.0
+65.0	117.0	51.0	62.0
+72.0	80.0	75.0	66.0
+55.0	57.0	47.0	46.0
+63.0	67.0	61.0	68.0
+53.0	58.0	51.0	56.0
+61.0	65.0	53.0	41.0
+56.0	52.0	45.0	47.0
+57.0	59.0	52.0	39.0
+57.0	57.0	53.0	35.0
+89.0	81.0	56.0	66.0
+71.0	75.0	76.0	75.0
+88.0	76.0	76.0	95.0
+65.0	57.0	61.0	53.0
+68.0	69.0	72.0	86.0
+76.0	77.0	66.0	64.0
+58.0	55.0	47.0	55.0
+50.0	49.0	45.0	53.0
+53.0	54.0	48.0	57.0
+59.0	55.0	49.0	42.0
+51.0	56.0	53.0	45.0
+76.0	68.0	72.0	77.0
+52.0	54.0	49.0	44.0
+65.0	67.0	69.0	87.0
+45.0	49.0	45.0	33.0
+49.0	49.0	47.0	45.0
+57.0	56.0	48.0	49.0
+76.0	73.0	66.0	78.0
+65.0	66.0	65.0	60.0
+77.0	69.0	66.0	62.0
+77.0	82.0	64.0	65.0
+87.0	90.0	75.0	65.0
+51.0	51.0	49.0	43.0
+68.0	77.0	57.0	41.0
+57.0	60.0	58.0	58.0
+79.0	74.0	71.0	87.0
+80.0	85.0	73.0	74.0
+60.0	68.0	61.0	64.0
+62.0	56.0	46.0	37.0
+73.0	71.0	55.0	45.0
+60.0	62.0	57.0	40.0
+79.0	83.0	76.0	76.0
+71.0	64.0	62.0	56.0
+54.0	56.0	45.0	54.0
+40.0	41.0	42.0	31.0
+66.0	65.0	66.0	67.0
+57.0	65.0	49.0	38.0
+41.0	40.0	46.0	41.0
+45.0	45.0	43.0	29.0
+52.0	52.0	48.0	58.0
+64.0	63.0	50.0	63.0
+52.0	52.0	47.0	44.0
+58.0	60.0	55.0	77.0
+84.0	81.0	73.0	89.0
+77.0	75.0	74.0	77.0
+63.0	59.0	48.0	64.0
+72.0	73.0	77.0	94.0
+73.0	75.0	73.0	66.0
+59.0	60.0	56.0	59.0
+73.0	75.0	68.0	56.0
+66.0	59.0	56.0	40.0
+49.0	53.0	47.0	56.0
+80.0	79.0	76.0	60.0
+59.0	57.0	49.0	46.0
+79.0	75.0	64.0	77.0
+69.0	71.0	67.0	81.0
+57.0	53.0	50.0	42.0
+47.0	46.0	48.0	56.0
+82.0	81.0	72.0	70.0
+54.0	49.0	47.0	29.0
+56.0	57.0	44.0	34.0
+60.0	60.0	54.0	53.0
+70.0	67.0	72.0	64.0
+65.0	61.0	62.0	60.0
+70.0	66.0	66.0	85.0
+65.0	64.0	50.0	55.0
+63.0	66.0	62.0	49.0
+57.0	64.0	52.0	49.0
+60.0	71.0	61.0	56.0
+67.0	75.0	62.0	60.0
+45.0	48.0	46.0	47.0
+60.0	53.0	48.0	70.0
+55.0	49.0	46.0	65.0
+86.0	85.0	67.0	81.0
+57.0	62.0	48.0	30.0
+46.0	50.0	42.0	58.0
+65.0	58.0	51.0	39.0
+79.0	72.0	74.0	95.0
+57.0	55.0	50.0	34.0
+72.0	74.0	70.0	91.0
+83.0	85.0	77.0	77.0
+77.0	73.0	77.0	93.0
+52.0	52.0	44.0	39.0
+64.0	67.0	64.0	62.0
+49.0	45.0	45.0	35.0
+52.0	46.0	46.0	41.0
+62.0	66.0	60.0	57.0
+81.0	71.0	75.0	86.0
+65.0	70.0	66.0	79.0
+55.0	58.0	46.0	53.0
+72.0	72.0	76.0	65.0
+74.0	74.0	74.0	71.0
+63.0	65.0	63.0	49.0
+68.0	77.0	55.0	39.0
+60.0	59.0	49.0	35.0
+44.0	45.0	41.0	61.0
+51.0	53.0	49.0	46.0
+57.0	53.0	54.0	72.0
+85.0	79.0	73.0	79.0
+51.0	49.0	44.0	44.0
+66.0	63.0	62.0	78.0
+63.0	69.0	54.0	45.0
+51.0	60.0	47.0	46.0
+63.0	64.0	60.0	73.0
+75.0	79.0	66.0	64.0
+49.0	55.0	43.0	58.0
+68.0	73.0	54.0	41.0
+62.0	60.0	57.0	62.0
+71.0	67.0	67.0	77.0
+41.0	42.0	45.0	58.0
+57.0	60.0	62.0	55.0
+55.0	57.0	47.0	30.0
+35.0	35.0	44.0	36.0
+71.0	75.0	66.0	84.0
+59.0	61.0	48.0	65.0
+53.0	51.0	46.0	59.0
+69.0	71.0	67.0	70.0
+71.0	74.0	74.0	71.0
+48.0	48.0	44.0	42.0
+68.0	74.0	70.0	60.0
+70.0	76.0	68.0	57.0
+54.0	58.0	47.0	37.0
+53.0	51.0	48.0	43.0
+67.0	72.0	68.0	78.0
+67.0	76.0	64.0	74.0
+52.0	52.0	47.0	60.0
+52.0	53.0	48.0	53.0
+67.0	65.0	65.0	83.0
+61.0	58.0	58.0	43.0
+74.0	77.0	74.0	56.0
+58.0	61.0	51.0	35.0
+66.0	67.0	64.0	54.0
+55.0	54.0	46.0	58.0
+71.0	79.0	65.0	58.0
+81.0	77.0	63.0	67.0
+75.0	71.0	64.0	55.0
+59.0	58.0	54.0	61.0
+64.0	68.0	55.0	56.0
+43.0	40.0	45.0	49.0
+75.0	80.0	75.0	71.0
+87.0	74.0	59.0	61.0
+48.0	57.0	42.0	57.0
+48.0	52.0	43.0	57.0
+74.0	71.0	71.0	95.0
+54.0	49.0	49.0	70.0
+77.0	89.0	59.0	61.0
+66.0	60.0	56.0	78.0
+59.0	59.0	58.0	40.0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/feature_selection_result03	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,262 @@
+temp_1	friend
+69.0	88.0
+59.0	66.0
+88.0	70.0
+65.0	58.0
+50.0	58.0
+51.0	63.0
+52.0	41.0
+78.0	66.0
+35.0	38.0
+40.0	36.0
+47.0	58.0
+72.0	88.0
+76.0	72.0
+39.0	46.0
+78.0	84.0
+71.0	85.0
+48.0	61.0
+72.0	68.0
+57.0	70.0
+40.0	39.0
+54.0	53.0
+58.0	71.0
+68.0	54.0
+65.0	65.0
+47.0	51.0
+44.0	42.0
+64.0	69.0
+62.0	67.0
+66.0	74.0
+70.0	90.0
+57.0	70.0
+50.0	57.0
+55.0	71.0
+55.0	67.0
+42.0	47.0
+65.0	41.0
+63.0	73.0
+48.0	28.0
+42.0	62.0
+51.0	38.0
+64.0	64.0
+75.0	63.0
+52.0	39.0
+67.0	80.0
+68.0	56.0
+54.0	42.0
+62.0	70.0
+76.0	61.0
+73.0	93.0
+52.0	35.0
+70.0	68.0
+77.0	62.0
+60.0	72.0
+52.0	54.0
+79.0	85.0
+76.0	74.0
+66.0	85.0
+57.0	62.0
+66.0	60.0
+61.0	41.0
+55.0	65.0
+48.0	54.0
+49.0	63.0
+65.0	73.0
+60.0	56.0
+56.0	36.0
+59.0	44.0
+44.0	35.0
+82.0	83.0
+64.0	76.0
+43.0	46.0
+64.0	57.0
+63.0	49.0
+70.0	79.0
+71.0	42.0
+76.0	85.0
+68.0	55.0
+39.0	39.0
+71.0	52.0
+69.0	89.0
+74.0	82.0
+81.0	81.0
+51.0	34.0
+45.0	61.0
+87.0	73.0
+71.0	86.0
+55.0	77.0
+80.0	81.0
+67.0	76.0
+61.0	78.0
+46.0	65.0
+39.0	51.0
+67.0	61.0
+52.0	50.0
+67.0	87.0
+75.0	77.0
+68.0	79.0
+92.0	71.0
+67.0	56.0
+44.0	56.0
+61.0	73.0
+65.0	41.0
+68.0	70.0
+87.0	69.0
+117.0	62.0
+80.0	66.0
+57.0	46.0
+67.0	68.0
+58.0	56.0
+65.0	41.0
+52.0	47.0
+59.0	39.0
+57.0	35.0
+81.0	66.0
+75.0	75.0
+76.0	95.0
+57.0	53.0
+69.0	86.0
+77.0	64.0
+55.0	55.0
+49.0	53.0
+54.0	57.0
+55.0	42.0
+56.0	45.0
+68.0	77.0
+54.0	44.0
+67.0	87.0
+49.0	33.0
+49.0	45.0
+56.0	49.0
+73.0	78.0
+66.0	60.0
+69.0	62.0
+82.0	65.0
+90.0	65.0
+51.0	43.0
+77.0	41.0
+60.0	58.0
+74.0	87.0
+85.0	74.0
+68.0	64.0
+56.0	37.0
+71.0	45.0
+62.0	40.0
+83.0	76.0
+64.0	56.0
+56.0	54.0
+41.0	31.0
+65.0	67.0
+65.0	38.0
+40.0	41.0
+45.0	29.0
+52.0	58.0
+63.0	63.0
+52.0	44.0
+60.0	77.0
+81.0	89.0
+75.0	77.0
+59.0	64.0
+73.0	94.0
+75.0	66.0
+60.0	59.0
+75.0	56.0
+59.0	40.0
+53.0	56.0
+79.0	60.0
+57.0	46.0
+75.0	77.0
+71.0	81.0
+53.0	42.0
+46.0	56.0
+81.0	70.0
+49.0	29.0
+57.0	34.0
+60.0	53.0
+67.0	64.0
+61.0	60.0
+66.0	85.0
+64.0	55.0
+66.0	49.0
+64.0	49.0
+71.0	56.0
+75.0	60.0
+48.0	47.0
+53.0	70.0
+49.0	65.0
+85.0	81.0
+62.0	30.0
+50.0	58.0
+58.0	39.0
+72.0	95.0
+55.0	34.0
+74.0	91.0
+85.0	77.0
+73.0	93.0
+52.0	39.0
+67.0	62.0
+45.0	35.0
+46.0	41.0
+66.0	57.0
+71.0	86.0
+70.0	79.0
+58.0	53.0
+72.0	65.0
+74.0	71.0
+65.0	49.0
+77.0	39.0
+59.0	35.0
+45.0	61.0
+53.0	46.0
+53.0	72.0
+79.0	79.0
+49.0	44.0
+63.0	78.0
+69.0	45.0
+60.0	46.0
+64.0	73.0
+79.0	64.0
+55.0	58.0
+73.0	41.0
+60.0	62.0
+67.0	77.0
+42.0	58.0
+60.0	55.0
+57.0	30.0
+35.0	36.0
+75.0	84.0
+61.0	65.0
+51.0	59.0
+71.0	70.0
+74.0	71.0
+48.0	42.0
+74.0	60.0
+76.0	57.0
+58.0	37.0
+51.0	43.0
+72.0	78.0
+76.0	74.0
+52.0	60.0
+53.0	53.0
+65.0	83.0
+58.0	43.0
+77.0	56.0
+61.0	35.0
+67.0	54.0
+54.0	58.0
+79.0	58.0
+77.0	67.0
+71.0	55.0
+58.0	61.0
+68.0	56.0
+40.0	49.0
+80.0	71.0
+74.0	61.0
+57.0	57.0
+52.0	57.0
+71.0	95.0
+49.0	70.0
+89.0	61.0
+60.0	78.0
+59.0	40.0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/feature_selection_result04	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,262 @@
+month	day	temp_2	temp_1	average	forecast_noaa	forecast_acc	forecast_under	friend	week_Mon
+9.0	19.0	68.0	69.0	69.7	65.0	74.0	71.0	88.0	1.0
+4.0	14.0	60.0	59.0	58.1	57.0	63.0	58.0	66.0	0.0
+7.0	30.0	85.0	88.0	77.3	75.0	79.0	77.0	70.0	0.0
+5.0	15.0	82.0	65.0	64.7	63.0	69.0	64.0	58.0	0.0
+1.0	18.0	54.0	50.0	47.5	44.0	48.0	49.0	58.0	1.0
+1.0	25.0	48.0	51.0	48.2	45.0	51.0	49.0	63.0	1.0
+11.0	25.0	49.0	52.0	48.6	45.0	52.0	47.0	41.0	0.0
+7.0	20.0	73.0	78.0	76.7	75.0	78.0	77.0	66.0	0.0
+12.0	17.0	39.0	35.0	45.2	43.0	47.0	46.0	38.0	0.0
+12.0	8.0	42.0	40.0	46.1	45.0	51.0	47.0	36.0	0.0
+12.0	28.0	42.0	47.0	45.3	41.0	49.0	44.0	58.0	0.0
+7.0	17.0	76.0	72.0	76.3	76.0	78.0	77.0	88.0	0.0
+7.0	7.0	69.0	76.0	74.4	73.0	77.0	74.0	72.0	0.0
+12.0	15.0	40.0	39.0	45.3	45.0	49.0	47.0	46.0	0.0
+6.0	27.0	71.0	78.0	72.2	70.0	74.0	72.0	84.0	1.0
+5.0	31.0	64.0	71.0	67.3	63.0	72.0	68.0	85.0	0.0
+1.0	20.0	54.0	48.0	47.7	44.0	52.0	49.0	61.0	0.0
+8.0	10.0	73.0	72.0	77.0	77.0	78.0	77.0	68.0	0.0
+3.0	23.0	56.0	57.0	54.7	50.0	58.0	55.0	70.0	0.0
+12.0	24.0	45.0	40.0	45.1	44.0	47.0	46.0	39.0	0.0
+1.0	19.0	50.0	54.0	47.6	47.0	49.0	48.0	53.0	0.0
+11.0	6.0	65.0	58.0	53.2	52.0	57.0	55.0	71.0	0.0
+4.0	17.0	60.0	68.0	58.6	58.0	62.0	59.0	54.0	0.0
+10.0	29.0	60.0	65.0	55.3	55.0	59.0	55.0	65.0	0.0
+2.0	1.0	48.0	47.0	48.8	46.0	49.0	49.0	51.0	1.0
+12.0	12.0	44.0	44.0	45.6	43.0	50.0	45.0	42.0	1.0
+5.0	30.0	64.0	64.0	67.1	64.0	70.0	66.0	69.0	1.0
+10.0	23.0	59.0	62.0	57.1	57.0	58.0	59.0	67.0	0.0
+9.0	30.0	68.0	66.0	65.7	64.0	67.0	65.0	74.0	0.0
+9.0	12.0	77.0	70.0	71.8	67.0	73.0	73.0	90.0	1.0
+11.0	2.0	59.0	57.0	54.2	54.0	58.0	55.0	70.0	0.0
+11.0	17.0	55.0	50.0	50.5	46.0	51.0	50.0	57.0	0.0
+3.0	3.0	58.0	55.0	51.8	49.0	54.0	50.0	71.0	0.0
+11.0	21.0	57.0	55.0	49.5	46.0	51.0	49.0	67.0	1.0
+12.0	27.0	42.0	42.0	45.2	41.0	50.0	47.0	47.0	0.0
+4.0	24.0	64.0	65.0	60.1	57.0	61.0	60.0	41.0	0.0
+5.0	20.0	64.0	63.0	65.6	63.0	70.0	64.0	73.0	0.0
+1.0	16.0	49.0	48.0	47.3	45.0	52.0	46.0	28.0	0.0
+12.0	7.0	40.0	42.0	46.3	44.0	51.0	46.0	62.0	0.0
+1.0	7.0	44.0	51.0	46.2	45.0	49.0	46.0	38.0	0.0
+9.0	24.0	67.0	64.0	68.0	65.0	71.0	66.0	64.0	0.0
+8.0	30.0	79.0	75.0	74.6	74.0	76.0	75.0	63.0	0.0
+1.0	11.0	50.0	52.0	46.7	42.0	48.0	48.0	39.0	1.0
+6.0	9.0	85.0	67.0	68.6	66.0	73.0	69.0	80.0	0.0
+9.0	22.0	67.0	68.0	68.7	65.0	70.0	69.0	56.0	0.0
+3.0	25.0	53.0	54.0	55.0	53.0	57.0	57.0	42.0	0.0
+10.0	24.0	62.0	62.0	56.8	52.0	61.0	57.0	70.0	1.0
+7.0	16.0	77.0	76.0	76.1	76.0	78.0	75.0	61.0	0.0
+7.0	1.0	74.0	73.0	73.1	71.0	75.0	72.0	93.0	0.0
+11.0	18.0	50.0	52.0	50.3	50.0	53.0	50.0	35.0	0.0
+9.0	3.0	75.0	70.0	73.9	71.0	75.0	73.0	68.0	0.0
+8.0	2.0	73.0	77.0	77.4	75.0	80.0	79.0	62.0	0.0
+4.0	5.0	69.0	60.0	56.6	52.0	58.0	56.0	72.0	0.0
+3.0	13.0	55.0	52.0	53.3	50.0	55.0	53.0	54.0	0.0
+8.0	28.0	81.0	79.0	75.0	71.0	77.0	76.0	85.0	0.0
+4.0	9.0	77.0	76.0	57.2	53.0	61.0	57.0	74.0	0.0
+5.0	26.0	66.0	66.0	66.5	64.0	70.0	65.0	85.0	0.0
+10.0	10.0	68.0	57.0	61.8	58.0	64.0	61.0	62.0	1.0
+4.0	10.0	76.0	66.0	57.4	57.0	60.0	57.0	60.0	0.0
+10.0	19.0	60.0	61.0	58.4	58.0	60.0	57.0	41.0	0.0
+3.0	12.0	56.0	55.0	53.1	52.0	58.0	53.0	65.0	0.0
+1.0	24.0	57.0	48.0	48.1	46.0	50.0	48.0	54.0	0.0
+2.0	7.0	53.0	49.0	49.2	46.0	51.0	48.0	63.0	0.0
+5.0	27.0	66.0	65.0	66.7	64.0	67.0	68.0	73.0	0.0
+5.0	5.0	74.0	60.0	62.5	58.0	66.0	62.0	56.0	0.0
+3.0	11.0	55.0	56.0	53.0	53.0	53.0	51.0	36.0	0.0
+10.0	22.0	62.0	59.0	57.4	56.0	59.0	58.0	44.0	0.0
+12.0	11.0	36.0	44.0	45.7	41.0	46.0	47.0	35.0	0.0
+5.0	8.0	77.0	82.0	63.2	62.0	65.0	63.0	83.0	0.0
+5.0	29.0	64.0	64.0	67.0	65.0	71.0	65.0	76.0	0.0
+12.0	13.0	44.0	43.0	45.5	41.0	47.0	46.0	46.0	0.0
+3.0	30.0	56.0	64.0	55.7	51.0	57.0	56.0	57.0	0.0
+11.0	8.0	61.0	63.0	52.7	49.0	57.0	52.0	49.0	0.0
+6.0	20.0	65.0	70.0	70.6	67.0	71.0	70.0	79.0	1.0
+11.0	9.0	63.0	71.0	52.4	48.0	56.0	52.0	42.0	0.0
+7.0	3.0	76.0	76.0	73.5	69.0	76.0	75.0	85.0	0.0
+10.0	9.0	64.0	68.0	62.1	58.0	65.0	63.0	55.0	0.0
+12.0	16.0	39.0	39.0	45.3	44.0	49.0	44.0	39.0	0.0
+9.0	16.0	79.0	71.0	70.7	70.0	74.0	71.0	52.0	0.0
+6.0	25.0	68.0	69.0	71.7	68.0	73.0	73.0	89.0	0.0
+9.0	13.0	70.0	74.0	71.5	71.0	75.0	70.0	82.0	0.0
+5.0	12.0	75.0	81.0	64.1	62.0	67.0	63.0	81.0	0.0
+2.0	8.0	49.0	51.0	49.3	49.0	52.0	50.0	34.0	1.0
+1.0	12.0	52.0	45.0	46.8	44.0	50.0	45.0	61.0	0.0
+8.0	13.0	80.0	87.0	76.8	73.0	79.0	78.0	73.0	0.0
+7.0	4.0	76.0	71.0	73.8	71.0	76.0	73.0	86.0	1.0
+4.0	25.0	65.0	55.0	60.3	56.0	64.0	61.0	77.0	1.0
+8.0	12.0	76.0	80.0	76.9	72.0	79.0	77.0	81.0	0.0
+9.0	21.0	71.0	67.0	69.0	65.0	70.0	70.0	76.0	0.0
+4.0	30.0	64.0	61.0	61.4	60.0	65.0	62.0	78.0	0.0
+12.0	5.0	49.0	46.0	46.6	43.0	50.0	45.0	65.0	1.0
+12.0	19.0	35.0	39.0	45.1	42.0	46.0	45.0	51.0	1.0
+9.0	23.0	68.0	67.0	68.3	67.0	69.0	67.0	61.0	0.0
+11.0	29.0	48.0	52.0	47.8	43.0	48.0	47.0	50.0	0.0
+6.0	16.0	60.0	67.0	69.8	68.0	72.0	71.0	87.0	0.0
+9.0	14.0	74.0	75.0	71.2	67.0	75.0	73.0	77.0	0.0
+9.0	6.0	68.0	68.0	73.3	73.0	76.0	75.0	79.0	0.0
+6.0	6.0	81.0	92.0	68.2	65.0	70.0	67.0	71.0	1.0
+9.0	8.0	68.0	67.0	72.8	69.0	77.0	73.0	56.0	0.0
+1.0	3.0	45.0	44.0	45.8	43.0	46.0	47.0	56.0	0.0
+4.0	28.0	60.0	61.0	61.0	56.0	65.0	62.0	73.0	0.0
+11.0	5.0	65.0	65.0	53.4	49.0	58.0	52.0	41.0	0.0
+9.0	7.0	68.0	68.0	73.0	72.0	78.0	71.0	70.0	0.0
+5.0	3.0	77.0	87.0	62.1	62.0	66.0	64.0	69.0	0.0
+10.0	31.0	65.0	117.0	54.8	51.0	59.0	56.0	62.0	1.0
+7.0	18.0	72.0	80.0	76.4	75.0	77.0	75.0	66.0	1.0
+11.0	15.0	55.0	57.0	51.0	47.0	54.0	51.0	46.0	0.0
+5.0	10.0	63.0	67.0	63.6	61.0	66.0	64.0	68.0	0.0
+3.0	18.0	53.0	58.0	54.0	51.0	57.0	54.0	56.0	0.0
+10.0	26.0	61.0	65.0	56.2	53.0	57.0	57.0	41.0	0.0
+1.0	30.0	56.0	52.0	48.6	45.0	51.0	48.0	47.0	0.0
+3.0	27.0	57.0	59.0	55.3	52.0	58.0	55.0	39.0	0.0
+11.0	3.0	57.0	57.0	53.9	53.0	54.0	54.0	35.0	0.0
+4.0	20.0	89.0	81.0	59.2	56.0	63.0	61.0	66.0	0.0
+7.0	24.0	71.0	75.0	77.1	76.0	78.0	78.0	75.0	0.0
+7.0	31.0	88.0	76.0	77.4	76.0	78.0	79.0	95.0	0.0
+5.0	16.0	65.0	57.0	64.8	61.0	65.0	65.0	53.0	1.0
+7.0	6.0	68.0	69.0	74.2	72.0	76.0	75.0	86.0	0.0
+9.0	27.0	76.0	77.0	66.8	66.0	67.0	68.0	64.0	0.0
+2.0	16.0	58.0	55.0	49.9	47.0	54.0	51.0	55.0	0.0
+12.0	4.0	50.0	49.0	46.8	45.0	47.0	47.0	53.0	0.0
+3.0	9.0	53.0	54.0	52.7	48.0	56.0	54.0	57.0	0.0
+11.0	14.0	59.0	55.0	51.2	49.0	53.0	53.0	42.0	1.0
+3.0	29.0	51.0	56.0	55.6	53.0	59.0	54.0	45.0	0.0
+7.0	8.0	76.0	68.0	74.6	72.0	79.0	75.0	77.0	0.0
+3.0	14.0	52.0	54.0	53.4	49.0	58.0	55.0	44.0	1.0
+6.0	11.0	65.0	67.0	69.0	69.0	72.0	71.0	87.0	0.0
+1.0	13.0	45.0	49.0	46.9	45.0	51.0	46.0	33.0	0.0
+2.0	5.0	49.0	49.0	49.1	47.0	50.0	49.0	45.0	0.0
+1.0	29.0	57.0	56.0	48.5	48.0	52.0	47.0	49.0	0.0
+6.0	22.0	76.0	73.0	71.0	66.0	71.0	72.0	78.0	0.0
+5.0	25.0	65.0	66.0	66.4	65.0	67.0	66.0	60.0	0.0
+9.0	28.0	77.0	69.0	66.5	66.0	68.0	66.0	62.0	0.0
+5.0	14.0	77.0	82.0	64.5	64.0	66.0	66.0	65.0	0.0
+8.0	14.0	87.0	90.0	76.7	75.0	78.0	78.0	65.0	0.0
+2.0	23.0	51.0	51.0	50.7	49.0	53.0	51.0	43.0	0.0
+4.0	8.0	68.0	77.0	57.1	57.0	61.0	57.0	41.0	0.0
+10.0	11.0	57.0	60.0	61.4	58.0	66.0	61.0	58.0	0.0
+6.0	30.0	79.0	74.0	72.8	71.0	76.0	72.0	87.0	0.0
+7.0	26.0	80.0	85.0	77.2	73.0	79.0	76.0	74.0	0.0
+5.0	6.0	60.0	68.0	62.8	61.0	64.0	61.0	64.0	0.0
+2.0	11.0	62.0	56.0	49.5	46.0	53.0	50.0	37.0	0.0
+4.0	2.0	73.0	71.0	56.2	55.0	58.0	58.0	45.0	0.0
+10.0	16.0	60.0	62.0	59.5	57.0	60.0	59.0	40.0	0.0
+7.0	28.0	79.0	83.0	77.3	76.0	80.0	78.0	76.0	0.0
+5.0	19.0	71.0	64.0	65.4	62.0	68.0	67.0	56.0	0.0
+1.0	27.0	54.0	56.0	48.4	45.0	51.0	49.0	54.0	0.0
+12.0	25.0	40.0	41.0	45.1	42.0	49.0	44.0	31.0	0.0
+5.0	24.0	66.0	65.0	66.2	66.0	71.0	66.0	67.0	0.0
+11.0	4.0	57.0	65.0	53.7	49.0	55.0	54.0	38.0	0.0
+1.0	5.0	41.0	40.0	46.0	46.0	46.0	46.0	41.0	0.0
+1.0	1.0	45.0	45.0	45.6	43.0	50.0	44.0	29.0	0.0
+11.0	26.0	52.0	52.0	48.4	48.0	50.0	47.0	58.0	0.0
+11.0	12.0	64.0	63.0	51.7	50.0	52.0	52.0	63.0	0.0
+11.0	30.0	52.0	52.0	47.6	47.0	52.0	49.0	44.0	0.0
+4.0	13.0	58.0	60.0	57.9	55.0	62.0	56.0	77.0	0.0
+8.0	23.0	84.0	81.0	75.7	73.0	78.0	77.0	89.0	0.0
+7.0	14.0	77.0	75.0	75.8	74.0	76.0	77.0	77.0	0.0
+11.0	13.0	63.0	59.0	51.4	48.0	56.0	50.0	64.0	0.0
+8.0	9.0	72.0	73.0	77.1	77.0	80.0	79.0	94.0	0.0
+8.0	4.0	73.0	75.0	77.3	73.0	79.0	78.0	66.0	0.0
+4.0	16.0	59.0	60.0	58.5	56.0	60.0	59.0	59.0	0.0
+6.0	23.0	73.0	75.0	71.3	68.0	72.0	71.0	56.0	0.0
+4.0	11.0	66.0	59.0	57.6	56.0	60.0	58.0	40.0	1.0
+2.0	6.0	49.0	53.0	49.1	47.0	53.0	49.0	56.0	0.0
+8.0	6.0	80.0	79.0	77.2	76.0	81.0	79.0	60.0	0.0
+3.0	5.0	59.0	57.0	52.1	49.0	53.0	51.0	46.0	0.0
+6.0	2.0	79.0	75.0	67.6	64.0	71.0	67.0	77.0	0.0
+9.0	20.0	69.0	71.0	69.4	67.0	73.0	69.0	81.0	0.0
+2.0	19.0	57.0	53.0	50.2	50.0	52.0	51.0	42.0	0.0
+2.0	2.0	47.0	46.0	48.8	48.0	50.0	50.0	56.0	0.0
+7.0	22.0	82.0	81.0	76.9	72.0	77.0	76.0	70.0	0.0
+11.0	24.0	54.0	49.0	48.9	47.0	53.0	48.0	29.0	0.0
+1.0	28.0	56.0	57.0	48.4	44.0	52.0	48.0	34.0	0.0
+10.0	18.0	60.0	60.0	58.8	54.0	60.0	57.0	53.0	0.0
+9.0	4.0	70.0	67.0	73.7	72.0	77.0	75.0	64.0	0.0
+10.0	4.0	65.0	61.0	64.1	62.0	69.0	65.0	60.0	0.0
+6.0	14.0	70.0	66.0	69.5	66.0	71.0	69.0	85.0	0.0
+11.0	11.0	65.0	64.0	51.9	50.0	53.0	52.0	55.0	0.0
+5.0	21.0	63.0	66.0	65.7	62.0	67.0	65.0	49.0	0.0
+3.0	6.0	57.0	64.0	52.2	52.0	53.0	51.0	49.0	0.0
+5.0	18.0	60.0	71.0	65.2	61.0	68.0	65.0	56.0	0.0
+5.0	11.0	67.0	75.0	63.8	62.0	68.0	63.0	60.0	0.0
+1.0	9.0	45.0	48.0	46.4	46.0	50.0	45.0	47.0	0.0
+3.0	8.0	60.0	53.0	52.5	48.0	56.0	51.0	70.0	0.0
+1.0	15.0	55.0	49.0	47.1	46.0	51.0	46.0	65.0	0.0
+6.0	8.0	86.0	85.0	68.5	67.0	70.0	69.0	81.0	0.0
+2.0	10.0	57.0	62.0	49.4	48.0	50.0	49.0	30.0	0.0
+12.0	3.0	46.0	50.0	47.0	42.0	52.0	47.0	58.0	0.0
+10.0	27.0	65.0	58.0	55.9	51.0	60.0	55.0	39.0	0.0
+8.0	7.0	79.0	72.0	77.2	74.0	78.0	77.0	95.0	0.0
+11.0	16.0	57.0	55.0	50.7	50.0	51.0	49.0	34.0	0.0
+9.0	10.0	72.0	74.0	72.3	70.0	77.0	74.0	91.0	0.0
+7.0	29.0	83.0	85.0	77.3	77.0	80.0	79.0	77.0	0.0
+8.0	3.0	77.0	73.0	77.3	77.0	81.0	77.0	93.0	0.0
+12.0	1.0	52.0	52.0	47.4	44.0	48.0	49.0	39.0	0.0
+9.0	25.0	64.0	67.0	67.6	64.0	72.0	67.0	62.0	0.0
+12.0	23.0	49.0	45.0	45.1	45.0	49.0	44.0	35.0	0.0
+12.0	2.0	52.0	46.0	47.2	46.0	51.0	49.0	41.0	0.0
+10.0	13.0	62.0	66.0	60.6	60.0	62.0	60.0	57.0	0.0
+7.0	23.0	81.0	71.0	77.0	75.0	81.0	76.0	86.0	0.0
+6.0	13.0	65.0	70.0	69.3	66.0	72.0	69.0	79.0	1.0
+2.0	15.0	55.0	58.0	49.9	46.0	52.0	49.0	53.0	1.0
+8.0	8.0	72.0	72.0	77.1	76.0	78.0	77.0	65.0	1.0
+7.0	12.0	74.0	74.0	75.4	74.0	77.0	77.0	71.0	0.0
+10.0	3.0	63.0	65.0	64.5	63.0	68.0	65.0	49.0	1.0
+4.0	18.0	68.0	77.0	58.8	55.0	59.0	57.0	39.0	1.0
+2.0	25.0	60.0	59.0	50.9	49.0	51.0	49.0	35.0	0.0
+1.0	2.0	44.0	45.0	45.7	41.0	50.0	44.0	61.0	0.0
+2.0	21.0	51.0	53.0	50.5	49.0	54.0	52.0	46.0	0.0
+3.0	24.0	57.0	53.0	54.9	54.0	56.0	56.0	72.0	0.0
+7.0	27.0	85.0	79.0	77.3	73.0	78.0	79.0	79.0	0.0
+2.0	4.0	51.0	49.0	49.0	44.0	54.0	51.0	44.0	0.0
+10.0	7.0	66.0	63.0	62.9	62.0	67.0	64.0	78.0	0.0
+4.0	4.0	63.0	69.0	56.5	54.0	59.0	56.0	45.0	1.0
+2.0	24.0	51.0	60.0	50.8	47.0	53.0	50.0	46.0	0.0
+10.0	8.0	63.0	64.0	62.5	60.0	65.0	61.0	73.0	0.0
+9.0	15.0	75.0	79.0	71.0	66.0	76.0	69.0	64.0	0.0
+1.0	14.0	49.0	55.0	47.0	43.0	47.0	46.0	58.0	0.0
+4.0	1.0	68.0	73.0	56.0	54.0	59.0	55.0	41.0	0.0
+10.0	17.0	62.0	60.0	59.1	57.0	63.0	59.0	62.0	1.0
+6.0	18.0	71.0	67.0	70.2	67.0	75.0	69.0	77.0	0.0
+12.0	26.0	41.0	42.0	45.2	45.0	48.0	46.0	58.0	1.0
+5.0	17.0	57.0	60.0	65.0	62.0	65.0	65.0	55.0	0.0
+11.0	20.0	55.0	57.0	49.8	47.0	54.0	48.0	30.0	0.0
+12.0	18.0	35.0	35.0	45.2	44.0	46.0	46.0	36.0	0.0
+9.0	17.0	71.0	75.0	70.3	66.0	73.0	70.0	84.0	0.0
+2.0	26.0	59.0	61.0	51.1	48.0	56.0	53.0	65.0	0.0
+2.0	22.0	53.0	51.0	50.6	46.0	51.0	50.0	59.0	1.0
+6.0	26.0	69.0	71.0	71.9	67.0	74.0	72.0	70.0	0.0
+7.0	11.0	71.0	74.0	75.3	74.0	79.0	75.0	71.0	1.0
+12.0	30.0	48.0	48.0	45.4	44.0	46.0	44.0	42.0	0.0
+7.0	9.0	68.0	74.0	74.9	70.0	79.0	76.0	60.0	0.0
+6.0	21.0	70.0	76.0	70.8	68.0	75.0	71.0	57.0	0.0
+3.0	2.0	54.0	58.0	51.6	47.0	54.0	52.0	37.0	0.0
+2.0	20.0	53.0	51.0	50.4	48.0	55.0	51.0	43.0	0.0
+9.0	9.0	67.0	72.0	72.6	68.0	77.0	71.0	78.0	0.0
+9.0	26.0	67.0	76.0	67.2	64.0	69.0	69.0	74.0	1.0
+1.0	22.0	52.0	52.0	47.9	47.0	48.0	48.0	60.0	0.0
+11.0	27.0	52.0	53.0	48.2	48.0	49.0	49.0	53.0	0.0
+6.0	12.0	67.0	65.0	69.1	65.0	73.0	70.0	83.0	0.0
+10.0	20.0	61.0	58.0	58.1	58.0	59.0	58.0	43.0	0.0
+7.0	13.0	74.0	77.0	75.6	74.0	78.0	76.0	56.0	0.0
+11.0	7.0	58.0	61.0	52.9	51.0	56.0	51.0	35.0	1.0
+10.0	1.0	66.0	67.0	65.3	64.0	70.0	64.0	54.0	0.0
+11.0	22.0	55.0	54.0	49.3	46.0	54.0	49.0	58.0	0.0
+6.0	1.0	71.0	79.0	67.4	65.0	69.0	66.0	58.0	0.0
+5.0	13.0	81.0	77.0	64.3	63.0	67.0	66.0	67.0	0.0
+6.0	3.0	75.0	71.0	67.7	64.0	71.0	66.0	55.0	0.0
+4.0	12.0	59.0	58.0	57.7	54.0	59.0	57.0	61.0	0.0
+3.0	31.0	64.0	68.0	55.9	55.0	59.0	56.0	56.0	0.0
+12.0	14.0	43.0	40.0	45.4	45.0	48.0	45.0	49.0	0.0
+8.0	5.0	75.0	80.0	77.3	75.0	81.0	78.0	71.0	0.0
+5.0	4.0	87.0	74.0	62.3	59.0	65.0	64.0	61.0	0.0
+12.0	31.0	48.0	57.0	45.5	42.0	48.0	47.0	57.0	0.0
+1.0	21.0	48.0	52.0	47.8	43.0	51.0	46.0	57.0	0.0
+7.0	10.0	74.0	71.0	75.1	71.0	77.0	76.0	95.0	0.0
+3.0	15.0	54.0	49.0	53.6	49.0	58.0	52.0	70.0	0.0
+4.0	19.0	77.0	89.0	59.0	59.0	63.0	59.0	61.0	0.0
+10.0	14.0	66.0	60.0	60.2	56.0	64.0	60.0	78.0	0.0
+4.0	15.0	59.0	59.0	58.3	58.0	61.0	60.0	40.0	0.0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/feature_selection_result05	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,262 @@
+month	day	temp_2	temp_1	average	forecast_noaa	forecast_acc	forecast_under	friend
+9.0	19.0	68.0	69.0	69.7	65.0	74.0	71.0	88.0
+4.0	14.0	60.0	59.0	58.1	57.0	63.0	58.0	66.0
+7.0	30.0	85.0	88.0	77.3	75.0	79.0	77.0	70.0
+5.0	15.0	82.0	65.0	64.7	63.0	69.0	64.0	58.0
+1.0	18.0	54.0	50.0	47.5	44.0	48.0	49.0	58.0
+1.0	25.0	48.0	51.0	48.2	45.0	51.0	49.0	63.0
+11.0	25.0	49.0	52.0	48.6	45.0	52.0	47.0	41.0
+7.0	20.0	73.0	78.0	76.7	75.0	78.0	77.0	66.0
+12.0	17.0	39.0	35.0	45.2	43.0	47.0	46.0	38.0
+12.0	8.0	42.0	40.0	46.1	45.0	51.0	47.0	36.0
+12.0	28.0	42.0	47.0	45.3	41.0	49.0	44.0	58.0
+7.0	17.0	76.0	72.0	76.3	76.0	78.0	77.0	88.0
+7.0	7.0	69.0	76.0	74.4	73.0	77.0	74.0	72.0
+12.0	15.0	40.0	39.0	45.3	45.0	49.0	47.0	46.0
+6.0	27.0	71.0	78.0	72.2	70.0	74.0	72.0	84.0
+5.0	31.0	64.0	71.0	67.3	63.0	72.0	68.0	85.0
+1.0	20.0	54.0	48.0	47.7	44.0	52.0	49.0	61.0
+8.0	10.0	73.0	72.0	77.0	77.0	78.0	77.0	68.0
+3.0	23.0	56.0	57.0	54.7	50.0	58.0	55.0	70.0
+12.0	24.0	45.0	40.0	45.1	44.0	47.0	46.0	39.0
+1.0	19.0	50.0	54.0	47.6	47.0	49.0	48.0	53.0
+11.0	6.0	65.0	58.0	53.2	52.0	57.0	55.0	71.0
+4.0	17.0	60.0	68.0	58.6	58.0	62.0	59.0	54.0
+10.0	29.0	60.0	65.0	55.3	55.0	59.0	55.0	65.0
+2.0	1.0	48.0	47.0	48.8	46.0	49.0	49.0	51.0
+12.0	12.0	44.0	44.0	45.6	43.0	50.0	45.0	42.0
+5.0	30.0	64.0	64.0	67.1	64.0	70.0	66.0	69.0
+10.0	23.0	59.0	62.0	57.1	57.0	58.0	59.0	67.0
+9.0	30.0	68.0	66.0	65.7	64.0	67.0	65.0	74.0
+9.0	12.0	77.0	70.0	71.8	67.0	73.0	73.0	90.0
+11.0	2.0	59.0	57.0	54.2	54.0	58.0	55.0	70.0
+11.0	17.0	55.0	50.0	50.5	46.0	51.0	50.0	57.0
+3.0	3.0	58.0	55.0	51.8	49.0	54.0	50.0	71.0
+11.0	21.0	57.0	55.0	49.5	46.0	51.0	49.0	67.0
+12.0	27.0	42.0	42.0	45.2	41.0	50.0	47.0	47.0
+4.0	24.0	64.0	65.0	60.1	57.0	61.0	60.0	41.0
+5.0	20.0	64.0	63.0	65.6	63.0	70.0	64.0	73.0
+1.0	16.0	49.0	48.0	47.3	45.0	52.0	46.0	28.0
+12.0	7.0	40.0	42.0	46.3	44.0	51.0	46.0	62.0
+1.0	7.0	44.0	51.0	46.2	45.0	49.0	46.0	38.0
+9.0	24.0	67.0	64.0	68.0	65.0	71.0	66.0	64.0
+8.0	30.0	79.0	75.0	74.6	74.0	76.0	75.0	63.0
+1.0	11.0	50.0	52.0	46.7	42.0	48.0	48.0	39.0
+6.0	9.0	85.0	67.0	68.6	66.0	73.0	69.0	80.0
+9.0	22.0	67.0	68.0	68.7	65.0	70.0	69.0	56.0
+3.0	25.0	53.0	54.0	55.0	53.0	57.0	57.0	42.0
+10.0	24.0	62.0	62.0	56.8	52.0	61.0	57.0	70.0
+7.0	16.0	77.0	76.0	76.1	76.0	78.0	75.0	61.0
+7.0	1.0	74.0	73.0	73.1	71.0	75.0	72.0	93.0
+11.0	18.0	50.0	52.0	50.3	50.0	53.0	50.0	35.0
+9.0	3.0	75.0	70.0	73.9	71.0	75.0	73.0	68.0
+8.0	2.0	73.0	77.0	77.4	75.0	80.0	79.0	62.0
+4.0	5.0	69.0	60.0	56.6	52.0	58.0	56.0	72.0
+3.0	13.0	55.0	52.0	53.3	50.0	55.0	53.0	54.0
+8.0	28.0	81.0	79.0	75.0	71.0	77.0	76.0	85.0
+4.0	9.0	77.0	76.0	57.2	53.0	61.0	57.0	74.0
+5.0	26.0	66.0	66.0	66.5	64.0	70.0	65.0	85.0
+10.0	10.0	68.0	57.0	61.8	58.0	64.0	61.0	62.0
+4.0	10.0	76.0	66.0	57.4	57.0	60.0	57.0	60.0
+10.0	19.0	60.0	61.0	58.4	58.0	60.0	57.0	41.0
+3.0	12.0	56.0	55.0	53.1	52.0	58.0	53.0	65.0
+1.0	24.0	57.0	48.0	48.1	46.0	50.0	48.0	54.0
+2.0	7.0	53.0	49.0	49.2	46.0	51.0	48.0	63.0
+5.0	27.0	66.0	65.0	66.7	64.0	67.0	68.0	73.0
+5.0	5.0	74.0	60.0	62.5	58.0	66.0	62.0	56.0
+3.0	11.0	55.0	56.0	53.0	53.0	53.0	51.0	36.0
+10.0	22.0	62.0	59.0	57.4	56.0	59.0	58.0	44.0
+12.0	11.0	36.0	44.0	45.7	41.0	46.0	47.0	35.0
+5.0	8.0	77.0	82.0	63.2	62.0	65.0	63.0	83.0
+5.0	29.0	64.0	64.0	67.0	65.0	71.0	65.0	76.0
+12.0	13.0	44.0	43.0	45.5	41.0	47.0	46.0	46.0
+3.0	30.0	56.0	64.0	55.7	51.0	57.0	56.0	57.0
+11.0	8.0	61.0	63.0	52.7	49.0	57.0	52.0	49.0
+6.0	20.0	65.0	70.0	70.6	67.0	71.0	70.0	79.0
+11.0	9.0	63.0	71.0	52.4	48.0	56.0	52.0	42.0
+7.0	3.0	76.0	76.0	73.5	69.0	76.0	75.0	85.0
+10.0	9.0	64.0	68.0	62.1	58.0	65.0	63.0	55.0
+12.0	16.0	39.0	39.0	45.3	44.0	49.0	44.0	39.0
+9.0	16.0	79.0	71.0	70.7	70.0	74.0	71.0	52.0
+6.0	25.0	68.0	69.0	71.7	68.0	73.0	73.0	89.0
+9.0	13.0	70.0	74.0	71.5	71.0	75.0	70.0	82.0
+5.0	12.0	75.0	81.0	64.1	62.0	67.0	63.0	81.0
+2.0	8.0	49.0	51.0	49.3	49.0	52.0	50.0	34.0
+1.0	12.0	52.0	45.0	46.8	44.0	50.0	45.0	61.0
+8.0	13.0	80.0	87.0	76.8	73.0	79.0	78.0	73.0
+7.0	4.0	76.0	71.0	73.8	71.0	76.0	73.0	86.0
+4.0	25.0	65.0	55.0	60.3	56.0	64.0	61.0	77.0
+8.0	12.0	76.0	80.0	76.9	72.0	79.0	77.0	81.0
+9.0	21.0	71.0	67.0	69.0	65.0	70.0	70.0	76.0
+4.0	30.0	64.0	61.0	61.4	60.0	65.0	62.0	78.0
+12.0	5.0	49.0	46.0	46.6	43.0	50.0	45.0	65.0
+12.0	19.0	35.0	39.0	45.1	42.0	46.0	45.0	51.0
+9.0	23.0	68.0	67.0	68.3	67.0	69.0	67.0	61.0
+11.0	29.0	48.0	52.0	47.8	43.0	48.0	47.0	50.0
+6.0	16.0	60.0	67.0	69.8	68.0	72.0	71.0	87.0
+9.0	14.0	74.0	75.0	71.2	67.0	75.0	73.0	77.0
+9.0	6.0	68.0	68.0	73.3	73.0	76.0	75.0	79.0
+6.0	6.0	81.0	92.0	68.2	65.0	70.0	67.0	71.0
+9.0	8.0	68.0	67.0	72.8	69.0	77.0	73.0	56.0
+1.0	3.0	45.0	44.0	45.8	43.0	46.0	47.0	56.0
+4.0	28.0	60.0	61.0	61.0	56.0	65.0	62.0	73.0
+11.0	5.0	65.0	65.0	53.4	49.0	58.0	52.0	41.0
+9.0	7.0	68.0	68.0	73.0	72.0	78.0	71.0	70.0
+5.0	3.0	77.0	87.0	62.1	62.0	66.0	64.0	69.0
+10.0	31.0	65.0	117.0	54.8	51.0	59.0	56.0	62.0
+7.0	18.0	72.0	80.0	76.4	75.0	77.0	75.0	66.0
+11.0	15.0	55.0	57.0	51.0	47.0	54.0	51.0	46.0
+5.0	10.0	63.0	67.0	63.6	61.0	66.0	64.0	68.0
+3.0	18.0	53.0	58.0	54.0	51.0	57.0	54.0	56.0
+10.0	26.0	61.0	65.0	56.2	53.0	57.0	57.0	41.0
+1.0	30.0	56.0	52.0	48.6	45.0	51.0	48.0	47.0
+3.0	27.0	57.0	59.0	55.3	52.0	58.0	55.0	39.0
+11.0	3.0	57.0	57.0	53.9	53.0	54.0	54.0	35.0
+4.0	20.0	89.0	81.0	59.2	56.0	63.0	61.0	66.0
+7.0	24.0	71.0	75.0	77.1	76.0	78.0	78.0	75.0
+7.0	31.0	88.0	76.0	77.4	76.0	78.0	79.0	95.0
+5.0	16.0	65.0	57.0	64.8	61.0	65.0	65.0	53.0
+7.0	6.0	68.0	69.0	74.2	72.0	76.0	75.0	86.0
+9.0	27.0	76.0	77.0	66.8	66.0	67.0	68.0	64.0
+2.0	16.0	58.0	55.0	49.9	47.0	54.0	51.0	55.0
+12.0	4.0	50.0	49.0	46.8	45.0	47.0	47.0	53.0
+3.0	9.0	53.0	54.0	52.7	48.0	56.0	54.0	57.0
+11.0	14.0	59.0	55.0	51.2	49.0	53.0	53.0	42.0
+3.0	29.0	51.0	56.0	55.6	53.0	59.0	54.0	45.0
+7.0	8.0	76.0	68.0	74.6	72.0	79.0	75.0	77.0
+3.0	14.0	52.0	54.0	53.4	49.0	58.0	55.0	44.0
+6.0	11.0	65.0	67.0	69.0	69.0	72.0	71.0	87.0
+1.0	13.0	45.0	49.0	46.9	45.0	51.0	46.0	33.0
+2.0	5.0	49.0	49.0	49.1	47.0	50.0	49.0	45.0
+1.0	29.0	57.0	56.0	48.5	48.0	52.0	47.0	49.0
+6.0	22.0	76.0	73.0	71.0	66.0	71.0	72.0	78.0
+5.0	25.0	65.0	66.0	66.4	65.0	67.0	66.0	60.0
+9.0	28.0	77.0	69.0	66.5	66.0	68.0	66.0	62.0
+5.0	14.0	77.0	82.0	64.5	64.0	66.0	66.0	65.0
+8.0	14.0	87.0	90.0	76.7	75.0	78.0	78.0	65.0
+2.0	23.0	51.0	51.0	50.7	49.0	53.0	51.0	43.0
+4.0	8.0	68.0	77.0	57.1	57.0	61.0	57.0	41.0
+10.0	11.0	57.0	60.0	61.4	58.0	66.0	61.0	58.0
+6.0	30.0	79.0	74.0	72.8	71.0	76.0	72.0	87.0
+7.0	26.0	80.0	85.0	77.2	73.0	79.0	76.0	74.0
+5.0	6.0	60.0	68.0	62.8	61.0	64.0	61.0	64.0
+2.0	11.0	62.0	56.0	49.5	46.0	53.0	50.0	37.0
+4.0	2.0	73.0	71.0	56.2	55.0	58.0	58.0	45.0
+10.0	16.0	60.0	62.0	59.5	57.0	60.0	59.0	40.0
+7.0	28.0	79.0	83.0	77.3	76.0	80.0	78.0	76.0
+5.0	19.0	71.0	64.0	65.4	62.0	68.0	67.0	56.0
+1.0	27.0	54.0	56.0	48.4	45.0	51.0	49.0	54.0
+12.0	25.0	40.0	41.0	45.1	42.0	49.0	44.0	31.0
+5.0	24.0	66.0	65.0	66.2	66.0	71.0	66.0	67.0
+11.0	4.0	57.0	65.0	53.7	49.0	55.0	54.0	38.0
+1.0	5.0	41.0	40.0	46.0	46.0	46.0	46.0	41.0
+1.0	1.0	45.0	45.0	45.6	43.0	50.0	44.0	29.0
+11.0	26.0	52.0	52.0	48.4	48.0	50.0	47.0	58.0
+11.0	12.0	64.0	63.0	51.7	50.0	52.0	52.0	63.0
+11.0	30.0	52.0	52.0	47.6	47.0	52.0	49.0	44.0
+4.0	13.0	58.0	60.0	57.9	55.0	62.0	56.0	77.0
+8.0	23.0	84.0	81.0	75.7	73.0	78.0	77.0	89.0
+7.0	14.0	77.0	75.0	75.8	74.0	76.0	77.0	77.0
+11.0	13.0	63.0	59.0	51.4	48.0	56.0	50.0	64.0
+8.0	9.0	72.0	73.0	77.1	77.0	80.0	79.0	94.0
+8.0	4.0	73.0	75.0	77.3	73.0	79.0	78.0	66.0
+4.0	16.0	59.0	60.0	58.5	56.0	60.0	59.0	59.0
+6.0	23.0	73.0	75.0	71.3	68.0	72.0	71.0	56.0
+4.0	11.0	66.0	59.0	57.6	56.0	60.0	58.0	40.0
+2.0	6.0	49.0	53.0	49.1	47.0	53.0	49.0	56.0
+8.0	6.0	80.0	79.0	77.2	76.0	81.0	79.0	60.0
+3.0	5.0	59.0	57.0	52.1	49.0	53.0	51.0	46.0
+6.0	2.0	79.0	75.0	67.6	64.0	71.0	67.0	77.0
+9.0	20.0	69.0	71.0	69.4	67.0	73.0	69.0	81.0
+2.0	19.0	57.0	53.0	50.2	50.0	52.0	51.0	42.0
+2.0	2.0	47.0	46.0	48.8	48.0	50.0	50.0	56.0
+7.0	22.0	82.0	81.0	76.9	72.0	77.0	76.0	70.0
+11.0	24.0	54.0	49.0	48.9	47.0	53.0	48.0	29.0
+1.0	28.0	56.0	57.0	48.4	44.0	52.0	48.0	34.0
+10.0	18.0	60.0	60.0	58.8	54.0	60.0	57.0	53.0
+9.0	4.0	70.0	67.0	73.7	72.0	77.0	75.0	64.0
+10.0	4.0	65.0	61.0	64.1	62.0	69.0	65.0	60.0
+6.0	14.0	70.0	66.0	69.5	66.0	71.0	69.0	85.0
+11.0	11.0	65.0	64.0	51.9	50.0	53.0	52.0	55.0
+5.0	21.0	63.0	66.0	65.7	62.0	67.0	65.0	49.0
+3.0	6.0	57.0	64.0	52.2	52.0	53.0	51.0	49.0
+5.0	18.0	60.0	71.0	65.2	61.0	68.0	65.0	56.0
+5.0	11.0	67.0	75.0	63.8	62.0	68.0	63.0	60.0
+1.0	9.0	45.0	48.0	46.4	46.0	50.0	45.0	47.0
+3.0	8.0	60.0	53.0	52.5	48.0	56.0	51.0	70.0
+1.0	15.0	55.0	49.0	47.1	46.0	51.0	46.0	65.0
+6.0	8.0	86.0	85.0	68.5	67.0	70.0	69.0	81.0
+2.0	10.0	57.0	62.0	49.4	48.0	50.0	49.0	30.0
+12.0	3.0	46.0	50.0	47.0	42.0	52.0	47.0	58.0
+10.0	27.0	65.0	58.0	55.9	51.0	60.0	55.0	39.0
+8.0	7.0	79.0	72.0	77.2	74.0	78.0	77.0	95.0
+11.0	16.0	57.0	55.0	50.7	50.0	51.0	49.0	34.0
+9.0	10.0	72.0	74.0	72.3	70.0	77.0	74.0	91.0
+7.0	29.0	83.0	85.0	77.3	77.0	80.0	79.0	77.0
+8.0	3.0	77.0	73.0	77.3	77.0	81.0	77.0	93.0
+12.0	1.0	52.0	52.0	47.4	44.0	48.0	49.0	39.0
+9.0	25.0	64.0	67.0	67.6	64.0	72.0	67.0	62.0
+12.0	23.0	49.0	45.0	45.1	45.0	49.0	44.0	35.0
+12.0	2.0	52.0	46.0	47.2	46.0	51.0	49.0	41.0
+10.0	13.0	62.0	66.0	60.6	60.0	62.0	60.0	57.0
+7.0	23.0	81.0	71.0	77.0	75.0	81.0	76.0	86.0
+6.0	13.0	65.0	70.0	69.3	66.0	72.0	69.0	79.0
+2.0	15.0	55.0	58.0	49.9	46.0	52.0	49.0	53.0
+8.0	8.0	72.0	72.0	77.1	76.0	78.0	77.0	65.0
+7.0	12.0	74.0	74.0	75.4	74.0	77.0	77.0	71.0
+10.0	3.0	63.0	65.0	64.5	63.0	68.0	65.0	49.0
+4.0	18.0	68.0	77.0	58.8	55.0	59.0	57.0	39.0
+2.0	25.0	60.0	59.0	50.9	49.0	51.0	49.0	35.0
+1.0	2.0	44.0	45.0	45.7	41.0	50.0	44.0	61.0
+2.0	21.0	51.0	53.0	50.5	49.0	54.0	52.0	46.0
+3.0	24.0	57.0	53.0	54.9	54.0	56.0	56.0	72.0
+7.0	27.0	85.0	79.0	77.3	73.0	78.0	79.0	79.0
+2.0	4.0	51.0	49.0	49.0	44.0	54.0	51.0	44.0
+10.0	7.0	66.0	63.0	62.9	62.0	67.0	64.0	78.0
+4.0	4.0	63.0	69.0	56.5	54.0	59.0	56.0	45.0
+2.0	24.0	51.0	60.0	50.8	47.0	53.0	50.0	46.0
+10.0	8.0	63.0	64.0	62.5	60.0	65.0	61.0	73.0
+9.0	15.0	75.0	79.0	71.0	66.0	76.0	69.0	64.0
+1.0	14.0	49.0	55.0	47.0	43.0	47.0	46.0	58.0
+4.0	1.0	68.0	73.0	56.0	54.0	59.0	55.0	41.0
+10.0	17.0	62.0	60.0	59.1	57.0	63.0	59.0	62.0
+6.0	18.0	71.0	67.0	70.2	67.0	75.0	69.0	77.0
+12.0	26.0	41.0	42.0	45.2	45.0	48.0	46.0	58.0
+5.0	17.0	57.0	60.0	65.0	62.0	65.0	65.0	55.0
+11.0	20.0	55.0	57.0	49.8	47.0	54.0	48.0	30.0
+12.0	18.0	35.0	35.0	45.2	44.0	46.0	46.0	36.0
+9.0	17.0	71.0	75.0	70.3	66.0	73.0	70.0	84.0
+2.0	26.0	59.0	61.0	51.1	48.0	56.0	53.0	65.0
+2.0	22.0	53.0	51.0	50.6	46.0	51.0	50.0	59.0
+6.0	26.0	69.0	71.0	71.9	67.0	74.0	72.0	70.0
+7.0	11.0	71.0	74.0	75.3	74.0	79.0	75.0	71.0
+12.0	30.0	48.0	48.0	45.4	44.0	46.0	44.0	42.0
+7.0	9.0	68.0	74.0	74.9	70.0	79.0	76.0	60.0
+6.0	21.0	70.0	76.0	70.8	68.0	75.0	71.0	57.0
+3.0	2.0	54.0	58.0	51.6	47.0	54.0	52.0	37.0
+2.0	20.0	53.0	51.0	50.4	48.0	55.0	51.0	43.0
+9.0	9.0	67.0	72.0	72.6	68.0	77.0	71.0	78.0
+9.0	26.0	67.0	76.0	67.2	64.0	69.0	69.0	74.0
+1.0	22.0	52.0	52.0	47.9	47.0	48.0	48.0	60.0
+11.0	27.0	52.0	53.0	48.2	48.0	49.0	49.0	53.0
+6.0	12.0	67.0	65.0	69.1	65.0	73.0	70.0	83.0
+10.0	20.0	61.0	58.0	58.1	58.0	59.0	58.0	43.0
+7.0	13.0	74.0	77.0	75.6	74.0	78.0	76.0	56.0
+11.0	7.0	58.0	61.0	52.9	51.0	56.0	51.0	35.0
+10.0	1.0	66.0	67.0	65.3	64.0	70.0	64.0	54.0
+11.0	22.0	55.0	54.0	49.3	46.0	54.0	49.0	58.0
+6.0	1.0	71.0	79.0	67.4	65.0	69.0	66.0	58.0
+5.0	13.0	81.0	77.0	64.3	63.0	67.0	66.0	67.0
+6.0	3.0	75.0	71.0	67.7	64.0	71.0	66.0	55.0
+4.0	12.0	59.0	58.0	57.7	54.0	59.0	57.0	61.0
+3.0	31.0	64.0	68.0	55.9	55.0	59.0	56.0	56.0
+12.0	14.0	43.0	40.0	45.4	45.0	48.0	45.0	49.0
+8.0	5.0	75.0	80.0	77.3	75.0	81.0	78.0	71.0
+5.0	4.0	87.0	74.0	62.3	59.0	65.0	64.0	61.0
+12.0	31.0	48.0	57.0	45.5	42.0	48.0	47.0	57.0
+1.0	21.0	48.0	52.0	47.8	43.0	51.0	46.0	57.0
+7.0	10.0	74.0	71.0	75.1	71.0	77.0	76.0	95.0
+3.0	15.0	54.0	49.0	53.6	49.0	58.0	52.0	70.0
+4.0	19.0	77.0	89.0	59.0	59.0	63.0	59.0	61.0
+10.0	14.0	66.0	60.0	60.2	56.0	64.0	60.0	78.0
+4.0	15.0	59.0	59.0	58.3	58.0	61.0	60.0	40.0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/feature_selection_result06	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,262 @@
+month	day	temp_2	temp_1	average	forecast_noaa	forecast_acc	forecast_under	friend
+9.0	19.0	68.0	69.0	69.7	65.0	74.0	71.0	88.0
+4.0	14.0	60.0	59.0	58.1	57.0	63.0	58.0	66.0
+7.0	30.0	85.0	88.0	77.3	75.0	79.0	77.0	70.0
+5.0	15.0	82.0	65.0	64.7	63.0	69.0	64.0	58.0
+1.0	18.0	54.0	50.0	47.5	44.0	48.0	49.0	58.0
+1.0	25.0	48.0	51.0	48.2	45.0	51.0	49.0	63.0
+11.0	25.0	49.0	52.0	48.6	45.0	52.0	47.0	41.0
+7.0	20.0	73.0	78.0	76.7	75.0	78.0	77.0	66.0
+12.0	17.0	39.0	35.0	45.2	43.0	47.0	46.0	38.0
+12.0	8.0	42.0	40.0	46.1	45.0	51.0	47.0	36.0
+12.0	28.0	42.0	47.0	45.3	41.0	49.0	44.0	58.0
+7.0	17.0	76.0	72.0	76.3	76.0	78.0	77.0	88.0
+7.0	7.0	69.0	76.0	74.4	73.0	77.0	74.0	72.0
+12.0	15.0	40.0	39.0	45.3	45.0	49.0	47.0	46.0
+6.0	27.0	71.0	78.0	72.2	70.0	74.0	72.0	84.0
+5.0	31.0	64.0	71.0	67.3	63.0	72.0	68.0	85.0
+1.0	20.0	54.0	48.0	47.7	44.0	52.0	49.0	61.0
+8.0	10.0	73.0	72.0	77.0	77.0	78.0	77.0	68.0
+3.0	23.0	56.0	57.0	54.7	50.0	58.0	55.0	70.0
+12.0	24.0	45.0	40.0	45.1	44.0	47.0	46.0	39.0
+1.0	19.0	50.0	54.0	47.6	47.0	49.0	48.0	53.0
+11.0	6.0	65.0	58.0	53.2	52.0	57.0	55.0	71.0
+4.0	17.0	60.0	68.0	58.6	58.0	62.0	59.0	54.0
+10.0	29.0	60.0	65.0	55.3	55.0	59.0	55.0	65.0
+2.0	1.0	48.0	47.0	48.8	46.0	49.0	49.0	51.0
+12.0	12.0	44.0	44.0	45.6	43.0	50.0	45.0	42.0
+5.0	30.0	64.0	64.0	67.1	64.0	70.0	66.0	69.0
+10.0	23.0	59.0	62.0	57.1	57.0	58.0	59.0	67.0
+9.0	30.0	68.0	66.0	65.7	64.0	67.0	65.0	74.0
+9.0	12.0	77.0	70.0	71.8	67.0	73.0	73.0	90.0
+11.0	2.0	59.0	57.0	54.2	54.0	58.0	55.0	70.0
+11.0	17.0	55.0	50.0	50.5	46.0	51.0	50.0	57.0
+3.0	3.0	58.0	55.0	51.8	49.0	54.0	50.0	71.0
+11.0	21.0	57.0	55.0	49.5	46.0	51.0	49.0	67.0
+12.0	27.0	42.0	42.0	45.2	41.0	50.0	47.0	47.0
+4.0	24.0	64.0	65.0	60.1	57.0	61.0	60.0	41.0
+5.0	20.0	64.0	63.0	65.6	63.0	70.0	64.0	73.0
+1.0	16.0	49.0	48.0	47.3	45.0	52.0	46.0	28.0
+12.0	7.0	40.0	42.0	46.3	44.0	51.0	46.0	62.0
+1.0	7.0	44.0	51.0	46.2	45.0	49.0	46.0	38.0
+9.0	24.0	67.0	64.0	68.0	65.0	71.0	66.0	64.0
+8.0	30.0	79.0	75.0	74.6	74.0	76.0	75.0	63.0
+1.0	11.0	50.0	52.0	46.7	42.0	48.0	48.0	39.0
+6.0	9.0	85.0	67.0	68.6	66.0	73.0	69.0	80.0
+9.0	22.0	67.0	68.0	68.7	65.0	70.0	69.0	56.0
+3.0	25.0	53.0	54.0	55.0	53.0	57.0	57.0	42.0
+10.0	24.0	62.0	62.0	56.8	52.0	61.0	57.0	70.0
+7.0	16.0	77.0	76.0	76.1	76.0	78.0	75.0	61.0
+7.0	1.0	74.0	73.0	73.1	71.0	75.0	72.0	93.0
+11.0	18.0	50.0	52.0	50.3	50.0	53.0	50.0	35.0
+9.0	3.0	75.0	70.0	73.9	71.0	75.0	73.0	68.0
+8.0	2.0	73.0	77.0	77.4	75.0	80.0	79.0	62.0
+4.0	5.0	69.0	60.0	56.6	52.0	58.0	56.0	72.0
+3.0	13.0	55.0	52.0	53.3	50.0	55.0	53.0	54.0
+8.0	28.0	81.0	79.0	75.0	71.0	77.0	76.0	85.0
+4.0	9.0	77.0	76.0	57.2	53.0	61.0	57.0	74.0
+5.0	26.0	66.0	66.0	66.5	64.0	70.0	65.0	85.0
+10.0	10.0	68.0	57.0	61.8	58.0	64.0	61.0	62.0
+4.0	10.0	76.0	66.0	57.4	57.0	60.0	57.0	60.0
+10.0	19.0	60.0	61.0	58.4	58.0	60.0	57.0	41.0
+3.0	12.0	56.0	55.0	53.1	52.0	58.0	53.0	65.0
+1.0	24.0	57.0	48.0	48.1	46.0	50.0	48.0	54.0
+2.0	7.0	53.0	49.0	49.2	46.0	51.0	48.0	63.0
+5.0	27.0	66.0	65.0	66.7	64.0	67.0	68.0	73.0
+5.0	5.0	74.0	60.0	62.5	58.0	66.0	62.0	56.0
+3.0	11.0	55.0	56.0	53.0	53.0	53.0	51.0	36.0
+10.0	22.0	62.0	59.0	57.4	56.0	59.0	58.0	44.0
+12.0	11.0	36.0	44.0	45.7	41.0	46.0	47.0	35.0
+5.0	8.0	77.0	82.0	63.2	62.0	65.0	63.0	83.0
+5.0	29.0	64.0	64.0	67.0	65.0	71.0	65.0	76.0
+12.0	13.0	44.0	43.0	45.5	41.0	47.0	46.0	46.0
+3.0	30.0	56.0	64.0	55.7	51.0	57.0	56.0	57.0
+11.0	8.0	61.0	63.0	52.7	49.0	57.0	52.0	49.0
+6.0	20.0	65.0	70.0	70.6	67.0	71.0	70.0	79.0
+11.0	9.0	63.0	71.0	52.4	48.0	56.0	52.0	42.0
+7.0	3.0	76.0	76.0	73.5	69.0	76.0	75.0	85.0
+10.0	9.0	64.0	68.0	62.1	58.0	65.0	63.0	55.0
+12.0	16.0	39.0	39.0	45.3	44.0	49.0	44.0	39.0
+9.0	16.0	79.0	71.0	70.7	70.0	74.0	71.0	52.0
+6.0	25.0	68.0	69.0	71.7	68.0	73.0	73.0	89.0
+9.0	13.0	70.0	74.0	71.5	71.0	75.0	70.0	82.0
+5.0	12.0	75.0	81.0	64.1	62.0	67.0	63.0	81.0
+2.0	8.0	49.0	51.0	49.3	49.0	52.0	50.0	34.0
+1.0	12.0	52.0	45.0	46.8	44.0	50.0	45.0	61.0
+8.0	13.0	80.0	87.0	76.8	73.0	79.0	78.0	73.0
+7.0	4.0	76.0	71.0	73.8	71.0	76.0	73.0	86.0
+4.0	25.0	65.0	55.0	60.3	56.0	64.0	61.0	77.0
+8.0	12.0	76.0	80.0	76.9	72.0	79.0	77.0	81.0
+9.0	21.0	71.0	67.0	69.0	65.0	70.0	70.0	76.0
+4.0	30.0	64.0	61.0	61.4	60.0	65.0	62.0	78.0
+12.0	5.0	49.0	46.0	46.6	43.0	50.0	45.0	65.0
+12.0	19.0	35.0	39.0	45.1	42.0	46.0	45.0	51.0
+9.0	23.0	68.0	67.0	68.3	67.0	69.0	67.0	61.0
+11.0	29.0	48.0	52.0	47.8	43.0	48.0	47.0	50.0
+6.0	16.0	60.0	67.0	69.8	68.0	72.0	71.0	87.0
+9.0	14.0	74.0	75.0	71.2	67.0	75.0	73.0	77.0
+9.0	6.0	68.0	68.0	73.3	73.0	76.0	75.0	79.0
+6.0	6.0	81.0	92.0	68.2	65.0	70.0	67.0	71.0
+9.0	8.0	68.0	67.0	72.8	69.0	77.0	73.0	56.0
+1.0	3.0	45.0	44.0	45.8	43.0	46.0	47.0	56.0
+4.0	28.0	60.0	61.0	61.0	56.0	65.0	62.0	73.0
+11.0	5.0	65.0	65.0	53.4	49.0	58.0	52.0	41.0
+9.0	7.0	68.0	68.0	73.0	72.0	78.0	71.0	70.0
+5.0	3.0	77.0	87.0	62.1	62.0	66.0	64.0	69.0
+10.0	31.0	65.0	117.0	54.8	51.0	59.0	56.0	62.0
+7.0	18.0	72.0	80.0	76.4	75.0	77.0	75.0	66.0
+11.0	15.0	55.0	57.0	51.0	47.0	54.0	51.0	46.0
+5.0	10.0	63.0	67.0	63.6	61.0	66.0	64.0	68.0
+3.0	18.0	53.0	58.0	54.0	51.0	57.0	54.0	56.0
+10.0	26.0	61.0	65.0	56.2	53.0	57.0	57.0	41.0
+1.0	30.0	56.0	52.0	48.6	45.0	51.0	48.0	47.0
+3.0	27.0	57.0	59.0	55.3	52.0	58.0	55.0	39.0
+11.0	3.0	57.0	57.0	53.9	53.0	54.0	54.0	35.0
+4.0	20.0	89.0	81.0	59.2	56.0	63.0	61.0	66.0
+7.0	24.0	71.0	75.0	77.1	76.0	78.0	78.0	75.0
+7.0	31.0	88.0	76.0	77.4	76.0	78.0	79.0	95.0
+5.0	16.0	65.0	57.0	64.8	61.0	65.0	65.0	53.0
+7.0	6.0	68.0	69.0	74.2	72.0	76.0	75.0	86.0
+9.0	27.0	76.0	77.0	66.8	66.0	67.0	68.0	64.0
+2.0	16.0	58.0	55.0	49.9	47.0	54.0	51.0	55.0
+12.0	4.0	50.0	49.0	46.8	45.0	47.0	47.0	53.0
+3.0	9.0	53.0	54.0	52.7	48.0	56.0	54.0	57.0
+11.0	14.0	59.0	55.0	51.2	49.0	53.0	53.0	42.0
+3.0	29.0	51.0	56.0	55.6	53.0	59.0	54.0	45.0
+7.0	8.0	76.0	68.0	74.6	72.0	79.0	75.0	77.0
+3.0	14.0	52.0	54.0	53.4	49.0	58.0	55.0	44.0
+6.0	11.0	65.0	67.0	69.0	69.0	72.0	71.0	87.0
+1.0	13.0	45.0	49.0	46.9	45.0	51.0	46.0	33.0
+2.0	5.0	49.0	49.0	49.1	47.0	50.0	49.0	45.0
+1.0	29.0	57.0	56.0	48.5	48.0	52.0	47.0	49.0
+6.0	22.0	76.0	73.0	71.0	66.0	71.0	72.0	78.0
+5.0	25.0	65.0	66.0	66.4	65.0	67.0	66.0	60.0
+9.0	28.0	77.0	69.0	66.5	66.0	68.0	66.0	62.0
+5.0	14.0	77.0	82.0	64.5	64.0	66.0	66.0	65.0
+8.0	14.0	87.0	90.0	76.7	75.0	78.0	78.0	65.0
+2.0	23.0	51.0	51.0	50.7	49.0	53.0	51.0	43.0
+4.0	8.0	68.0	77.0	57.1	57.0	61.0	57.0	41.0
+10.0	11.0	57.0	60.0	61.4	58.0	66.0	61.0	58.0
+6.0	30.0	79.0	74.0	72.8	71.0	76.0	72.0	87.0
+7.0	26.0	80.0	85.0	77.2	73.0	79.0	76.0	74.0
+5.0	6.0	60.0	68.0	62.8	61.0	64.0	61.0	64.0
+2.0	11.0	62.0	56.0	49.5	46.0	53.0	50.0	37.0
+4.0	2.0	73.0	71.0	56.2	55.0	58.0	58.0	45.0
+10.0	16.0	60.0	62.0	59.5	57.0	60.0	59.0	40.0
+7.0	28.0	79.0	83.0	77.3	76.0	80.0	78.0	76.0
+5.0	19.0	71.0	64.0	65.4	62.0	68.0	67.0	56.0
+1.0	27.0	54.0	56.0	48.4	45.0	51.0	49.0	54.0
+12.0	25.0	40.0	41.0	45.1	42.0	49.0	44.0	31.0
+5.0	24.0	66.0	65.0	66.2	66.0	71.0	66.0	67.0
+11.0	4.0	57.0	65.0	53.7	49.0	55.0	54.0	38.0
+1.0	5.0	41.0	40.0	46.0	46.0	46.0	46.0	41.0
+1.0	1.0	45.0	45.0	45.6	43.0	50.0	44.0	29.0
+11.0	26.0	52.0	52.0	48.4	48.0	50.0	47.0	58.0
+11.0	12.0	64.0	63.0	51.7	50.0	52.0	52.0	63.0
+11.0	30.0	52.0	52.0	47.6	47.0	52.0	49.0	44.0
+4.0	13.0	58.0	60.0	57.9	55.0	62.0	56.0	77.0
+8.0	23.0	84.0	81.0	75.7	73.0	78.0	77.0	89.0
+7.0	14.0	77.0	75.0	75.8	74.0	76.0	77.0	77.0
+11.0	13.0	63.0	59.0	51.4	48.0	56.0	50.0	64.0
+8.0	9.0	72.0	73.0	77.1	77.0	80.0	79.0	94.0
+8.0	4.0	73.0	75.0	77.3	73.0	79.0	78.0	66.0
+4.0	16.0	59.0	60.0	58.5	56.0	60.0	59.0	59.0
+6.0	23.0	73.0	75.0	71.3	68.0	72.0	71.0	56.0
+4.0	11.0	66.0	59.0	57.6	56.0	60.0	58.0	40.0
+2.0	6.0	49.0	53.0	49.1	47.0	53.0	49.0	56.0
+8.0	6.0	80.0	79.0	77.2	76.0	81.0	79.0	60.0
+3.0	5.0	59.0	57.0	52.1	49.0	53.0	51.0	46.0
+6.0	2.0	79.0	75.0	67.6	64.0	71.0	67.0	77.0
+9.0	20.0	69.0	71.0	69.4	67.0	73.0	69.0	81.0
+2.0	19.0	57.0	53.0	50.2	50.0	52.0	51.0	42.0
+2.0	2.0	47.0	46.0	48.8	48.0	50.0	50.0	56.0
+7.0	22.0	82.0	81.0	76.9	72.0	77.0	76.0	70.0
+11.0	24.0	54.0	49.0	48.9	47.0	53.0	48.0	29.0
+1.0	28.0	56.0	57.0	48.4	44.0	52.0	48.0	34.0
+10.0	18.0	60.0	60.0	58.8	54.0	60.0	57.0	53.0
+9.0	4.0	70.0	67.0	73.7	72.0	77.0	75.0	64.0
+10.0	4.0	65.0	61.0	64.1	62.0	69.0	65.0	60.0
+6.0	14.0	70.0	66.0	69.5	66.0	71.0	69.0	85.0
+11.0	11.0	65.0	64.0	51.9	50.0	53.0	52.0	55.0
+5.0	21.0	63.0	66.0	65.7	62.0	67.0	65.0	49.0
+3.0	6.0	57.0	64.0	52.2	52.0	53.0	51.0	49.0
+5.0	18.0	60.0	71.0	65.2	61.0	68.0	65.0	56.0
+5.0	11.0	67.0	75.0	63.8	62.0	68.0	63.0	60.0
+1.0	9.0	45.0	48.0	46.4	46.0	50.0	45.0	47.0
+3.0	8.0	60.0	53.0	52.5	48.0	56.0	51.0	70.0
+1.0	15.0	55.0	49.0	47.1	46.0	51.0	46.0	65.0
+6.0	8.0	86.0	85.0	68.5	67.0	70.0	69.0	81.0
+2.0	10.0	57.0	62.0	49.4	48.0	50.0	49.0	30.0
+12.0	3.0	46.0	50.0	47.0	42.0	52.0	47.0	58.0
+10.0	27.0	65.0	58.0	55.9	51.0	60.0	55.0	39.0
+8.0	7.0	79.0	72.0	77.2	74.0	78.0	77.0	95.0
+11.0	16.0	57.0	55.0	50.7	50.0	51.0	49.0	34.0
+9.0	10.0	72.0	74.0	72.3	70.0	77.0	74.0	91.0
+7.0	29.0	83.0	85.0	77.3	77.0	80.0	79.0	77.0
+8.0	3.0	77.0	73.0	77.3	77.0	81.0	77.0	93.0
+12.0	1.0	52.0	52.0	47.4	44.0	48.0	49.0	39.0
+9.0	25.0	64.0	67.0	67.6	64.0	72.0	67.0	62.0
+12.0	23.0	49.0	45.0	45.1	45.0	49.0	44.0	35.0
+12.0	2.0	52.0	46.0	47.2	46.0	51.0	49.0	41.0
+10.0	13.0	62.0	66.0	60.6	60.0	62.0	60.0	57.0
+7.0	23.0	81.0	71.0	77.0	75.0	81.0	76.0	86.0
+6.0	13.0	65.0	70.0	69.3	66.0	72.0	69.0	79.0
+2.0	15.0	55.0	58.0	49.9	46.0	52.0	49.0	53.0
+8.0	8.0	72.0	72.0	77.1	76.0	78.0	77.0	65.0
+7.0	12.0	74.0	74.0	75.4	74.0	77.0	77.0	71.0
+10.0	3.0	63.0	65.0	64.5	63.0	68.0	65.0	49.0
+4.0	18.0	68.0	77.0	58.8	55.0	59.0	57.0	39.0
+2.0	25.0	60.0	59.0	50.9	49.0	51.0	49.0	35.0
+1.0	2.0	44.0	45.0	45.7	41.0	50.0	44.0	61.0
+2.0	21.0	51.0	53.0	50.5	49.0	54.0	52.0	46.0
+3.0	24.0	57.0	53.0	54.9	54.0	56.0	56.0	72.0
+7.0	27.0	85.0	79.0	77.3	73.0	78.0	79.0	79.0
+2.0	4.0	51.0	49.0	49.0	44.0	54.0	51.0	44.0
+10.0	7.0	66.0	63.0	62.9	62.0	67.0	64.0	78.0
+4.0	4.0	63.0	69.0	56.5	54.0	59.0	56.0	45.0
+2.0	24.0	51.0	60.0	50.8	47.0	53.0	50.0	46.0
+10.0	8.0	63.0	64.0	62.5	60.0	65.0	61.0	73.0
+9.0	15.0	75.0	79.0	71.0	66.0	76.0	69.0	64.0
+1.0	14.0	49.0	55.0	47.0	43.0	47.0	46.0	58.0
+4.0	1.0	68.0	73.0	56.0	54.0	59.0	55.0	41.0
+10.0	17.0	62.0	60.0	59.1	57.0	63.0	59.0	62.0
+6.0	18.0	71.0	67.0	70.2	67.0	75.0	69.0	77.0
+12.0	26.0	41.0	42.0	45.2	45.0	48.0	46.0	58.0
+5.0	17.0	57.0	60.0	65.0	62.0	65.0	65.0	55.0
+11.0	20.0	55.0	57.0	49.8	47.0	54.0	48.0	30.0
+12.0	18.0	35.0	35.0	45.2	44.0	46.0	46.0	36.0
+9.0	17.0	71.0	75.0	70.3	66.0	73.0	70.0	84.0
+2.0	26.0	59.0	61.0	51.1	48.0	56.0	53.0	65.0
+2.0	22.0	53.0	51.0	50.6	46.0	51.0	50.0	59.0
+6.0	26.0	69.0	71.0	71.9	67.0	74.0	72.0	70.0
+7.0	11.0	71.0	74.0	75.3	74.0	79.0	75.0	71.0
+12.0	30.0	48.0	48.0	45.4	44.0	46.0	44.0	42.0
+7.0	9.0	68.0	74.0	74.9	70.0	79.0	76.0	60.0
+6.0	21.0	70.0	76.0	70.8	68.0	75.0	71.0	57.0
+3.0	2.0	54.0	58.0	51.6	47.0	54.0	52.0	37.0
+2.0	20.0	53.0	51.0	50.4	48.0	55.0	51.0	43.0
+9.0	9.0	67.0	72.0	72.6	68.0	77.0	71.0	78.0
+9.0	26.0	67.0	76.0	67.2	64.0	69.0	69.0	74.0
+1.0	22.0	52.0	52.0	47.9	47.0	48.0	48.0	60.0
+11.0	27.0	52.0	53.0	48.2	48.0	49.0	49.0	53.0
+6.0	12.0	67.0	65.0	69.1	65.0	73.0	70.0	83.0
+10.0	20.0	61.0	58.0	58.1	58.0	59.0	58.0	43.0
+7.0	13.0	74.0	77.0	75.6	74.0	78.0	76.0	56.0
+11.0	7.0	58.0	61.0	52.9	51.0	56.0	51.0	35.0
+10.0	1.0	66.0	67.0	65.3	64.0	70.0	64.0	54.0
+11.0	22.0	55.0	54.0	49.3	46.0	54.0	49.0	58.0
+6.0	1.0	71.0	79.0	67.4	65.0	69.0	66.0	58.0
+5.0	13.0	81.0	77.0	64.3	63.0	67.0	66.0	67.0
+6.0	3.0	75.0	71.0	67.7	64.0	71.0	66.0	55.0
+4.0	12.0	59.0	58.0	57.7	54.0	59.0	57.0	61.0
+3.0	31.0	64.0	68.0	55.9	55.0	59.0	56.0	56.0
+12.0	14.0	43.0	40.0	45.4	45.0	48.0	45.0	49.0
+8.0	5.0	75.0	80.0	77.3	75.0	81.0	78.0	71.0
+5.0	4.0	87.0	74.0	62.3	59.0	65.0	64.0	61.0
+12.0	31.0	48.0	57.0	45.5	42.0	48.0	47.0	57.0
+1.0	21.0	48.0	52.0	47.8	43.0	51.0	46.0	57.0
+7.0	10.0	74.0	71.0	75.1	71.0	77.0	76.0	95.0
+3.0	15.0	54.0	49.0	53.6	49.0	58.0	52.0	70.0
+4.0	19.0	77.0	89.0	59.0	59.0	63.0	59.0	61.0
+10.0	14.0	66.0	60.0	60.2	56.0	64.0	60.0	78.0
+4.0	15.0	59.0	59.0	58.3	58.0	61.0	60.0	40.0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/feature_selection_result07	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,262 @@
+month	day	temp_2	temp_1	average	forecast_noaa	forecast_acc	forecast_under	friend
+9.0	19.0	68.0	69.0	69.7	65.0	74.0	71.0	88.0
+4.0	14.0	60.0	59.0	58.1	57.0	63.0	58.0	66.0
+7.0	30.0	85.0	88.0	77.3	75.0	79.0	77.0	70.0
+5.0	15.0	82.0	65.0	64.7	63.0	69.0	64.0	58.0
+1.0	18.0	54.0	50.0	47.5	44.0	48.0	49.0	58.0
+1.0	25.0	48.0	51.0	48.2	45.0	51.0	49.0	63.0
+11.0	25.0	49.0	52.0	48.6	45.0	52.0	47.0	41.0
+7.0	20.0	73.0	78.0	76.7	75.0	78.0	77.0	66.0
+12.0	17.0	39.0	35.0	45.2	43.0	47.0	46.0	38.0
+12.0	8.0	42.0	40.0	46.1	45.0	51.0	47.0	36.0
+12.0	28.0	42.0	47.0	45.3	41.0	49.0	44.0	58.0
+7.0	17.0	76.0	72.0	76.3	76.0	78.0	77.0	88.0
+7.0	7.0	69.0	76.0	74.4	73.0	77.0	74.0	72.0
+12.0	15.0	40.0	39.0	45.3	45.0	49.0	47.0	46.0
+6.0	27.0	71.0	78.0	72.2	70.0	74.0	72.0	84.0
+5.0	31.0	64.0	71.0	67.3	63.0	72.0	68.0	85.0
+1.0	20.0	54.0	48.0	47.7	44.0	52.0	49.0	61.0
+8.0	10.0	73.0	72.0	77.0	77.0	78.0	77.0	68.0
+3.0	23.0	56.0	57.0	54.7	50.0	58.0	55.0	70.0
+12.0	24.0	45.0	40.0	45.1	44.0	47.0	46.0	39.0
+1.0	19.0	50.0	54.0	47.6	47.0	49.0	48.0	53.0
+11.0	6.0	65.0	58.0	53.2	52.0	57.0	55.0	71.0
+4.0	17.0	60.0	68.0	58.6	58.0	62.0	59.0	54.0
+10.0	29.0	60.0	65.0	55.3	55.0	59.0	55.0	65.0
+2.0	1.0	48.0	47.0	48.8	46.0	49.0	49.0	51.0
+12.0	12.0	44.0	44.0	45.6	43.0	50.0	45.0	42.0
+5.0	30.0	64.0	64.0	67.1	64.0	70.0	66.0	69.0
+10.0	23.0	59.0	62.0	57.1	57.0	58.0	59.0	67.0
+9.0	30.0	68.0	66.0	65.7	64.0	67.0	65.0	74.0
+9.0	12.0	77.0	70.0	71.8	67.0	73.0	73.0	90.0
+11.0	2.0	59.0	57.0	54.2	54.0	58.0	55.0	70.0
+11.0	17.0	55.0	50.0	50.5	46.0	51.0	50.0	57.0
+3.0	3.0	58.0	55.0	51.8	49.0	54.0	50.0	71.0
+11.0	21.0	57.0	55.0	49.5	46.0	51.0	49.0	67.0
+12.0	27.0	42.0	42.0	45.2	41.0	50.0	47.0	47.0
+4.0	24.0	64.0	65.0	60.1	57.0	61.0	60.0	41.0
+5.0	20.0	64.0	63.0	65.6	63.0	70.0	64.0	73.0
+1.0	16.0	49.0	48.0	47.3	45.0	52.0	46.0	28.0
+12.0	7.0	40.0	42.0	46.3	44.0	51.0	46.0	62.0
+1.0	7.0	44.0	51.0	46.2	45.0	49.0	46.0	38.0
+9.0	24.0	67.0	64.0	68.0	65.0	71.0	66.0	64.0
+8.0	30.0	79.0	75.0	74.6	74.0	76.0	75.0	63.0
+1.0	11.0	50.0	52.0	46.7	42.0	48.0	48.0	39.0
+6.0	9.0	85.0	67.0	68.6	66.0	73.0	69.0	80.0
+9.0	22.0	67.0	68.0	68.7	65.0	70.0	69.0	56.0
+3.0	25.0	53.0	54.0	55.0	53.0	57.0	57.0	42.0
+10.0	24.0	62.0	62.0	56.8	52.0	61.0	57.0	70.0
+7.0	16.0	77.0	76.0	76.1	76.0	78.0	75.0	61.0
+7.0	1.0	74.0	73.0	73.1	71.0	75.0	72.0	93.0
+11.0	18.0	50.0	52.0	50.3	50.0	53.0	50.0	35.0
+9.0	3.0	75.0	70.0	73.9	71.0	75.0	73.0	68.0
+8.0	2.0	73.0	77.0	77.4	75.0	80.0	79.0	62.0
+4.0	5.0	69.0	60.0	56.6	52.0	58.0	56.0	72.0
+3.0	13.0	55.0	52.0	53.3	50.0	55.0	53.0	54.0
+8.0	28.0	81.0	79.0	75.0	71.0	77.0	76.0	85.0
+4.0	9.0	77.0	76.0	57.2	53.0	61.0	57.0	74.0
+5.0	26.0	66.0	66.0	66.5	64.0	70.0	65.0	85.0
+10.0	10.0	68.0	57.0	61.8	58.0	64.0	61.0	62.0
+4.0	10.0	76.0	66.0	57.4	57.0	60.0	57.0	60.0
+10.0	19.0	60.0	61.0	58.4	58.0	60.0	57.0	41.0
+3.0	12.0	56.0	55.0	53.1	52.0	58.0	53.0	65.0
+1.0	24.0	57.0	48.0	48.1	46.0	50.0	48.0	54.0
+2.0	7.0	53.0	49.0	49.2	46.0	51.0	48.0	63.0
+5.0	27.0	66.0	65.0	66.7	64.0	67.0	68.0	73.0
+5.0	5.0	74.0	60.0	62.5	58.0	66.0	62.0	56.0
+3.0	11.0	55.0	56.0	53.0	53.0	53.0	51.0	36.0
+10.0	22.0	62.0	59.0	57.4	56.0	59.0	58.0	44.0
+12.0	11.0	36.0	44.0	45.7	41.0	46.0	47.0	35.0
+5.0	8.0	77.0	82.0	63.2	62.0	65.0	63.0	83.0
+5.0	29.0	64.0	64.0	67.0	65.0	71.0	65.0	76.0
+12.0	13.0	44.0	43.0	45.5	41.0	47.0	46.0	46.0
+3.0	30.0	56.0	64.0	55.7	51.0	57.0	56.0	57.0
+11.0	8.0	61.0	63.0	52.7	49.0	57.0	52.0	49.0
+6.0	20.0	65.0	70.0	70.6	67.0	71.0	70.0	79.0
+11.0	9.0	63.0	71.0	52.4	48.0	56.0	52.0	42.0
+7.0	3.0	76.0	76.0	73.5	69.0	76.0	75.0	85.0
+10.0	9.0	64.0	68.0	62.1	58.0	65.0	63.0	55.0
+12.0	16.0	39.0	39.0	45.3	44.0	49.0	44.0	39.0
+9.0	16.0	79.0	71.0	70.7	70.0	74.0	71.0	52.0
+6.0	25.0	68.0	69.0	71.7	68.0	73.0	73.0	89.0
+9.0	13.0	70.0	74.0	71.5	71.0	75.0	70.0	82.0
+5.0	12.0	75.0	81.0	64.1	62.0	67.0	63.0	81.0
+2.0	8.0	49.0	51.0	49.3	49.0	52.0	50.0	34.0
+1.0	12.0	52.0	45.0	46.8	44.0	50.0	45.0	61.0
+8.0	13.0	80.0	87.0	76.8	73.0	79.0	78.0	73.0
+7.0	4.0	76.0	71.0	73.8	71.0	76.0	73.0	86.0
+4.0	25.0	65.0	55.0	60.3	56.0	64.0	61.0	77.0
+8.0	12.0	76.0	80.0	76.9	72.0	79.0	77.0	81.0
+9.0	21.0	71.0	67.0	69.0	65.0	70.0	70.0	76.0
+4.0	30.0	64.0	61.0	61.4	60.0	65.0	62.0	78.0
+12.0	5.0	49.0	46.0	46.6	43.0	50.0	45.0	65.0
+12.0	19.0	35.0	39.0	45.1	42.0	46.0	45.0	51.0
+9.0	23.0	68.0	67.0	68.3	67.0	69.0	67.0	61.0
+11.0	29.0	48.0	52.0	47.8	43.0	48.0	47.0	50.0
+6.0	16.0	60.0	67.0	69.8	68.0	72.0	71.0	87.0
+9.0	14.0	74.0	75.0	71.2	67.0	75.0	73.0	77.0
+9.0	6.0	68.0	68.0	73.3	73.0	76.0	75.0	79.0
+6.0	6.0	81.0	92.0	68.2	65.0	70.0	67.0	71.0
+9.0	8.0	68.0	67.0	72.8	69.0	77.0	73.0	56.0
+1.0	3.0	45.0	44.0	45.8	43.0	46.0	47.0	56.0
+4.0	28.0	60.0	61.0	61.0	56.0	65.0	62.0	73.0
+11.0	5.0	65.0	65.0	53.4	49.0	58.0	52.0	41.0
+9.0	7.0	68.0	68.0	73.0	72.0	78.0	71.0	70.0
+5.0	3.0	77.0	87.0	62.1	62.0	66.0	64.0	69.0
+10.0	31.0	65.0	117.0	54.8	51.0	59.0	56.0	62.0
+7.0	18.0	72.0	80.0	76.4	75.0	77.0	75.0	66.0
+11.0	15.0	55.0	57.0	51.0	47.0	54.0	51.0	46.0
+5.0	10.0	63.0	67.0	63.6	61.0	66.0	64.0	68.0
+3.0	18.0	53.0	58.0	54.0	51.0	57.0	54.0	56.0
+10.0	26.0	61.0	65.0	56.2	53.0	57.0	57.0	41.0
+1.0	30.0	56.0	52.0	48.6	45.0	51.0	48.0	47.0
+3.0	27.0	57.0	59.0	55.3	52.0	58.0	55.0	39.0
+11.0	3.0	57.0	57.0	53.9	53.0	54.0	54.0	35.0
+4.0	20.0	89.0	81.0	59.2	56.0	63.0	61.0	66.0
+7.0	24.0	71.0	75.0	77.1	76.0	78.0	78.0	75.0
+7.0	31.0	88.0	76.0	77.4	76.0	78.0	79.0	95.0
+5.0	16.0	65.0	57.0	64.8	61.0	65.0	65.0	53.0
+7.0	6.0	68.0	69.0	74.2	72.0	76.0	75.0	86.0
+9.0	27.0	76.0	77.0	66.8	66.0	67.0	68.0	64.0
+2.0	16.0	58.0	55.0	49.9	47.0	54.0	51.0	55.0
+12.0	4.0	50.0	49.0	46.8	45.0	47.0	47.0	53.0
+3.0	9.0	53.0	54.0	52.7	48.0	56.0	54.0	57.0
+11.0	14.0	59.0	55.0	51.2	49.0	53.0	53.0	42.0
+3.0	29.0	51.0	56.0	55.6	53.0	59.0	54.0	45.0
+7.0	8.0	76.0	68.0	74.6	72.0	79.0	75.0	77.0
+3.0	14.0	52.0	54.0	53.4	49.0	58.0	55.0	44.0
+6.0	11.0	65.0	67.0	69.0	69.0	72.0	71.0	87.0
+1.0	13.0	45.0	49.0	46.9	45.0	51.0	46.0	33.0
+2.0	5.0	49.0	49.0	49.1	47.0	50.0	49.0	45.0
+1.0	29.0	57.0	56.0	48.5	48.0	52.0	47.0	49.0
+6.0	22.0	76.0	73.0	71.0	66.0	71.0	72.0	78.0
+5.0	25.0	65.0	66.0	66.4	65.0	67.0	66.0	60.0
+9.0	28.0	77.0	69.0	66.5	66.0	68.0	66.0	62.0
+5.0	14.0	77.0	82.0	64.5	64.0	66.0	66.0	65.0
+8.0	14.0	87.0	90.0	76.7	75.0	78.0	78.0	65.0
+2.0	23.0	51.0	51.0	50.7	49.0	53.0	51.0	43.0
+4.0	8.0	68.0	77.0	57.1	57.0	61.0	57.0	41.0
+10.0	11.0	57.0	60.0	61.4	58.0	66.0	61.0	58.0
+6.0	30.0	79.0	74.0	72.8	71.0	76.0	72.0	87.0
+7.0	26.0	80.0	85.0	77.2	73.0	79.0	76.0	74.0
+5.0	6.0	60.0	68.0	62.8	61.0	64.0	61.0	64.0
+2.0	11.0	62.0	56.0	49.5	46.0	53.0	50.0	37.0
+4.0	2.0	73.0	71.0	56.2	55.0	58.0	58.0	45.0
+10.0	16.0	60.0	62.0	59.5	57.0	60.0	59.0	40.0
+7.0	28.0	79.0	83.0	77.3	76.0	80.0	78.0	76.0
+5.0	19.0	71.0	64.0	65.4	62.0	68.0	67.0	56.0
+1.0	27.0	54.0	56.0	48.4	45.0	51.0	49.0	54.0
+12.0	25.0	40.0	41.0	45.1	42.0	49.0	44.0	31.0
+5.0	24.0	66.0	65.0	66.2	66.0	71.0	66.0	67.0
+11.0	4.0	57.0	65.0	53.7	49.0	55.0	54.0	38.0
+1.0	5.0	41.0	40.0	46.0	46.0	46.0	46.0	41.0
+1.0	1.0	45.0	45.0	45.6	43.0	50.0	44.0	29.0
+11.0	26.0	52.0	52.0	48.4	48.0	50.0	47.0	58.0
+11.0	12.0	64.0	63.0	51.7	50.0	52.0	52.0	63.0
+11.0	30.0	52.0	52.0	47.6	47.0	52.0	49.0	44.0
+4.0	13.0	58.0	60.0	57.9	55.0	62.0	56.0	77.0
+8.0	23.0	84.0	81.0	75.7	73.0	78.0	77.0	89.0
+7.0	14.0	77.0	75.0	75.8	74.0	76.0	77.0	77.0
+11.0	13.0	63.0	59.0	51.4	48.0	56.0	50.0	64.0
+8.0	9.0	72.0	73.0	77.1	77.0	80.0	79.0	94.0
+8.0	4.0	73.0	75.0	77.3	73.0	79.0	78.0	66.0
+4.0	16.0	59.0	60.0	58.5	56.0	60.0	59.0	59.0
+6.0	23.0	73.0	75.0	71.3	68.0	72.0	71.0	56.0
+4.0	11.0	66.0	59.0	57.6	56.0	60.0	58.0	40.0
+2.0	6.0	49.0	53.0	49.1	47.0	53.0	49.0	56.0
+8.0	6.0	80.0	79.0	77.2	76.0	81.0	79.0	60.0
+3.0	5.0	59.0	57.0	52.1	49.0	53.0	51.0	46.0
+6.0	2.0	79.0	75.0	67.6	64.0	71.0	67.0	77.0
+9.0	20.0	69.0	71.0	69.4	67.0	73.0	69.0	81.0
+2.0	19.0	57.0	53.0	50.2	50.0	52.0	51.0	42.0
+2.0	2.0	47.0	46.0	48.8	48.0	50.0	50.0	56.0
+7.0	22.0	82.0	81.0	76.9	72.0	77.0	76.0	70.0
+11.0	24.0	54.0	49.0	48.9	47.0	53.0	48.0	29.0
+1.0	28.0	56.0	57.0	48.4	44.0	52.0	48.0	34.0
+10.0	18.0	60.0	60.0	58.8	54.0	60.0	57.0	53.0
+9.0	4.0	70.0	67.0	73.7	72.0	77.0	75.0	64.0
+10.0	4.0	65.0	61.0	64.1	62.0	69.0	65.0	60.0
+6.0	14.0	70.0	66.0	69.5	66.0	71.0	69.0	85.0
+11.0	11.0	65.0	64.0	51.9	50.0	53.0	52.0	55.0
+5.0	21.0	63.0	66.0	65.7	62.0	67.0	65.0	49.0
+3.0	6.0	57.0	64.0	52.2	52.0	53.0	51.0	49.0
+5.0	18.0	60.0	71.0	65.2	61.0	68.0	65.0	56.0
+5.0	11.0	67.0	75.0	63.8	62.0	68.0	63.0	60.0
+1.0	9.0	45.0	48.0	46.4	46.0	50.0	45.0	47.0
+3.0	8.0	60.0	53.0	52.5	48.0	56.0	51.0	70.0
+1.0	15.0	55.0	49.0	47.1	46.0	51.0	46.0	65.0
+6.0	8.0	86.0	85.0	68.5	67.0	70.0	69.0	81.0
+2.0	10.0	57.0	62.0	49.4	48.0	50.0	49.0	30.0
+12.0	3.0	46.0	50.0	47.0	42.0	52.0	47.0	58.0
+10.0	27.0	65.0	58.0	55.9	51.0	60.0	55.0	39.0
+8.0	7.0	79.0	72.0	77.2	74.0	78.0	77.0	95.0
+11.0	16.0	57.0	55.0	50.7	50.0	51.0	49.0	34.0
+9.0	10.0	72.0	74.0	72.3	70.0	77.0	74.0	91.0
+7.0	29.0	83.0	85.0	77.3	77.0	80.0	79.0	77.0
+8.0	3.0	77.0	73.0	77.3	77.0	81.0	77.0	93.0
+12.0	1.0	52.0	52.0	47.4	44.0	48.0	49.0	39.0
+9.0	25.0	64.0	67.0	67.6	64.0	72.0	67.0	62.0
+12.0	23.0	49.0	45.0	45.1	45.0	49.0	44.0	35.0
+12.0	2.0	52.0	46.0	47.2	46.0	51.0	49.0	41.0
+10.0	13.0	62.0	66.0	60.6	60.0	62.0	60.0	57.0
+7.0	23.0	81.0	71.0	77.0	75.0	81.0	76.0	86.0
+6.0	13.0	65.0	70.0	69.3	66.0	72.0	69.0	79.0
+2.0	15.0	55.0	58.0	49.9	46.0	52.0	49.0	53.0
+8.0	8.0	72.0	72.0	77.1	76.0	78.0	77.0	65.0
+7.0	12.0	74.0	74.0	75.4	74.0	77.0	77.0	71.0
+10.0	3.0	63.0	65.0	64.5	63.0	68.0	65.0	49.0
+4.0	18.0	68.0	77.0	58.8	55.0	59.0	57.0	39.0
+2.0	25.0	60.0	59.0	50.9	49.0	51.0	49.0	35.0
+1.0	2.0	44.0	45.0	45.7	41.0	50.0	44.0	61.0
+2.0	21.0	51.0	53.0	50.5	49.0	54.0	52.0	46.0
+3.0	24.0	57.0	53.0	54.9	54.0	56.0	56.0	72.0
+7.0	27.0	85.0	79.0	77.3	73.0	78.0	79.0	79.0
+2.0	4.0	51.0	49.0	49.0	44.0	54.0	51.0	44.0
+10.0	7.0	66.0	63.0	62.9	62.0	67.0	64.0	78.0
+4.0	4.0	63.0	69.0	56.5	54.0	59.0	56.0	45.0
+2.0	24.0	51.0	60.0	50.8	47.0	53.0	50.0	46.0
+10.0	8.0	63.0	64.0	62.5	60.0	65.0	61.0	73.0
+9.0	15.0	75.0	79.0	71.0	66.0	76.0	69.0	64.0
+1.0	14.0	49.0	55.0	47.0	43.0	47.0	46.0	58.0
+4.0	1.0	68.0	73.0	56.0	54.0	59.0	55.0	41.0
+10.0	17.0	62.0	60.0	59.1	57.0	63.0	59.0	62.0
+6.0	18.0	71.0	67.0	70.2	67.0	75.0	69.0	77.0
+12.0	26.0	41.0	42.0	45.2	45.0	48.0	46.0	58.0
+5.0	17.0	57.0	60.0	65.0	62.0	65.0	65.0	55.0
+11.0	20.0	55.0	57.0	49.8	47.0	54.0	48.0	30.0
+12.0	18.0	35.0	35.0	45.2	44.0	46.0	46.0	36.0
+9.0	17.0	71.0	75.0	70.3	66.0	73.0	70.0	84.0
+2.0	26.0	59.0	61.0	51.1	48.0	56.0	53.0	65.0
+2.0	22.0	53.0	51.0	50.6	46.0	51.0	50.0	59.0
+6.0	26.0	69.0	71.0	71.9	67.0	74.0	72.0	70.0
+7.0	11.0	71.0	74.0	75.3	74.0	79.0	75.0	71.0
+12.0	30.0	48.0	48.0	45.4	44.0	46.0	44.0	42.0
+7.0	9.0	68.0	74.0	74.9	70.0	79.0	76.0	60.0
+6.0	21.0	70.0	76.0	70.8	68.0	75.0	71.0	57.0
+3.0	2.0	54.0	58.0	51.6	47.0	54.0	52.0	37.0
+2.0	20.0	53.0	51.0	50.4	48.0	55.0	51.0	43.0
+9.0	9.0	67.0	72.0	72.6	68.0	77.0	71.0	78.0
+9.0	26.0	67.0	76.0	67.2	64.0	69.0	69.0	74.0
+1.0	22.0	52.0	52.0	47.9	47.0	48.0	48.0	60.0
+11.0	27.0	52.0	53.0	48.2	48.0	49.0	49.0	53.0
+6.0	12.0	67.0	65.0	69.1	65.0	73.0	70.0	83.0
+10.0	20.0	61.0	58.0	58.1	58.0	59.0	58.0	43.0
+7.0	13.0	74.0	77.0	75.6	74.0	78.0	76.0	56.0
+11.0	7.0	58.0	61.0	52.9	51.0	56.0	51.0	35.0
+10.0	1.0	66.0	67.0	65.3	64.0	70.0	64.0	54.0
+11.0	22.0	55.0	54.0	49.3	46.0	54.0	49.0	58.0
+6.0	1.0	71.0	79.0	67.4	65.0	69.0	66.0	58.0
+5.0	13.0	81.0	77.0	64.3	63.0	67.0	66.0	67.0
+6.0	3.0	75.0	71.0	67.7	64.0	71.0	66.0	55.0
+4.0	12.0	59.0	58.0	57.7	54.0	59.0	57.0	61.0
+3.0	31.0	64.0	68.0	55.9	55.0	59.0	56.0	56.0
+12.0	14.0	43.0	40.0	45.4	45.0	48.0	45.0	49.0
+8.0	5.0	75.0	80.0	77.3	75.0	81.0	78.0	71.0
+5.0	4.0	87.0	74.0	62.3	59.0	65.0	64.0	61.0
+12.0	31.0	48.0	57.0	45.5	42.0	48.0	47.0	57.0
+1.0	21.0	48.0	52.0	47.8	43.0	51.0	46.0	57.0
+7.0	10.0	74.0	71.0	75.1	71.0	77.0	76.0	95.0
+3.0	15.0	54.0	49.0	53.6	49.0	58.0	52.0	70.0
+4.0	19.0	77.0	89.0	59.0	59.0	63.0	59.0	61.0
+10.0	14.0	66.0	60.0	60.2	56.0	64.0	60.0	78.0
+4.0	15.0	59.0	59.0	58.3	58.0	61.0	60.0	40.0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/feature_selection_result08	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,11 @@
+0	1
+143.762620712	-0.330941870584
+-88.5787166225	1.08055532812
+-82.8452345578	0.272541389247
+72.4951388149	-0.26868660527800003
+11.805182128	1.0360467096600001
+-63.9354970901	-0.101485840571
+126.32584079600001	-0.35999834017899995
+23.0341392692	0.5185404651359999
+67.6714937696	-0.115688051547
+47.39275848810001	-0.7850965413680001
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/feature_selection_result09	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,11 @@
+0
+143.762620712
+-88.5787166225
+-82.8452345578
+72.4951388149
+11.805182128
+-63.9354970901
+126.32584079600001
+23.0341392692
+67.6714937696
+47.39275848810001
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/feature_selection_result10	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,262 @@
+month	day	temp_2	temp_1	average	forecast_noaa	forecast_acc	forecast_under	friend	week_Fri	week_Mon	week_Sat	week_Sun	week_Thurs	week_Tues	week_Wed
+9.0	19.0	68.0	69.0	69.7	65.0	74.0	71.0	88.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+4.0	14.0	60.0	59.0	58.1	57.0	63.0	58.0	66.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+7.0	30.0	85.0	88.0	77.3	75.0	79.0	77.0	70.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+5.0	15.0	82.0	65.0	64.7	63.0	69.0	64.0	58.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+1.0	18.0	54.0	50.0	47.5	44.0	48.0	49.0	58.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+1.0	25.0	48.0	51.0	48.2	45.0	51.0	49.0	63.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+11.0	25.0	49.0	52.0	48.6	45.0	52.0	47.0	41.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+7.0	20.0	73.0	78.0	76.7	75.0	78.0	77.0	66.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+12.0	17.0	39.0	35.0	45.2	43.0	47.0	46.0	38.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+12.0	8.0	42.0	40.0	46.1	45.0	51.0	47.0	36.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+12.0	28.0	42.0	47.0	45.3	41.0	49.0	44.0	58.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+7.0	17.0	76.0	72.0	76.3	76.0	78.0	77.0	88.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+7.0	7.0	69.0	76.0	74.4	73.0	77.0	74.0	72.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+12.0	15.0	40.0	39.0	45.3	45.0	49.0	47.0	46.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+6.0	27.0	71.0	78.0	72.2	70.0	74.0	72.0	84.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+5.0	31.0	64.0	71.0	67.3	63.0	72.0	68.0	85.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+1.0	20.0	54.0	48.0	47.7	44.0	52.0	49.0	61.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+8.0	10.0	73.0	72.0	77.0	77.0	78.0	77.0	68.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+3.0	23.0	56.0	57.0	54.7	50.0	58.0	55.0	70.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+12.0	24.0	45.0	40.0	45.1	44.0	47.0	46.0	39.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+1.0	19.0	50.0	54.0	47.6	47.0	49.0	48.0	53.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+11.0	6.0	65.0	58.0	53.2	52.0	57.0	55.0	71.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+4.0	17.0	60.0	68.0	58.6	58.0	62.0	59.0	54.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+10.0	29.0	60.0	65.0	55.3	55.0	59.0	55.0	65.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+2.0	1.0	48.0	47.0	48.8	46.0	49.0	49.0	51.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+12.0	12.0	44.0	44.0	45.6	43.0	50.0	45.0	42.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+5.0	30.0	64.0	64.0	67.1	64.0	70.0	66.0	69.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+10.0	23.0	59.0	62.0	57.1	57.0	58.0	59.0	67.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+9.0	30.0	68.0	66.0	65.7	64.0	67.0	65.0	74.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+9.0	12.0	77.0	70.0	71.8	67.0	73.0	73.0	90.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+11.0	2.0	59.0	57.0	54.2	54.0	58.0	55.0	70.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+11.0	17.0	55.0	50.0	50.5	46.0	51.0	50.0	57.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+3.0	3.0	58.0	55.0	51.8	49.0	54.0	50.0	71.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+11.0	21.0	57.0	55.0	49.5	46.0	51.0	49.0	67.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+12.0	27.0	42.0	42.0	45.2	41.0	50.0	47.0	47.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+4.0	24.0	64.0	65.0	60.1	57.0	61.0	60.0	41.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+5.0	20.0	64.0	63.0	65.6	63.0	70.0	64.0	73.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+1.0	16.0	49.0	48.0	47.3	45.0	52.0	46.0	28.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+12.0	7.0	40.0	42.0	46.3	44.0	51.0	46.0	62.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+1.0	7.0	44.0	51.0	46.2	45.0	49.0	46.0	38.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+9.0	24.0	67.0	64.0	68.0	65.0	71.0	66.0	64.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+8.0	30.0	79.0	75.0	74.6	74.0	76.0	75.0	63.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+1.0	11.0	50.0	52.0	46.7	42.0	48.0	48.0	39.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+6.0	9.0	85.0	67.0	68.6	66.0	73.0	69.0	80.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+9.0	22.0	67.0	68.0	68.7	65.0	70.0	69.0	56.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+3.0	25.0	53.0	54.0	55.0	53.0	57.0	57.0	42.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+10.0	24.0	62.0	62.0	56.8	52.0	61.0	57.0	70.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+7.0	16.0	77.0	76.0	76.1	76.0	78.0	75.0	61.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+7.0	1.0	74.0	73.0	73.1	71.0	75.0	72.0	93.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+11.0	18.0	50.0	52.0	50.3	50.0	53.0	50.0	35.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+9.0	3.0	75.0	70.0	73.9	71.0	75.0	73.0	68.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+8.0	2.0	73.0	77.0	77.4	75.0	80.0	79.0	62.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+4.0	5.0	69.0	60.0	56.6	52.0	58.0	56.0	72.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+3.0	13.0	55.0	52.0	53.3	50.0	55.0	53.0	54.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+8.0	28.0	81.0	79.0	75.0	71.0	77.0	76.0	85.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+4.0	9.0	77.0	76.0	57.2	53.0	61.0	57.0	74.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+5.0	26.0	66.0	66.0	66.5	64.0	70.0	65.0	85.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+10.0	10.0	68.0	57.0	61.8	58.0	64.0	61.0	62.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+4.0	10.0	76.0	66.0	57.4	57.0	60.0	57.0	60.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+10.0	19.0	60.0	61.0	58.4	58.0	60.0	57.0	41.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+3.0	12.0	56.0	55.0	53.1	52.0	58.0	53.0	65.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+1.0	24.0	57.0	48.0	48.1	46.0	50.0	48.0	54.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+2.0	7.0	53.0	49.0	49.2	46.0	51.0	48.0	63.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+5.0	27.0	66.0	65.0	66.7	64.0	67.0	68.0	73.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+5.0	5.0	74.0	60.0	62.5	58.0	66.0	62.0	56.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+3.0	11.0	55.0	56.0	53.0	53.0	53.0	51.0	36.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+10.0	22.0	62.0	59.0	57.4	56.0	59.0	58.0	44.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+12.0	11.0	36.0	44.0	45.7	41.0	46.0	47.0	35.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+5.0	8.0	77.0	82.0	63.2	62.0	65.0	63.0	83.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+5.0	29.0	64.0	64.0	67.0	65.0	71.0	65.0	76.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+12.0	13.0	44.0	43.0	45.5	41.0	47.0	46.0	46.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+3.0	30.0	56.0	64.0	55.7	51.0	57.0	56.0	57.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+11.0	8.0	61.0	63.0	52.7	49.0	57.0	52.0	49.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+6.0	20.0	65.0	70.0	70.6	67.0	71.0	70.0	79.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+11.0	9.0	63.0	71.0	52.4	48.0	56.0	52.0	42.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+7.0	3.0	76.0	76.0	73.5	69.0	76.0	75.0	85.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+10.0	9.0	64.0	68.0	62.1	58.0	65.0	63.0	55.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+12.0	16.0	39.0	39.0	45.3	44.0	49.0	44.0	39.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+9.0	16.0	79.0	71.0	70.7	70.0	74.0	71.0	52.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+6.0	25.0	68.0	69.0	71.7	68.0	73.0	73.0	89.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+9.0	13.0	70.0	74.0	71.5	71.0	75.0	70.0	82.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+5.0	12.0	75.0	81.0	64.1	62.0	67.0	63.0	81.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+2.0	8.0	49.0	51.0	49.3	49.0	52.0	50.0	34.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+1.0	12.0	52.0	45.0	46.8	44.0	50.0	45.0	61.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+8.0	13.0	80.0	87.0	76.8	73.0	79.0	78.0	73.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+7.0	4.0	76.0	71.0	73.8	71.0	76.0	73.0	86.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+4.0	25.0	65.0	55.0	60.3	56.0	64.0	61.0	77.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+8.0	12.0	76.0	80.0	76.9	72.0	79.0	77.0	81.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+9.0	21.0	71.0	67.0	69.0	65.0	70.0	70.0	76.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+4.0	30.0	64.0	61.0	61.4	60.0	65.0	62.0	78.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+12.0	5.0	49.0	46.0	46.6	43.0	50.0	45.0	65.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+12.0	19.0	35.0	39.0	45.1	42.0	46.0	45.0	51.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+9.0	23.0	68.0	67.0	68.3	67.0	69.0	67.0	61.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+11.0	29.0	48.0	52.0	47.8	43.0	48.0	47.0	50.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+6.0	16.0	60.0	67.0	69.8	68.0	72.0	71.0	87.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+9.0	14.0	74.0	75.0	71.2	67.0	75.0	73.0	77.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+9.0	6.0	68.0	68.0	73.3	73.0	76.0	75.0	79.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+6.0	6.0	81.0	92.0	68.2	65.0	70.0	67.0	71.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+9.0	8.0	68.0	67.0	72.8	69.0	77.0	73.0	56.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+1.0	3.0	45.0	44.0	45.8	43.0	46.0	47.0	56.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+4.0	28.0	60.0	61.0	61.0	56.0	65.0	62.0	73.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+11.0	5.0	65.0	65.0	53.4	49.0	58.0	52.0	41.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+9.0	7.0	68.0	68.0	73.0	72.0	78.0	71.0	70.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+5.0	3.0	77.0	87.0	62.1	62.0	66.0	64.0	69.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+10.0	31.0	65.0	117.0	54.8	51.0	59.0	56.0	62.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+7.0	18.0	72.0	80.0	76.4	75.0	77.0	75.0	66.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+11.0	15.0	55.0	57.0	51.0	47.0	54.0	51.0	46.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+5.0	10.0	63.0	67.0	63.6	61.0	66.0	64.0	68.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+3.0	18.0	53.0	58.0	54.0	51.0	57.0	54.0	56.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+10.0	26.0	61.0	65.0	56.2	53.0	57.0	57.0	41.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+1.0	30.0	56.0	52.0	48.6	45.0	51.0	48.0	47.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+3.0	27.0	57.0	59.0	55.3	52.0	58.0	55.0	39.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+11.0	3.0	57.0	57.0	53.9	53.0	54.0	54.0	35.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+4.0	20.0	89.0	81.0	59.2	56.0	63.0	61.0	66.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+7.0	24.0	71.0	75.0	77.1	76.0	78.0	78.0	75.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+7.0	31.0	88.0	76.0	77.4	76.0	78.0	79.0	95.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+5.0	16.0	65.0	57.0	64.8	61.0	65.0	65.0	53.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+7.0	6.0	68.0	69.0	74.2	72.0	76.0	75.0	86.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+9.0	27.0	76.0	77.0	66.8	66.0	67.0	68.0	64.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+2.0	16.0	58.0	55.0	49.9	47.0	54.0	51.0	55.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+12.0	4.0	50.0	49.0	46.8	45.0	47.0	47.0	53.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+3.0	9.0	53.0	54.0	52.7	48.0	56.0	54.0	57.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+11.0	14.0	59.0	55.0	51.2	49.0	53.0	53.0	42.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+3.0	29.0	51.0	56.0	55.6	53.0	59.0	54.0	45.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+7.0	8.0	76.0	68.0	74.6	72.0	79.0	75.0	77.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+3.0	14.0	52.0	54.0	53.4	49.0	58.0	55.0	44.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+6.0	11.0	65.0	67.0	69.0	69.0	72.0	71.0	87.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+1.0	13.0	45.0	49.0	46.9	45.0	51.0	46.0	33.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+2.0	5.0	49.0	49.0	49.1	47.0	50.0	49.0	45.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+1.0	29.0	57.0	56.0	48.5	48.0	52.0	47.0	49.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+6.0	22.0	76.0	73.0	71.0	66.0	71.0	72.0	78.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+5.0	25.0	65.0	66.0	66.4	65.0	67.0	66.0	60.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+9.0	28.0	77.0	69.0	66.5	66.0	68.0	66.0	62.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+5.0	14.0	77.0	82.0	64.5	64.0	66.0	66.0	65.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+8.0	14.0	87.0	90.0	76.7	75.0	78.0	78.0	65.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+2.0	23.0	51.0	51.0	50.7	49.0	53.0	51.0	43.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+4.0	8.0	68.0	77.0	57.1	57.0	61.0	57.0	41.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+10.0	11.0	57.0	60.0	61.4	58.0	66.0	61.0	58.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+6.0	30.0	79.0	74.0	72.8	71.0	76.0	72.0	87.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+7.0	26.0	80.0	85.0	77.2	73.0	79.0	76.0	74.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+5.0	6.0	60.0	68.0	62.8	61.0	64.0	61.0	64.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+2.0	11.0	62.0	56.0	49.5	46.0	53.0	50.0	37.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+4.0	2.0	73.0	71.0	56.2	55.0	58.0	58.0	45.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+10.0	16.0	60.0	62.0	59.5	57.0	60.0	59.0	40.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+7.0	28.0	79.0	83.0	77.3	76.0	80.0	78.0	76.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+5.0	19.0	71.0	64.0	65.4	62.0	68.0	67.0	56.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+1.0	27.0	54.0	56.0	48.4	45.0	51.0	49.0	54.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+12.0	25.0	40.0	41.0	45.1	42.0	49.0	44.0	31.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+5.0	24.0	66.0	65.0	66.2	66.0	71.0	66.0	67.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+11.0	4.0	57.0	65.0	53.7	49.0	55.0	54.0	38.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+1.0	5.0	41.0	40.0	46.0	46.0	46.0	46.0	41.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+1.0	1.0	45.0	45.0	45.6	43.0	50.0	44.0	29.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+11.0	26.0	52.0	52.0	48.4	48.0	50.0	47.0	58.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+11.0	12.0	64.0	63.0	51.7	50.0	52.0	52.0	63.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+11.0	30.0	52.0	52.0	47.6	47.0	52.0	49.0	44.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+4.0	13.0	58.0	60.0	57.9	55.0	62.0	56.0	77.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+8.0	23.0	84.0	81.0	75.7	73.0	78.0	77.0	89.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+7.0	14.0	77.0	75.0	75.8	74.0	76.0	77.0	77.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+11.0	13.0	63.0	59.0	51.4	48.0	56.0	50.0	64.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+8.0	9.0	72.0	73.0	77.1	77.0	80.0	79.0	94.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+8.0	4.0	73.0	75.0	77.3	73.0	79.0	78.0	66.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+4.0	16.0	59.0	60.0	58.5	56.0	60.0	59.0	59.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+6.0	23.0	73.0	75.0	71.3	68.0	72.0	71.0	56.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+4.0	11.0	66.0	59.0	57.6	56.0	60.0	58.0	40.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+2.0	6.0	49.0	53.0	49.1	47.0	53.0	49.0	56.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+8.0	6.0	80.0	79.0	77.2	76.0	81.0	79.0	60.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+3.0	5.0	59.0	57.0	52.1	49.0	53.0	51.0	46.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+6.0	2.0	79.0	75.0	67.6	64.0	71.0	67.0	77.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+9.0	20.0	69.0	71.0	69.4	67.0	73.0	69.0	81.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+2.0	19.0	57.0	53.0	50.2	50.0	52.0	51.0	42.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+2.0	2.0	47.0	46.0	48.8	48.0	50.0	50.0	56.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+7.0	22.0	82.0	81.0	76.9	72.0	77.0	76.0	70.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+11.0	24.0	54.0	49.0	48.9	47.0	53.0	48.0	29.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+1.0	28.0	56.0	57.0	48.4	44.0	52.0	48.0	34.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+10.0	18.0	60.0	60.0	58.8	54.0	60.0	57.0	53.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+9.0	4.0	70.0	67.0	73.7	72.0	77.0	75.0	64.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+10.0	4.0	65.0	61.0	64.1	62.0	69.0	65.0	60.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+6.0	14.0	70.0	66.0	69.5	66.0	71.0	69.0	85.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+11.0	11.0	65.0	64.0	51.9	50.0	53.0	52.0	55.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+5.0	21.0	63.0	66.0	65.7	62.0	67.0	65.0	49.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+3.0	6.0	57.0	64.0	52.2	52.0	53.0	51.0	49.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+5.0	18.0	60.0	71.0	65.2	61.0	68.0	65.0	56.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+5.0	11.0	67.0	75.0	63.8	62.0	68.0	63.0	60.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+1.0	9.0	45.0	48.0	46.4	46.0	50.0	45.0	47.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+3.0	8.0	60.0	53.0	52.5	48.0	56.0	51.0	70.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+1.0	15.0	55.0	49.0	47.1	46.0	51.0	46.0	65.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+6.0	8.0	86.0	85.0	68.5	67.0	70.0	69.0	81.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+2.0	10.0	57.0	62.0	49.4	48.0	50.0	49.0	30.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+12.0	3.0	46.0	50.0	47.0	42.0	52.0	47.0	58.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+10.0	27.0	65.0	58.0	55.9	51.0	60.0	55.0	39.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+8.0	7.0	79.0	72.0	77.2	74.0	78.0	77.0	95.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+11.0	16.0	57.0	55.0	50.7	50.0	51.0	49.0	34.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+9.0	10.0	72.0	74.0	72.3	70.0	77.0	74.0	91.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+7.0	29.0	83.0	85.0	77.3	77.0	80.0	79.0	77.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+8.0	3.0	77.0	73.0	77.3	77.0	81.0	77.0	93.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+12.0	1.0	52.0	52.0	47.4	44.0	48.0	49.0	39.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+9.0	25.0	64.0	67.0	67.6	64.0	72.0	67.0	62.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+12.0	23.0	49.0	45.0	45.1	45.0	49.0	44.0	35.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+12.0	2.0	52.0	46.0	47.2	46.0	51.0	49.0	41.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+10.0	13.0	62.0	66.0	60.6	60.0	62.0	60.0	57.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+7.0	23.0	81.0	71.0	77.0	75.0	81.0	76.0	86.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+6.0	13.0	65.0	70.0	69.3	66.0	72.0	69.0	79.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+2.0	15.0	55.0	58.0	49.9	46.0	52.0	49.0	53.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+8.0	8.0	72.0	72.0	77.1	76.0	78.0	77.0	65.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+7.0	12.0	74.0	74.0	75.4	74.0	77.0	77.0	71.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+10.0	3.0	63.0	65.0	64.5	63.0	68.0	65.0	49.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+4.0	18.0	68.0	77.0	58.8	55.0	59.0	57.0	39.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+2.0	25.0	60.0	59.0	50.9	49.0	51.0	49.0	35.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+1.0	2.0	44.0	45.0	45.7	41.0	50.0	44.0	61.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+2.0	21.0	51.0	53.0	50.5	49.0	54.0	52.0	46.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+3.0	24.0	57.0	53.0	54.9	54.0	56.0	56.0	72.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+7.0	27.0	85.0	79.0	77.3	73.0	78.0	79.0	79.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+2.0	4.0	51.0	49.0	49.0	44.0	54.0	51.0	44.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+10.0	7.0	66.0	63.0	62.9	62.0	67.0	64.0	78.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+4.0	4.0	63.0	69.0	56.5	54.0	59.0	56.0	45.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+2.0	24.0	51.0	60.0	50.8	47.0	53.0	50.0	46.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+10.0	8.0	63.0	64.0	62.5	60.0	65.0	61.0	73.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+9.0	15.0	75.0	79.0	71.0	66.0	76.0	69.0	64.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+1.0	14.0	49.0	55.0	47.0	43.0	47.0	46.0	58.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+4.0	1.0	68.0	73.0	56.0	54.0	59.0	55.0	41.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+10.0	17.0	62.0	60.0	59.1	57.0	63.0	59.0	62.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+6.0	18.0	71.0	67.0	70.2	67.0	75.0	69.0	77.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+12.0	26.0	41.0	42.0	45.2	45.0	48.0	46.0	58.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+5.0	17.0	57.0	60.0	65.0	62.0	65.0	65.0	55.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+11.0	20.0	55.0	57.0	49.8	47.0	54.0	48.0	30.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+12.0	18.0	35.0	35.0	45.2	44.0	46.0	46.0	36.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+9.0	17.0	71.0	75.0	70.3	66.0	73.0	70.0	84.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+2.0	26.0	59.0	61.0	51.1	48.0	56.0	53.0	65.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+2.0	22.0	53.0	51.0	50.6	46.0	51.0	50.0	59.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+6.0	26.0	69.0	71.0	71.9	67.0	74.0	72.0	70.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+7.0	11.0	71.0	74.0	75.3	74.0	79.0	75.0	71.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+12.0	30.0	48.0	48.0	45.4	44.0	46.0	44.0	42.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+7.0	9.0	68.0	74.0	74.9	70.0	79.0	76.0	60.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+6.0	21.0	70.0	76.0	70.8	68.0	75.0	71.0	57.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+3.0	2.0	54.0	58.0	51.6	47.0	54.0	52.0	37.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+2.0	20.0	53.0	51.0	50.4	48.0	55.0	51.0	43.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+9.0	9.0	67.0	72.0	72.6	68.0	77.0	71.0	78.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+9.0	26.0	67.0	76.0	67.2	64.0	69.0	69.0	74.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+1.0	22.0	52.0	52.0	47.9	47.0	48.0	48.0	60.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+11.0	27.0	52.0	53.0	48.2	48.0	49.0	49.0	53.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+6.0	12.0	67.0	65.0	69.1	65.0	73.0	70.0	83.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+10.0	20.0	61.0	58.0	58.1	58.0	59.0	58.0	43.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+7.0	13.0	74.0	77.0	75.6	74.0	78.0	76.0	56.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+11.0	7.0	58.0	61.0	52.9	51.0	56.0	51.0	35.0	0.0	1.0	0.0	0.0	0.0	0.0	0.0
+10.0	1.0	66.0	67.0	65.3	64.0	70.0	64.0	54.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+11.0	22.0	55.0	54.0	49.3	46.0	54.0	49.0	58.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+6.0	1.0	71.0	79.0	67.4	65.0	69.0	66.0	58.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+5.0	13.0	81.0	77.0	64.3	63.0	67.0	66.0	67.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+6.0	3.0	75.0	71.0	67.7	64.0	71.0	66.0	55.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+4.0	12.0	59.0	58.0	57.7	54.0	59.0	57.0	61.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+3.0	31.0	64.0	68.0	55.9	55.0	59.0	56.0	56.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+12.0	14.0	43.0	40.0	45.4	45.0	48.0	45.0	49.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+8.0	5.0	75.0	80.0	77.3	75.0	81.0	78.0	71.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+5.0	4.0	87.0	74.0	62.3	59.0	65.0	64.0	61.0	0.0	0.0	0.0	0.0	0.0	0.0	1.0
+12.0	31.0	48.0	57.0	45.5	42.0	48.0	47.0	57.0	0.0	0.0	1.0	0.0	0.0	0.0	0.0
+1.0	21.0	48.0	52.0	47.8	43.0	51.0	46.0	57.0	0.0	0.0	0.0	0.0	1.0	0.0	0.0
+7.0	10.0	74.0	71.0	75.1	71.0	77.0	76.0	95.0	0.0	0.0	0.0	1.0	0.0	0.0	0.0
+3.0	15.0	54.0	49.0	53.6	49.0	58.0	52.0	70.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+4.0	19.0	77.0	89.0	59.0	59.0	63.0	59.0	61.0	0.0	0.0	0.0	0.0	0.0	1.0	0.0
+10.0	14.0	66.0	60.0	60.2	56.0	64.0	60.0	78.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
+4.0	15.0	59.0	59.0	58.3	58.0	61.0	60.0	40.0	1.0	0.0	0.0	0.0	0.0	0.0	0.0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/feature_selection_result11	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,51 @@
+Race	AIDS	Total
+4.0	2555.0	14443382.0
+4.0	55300.0	14704293.0
+4.0	82334.0	16641977.0
+4.0	38006.0	13888285.0
+4.0	16068.0	21845911.0
+2.0	2489.0	2367256.0
+2.0	34204.0	2410019.0
+2.0	51776.0	2727604.0
+2.0	23896.0	2276276.0
+2.0	10169.0	3580523.0
+3.0	1363.0	1542563.0
+3.0	20712.0	1570428.0
+3.0	27200.0	1777374.0
+3.0	11251.0	1483278.0
+3.0	4674.0	2333158.0
+1.0	38.0	699627.0
+1.0	731.0	712265.0
+1.0	1162.0	806125.0
+1.0	560.0	672738.0
+1.0	258.0	1058200.0
+0.0	26.0	169115.0
+0.0	390.0	172170.0
+0.0	417.0	194858.0
+0.0	140.0	162616.0
+0.0	48.0	255790.0
+4.0	490.0	14999423.0
+4.0	4788.0	15270378.0
+4.0	5377.0	17282659.0
+4.0	2152.0	14422956.0
+4.0	1790.0	22686934.0
+2.0	1490.0	2458391.0
+2.0	12280.0	2502800.0
+2.0	15713.0	2832611.0
+2.0	5788.0	2363908.0
+2.0	2534.0	3718366.0
+3.0	493.0	1601948.0
+3.0	4660.0	1630887.0
+3.0	5153.0	1845800.0
+3.0	1944.0	1540381.0
+3.0	910.0	2422980.0
+1.0	6.0	726561.0
+1.0	83.0	739686.0
+1.0	106.0	837159.0
+1.0	69.0	698637.0
+1.0	55.0	1098938.0
+0.0	3.0	175626.0
+0.0	78.0	178798.0
+0.0	77.0	202360.0
+0.0	31.0	168876.0
+0.0	14.0	265637.0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/feature_selection_result12	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,11 @@
+0	1
+143.762620712	-1.1796457192799998
+-88.5787166225	-2.5710918402200003
+-82.8452345578	-0.168636324107
+72.4951388149	0.991068834926
+11.805182128	-0.7096855607860001
+-63.9354970901	0.9841122108220001
+126.32584079600001	0.35353444883900004
+23.0341392692	1.03188231893
+67.6714937696	-0.8214378651719999
+47.39275848810001	-0.0942409319417
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/friedman1.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,101 @@
+0	1	2	3	4	5	6	7	8	9	0
+0.5434049417909654	0.27836938509379616	0.4245175907491331	0.8447761323199037	0.004718856190972565	0.12156912078311422	0.6707490847267786	0.8258527551050476	0.13670658968495297	0.57509332942725	13.160650397398078
+0.891321954312264	0.20920212211718958	0.18532821955007506	0.10837689046425514	0.21969749262499216	0.9786237847073697	0.8116831490893233	0.1719410127325942	0.8162247487258399	0.2740737470416992	9.691298137658498
+0.4317041836631217	0.9400298196223746	0.8176493787767274	0.3361119501208987	0.17541045374233666	0.37283204628992317	0.005688507352573424	0.25242635344484043	0.7956625084732873	0.01525497124633901	15.821619961828777
+0.5988433769284929	0.6038045390428536	0.10514768541205632	0.38194344494311006	0.03647605659256892	0.8904115634420757	0.9809208570123115	0.05994198881803725	0.8905459447285041	0.5769014994000329	16.18933274618261
+0.7424796890979773	0.6301839364753761	0.5818421923987779	0.020439132026923157	0.2100265776728606	0.5446848781786475	0.7691151711056516	0.2506952291383959	0.2858956904068647	0.8523950878413064	11.33767760089345
+0.9750064936065875	0.8848532934911055	0.35950784393690227	0.5988589458757472	0.3547956116572998	0.34019021537064575	0.17808098950580487	0.23769420862405044	0.04486228246077528	0.5054314296357892	12.337142824178603
+0.376252454297363	0.5928054009758866	0.6299418755874974	0.14260031444628352	0.933841299466419	0.9463798808091013	0.6022966577308656	0.38776628032663074	0.3631880041093498	0.20434527686864423	12.880550712301464
+0.27676506139633517	0.24653588120354963	0.17360800174020508	0.9666096944873236	0.9570126003527981	0.5979736843289207	0.7313007530599226	0.3403852228374361	0.09205560337723862	0.4634980189371477	18.709003936604173
+0.508698893238194	0.08846017300289077	0.5280352233180474	0.9921580365105283	0.3950359317582296	0.3355964417185683	0.8054505373292797	0.7543489945823536	0.3130664415885097	0.6340366829622751	13.321479131556272
+0.5404045753007164	0.2967937508800147	0.11078790118244575	0.3126402978757431	0.4569791300492658	0.6589400702261969	0.2542575178177181	0.6411012587007017	0.20012360721840317	0.6576248055289837	13.269253863108887
+0.7782892154498485	0.7795983986107496	0.6103281532093938	0.30900034852440217	0.697734907512956	0.8596182957290651	0.6253237577568076	0.9824078296095496	0.9765001270158553	0.16669413119885812	16.264995170787344
+0.02317813647840361	0.16074454850708164	0.9234968252590874	0.953549849879534	0.21097841871844636	0.3605252508146082	0.5493752616276721	0.2718308491769721	0.46060162107485014	0.6961615648233853	14.294427313499119
+0.500355896674865	0.7160709905643361	0.525955936229779	0.0013990231190438296	0.3947002866898355	0.49216696990114994	0.40288033137914214	0.3542983001063206	0.5006143194429532	0.4451766288311383	11.026237192296225
+0.09043278819643585	0.27356292002744065	0.9434770977427269	0.026544641333941965	0.039998689640650786	0.28314035971981955	0.5823441702167689	0.9908928029248271	0.9926422374029681	0.9931173724810448	5.175296804362765
+0.11004833096656297	0.6644814459639401	0.5239868344883128	0.17314990980873102	0.9429602449150257	0.2418600859762523	0.998932268843212	0.5826938151498987	0.18327900063057578	0.38684542191779026	8.73494610704017
+0.1896735289121496	0.41077067302531	0.5946800689017054	0.7165860931283399	0.4868914823691235	0.3095898177667046	0.5774413728278474	0.44170781956874294	0.35967810260053623	0.3213319320088136	12.202924702612343
+0.20820724019602266	0.45125862406183437	0.4918429102640539	0.8990763147937112	0.7293604610294412	0.7700897729196955	0.3754392475619882	0.34373953523538436	0.6550352059993224	0.7110379932104975	15.547914734580145
+0.11353757521867625	0.13302868937357504	0.45603905760612395	0.15973623015851013	0.9616419037746458	0.8376157448618098	0.5201606870379233	0.2182722577281544	0.13491872253239878	0.9790703454838688	6.918543527074358
+0.7070434956891432	0.8599755569456631	0.38717262782863904	0.2508340198317248	0.29943801894470223	0.8568955284050157	0.47298399056822105	0.6632770470161282	0.8057286074367852	0.2529805046497241	13.689616365480411
+0.07957343897032487	0.7327606050157152	0.9613974775036055	0.9538047341676628	0.49049905188389964	0.6321920644327551	0.7329950198379923	0.9024095032479662	0.16224691874820008	0.40588132236756125	18.06987664088426
+0.41709073558366083	0.6955910282920739	0.4248472379248316	0.8581142260514297	0.846932479609419	0.07019911390868883	0.3017524134841485	0.9796236810301702	0.035626996553034807	0.4923926469985821	20.83271160119166
+0.9523768530135464	0.8105737585294711	0.2943304412963712	0.5962335185183412	0.43117785229972994	0.5923975029889863	0.893752104720206	0.5540211897717062	0.4928665073452738	0.3192704571895012	15.530752257310834
+0.263365783050724	0.5422806135357958	0.08226452393202399	0.6356367098253985	0.7964052251862078	0.9547475054308089	0.6846242716927129	0.48829316680509927	0.4854143101843673	0.9666929205829677	18.166185696459205
+0.21134788749712163	0.41164813817783297	0.9896655767792834	0.02841185671325175	0.7013265140935161	0.0251715638848119	0.3208817260865362	0.07352706186557412	0.06088456434663547	0.11140631670405321	11.285510796612236
+0.16926890814543094	0.627686279501054	0.43839309463984333	0.8309037646039747	0.23979218956447224	0.19005270791973705	0.7118996585829157	0.8582949253267775	0.5590558855960195	0.7044204082888571	12.860142449687132
+0.605112035518179	0.5592172832680401	0.8603941909075867	0.9197553591500698	0.8496073257589813	0.2544665354944545	0.8775555422867709	0.43513019009222575	0.729494343964508	0.4126407675387943	24.78184394518976
+0.1908360458112225	0.7060195199561622	0.24063282092985294	0.8513244268329954	0.8241022892585868	0.5252117866139705	0.3863407943061684	0.5908807907349247	0.13752361490782572	0.8082704078916083	18.086707510047084
+0.965825815244485	0.7797958042329348	0.23933508209581977	0.8672604131084306	0.8081150128937004	0.06368112422046845	0.231228304048803	0.5896854487035268	0.13748694797777417	0.6784407043714858	21.072919626578763
+0.9921906895152471	0.28575198481557174	0.7609127595588501	0.046527167666138625	0.33253590652220666	0.9445527910270574	0.6365170412547786	0.6018486061318925	0.9281846814636464	0.18167941079661343	11.264618441952907
+0.017823184026521055	0.1900721761341725	0.5218717978245897	0.49582198590367044	0.8004912055691525	0.8594363114449111	0.21295603224034498	0.43726884144766365	0.42161750906258955	0.0547173770819418	9.076668851874988
+0.009933693670982957	0.7897656793360066	0.27531321879489834	0.7177400045433364	0.4213559217565558	0.14333587216899957	0.19252168025197935	0.3138152333176353	0.8051701673672972	0.012625830357479995	10.540304759459294
+0.0491059726975559	0.5660003849850935	0.686810696154396	0.7268109050517068	0.47969376130167696	0.3676567217785285	0.8399700992017514	0.45416355245100537	0.3213658387821987	0.09271986717104153	11.236607686992008
+0.06043793213558557	0.09095116720087482	0.6827064564283071	0.6807357672306377	0.24317416588742535	0.6404614421560298	0.06913918311155143	0.8729199617462652	0.10960694983251273	0.16905576511943454	8.863543124398952
+0.46737799144534753	0.7759492194033726	0.8544445157050565	0.21038644476715873	0.07664186926890304	0.788914797103218	0.5475000011493021	0.7862548628154125	0.9200470428587104	0.4809727659278811	14.08324795108047
+0.459553670010184	0.5989791554809532	0.5993187807242845	0.5043734512337575	0.30687852974345065	0.5413529803491126	0.9249269434027916	0.9705508020302188	0.39579460989699644	0.7987452725553391	14.384836026928141
+0.6350881477509265	0.2299691652490331	0.05120709286293723	0.028463806171351802	0.1228477519037694	0.2202125178336386	0.8290227537008228	0.28549182770003945	0.7810640826310915	0.5046658125966791	9.356188456069104
+0.1384489237765847	0.778036552333978	0.9213317935208427	0.9430186320361914	0.7044357972639433	0.6939164454759088	0.546551813367495	0.36921722973788307	0.982467574726993	0.0656092254275048	19.82262440529854
+0.8976783107422656	0.26393098909487067	0.5744758420233385	0.5128662680937877	0.554476808071934	0.6471673318283991	0.1854741590544805	0.27197820430902153	0.14843865774278353	0.030304170594405044	14.786714087609445
+0.9392555841521393	0.34675413017620393	0.10956460430560977	0.3783269956614701	0.38407945904141416	0.6654236879194613	0.24449092930615968	0.661480973773685	0.09849288379186216	0.5808627476668515	17.29018333220705
+0.10686550466855071	0.5482545074639875	0.5197517077112073	0.2962341178657576	0.45572905099809846	0.03866652012956684	0.5990030248885009	0.0004867594752598903	0.5018135936855311	0.5017261216916143	7.079056484266911
+0.06066969591495719	0.9498369391498449	0.6086590451398208	0.6720026837921436	0.4627735236945656	0.7042730952349673	0.18106714116610723	0.6475821773323257	0.5681087348454958	0.9541383145344952	11.07054139657063
+0.7966902388813616	0.5853103927119501	0.4553549670732038	0.7384515305314945	0.8122362779627881	0.9272911735521501	0.8263756067215121	0.029956597665086293	0.7728028218089087	0.5217773936163203	21.42960531525592
+0.885387332241226	0.45856166708365387	0.5407225761596202	0.9077649982654136	0.5563100402768733	0.18711472229064618	0.6811113675419537	0.013846685418091642	0.38009165785093446	0.8086844901333918	21.459530154181827
+0.5761254124118753	0.15178450453000336	0.32985476037950434	0.9517731461483258	0.0303847229992098	0.7781735271559485	0.1813838598387736	0.21365686845063014	0.6525962229220905	0.14409194606082942	12.961442345162663
+0.3810072706070531	0.4057345325726489	0.6589654345726036	0.5118226737134436	0.4825851038502419	0.5240217982839889	0.8062858732427213	0.8043910806692938	0.14770043610250894	0.9934535770806974	12.704402405651866
+0.067767735751191	0.9958158069623947	0.12344969265330885	0.06192919793340079	0.7040354417782194	0.9609796529778833	0.712150947902339	0.6630813223207347	0.13367496222456432	0.1803451692283481	9.079503671616516
+0.15671586892228329	0.0904734812788307	0.9718661482450326	0.5098611302849001	0.4508774763010518	0.3297009784972129	0.49351204204947463	0.14360098508058272	0.1509202908404773	0.8153385794598776	12.251439442464823
+0.2112818837963617	0.08654232235729176	0.38725741753121723	0.8934034140221164	0.4286432979428625	0.7663040121802115	0.9952654020174069	0.020062850895111617	0.10819822866909212	0.69474267149362	11.905587280344058
+0.8906640504565513	0.4924763237765829	0.07026799039549492	0.08843736434987892	0.10620815853048937	0.20125887824678435	0.8773640053306407	0.9432225022019286	0.13563613798031937	0.8587269726838475	14.92352889377353
+0.7571582824355558	0.6861716144556532	0.8563933901602275	0.23087775291356172	0.5193379792114721	0.3433334451764454	0.6587729293586823	0.28279025386662415	0.502466433756727	0.30327751955275506	17.426955660751474
+0.5525294234343233	0.16112709705428085	0.568548964618283	0.4857098681067773	0.12751954351366868	0.5436921692300374	0.20049060873265778	0.6701608599998026	0.5581122170361856	0.2323783174916082	8.349233666783295
+0.5155884856098234	0.3149919734186799	0.8465925489214037	0.44737628027740306	0.10008522439470402	0.9015920853941103	0.8560882485516653	0.2863298739118133	0.25901477045356636	0.06637137355819867	12.26035889088531
+0.3176316716278835	0.05184299524331337	0.9441883178319019	0.7172173020432209	0.553659200161456	0.35974476987985604	0.15918230108432907	0.43295804116479997	0.2793621769098912	0.9610376321653145	14.40362888425922
+0.09813215580838908	0.40699555242514285	0.008376446001807092	0.5680589295963213	0.5766097683672401	0.1371442613273378	0.6722185660414206	0.1428737274580416	0.5092314972536864	0.36876195253012645	14.64895450617728
+0.2491073893585356	0.13628212203334145	0.11929113212325759	0.05238812645692448	0.4348993146930489	0.7707053805867863	0.8509141823068277	0.6212826674295909	0.37988768839810483	0.6799110364172396	6.661677492887992
+0.3137655042597186	0.726637982999317	0.9144831910873826	0.094895480739556	0.6649769518322519	0.35687279405119077	0.7622909202623359	0.9450056911510231	0.22374220285139934	0.05725321925421012	14.275479679694111
+0.6428018502331379	0.0887771085528527	0.6679384149986543	0.6072213851311274	0.01959981977284353	0.3937933443577386	0.4595073026861176	0.021136011560755397	0.37369090134501737	0.5655671369760998	8.51747510592055
+0.00887517698156215	0.16284534638833636	0.8981317369729009	0.35543331858117866	0.3097535151674734	0.5821566782631048	0.5221646219283154	0.8824557693517251	0.2723444648400082	0.2998200567828857	8.318683055535784
+0.3083867067948075	0.10100427170620596	0.29502169857893545	0.7289047920416258	0.34187889271524396	0.2860681555183966	0.9563476061071962	0.9994791511322937	0.3373519213932864	0.4751215567999363	10.81575853973493
+0.8296496599906129	0.09940514628180974	0.50811464169943	0.8338365663554891	0.7701229934134927	0.8160003497549749	0.051549976415450005	0.6813237878724938	0.9632936328077967	0.7009474565722479	14.7523242052166
+0.4098464718143954	0.2070405888350909	0.9560226669224692	0.40601117716635504	0.716880130904611	0.6723314084399745	0.8421371025537246	0.940740392297392	0.4698011067009591	0.10771652388871167	14.437977850974152
+0.5666853987413368	0.9797770299024345	0.4339147015301905	0.8180344364829785	0.43724959672412667	0.8105342992752003	0.22960846580858452	0.4109781451687913	0.7309511398181268	0.6373144062380719	20.303811360434118
+0.7691426808213709	0.9562240422458972	0.3760066618461234	0.8957014217970638	0.20848049565757376	0.06319643998308144	0.2394216729185552	0.7801992488254825	0.3760754415175315	0.5814837295524542	17.693211514972546
+0.2417021356737692	0.4385545867531734	0.18045227317063817	0.37312046783579444	0.8639333907383302	0.8559936753056242	0.940079549566491	0.4057399896621089	0.9823102135057693	0.4826039437830758	13.361954459981405
+0.8771207824694917	0.4088792202469834	0.31977322627438365	0.6424685981654128	0.7093654458159975	0.7423468167300954	0.604514627149687	0.8584415473916255	0.6499068382880037	0.270485889197416	19.651095541242153
+0.8584748656310555	0.1808249680067895	0.5377051151480724	0.38692991753348105	0.6195852092738365	0.5485863059731005	0.46389401201881464	0.8264448382313554	0.40099782742517387	0.6195032797683993	11.681443862998442
+0.5007091183337946	0.5008895041536758	0.6089031038167406	0.9953652409958986	0.24794951921663877	0.7384334058920138	0.9300439181805716	0.5844120756954285	0.8806471520789401	0.6920591198056676	18.519413433986806
+0.35141827940417747	0.8206994508517493	0.2370849611913043	0.9216936684824427	0.9188489045540845	0.6295307118357462	0.5122231170341107	0.29985152129987824	0.4510620990884934	0.7171435833472242	23.064480246814917
+0.2897107697174295	0.20884415472966478	0.31653691874943835	0.5732346168518381	0.46252622730189574	0.5026185641627156	0.4872415437421902	0.779227269647643	0.39013589036969454	0.7685351778741765	10.607527674342451
+0.8614682627614487	0.15345044177087064	0.6153544991431779	0.5132315524167129	0.9892656389217689	0.08282528798350319	0.7114699262161587	0.27315441706016785	0.9949414263945612	0.35472791394445913	14.379380861585393
+0.0886254141339946	0.9832503769165538	0.479242981871837	0.4821670204872105	0.5265454160436102	0.9430743268241158	0.4907038517169977	0.030130396160569006	0.9354703428207063	0.7472800008826406	10.166561408472493
+0.7304114921128106	0.10528115445790953	0.7656025630259959	0.7078790446085943	0.9225381437161363	0.5090713624505511	0.7121099683829537	0.8710483215307725	0.43066181495719147	0.48712869117962754	15.494784545703714
+0.12223180018508994	0.1900160836371645	0.5997405304143875	0.2980776286541513	0.18268336777640204	0.5030276903035737	0.9506696371583517	0.2325800919586698	0.7390820442705245	0.7616713142711553	4.822175852305057
+0.7660564796818717	0.9244958016032567	0.3228087260890464	0.6789428837728861	0.1718199895762833	0.7095739437934471	0.4893233847660068	0.441921269249274	0.6465757977985269	0.4784335817739622	16.21224059173453
+0.7809835653732088	0.5637844595472824	0.8491603722968005	0.3324874926307865	0.6876383457298232	0.31032585761982945	0.6607954615137971	0.35447467775251196	0.061312486142167555	0.44390848519873516	19.0259976096665
+0.7083258497660975	0.2574186578134675	0.6183630278806319	0.12162527851495386	0.6373243081047304	0.05829174691838146	0.04762410122741678	0.511944559203932	0.29931499088474944	0.34643613534056983	10.103164404071599
+0.6492174346036962	0.9488882701086157	0.5162418791778752	0.7135434407602232	0.5861612487888144	0.39493583813539335	0.671816525290099	0.23717057627672355	0.8482091462350475	0.2924731670105124	19.414416242542014
+0.12065632604964383	0.4311841945956453	0.2719515607303118	0.2737262760819733	0.6422025693611261	0.44991232849801055	0.9084847728691557	0.7753971680607056	0.33911251996550873	0.7037406503612524	8.615547132563627
+0.23911862145194263	0.20516107579979725	0.6839686008379533	0.41669528896656205	0.19521144746509556	0.3903295752782401	0.09852342315710272	0.32254437988658846	0.8894781356759724	0.9422719149629099	7.355002272760527
+0.6574707574441057	0.1956287488018773	0.5256787607410369	0.3108091040925598	0.5553483943313786	0.5355298073676616	0.4651129288983915	0.7678645943333149	0.8869469716865482	0.8298093684181447	9.829679628165866
+0.9588430789564042	0.9110639960968554	0.1196747838441613	0.11446859495951	0.9969650063282696	0.04000832595810755	0.8595637445186795	0.46550503372369256	0.2889983273891915	0.7332639578005105	12.890832144541104
+0.47219244963377505	0.36603378202458836	0.07374308587639289	0.8212053023334988	0.48801691478932074	0.7570620648656129	0.37107807260930714	0.2695048247626399	0.7345946354267014	0.8465645262987437	19.45300037464767
+0.7731597126964512	0.09726311997082848	0.3128848054042207	0.054297371248047455	0.9964178644970716	0.177698734352288	0.37123100482185356	0.3589325920964376	0.23918094189867656	0.19412444639857296	8.565865450206013
+0.7221568697894736	0.9963498623999889	0.6578810615587287	0.18964066816521796	0.7960500133787225	0.6331488340440541	0.05997465943644009	0.45123696414113945	0.3981555798526656	0.4574877112189486	14.089903184543674
+0.17329540858703296	0.5551602246692062	0.675575702816968	0.8264278406303862	0.753975346409477	0.03806626488278475	0.795113651901603	0.6539318070808459	0.6049933023598654	0.00079912648846725	15.627307991786289
+0.013114781463635872	0.14710484933761359	0.26562391867980684	0.06049450827851821	0.2578656308496723	0.22906133301836384	0.8240837710969812	0.20185448655187266	0.881092325628702	0.21436450568575982	3.053524927766419
+0.09124750057287223	0.7458057935231055	0.5043400350526346	0.5862020432833676	0.36415611319487795	0.5532539595411161	0.8128446991062696	0.14007325741439247	0.26762510211969903	0.7395485502578282	9.804873358542737
+0.273796078111771	0.5968614644069085	0.33862246805035456	0.07160379461501021	0.49859687569685474	0.7144913096107074	0.9906342627731619	0.30616421419444173	0.43181899369392907	0.5481835598658806	8.641240148791484
+0.5922789121550232	0.10793438223331675	0.7218030237835277	0.28781493382595613	0.7101954909298428	0.26491733998837474	0.32929177720525493	0.15393928318285965	0.30573627751887034	0.767593568436209	9.407918967360633
+0.5738480440000739	0.9717102350944524	0.6918493680668857	0.49136225796249566	0.4189538130977012	0.9528784220570516	0.14422252170336136	0.5212103058543409	0.8891494541942766	0.7243161529127102	17.58115736412586
+0.6524273028079878	0.5732108771943734	0.18508275660219697	0.6138808688662424	0.07695021292315907	0.6680945170106404	0.23147976471742693	0.2237384718444413	0.07931564343308894	0.5290531406613654	17.733483205030982
+0.292207224946918	0.5347443302731564	0.4966394675328142	0.43871374689137466	0.40966714178368036	0.2606110148444858	0.08937483777810629	0.8066866320537381	0.15657531573242267	0.9139261452578302	11.149836991525426
+0.44666536992172634	0.44940086096850873	0.08179437299051329	0.6964934161855384	0.20657215375013938	0.09570310018074724	0.7220107222790408	0.3936551862994325	0.5911130758518441	0.5127646181849301	17.392150320937144
+0.024792440847191677	0.7627946139093299	0.26576180603378574	0.9788268401766658	0.9486860068478548	0.7256699734894949	0.7255050205514576	0.050824790816173304	0.5940661143252837	0.7171266563833804	16.222823164393663
+0.04187295085349507	0.4858483334364002	0.9868242589438908	0.04782633490074317	0.5788519741372516	0.07155939791943544	0.28014174429830796	0.7018218260054466	0.16232193959804986	0.49228648720154566	8.751167952614102
+0.9545457112974848	0.5893551623652425	0.6066268202107414	0.8679865440385066	0.9365479368445849	0.14416045993162074	0.2770071902007831	0.12532193725528784	0.884720788157515	0.8267377704644704	23.39743606740882
+0.9953588810927804	0.8138696157910104	0.11914570059659024	0.9315367835142864	0.006986692731106969	0.5383962494524664	0.7825015421974374	0.8888692517279119	0.30537562757152403	0.6446775039355818	17.869735208455047
+0.12491934664885951	0.608584300362758	0.18949843940084687	0.4390658193797916	0.9704126030213763	0.06809275523457425	0.2051728622611535	0.5075719409410157	0.14050011761810988	0.9337383557266488	13.53666671909896
+0.6065454317067481	0.46153152916886886	0.8015021709095485	0.6987073120764528	0.7445573429189948	0.32516377858166023	0.17845078715926477	0.014351502625561174	0.10704972728076023	0.2730517009310389	20.2318585989548
+0.6165217754396433	0.9475792237640892	0.9064723688429247	0.965094028213592	0.33762107364119875	0.6564030876691848	0.291455780992926	0.15086922353097754	0.036932063464012566	0.5979637425112644	24.295590457548577
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/friedman2.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,101 @@
+0	1	2	3	0
+54.340494179096545	580.4157780449804	0.4245175907491331	9.447761323199037	252.3175321312284
+0.47188561909725646	324.2624476565047	0.6707490847267786	9.258527551050477	217.49891878908315
+13.670658968495298	1065.1523751493062	0.891321954312264	3.092021221171896	949.4918123086619
+18.532821955007506	302.71124845232475	0.21969749262499216	10.786237847073696	69.0385890614886
+81.16831490893233	406.55138981837536	0.8162247487258399	3.740737470416992	341.61946168251893
+43.17041836631217	1661.3229093937068	0.8176493787767274	4.361119501208987	1359.065329368987
+17.541045374233665	734.7326433201733	0.005688507352573424	3.524263534448404	18.032014110410582
+79.56625084732873	150.58465705466725	0.5988433769284929	7.038045390428536	120.2598923821887
+10.514768541205633	749.6172809180189	0.03647605659256892	9.904115634420757	29.295002042749065
+98.09208570123114	223.58662823399155	0.8905459447285041	6.769014994000329	221.96451266962563
+74.24796890979773	1155.1499432690875	0.5818421923987779	1.2043913202692316	676.202880083338
+21.00265776728606	1015.4762722834868	0.7691151711056516	3.5069522913839593	781.3002704061951
+28.58956904068647	1518.1603420210945	0.9750064936065875	9.848532934911056	1480.4921951648091
+35.95078439369023	1103.9765558914746	0.3547956116572998	4.401902153706457	393.33223818275417
+17.808098950580487	513.9676635429531	0.04486228246077528	6.054314296357893	29.13372581378542
+37.625245429736296	1094.087314354974	0.6299418755874974	2.426003144462835	690.2372882885904
+93.3841299466419	1671.6965482922212	0.6022966577308656	4.877662803266308	1011.1784501808802
+36.31880041093498	459.48790885887036	0.27676506139633517	3.4653588120354963	132.2541308347294
+17.360800174020508	1704.7445419904177	0.9570126003527981	6.979736843289207	1631.554290748974
+73.13007530599226	681.726598181031	0.09205560337723862	5.634980189371477	96.36589298307057
+50.86988932381939	270.1747375569969	0.5280352233180474	10.921580365105282	151.45967058029146
+39.50359317582296	673.903510398035	0.8054505373292797	8.543489945823536	544.2313687666258
+31.306644158850972	1161.4438984999683	0.5404045753007164	3.967937508800147	628.4296697532741
+11.078790118244575	636.4017069153224	0.4569791300492658	7.589400702261969	291.03303662060034
+25.42575178177181	1172.9847885050644	0.20012360721840317	7.576248055289837	236.1147978147717
+77.82892154498485	1399.2376190930588	0.6103281532093938	4.090003485244022	857.5330814879569
+69.7734907512956	1529.9603779755726	0.6253237577568076	10.824078296095497	959.2614236165756
+97.65001270158552	397.9799362884419	0.02317813647840361	2.6074454850708166	98.08464391759719
+92.34968252590873	1683.4096118144525	0.21097841871844636	4.605252508146082	366.97302133435386
+54.93752616276721	569.734241516186	0.46060162107485014	7.961615648233853	268.10919955478056
+50.035589667486505	1295.4574551145477	0.525955936229779	1.0139902311904383	683.18750535065
+39.470028668983545	929.6815373737124	0.40288033137914214	4.542983001063206	376.6240995010018
+50.06143194429532	852.9167920201943	0.09043278819643585	3.7356292002744063	91.95318916050276
+94.34770977427269	169.0277802511735	0.039998689640650786	3.8314035971981957	94.5895295076982
+58.23441702167689	1744.4141122286821	0.9926422374029681	10.931173724810447	1732.5580336252374
+11.004833096656297	1211.179321268851	0.5239868344883128	2.73149909808731	634.7371222778227
+94.29602449150258	520.7731581793785	0.998932268843212	6.826938151498987	528.693948971785
+18.327900063057577	757.625288640914	0.1896735289121496	5.1077067302531	144.86527485195924
+59.46800689017054	1296.2989411786257	0.4868914823691235	4.095898177667046	633.9520920433132
+57.744137282784735	847.2500474585627	0.35967810260053623	4.213319320088136	310.15968510981907
+20.820724019602267	862.8525108188742	0.4918429102640539	9.990763147937113	424.8982058212394
+72.93604610294412	1383.7040602123484	0.3754392475619882	4.437395352353843	524.5916835666012
+65.50352059993224	1287.2354088081224	0.11353757521867625	2.3302868937357504	160.1571589449888
+45.60390576061239	386.6133130762057	0.9616419037746458	9.376157448618098	374.56979106026796
+52.01606870379233	482.23941725143015	0.13491872253239878	10.790703454838688	83.29980059287064
+70.70434956891431	1530.5440099665805	0.38717262782863904	3.5083401983172484	596.7877059177458
+29.943801894470223	1525.5123885477851	0.47298399056822105	7.632770470161282	722.1639132185364
+80.57286074367852	538.9397874962779	0.07957343897032487	8.32760605015715	91.27494219348714
+96.13974775036056	1683.825997970145	0.49049905188389964	7.321920644327551	831.4916692830858
+73.29950198379923	1599.8653004289727	0.16224691874820008	5.058813223675612	269.7239459214427
+41.709073558366086	1262.0008116239733	0.4248472379248316	9.581142260514298	537.7773575456935
+84.6932479609419	240.34295682649764	0.3017524134841485	10.796236810301702	111.50170710135895
+3.5626996553034807	930.0502098396282	0.9523768530135464	9.105737585294712	885.7653388336638
+29.43304412963712	1099.6875837762232	0.43117785229972994	6.9239750298898635	475.0734339263449
+89.37521047202061	1030.7283339979235	0.4928665073452738	4.192704571895012	515.8132906927318
+26.3365783050724	1011.5485978110671	0.08226452393202399	7.356367098253985	87.28262499048417
+79.64052251862078	1685.366135672789	0.6846242716927129	5.882931668050992	1156.58767097945
+48.54143101843673	1704.8805024855624	0.21134788749712163	5.11648138177833	363.57774253644357
+98.96655767792834	172.07811591269444	0.7013265140935161	1.251715638848119	156.06931868323713
+32.08817260865362	245.77958638999525	0.06088456434663547	2.1140631670405323	35.40508437542623
+16.926890814543093	1151.0697004521946	0.43839309463984333	9.309037646039748	504.9047309043652
+23.979218956447223	436.1391654612479	0.7118996585829157	9.582949253267776	311.4116762435596
+55.90558855960195	1276.4247355974696	0.605112035518179	6.592172832680401	774.4004579134555
+86.03941909075867	1628.201979434556	0.8496073257589813	3.544665354944545	1386.0052800129015
+87.75555422867708	836.5046465890024	0.729494343964508	5.126407675387943	616.502880557919
+19.08360458112225	1279.0370894799328	0.24063282092985294	9.513244268329954	308.3692869277446
+82.41022892585868	983.664481154306	0.3863407943061684	6.908807907349248	388.86234039746984
+13.752361490782572	1446.0770214276688	0.965825815244485	8.797958042329348	1396.7261450068233
+23.933508209581976	1542.444756280353	0.8081150128937004	1.6368112422046845	1246.7021204183736
+23.1228304048803	1088.990472403008	0.13748694797777417	7.784407043714858	151.49686527332432
+99.21906895152472	592.4762009911489	0.7609127595588501	1.4652716766613862	461.6107590254396
+33.253590652220666	1668.7117629371276	0.6365170412547786	7.018486061318925	1062.6838031691402
+92.81846814636464	422.4603113225164	0.017823184026521055	2.9007217613417247	93.12330768632674
+52.18717978245897	935.6524745132937	0.8004912055691525	9.594363114449111	750.7974014518164
+21.295603224034497	839.9984077101558	0.42161750906258955	1.547173770819418	354.7969452507752
+0.9933693670982957	1415.847175398454	0.27531321879489834	8.177400045433364	389.8026225581974
+42.13559217565558	359.8212261046394	0.19252168025197935	4.138152333176353	81.08093014555008
+80.51701673672972	146.2896184097874	0.0491059726975559	6.660003849850935	80.83675338792878
+68.68106961543961	1313.0024820704748	0.47969376130167696	4.676567217785285	633.5725491887692
+83.99700992017513	867.5980836959187	0.3213658387821987	1.9271986717104153	291.1936489907113
+6.043793213558557	274.244095874708	0.6827064564283071	7.8073576723063765	187.3252705855037
+24.317416588742535	1171.9395661677436	0.06913918311155143	9.729199617462651	84.5972117336421
+10.960694983251273	401.83796801162464	0.46737799144534753	8.759492194033726	188.12950260375516
+85.44445157050565	469.3569309771897	0.07664186926890304	8.88914797103218	92.70787499286608
+54.75000011493021	1410.11180659607	0.9200470428587104	5.809727659278811	1298.5238084377568
+45.9553670010184	1104.1729336900296	0.5993187807242845	6.043734512337576	663.345193848069
+30.687852974345063	1010.0331900967218	0.9249269434027916	10.705508020302188	934.7107170433636
+39.57946098969964	1430.5164919252954	0.6350881477509265	3.2996916524903313	909.3655989305239
+5.120709286293723	172.1629820113755	0.1228477519037694	3.202125178336386	21.759146841336335
+82.90227537008228	592.0512009960225	0.7810640826310915	6.046658125966791	469.80205128257876
+13.844892377658468	1396.6861430027047	0.9213317935208427	10.430186320361914	1286.885757399791
+70.44357972639433	1259.2651659459655	0.546551813367495	4.69217229737883	691.8490914986029
+98.2467574726993	232.84478566118992	0.8976783107422656	3.6393098909487067	230.95708002350815
+57.44758420233384	963.4964942046691	0.554476808071934	7.471673318283991	537.3161754923093
+18.54741590544805	569.9749650123499	0.14843865774278353	1.3030417059440504	86.61413266611218
+93.92555841521393	692.1310246846019	0.10956460430560977	4.783269956614701	120.71709895964038
+38.407945904141414	1212.7185942796432	0.24449092930615968	7.6148097377368495	298.97589013891826
+9.849288379186216	1074.5774593669562	0.10686550466855071	6.482545074639875	115.25672659315927
+51.97517077112073	609.6001089270445	0.45572905099809846	1.3866652012956684	282.63144665101163
+59.90030248885009	126.4588901391934	0.5018135936855311	6.017261216916143	87.26338001352038
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/friedman3.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,101 @@
+0	1	2	3	0
+54.340494179096545	580.4157780449804	0.4245175907491331	9.447761323199037	1.3537302182704163
+0.47188561909725646	324.2624476565047	0.6707490847267786	9.258527551050477	1.5686267252541977
+13.670658968495298	1065.1523751493062	0.891321954312264	3.092021221171896	1.5563979600543916
+18.532821955007506	302.71124845232475	0.21969749262499216	10.786237847073696	1.2990215504772198
+81.16831490893233	406.55138981837536	0.8162247487258399	3.740737470416992	1.330903394043473
+43.17041836631217	1661.3229093937068	0.8176493787767274	4.361119501208987	1.5390261973034576
+17.541045374233665	734.7326433201733	0.005688507352573424	3.524263534448404	0.23388919220067908
+79.56625084732873	150.58465705466725	0.5988433769284929	7.038045390428536	0.8478202561730687
+10.514768541205633	749.6172809180189	0.03647605659256892	9.904115634420757	1.2036782417865977
+98.09208570123114	223.58662823399155	0.8905459447285041	6.769014994000329	1.113050765386626
+74.24796890979773	1155.1499432690875	0.5818421923987779	1.2043913202692316	1.4607731674987232
+21.00265776728606	1015.4762722834868	0.7691151711056516	3.5069522913839593	1.5439114159725646
+28.58956904068647	1518.1603420210945	0.9750064936065875	9.848532934911056	1.5514842721164925
+35.95078439369023	1103.9765558914746	0.3547956116572998	4.401902153706457	1.4792680312252677
+17.808098950580487	513.9676635429531	0.04486228246077528	6.054314296357893	0.9131525635743539
+37.625245429736296	1094.087314354974	0.6299418755874974	2.426003144462835	1.5162586999022116
+93.3841299466419	1671.6965482922212	0.6022966577308656	4.877662803266308	1.478312764448359
+36.31880041093498	459.48790885887036	0.27676506139633517	3.4653588120354963	1.292608359663051
+17.360800174020508	1704.7445419904177	0.9570126003527981	6.979736843289207	1.5601554747573891
+73.13007530599226	681.726598181031	0.09205560337723862	5.634980189371477	0.7092059328226685
+50.86988932381939	270.1747375569969	0.5280352233180474	10.921580365105282	1.228273691878848
+39.50359317582296	673.903510398035	0.8054505373292797	8.543489945823536	1.4981464081771367
+31.306644158850972	1161.4438984999683	0.5404045753007164	3.967937508800147	1.520958438151283
+11.078790118244575	636.4017069153224	0.4569791300492658	7.589400702261969	1.532720004888662
+25.42575178177181	1172.9847885050644	0.20012360721840317	7.576248055289837	1.4629032640882886
+77.82892154498485	1399.2376190930588	0.6103281532093938	4.090003485244022	1.4799121730128941
+69.7734907512956	1529.9603779755726	0.6253237577568076	10.824078296095497	1.4979953570128628
+97.65001270158552	397.9799362884419	0.02317813647840361	2.6074454850708166	0.09417496029834331
+92.34968252590873	1683.4096118144525	0.21097841871844636	4.605252508146082	1.316408987919193
+54.93752616276721	569.734241516186	0.46060162107485014	7.961615648233853	1.3644273530320843
+50.035589667486505	1295.4574551145477	0.525955936229779	1.0139902311904383	1.4974922509449833
+39.470028668983545	929.6815373737124	0.40288033137914214	4.542983001063206	1.465804007778235
+50.06143194429532	852.9167920201943	0.09043278819643585	3.7356292002744063	0.9950952334037717
+94.34770977427269	169.0277802511735	0.039998689640650786	3.8314035971981957	0.07152072382161595
+58.23441702167689	1744.4141122286821	0.9926422374029681	10.931173724810447	1.537178181507009
+11.004833096656297	1211.179321268851	0.5239868344883128	2.73149909808731	1.553457834819853
+94.29602449150258	520.7731581793785	0.998932268843212	6.826938151498987	1.3914803680125012
+18.327900063057577	757.625288640914	0.1896735289121496	5.1077067302531	1.4439394940411856
+59.46800689017054	1296.2989411786257	0.4868914823691235	4.095898177667046	1.4768530008487357
+57.744137282784735	847.2500474585627	0.35967810260053623	4.213319320088136	1.3835281729272806
+20.820724019602267	862.8525108188742	0.4918429102640539	9.990763147937113	1.5217750198560809
+72.93604610294412	1383.7040602123484	0.3754392475619882	4.437395352353843	1.4313105187399757
+65.50352059993224	1287.2354088081224	0.11353757521867625	2.3302868937357504	1.1494435656372273
+45.60390576061239	386.6133130762057	0.9616419037746458	9.376157448618098	1.4487434272797226
+52.01606870379233	482.23941725143015	0.13491872253239878	10.790703454838688	0.8963767176774797
+70.70434956891431	1530.5440099665805	0.38717262782863904	3.5083401983172484	1.4520425271394557
+29.943801894470223	1525.5123885477851	0.47298399056822105	7.632770470161282	1.5293204399456315
+80.57286074367852	538.9397874962779	0.07957343897032487	8.32760605015715	0.48911511072271613
+96.13974775036056	1683.825997970145	0.49049905188389964	7.321920644327551	1.4549139176354322
+73.29950198379923	1599.8653004289727	0.16224691874820008	5.058813223675612	1.2955775487583667
+41.709073558366086	1262.0008116239733	0.4248472379248316	9.581142260514298	1.4931601045151275
+84.6932479609419	240.34295682649764	0.3017524134841485	10.796236810301702	0.7081460027584869
+3.5626996553034807	930.0502098396282	0.9523768530135464	9.105737585294712	1.5667741449535897
+29.43304412963712	1099.6875837762232	0.43117785229972994	6.9239750298898635	1.508801898429284
+89.37521047202061	1030.7283339979235	0.4928665073452738	4.192704571895012	1.3966469247041897
+26.3365783050724	1011.5485978110671	0.08226452393202399	7.356367098253985	1.2642801056018358
+79.64052251862078	1685.366135672789	0.6846242716927129	5.882931668050992	1.5018836153535167
+48.54143101843673	1704.8805024855624	0.21134788749712163	5.11648138177833	1.4368860145584557
+98.96655767792834	172.07811591269444	0.7013265140935161	1.251715638848119	0.8839273983451799
+32.08817260865362	245.77958638999525	0.06088456434663547	2.1140631670405323	0.4363143388850777
+16.926890814543093	1151.0697004521946	0.43839309463984333	9.309037646039748	1.537265123522342
+23.979218956447223	436.1391654612479	0.7118996585829157	9.582949253267776	1.4937183598137929
+55.90558855960195	1276.4247355974696	0.605112035518179	6.592172832680401	1.4985413807429304
+86.03941909075867	1628.201979434556	0.8496073257589813	3.544665354944545	1.5086791210059998
+87.75555422867708	836.5046465890024	0.729494343964508	5.126407675387943	1.4279670872972425
+19.08360458112225	1279.0370894799328	0.24063282092985294	9.513244268329954	1.5088712014128396
+82.41022892585868	983.664481154306	0.3863407943061684	6.908807907349248	1.3572505259832122
+13.752361490782572	1446.0770214276688	0.965825815244485	8.797958042329348	1.5609500274635577
+23.933508209581976	1542.444756280353	0.8081150128937004	1.6368112422046845	1.551597692135967
+23.1228304048803	1088.990472403008	0.13748694797777417	7.784407043714858	1.4175683268390444
+99.21906895152472	592.4762009911489	0.7609127595588501	1.4652716766613862	1.3541649297787708
+33.253590652220666	1668.7117629371276	0.6365170412547786	7.018486061318925	1.5394991338751214
+92.81846814636464	422.4603113225164	0.017823184026521055	2.9007217613417247	0.08093567500779064
+52.18717978245897	935.6524745132937	0.8004912055691525	9.594363114449111	1.5012312283366778
+21.295603224034497	839.9984077101558	0.42161750906258955	1.547173770819418	1.5107382823434816
+0.9933693670982957	1415.847175398454	0.27531321879489834	8.177400045433364	1.5682479333649404
+42.13559217565558	359.8212261046394	0.19252168025197935	4.138152333176353	1.0243278438907364
+80.51701673672972	146.2896184097874	0.0491059726975559	6.660003849850935	0.08897131915549368
+68.68106961543961	1313.0024820704748	0.47969376130167696	4.676567217785285	1.4621800366126962
+83.99700992017513	867.5980836959187	0.3213658387821987	1.9271986717104153	1.278180794940832
+6.043793213558557	274.244095874708	0.6827064564283071	7.8073576723063765	1.5385270967777893
+24.317416588742535	1171.9395661677436	0.06913918311155143	9.729199617462651	1.279233560839038
+10.960694983251273	401.83796801162464	0.46737799144534753	8.759492194033726	1.5125018799191523
+85.44445157050565	469.3569309771897	0.07664186926890304	8.88914797103218	0.39847812418012996
+54.75000011493021	1410.11180659607	0.9200470428587104	5.809727659278811	1.5286205617962407
+45.9553670010184	1104.1729336900296	0.5993187807242845	6.043734512337576	1.5014625812811586
+30.687852974345063	1010.0331900967218	0.9249269434027916	10.705508020302188	1.5379590348236802
+39.57946098969964	1430.5164919252954	0.6350881477509265	3.2996916524903313	1.5272583174422345
+5.120709286293723	172.1629820113755	0.1228477519037694	3.202125178336386	1.3332321248119827
+82.90227537008228	592.0512009960225	0.7810640826310915	6.046658125966791	1.3934053052318693
+13.844892377658468	1396.6861430027047	0.9213317935208427	10.430186320361914	1.5600376721205496
+70.44357972639433	1259.2651659459655	0.546551813367495	4.69217229737883	1.4688002865000722
+98.2467574726993	232.84478566118992	0.8976783107422656	3.6393098909487067	1.1314039082633651
+57.44758420233384	963.4964942046691	0.554476808071934	7.471673318283991	1.463675788141726
+18.54741590544805	569.9749650123499	0.14843865774278353	1.3030417059440504	1.3549865945559618
+93.92555841521393	692.1310246846019	0.10956460430560977	4.783269956614701	0.67921924302924
+38.407945904141414	1212.7185942796432	0.24449092930615968	7.6148097377368495	1.4419753005453402
+9.849288379186216	1074.5774593669562	0.10686550466855071	6.482545074639875	1.485236760818887
+51.97517077112073	609.6001089270445	0.45572905099809846	1.3866652012956684	1.3858463757729043
+59.90030248885009	126.4588901391934	0.5018135936855311	6.017261216916143	0.8142264061570644
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gaus.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,101 @@
+0	1	0
+1.1705269829481435	2.0777122322502035	1
+2.0346075615049335	-0.5507144119145928	1
+-0.07602346572462335	0.003957593987599105	0
+-0.18949583082317534	0.25500144427338167	0
+1.299748074755309	-1.733095623653281	1
+1.943262263433996	-1.4474361123195851	1
+1.1896222680291255	-1.690616826383604	1
+-0.5788258247909884	-1.1994511991939312	1
+0.7310003438348087	1.361556125145331	1
+-0.5144298913687853	-0.21606012000326133	0
+0.1088634678336795	0.50780959049232	0
+-0.12620118371357705	1.9902736497540905	1
+-0.7044181997350232	-0.591375121085172	0
+-1.5075851602643862	0.10788413080661359	1
+-0.4580269855026243	0.43516348812289213	0
+1.0936866496587212	-0.2295177532399562	0
+-0.9400461615447682	-0.8279323643658708	1
+0.46629936835718944	0.26998723863108903	0
+-0.32623805920230253	0.055676014854776905	0
+0.6901214702247076	0.6868900661384048	0
+1.5861709384232352	0.6933906585165882	1
+0.672720805709661	-0.10441114339062771	0
+-0.5999830448488669	1.5761667243192063	1
+2.0747931679465657	-0.34329768218246975	1
+-0.5444391616724643	-0.6681717368134277	0
+0.5229978045207515	-0.016345402757487165	0
+-2.9733154740508856	0.03331727813886288	1
+-0.008898663292110321	-0.5431980084071721	0
+-1.2963918071501508	0.095139443565453	1
+-1.4977203810831696	-1.193885976791938	1
+-0.251879139213213	-0.8424357382512976	0
+-0.07961124591739943	-0.8897314812650339	0
+0.8945977057600133	0.7596931198502055	0
+-0.23871286931467955	-1.429066898448291	1
+0.22117966922140045	-1.0700433305682933	0
+-0.3198310471180883	-1.1477415998765863	0
+-0.42371509994342044	-1.185983564929173	1
+0.9813207869512316	0.5142188413943821	0
+0.7504447615341785	-0.4559469274680022	0
+1.2962625863990573	0.9522756260818906	1
+-1.7497654730546974	0.34268040332750216	1
+0.7369951690182122	0.4358672525149101	0
+0.6130388816875463	0.7362052133238238	0
+-1.415042920852526	-0.6407599230105716	1
+0.22239080944544862	-0.6849217352472302	0
+1.6189816606752596	1.5416051745134067	1
+1.8765734269621657	-0.37690335016897475	1
+0.007314563228903049	-0.6129387354781626	0
+0.7470556550991475	0.4296764358626096	0
+0.10887198989791452	0.028283634823073247	0
+-0.43813562270441736	-1.1183182462554362	0
+0.30104946378806546	-1.6848999616851803	1
+-1.3969993449532836	-1.0971719846398227	1
+-0.24888866705810792	-0.45017643501165083	0
+-1.635529399380822	-1.044209877709317	1
+-0.17478155445149818	1.0172643432511694	0
+-0.5835950503226648	0.816847071685779	0
+-1.9580812342078666	-0.13480131198999493	1
+0.4223802204219781	-1.094042931032235	0
+-0.98331009912963	0.3575077531673654	0
+-1.566687529578391	0.9049741214666812	1
+0.9490047765052598	-0.019397585962465276	0
+-0.5312803768519098	1.0297326851333461	0
+0.7530621876919789	-1.6094388961729544	1
+0.13024845535270219	0.9493608646609868	0
+-0.3317771350528086	-0.6892179780897532	0
+1.703623988120705	-0.7221507700557533	1
+-1.841188300186717	0.36609322616730366	1
+-0.365461992676627	-1.271023040846661	1
+-0.8817983894830175	0.01863894948806016	0
+-1.7059520057381703	0.3691639571070058	1
+-0.8622273465104797	1.249469742726979	1
+-1.1880175973177194	-0.5497461935354897	1
+-1.7046512057609624	-1.1362610068273629	1
+-0.18501411089711395	-2.4871515352227695	1
+-0.45592201921402026	0.6491729272546821	0
+0.22239960855530486	-1.4432169952253369	1
+0.7504533303268411	-1.3069923390808191	1
+0.13242780114877378	0.022213928039390988	0
+1.8319360818255361	0.003017434031214063	1
+-0.41581633584065	-1.3585029367597998	1
+-1.3563990488613127	-1.2324345139149262	1
+-1.5406160245526137	2.0467139684821385	1
+-1.2172541306410147	-0.15726516737513793	0
+1.0269214393997905	-1.4321906110589266	1
+1.153035802563644	-0.25243603652138985	0
+0.5805733357942744	-1.1045230926622938	1
+1.7759935855067666	0.5130743788396454	1
+-0.7563523055944354	0.8164540110192858	0
+1.2369078851902253	-0.23028467842710793	1
+0.31736797594106797	-0.7524141777250374	0
+0.18451869056394285	0.9370822011089522	0
+-0.6166293716831945	0.7631836460599923	0
+0.7796263036636958	-0.43812091634884287	0
+0.2378446219236218	0.013548548628612411	0
+2.2986539407136757	-0.16520955264073184	1
+0.19291719182330652	-0.3484589306523706	0
+-1.6135785028221759	1.4707138666121289	1
+-2.0151887171225265	-0.07954058693411101	1
+0.7788223993230673	0.4282328705967407	0
Binary file test-data/gbc_model01 has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gbc_result01	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,6 @@
+0	1	2	3	predicted
+3.68258022948	2.82110345641	-3.990140724	-1.9523364774	1
+0.015942057224	-0.711958594347	0.125502976978	-0.972218263337	0
+2.08690768825	0.929399321468	-2.12924084484	-1.99714022188	1
+1.41321052084	0.523750660422	-1.4210539291	-1.49298569451	1
+0.76831404394	1.38267855169	-0.989045048734	0.649504257894	1
Binary file test-data/gbr_model01 has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gbr_prediction_result01.tabular	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,88 @@
+year	month	day	temp_2	temp_1	average	forecast_noaa	forecast_acc	forecast_under	friend	week_Fri	week_Mon	week_Sat	week_Sun	week_Thurs	week_Tues	week_Wed	0
+2016	9	29	69	68	66.1	63	71	68	57	0	0	0	0	1	0	0	69.8047715468
+2016	4	27	59	60	60.7	59	65	60	50	0	0	0	0	0	0	1	62.3940847433
+2016	11	28	53	48	48.0	46	48	49	44	0	1	0	0	0	0	0	51.1656331745
+2016	10	12	60	62	61.0	60	63	63	52	0	0	0	0	0	0	1	60.7602326565
+2016	6	19	67	65	70.4	69	73	70	58	0	0	0	1	0	0	0	66.2416657667
+2016	5	7	68	77	63.0	61	65	63	83	0	0	1	0	0	0	0	71.7162060939
+2016	7	25	75	80	77.1	75	82	76	81	0	1	0	0	0	0	0	78.6168727393
+2016	8	15	90	83	76.6	76	79	75	70	0	1	0	0	0	0	0	77.9015583717
+2016	10	28	58	60	55.6	52	56	55	52	1	0	0	0	0	0	0	61.4191796096
+2016	6	5	80	81	68.0	64	70	66	54	0	0	0	1	0	0	0	74.4136969328
+2016	3	19	58	63	54.2	54	59	54	62	0	0	1	0	0	0	0	60.9589968112
+2016	6	7	92	86	68.3	67	69	70	58	0	0	0	0	0	1	0	75.5031094008
+2016	12	10	41	36	45.9	44	48	44	65	0	0	1	0	0	0	0	38.5555100028
+2016	4	23	73	64	59.9	56	63	59	57	0	0	1	0	0	0	0	64.0035135524
+2016	6	24	75	68	71.5	67	73	73	65	1	0	0	0	0	0	0	74.5305649268
+2016	2	9	51	57	49.4	45	52	49	57	0	0	0	0	0	1	0	57.0110982119
+2016	11	10	71	65	52.2	52	54	51	38	0	0	0	0	1	0	0	61.876179905
+2016	3	21	61	55	54.5	52	56	55	52	0	1	0	0	0	0	0	56.0732986026
+2016	2	28	60	57	51.3	48	56	53	66	0	0	0	1	0	0	0	56.9672058242
+2016	6	28	78	85	72.4	72	76	74	67	0	0	0	0	0	1	0	78.4438620045
+2016	10	6	63	66	63.3	62	67	63	55	0	0	0	0	1	0	0	63.9639842609
+2016	2	17	55	56	50.0	45	51	49	46	0	0	0	0	0	0	1	54.149464399
+2016	6	15	66	60	69.7	65	73	71	69	0	0	0	0	0	0	1	66.1043951877
+2016	10	15	60	60	59.9	59	62	59	46	0	0	1	0	0	0	0	61.6791270097
+2016	3	26	54	57	55.2	53	57	55	54	0	0	1	0	0	0	0	60.2367595132
+2016	1	26	51	54	48.3	44	53	50	61	0	0	0	0	0	1	0	52.9547372573
+2016	5	23	59	66	66.1	63	68	68	66	0	1	0	0	0	0	0	64.6813560623
+2016	1	10	48	50	46.5	45	48	48	49	0	0	0	1	0	0	0	45.1415524342
+2016	5	22	66	59	65.9	62	66	65	80	0	0	0	1	0	0	0	59.8874932366
+2016	7	15	75	77	76.0	74	80	78	75	1	0	0	0	0	0	0	82.9044308458
+2016	4	22	81	73	59.7	59	64	60	59	1	0	0	0	0	0	0	74.8537745899
+2016	4	29	61	64	61.2	61	65	61	49	1	0	0	0	0	0	0	65.3872817114
+2016	1	23	52	57	48.0	45	49	50	37	0	0	1	0	0	0	0	51.8565179701
+2016	8	16	83	84	76.5	72	78	78	90	0	0	0	0	0	1	0	83.6982049493
+2016	8	1	76	73	77.4	76	78	79	65	0	1	0	0	0	0	0	72.4140203449
+2016	2	27	61	60	51.2	51	53	53	61	0	0	1	0	0	0	0	60.839700499
+2016	2	12	56	55	49.6	49	52	48	33	1	0	0	0	0	0	0	54.9702164699
+2016	1	31	52	48	48.7	47	52	49	61	0	0	0	1	0	0	0	49.8435633428
+2016	9	5	67	68	73.5	71	75	73	54	0	1	0	0	0	0	0	69.325684558
+2016	12	20	39	46	45.1	45	49	45	62	0	0	0	0	0	1	0	43.4575487159
+2016	5	1	61	68	61.6	60	65	60	75	0	0	0	1	0	0	0	65.0535826144
+2016	3	28	59	51	55.5	55	57	55	47	0	1	0	0	0	0	0	57.5541221212
+2016	4	21	81	81	59.4	55	61	59	55	0	0	0	0	1	0	0	76.9948007001
+2016	1	6	40	44	46.1	43	49	48	40	0	0	0	0	0	0	1	41.3862075834
+2016	10	21	58	62	57.8	56	60	59	44	1	0	0	0	0	0	0	61.0523769432
+2016	5	2	68	77	61.9	60	66	61	59	0	1	0	0	0	0	0	74.2435105222
+2016	3	1	53	54	51.5	48	56	50	53	0	0	0	0	0	1	0	54.3306325137
+2016	7	21	78	82	76.8	73	81	78	84	0	0	0	0	1	0	0	81.2097724662
+2016	3	17	51	53	53.9	49	58	52	62	0	0	0	0	1	0	0	52.1836048796
+2016	12	6	46	40	46.4	44	50	45	56	0	0	0	0	0	1	0	42.2019357209
+2016	12	21	46	51	45.1	44	50	46	39	0	0	0	0	0	0	1	45.9011800782
+2016	1	4	44	41	45.9	44	48	46	53	0	1	0	0	0	0	0	41.1820761074
+2016	10	2	67	63	64.9	62	69	66	82	0	0	0	1	0	0	0	61.3727414202
+2016	5	28	65	64	66.8	64	69	65	64	0	0	1	0	0	0	0	65.5895934942
+2016	9	11	74	77	72.1	69	75	71	70	0	0	0	1	0	0	0	74.3381013887
+2016	10	25	62	61	56.5	53	60	55	70	0	0	0	0	0	1	0	61.2657495686
+2016	2	18	56	57	50.1	47	55	49	34	0	0	0	0	1	0	0	55.5571516621
+2016	11	1	117	59	54.5	51	59	55	61	0	0	0	0	0	1	0	60.8285501381
+2016	3	16	49	51	53.7	52	54	55	65	0	0	0	0	0	0	1	54.4944109202
+2016	4	26	55	59	60.5	56	61	62	75	0	0	0	0	0	1	0	61.8372077373
+2016	6	10	67	65	68.8	67	71	67	73	1	0	0	0	0	0	0	63.9222528587
+2016	2	3	46	51	48.9	48	49	50	40	0	0	0	0	0	0	1	48.8811572638
+2016	3	7	64	60	52.4	49	57	53	71	0	1	0	0	0	0	0	62.8822601273
+2016	9	18	75	68	70.0	66	73	71	90	0	0	0	1	0	0	0	71.4706106408
+2016	3	20	63	61	54.3	51	56	55	50	0	0	0	1	0	0	0	59.7324860951
+2016	4	6	60	57	56.8	53	59	57	64	0	0	0	0	0	0	1	58.9890626595
+2016	7	2	73	76	73.3	70	77	73	84	0	0	1	0	0	0	0	71.2799971324
+2016	7	5	71	68	74.0	72	77	74	62	0	0	0	0	0	1	0	68.9560415136
+2016	7	19	80	73	76.6	76	78	77	90	0	0	0	0	0	1	0	77.0157028161
+2016	12	9	40	41	46.0	43	51	44	54	1	0	0	0	0	0	0	42.1221149466
+2016	6	29	85	79	72.6	68	76	74	81	0	0	0	0	0	0	1	74.3021609896
+2016	3	22	55	56	54.6	51	55	54	64	0	0	0	0	0	1	0	57.100481947
+2016	4	3	71	63	56.3	54	61	56	64	0	0	0	1	0	0	0	60.29402298
+2016	1	17	48	54	47.4	45	51	46	47	0	0	0	1	0	0	0	50.2034551756
+2016	3	10	54	55	52.8	49	55	53	50	0	0	0	0	1	0	0	55.1100177804
+2016	5	9	82	63	63.4	59	66	62	64	0	1	0	0	0	0	0	61.9408775418
+2016	1	8	51	45	46.3	43	47	46	34	1	0	0	0	0	0	0	45.3158658848
+2016	8	11	72	76	76.9	74	81	75	80	0	0	0	0	1	0	0	74.2995087324
+2016	12	29	47	48	45.3	43	50	45	65	0	0	0	0	1	0	0	47.8575821187
+2016	11	23	54	54	49.1	48	52	49	38	0	0	0	0	0	0	1	51.5257711552
+2016	11	19	52	55	50.0	50	54	49	56	0	0	1	0	0	0	0	53.6344142464
+2016	4	7	57	68	56.9	52	61	55	38	0	0	0	0	1	0	0	66.7238759737
+2016	6	4	71	80	67.9	63	72	66	76	0	0	1	0	0	0	0	72.7073855763
+2016	6	17	67	71	70.0	66	74	69	54	1	0	0	0	0	0	0	73.4041601901
+2016	10	5	61	63	63.7	61	66	65	48	0	0	0	0	0	0	1	63.9616628787
+2016	3	4	55	59	51.9	47	56	53	45	1	0	0	0	0	0	0	58.3547591361
+2016	12	22	51	49	45.1	42	47	46	38	0	0	0	0	1	0	0	44.7834274452
Binary file test-data/glm_model01 has changed
Binary file test-data/glm_model02 has changed
Binary file test-data/glm_model03 has changed
Binary file test-data/glm_model04 has changed
Binary file test-data/glm_model05 has changed
Binary file test-data/glm_model06 has changed
Binary file test-data/glm_model07 has changed
Binary file test-data/glm_model08 has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/glm_result01	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,5 @@
+86.97021227350001	1.00532111569	-1.01739601979	-0.613139481654	0.641846874331	3703215242836.872
+91.2021798817	-0.6215229712070001	1.11914889596	0.390012184498	1.28956938152	3875943636708.156
+-47.4101632272	-0.638416457964	-0.7327774684530001	-0.8640261049779999	-1.06109770116	-2071574726112.0168
+61.712804630200004	-1.0999480057700002	-0.739679672932	0.585657963012	1.4890682753600002	2642119730255.405
+-206.998295124	0.130238853011	0.70574123041	1.3320656526399999	-1.3322092373799999	-8851040854159.11
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/glm_result02	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,5 @@
+3.68258022948	2.82110345641	-3.9901407239999998	-1.9523364774	1
+0.015942057224	-0.7119585943469999	0.125502976978	-0.972218263337	0
+2.0869076882499997	0.929399321468	-2.1292408448400004	-1.9971402218799998	0
+1.4132105208399999	0.523750660422	-1.4210539291	-1.49298569451	0
+0.7683140439399999	1.38267855169	-0.989045048734	0.649504257894	1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/glm_result03	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,5 @@
+3.68258022948	2.82110345641	-3.9901407239999998	-1.9523364774	1
+0.015942057224	-0.7119585943469999	0.125502976978	-0.972218263337	0
+2.0869076882499997	0.929399321468	-2.1292408448400004	-1.9971402218799998	0
+1.4132105208399999	0.523750660422	-1.4210539291	-1.49298569451	0
+0.7683140439399999	1.38267855169	-0.989045048734	0.649504257894	1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/glm_result04	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,5 @@
+86.97021227350001	1.00532111569	-1.01739601979	-0.613139481654	0.641846874331	0.5282637592226301
+91.2021798817	-0.6215229712070001	1.11914889596	0.390012184498	1.28956938152	0.5180352211818147
+-47.4101632272	-0.638416457964	-0.7327774684530001	-0.8640261049779999	-1.06109770116	0.012682414140451959
+61.712804630200004	-1.0999480057700002	-0.739679672932	0.585657963012	1.4890682753600002	0.1869842234155321
+-206.998295124	0.130238853011	0.70574123041	1.3320656526399999	-1.3322092373799999	-1.6599360904302456
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/glm_result05	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,5 @@
+3.68258022948	2.82110345641	-3.9901407239999998	-1.9523364774	1
+0.015942057224	-0.7119585943469999	0.125502976978	-0.972218263337	0
+2.0869076882499997	0.929399321468	-2.1292408448400004	-1.9971402218799998	1
+1.4132105208399999	0.523750660422	-1.4210539291	-1.49298569451	1
+0.7683140439399999	1.38267855169	-0.989045048734	0.649504257894	1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/glm_result06	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,5 @@
+3.68258022948	2.82110345641	-3.9901407239999998	-1.9523364774	1
+0.015942057224	-0.7119585943469999	0.125502976978	-0.972218263337	0
+2.0869076882499997	0.929399321468	-2.1292408448400004	-1.9971402218799998	1
+1.4132105208399999	0.523750660422	-1.4210539291	-1.49298569451	1
+0.7683140439399999	1.38267855169	-0.989045048734	0.649504257894	1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/glm_result07	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,5 @@
+86.97021227350001	1.00532111569	-1.01739601979	-0.613139481654	0.641846874331	0.6093152833692663
+91.2021798817	-0.6215229712070001	1.11914889596	0.390012184498	1.28956938152	0.5963828164943974
+-47.4101632272	-0.638416457964	-0.7327774684530001	-0.8640261049779999	-1.06109770116	-0.07927429227257943
+61.712804630200004	-1.0999480057700002	-0.739679672932	0.585657963012	1.4890682753600002	0.2621440442022235
+-206.998295124	0.130238853011	0.70574123041	1.3320656526399999	-1.3322092373799999	-1.7330414645145749
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/glm_result08	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,5 @@
+3.68258022948	2.82110345641	-3.9901407239999998	-1.9523364774	1
+0.015942057224	-0.7119585943469999	0.125502976978	-0.972218263337	0
+2.0869076882499997	0.929399321468	-2.1292408448400004	-1.9971402218799998	1
+1.4132105208399999	0.523750660422	-1.4210539291	-1.49298569451	1
+0.7683140439399999	1.38267855169	-0.989045048734	0.649504257894	1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/hamming_loss.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,2 @@
+hamming_loss : 
+0.15384615384615385
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/hastie.txt	Sat Aug 04 12:31:24 2018 -0400
@@ -0,0 +1,12001 @@
+0	1	2	3	4	5	6	7	8	9	0
+-1.7497654730546974	0.34268040332750216	1.153035802563644	-0.25243603652138985	0.9813207869512316	0.5142188413943821	0.22117966922140045	-1.0700433305682933	-0.18949583082317534	0.25500144427338167	-1.0
+-0.4580269855026243	0.43516348812289213	-0.5835950503226648	0.816847071685779	0.672720805709661	-0.10441114339062771	-0.5312803768519098	1.0297326851333461	-0.43813562270441736	-1.1183182462554362	-1.0
+1.6189816606752596	1.5416051745134067	-0.251879139213213	-0.8424357382512976	0.18451869056394285	0.9370822011089522	0.7310003438348087	1.361556125145331	-0.32623805920230253	0.055676014854776905	-1.0
+0.22239960855530486	-1.4432169952253369	-0.7563523055944354	0.8164540110192858	0.7504447615341785	-0.4559469274680022	1.1896222680291255	-1.690616826383604	-1.3563990488613127	-1.2324345139149262	1.0
+-0.5444391616724643	-0.6681717368134277	0.007314563228903049	-0.6129387354781626	1.299748074755309	-1.733095623653281	-0.98331009912963	0.3575077531673654	-1.6135785028221759	1.4707138666121289	1.0
+-1.1880175973177194	-0.5497461935354897	-0.9400461615447682	-0.8279323643658708	0.1088634678336795	0.50780959049232	-0.8622273465104797	1.249469742726979	-0.07961124591739943	-0.8897314812650339	-1.0
+-0.8817983894830175	0.01863894948806016	0.2378446219236218	0.013548548628612411	-1.635529399380822	-1.044209877709317	0.6130388816875463	0.7362052133238238	1.0269214393997905	-1.4321906110589266	-1.0
+-1.841188300186717	0.36609322616730366	-0.3317771350528086	-0.6892179780897532	2.0346075615049335	-0.5507144119145928	0.7504533303268411	-1.3069923390808191	0.5805733357942744	-1.1045230926622938	1.0
+0.6901214702247076	0.6868900661384048	-1.566687529578391	0.9049741214666812	0.7788223993230673	0.4282328705967407	0.10887198989791452	0.028283634823073247	-0.5788258247909884	-1.1994511991939312	-1.0
+-1.7059520057381703	0.3691639571070058	1.8765734269621657	-0.37690335016897475	1.8319360818255361	0.003017434031214063	-0.07602346572462335	0.003957593987599105	-0.18501411089711395	-2.4871515352227695	1.0
+-1.7046512057609624	-1.1362610068273629	-2.9733154740508856	0.03331727813886288	-0.24888866705810792	-0.45017643501165083	0.13242780114877378	0.022213928039390988	0.31736797594106797	-0.7524141777250374	1.0
+-1.2963918071501508	0.095139443565453	-0.42371509994342044	-1.185983564929173	-0.365461992676627	-1.271023040846661	1.5861709384232352	0.6933906585165882	-1.9580812342078666	-0.13480131198999493	1.0
+-1.5406160245526137	2.0467139684821385	-1.3969993449532836	-1.0971719846398227	-0.23871286931467955	-1.429066898448291	0.9490047765052598	-0.019397585962465276	0.8945977057600133	0.7596931198502055	1.0
+-1.4977203810831696	-1.193885976791938	1.2962625863990573	0.9522756260818906	-1.2172541306410147	-0.15726516737513793	-1.5075851602643862	0.10788413080661359	0.7470556550991475	0.4296764358626096	1.0
+-1.415042920852526	-0.6407599230105716	0.7796263036636958	-0.43812091634884287	2.0747931679465657	-0.34329768218246975	-0.6166293716831945	0.7631836460599923	0.19291719182330652	-0.3484589306523706	-1.0
+2.2986539407136757	-0.16520955264073184	0.46629936835718944	0.26998723863108903	-0.3198310471180883	-1.1477415998765863	1.703623988120705	-0.7221507700557533	1.0936866496587212	-0.2295177532399562	1.0
+-0.008898663292110321	-0.5431980084071721	0.7530621876919789	-1.6094388961729544	1.943262263433996	-1.4474361123195851	0.13024845535270219	0.9493608646609868	-2.0151887171225265	-0.07954058693411101	1.0
+0.30104946378806546	-1.6848999616851803	0.22239080944544862	-0.6849217352472302	-0.12620118371357705	1.9902736497540905	0.5229978045207515	-0.016345402757487165	-0.41581633584065	-1.3585029367597998	1.0
+-0.5144298913687853	-0.21606012000326133	0.4223802204219781	-1.094042931032235	1.2369078851902253	-0.23028467842710793	-0.7044181997350232	-0.591375121085172	0.7369951690182122	0.4358672525149101	-1.0
+1.7759935855067666	0.5130743788396454	1.1705269829481435	2.0777122322502035	-0.45592201921402026	0.6491729272546821	-0.17478155445149818	1.0172643432511694	-0.5999830448488669	1.5761667243192063	1.0
+0.6044235385892025	-0.9070304174806991	0.5920232693603779	-0.4370644156515733	0.10177577296931657	1.3083468266441474	1.3876018114085524	-1.7353911473330734	0.28837742022732415	-0.33908543327636353	-1.0
+0.5273691328244136	-0.3743028837477471	0.47709229741768444	-1.4297626622362145	0.4077065249765084	-0.828280392745567	0.4234572818376501	-0.15951736500333072	1.2410820871966046	1.6635363107373078	-1.0
+-0.661937714925914	3.465227148479317	0.39143861927191975	0.3272453529764515	-0.31134706056867467	-1.4246555886796946	-0.6248721853412322	-0.1099953959208559	0.9529594279919252	-0.9833626436429376	1.0
+-1.0945571896156956	-0.24134874955198468	-0.5951138391567017	-0.9828118947823061	0.08822993442548502	-0.602759369823714	1.1255554529825982	0.9270532988002531	-2.2691569946862655	-0.34817063773317436	1.0
+-0.1640254026760564	1.2165805903649096	-0.6268539047283007	-0.2749398078895973	1.14745743851399	1.1599689740750685	0.702184505359777	-1.28390481061431	1.5223077678776793	-0.17996331764913345	-1.0
+-0.37614736761593637	0.46034921066168377	1.455421460737774	0.2415068878754467	-0.03766667059723912	0.8315330299051433	2.299369468755593	-0.9396024430587621	0.11182257854217889	2.5394320331114613	1.0
+0.40359841542535574	-1.8848343873195796	1.2774520318648948	-0.44558826380657596	-1.2703180389254833	0.6355011681954533	-0.2984356710923274	-0.4022899215971822	-0.5366404268123247	0.8231244016664833	-1.0
+0.025191903274544	1.5175361283542563	0.3696111506737348	-0.4806321621688906	1.0423327430213356	1.098875986566869	-2.132910373907718	0.7592043314019562	-0.2851808701227014	0.4804114112715212	1.0
+0.46800068820276425	2.7090019473659184	2.019086116729861	0.7474034182399546	-0.5897085867477189	-0.8134248245767957	-0.17689686434453186	0.5070475019762871	-0.2667781642372559	-0.8560620219978579	1.0
+1.5593148568891022	-1.0926888646283135	0.7580424981657605	-1.199439969467994	0.1763704781550424	-0.8757308415987771	0.11760845626656423	-0.958168335581346	-1.8811146489414055	0.1823427274870421	1.0
+-0.5484922802752095	-0.0526349697724523	3.1733905239619795	3.334203517597432	1.6033719963489919	1.0128962309550167	1.8445232062556762	-0.3361436284769567	0.49875048880422795	-1.0778260770671824	1.0
+0.5769340599430341	0.08652484860757291	0.38378884838187516	1.3347307577271426	1.6717911886146681	-0.3130077315757537	0.12355262918532725	1.5477291028255866	-0.10788917679723521	1.0033975572213907	-1.0
+0.8876717808262652	0.08864979057352633	-1.3245780959402302	0.2383846452550063	1.1966614601200112	-0.46484257027188	-1.1366727112923867	0.2484946248806814	0.3506928143980163	-0.13207671471324264	-1.0
+-0.5256451948154732	-0.584889332459948	-0.9292471979014248	0.39841641960968166	-1.3559078555972999	-1.7115830531175702	0.15859859636139104	2.1324867288289617	2.7213336098665635	-1.9728640480783795	1.0
+0.5398129189913056	0.5431731800991407	0.9637445310773097	1.2537261342634507	-0.22013056376799153	-0.25227004044698087	0.01003713940839754	0.48028838228527204	-1.9569675522430627	-0.564484658307677	-1.0
+-1.163235822180662	-0.021175774300496716	0.33107168261445835	-0.3664962494470602	0.8604754069049109	-0.24659729953406678	1.490533097267343	-0.39939137701024663	0.3252062923168107	-0.6542808538079327	-1.0
+-0.01912275129904966	0.9929416493373554	-0.1295965590136687	-0.1708304076874391	0.7904280904722739	1.0918159072154612	-0.40508326392063543	0.5364439368681257	-2.1313146599852018	0.2630766894332881	-1.0
+-1.2710579854942345	0.9291001132966914	-1.9314128569290476	0.02421534060406341	-1.213691539345214	0.1881369570559398	-0.5722638992074314	2.745117964775073	0.12495397935004156	-1.0652461548210312	1.0
+0.6030536979033265	-1.0614676369216434	-1.5164304957203023	0.32928250529485964	-1.9836209428041778	0.16713678370411497	-0.1788939995187421	1.178239159200306	-0.44340798605665754	0.7389539007599524	1.0
+-0.15484845483449294	-0.08605564337254189	-0.3357568385230854	-0.1366293792823912	0.09277642496734965	0.18971879197958597	-2.048671922604096	0.7837860781804775	-0.2329845615794952	-1.1844114274105708	-1.0
+-0.1977972902611956	-0.8546727892795731	0.02359749586524577	-0.1704564684096478	-1.0696662666401626	0.22583874577075078	-0.8676594983663888	0.41841523883774684	-2.305258151983712	0.1621555997620361	-1.0
+-0.5788411209471953	-0.3992846345441018	1.4878944321336367	-0.35781685235193555	0.35643089395408944	1.0312821968019672	1.5225430928104695	-1.0164811121806232	1.1284147518659724	-0.9272485993677742	1.0
+-1.1927713830291693	1.3748594175398903	-0.7032369510661453	0.24420707079596798	1.0323459107790158	1.6169399021897064	-0.05483023725936617	-0.24801134827199994	-0.3967249498631411	-0.033547027338664666	-1.0
+1.0329180459160618	-1.9898222399382914	-0.2780337171101295	0.7656954261085819	0.7441495680026682	-1.7231933239653434	1.0303924263130786	0.05971477069293665	-0.9342158375564429	-1.0624411368884286	1.0
+-0.6294458606293386	-0.3022844248616988	1.0396388948858852	-0.9309696527726209	-1.277629080640249	-0.9443200259389776	-0.3188074229604005	-2.0842708835548924	1.2703115446925113	0.030877752980638058	1.0
+0.6531758521433048	0.558346902284024	0.13639753659343484	-0.33733841113672913	-1.337165050885127	-0.41149095236240474	-0.10777619396316224	0.5229173631509835	0.9561499786482655	1.2033205926353625	-1.0
+-0.9762315218209106	-0.0751525704189141	0.35280658284312694	0.049037461548016935	1.2860174671016282	-0.26722530141904327	1.3242380220962733	-0.26759192177397656	-0.4694062226879811	-1.4257562814463445	-1.0
+0.8054921061469411	1.3547691398570894	0.8255591814670258	-0.2586895904715146	0.7574995244231507	-0.7044557030990274	1.2113185073849615	-1.8422341740345995	-0.36824556412752163	-1.5479925634100813	1.0
+-0.45167227065102006	-1.1375423986557498	-0.13587675227718632	0.6343790937890923	-0.013557918030451043	0.3758968273279556	-0.23658235285975457	0.9791413360462421	1.0937481979752155	-1.3836221562341127	-1.0
+1.0101338828657191	0.8726631262318649	1.0376123351490436	0.3025477016355275	-1.2981174812942935	0.8478637181249223	-0.2688763993683175	0.30198299200599726	-2.2719054986176683	0.7576049876525334	1.0
+0.8760511854123076	2.1562199933480133	1.2887025562956078	-0.14253519602584672	1.6659047027918155	-1.380114296433079	3.85793967348964	3.075573893432424	0.830819563694863	-0.8782681675417305	1.0
+0.13986220576101485	0.7125389403746353	0.3596237434172795	0.7127480011897636	1.0687856807518747	-0.4951739548431622	0.132962280436304	-0.08289852500467178	0.21421904746683115	0.692696057131838	-1.0
+-1.9081847831366037	0.11653331605849324	1.7551741656764832	-0.3955656348590421	-0.9325834567618385	-0.6735645547992268	0.714532047991697	-1.790003919076157	0.22430285295477725	-3.209955381978046	1.0
+1.5235848315795288	-0.0696156591485477	1.3655901991926498	-0.5586953357167566	0.2753934759411781	2.4009183113212806	-1.0110351209554707	0.9425068791712249	-2.221510823700524	-2.585767588999438	1.0
+0.6889213621579444	0.041274574202699865	-0.49772668445684926	-0.009847287471481413	-0.5176603237193814	0.30217682520827216	0.7734409975442094	0.988208848486463	0.017600206923097966	0.8198061540197786	-1.0
+0.687759695794799	0.39315819224910903	-0.5108631934878929	-2.752037662677927	-0.19206908223922012	-0.23406889069910192	-1.6014139415281856	0.7910261496852212	0.012866884184724063	-1.3485118844184532	1.0
+0.8660591728218054	0.7912949804001552	1.176952513690748	-1.1654317335035704	0.5382460975045578	-0.8428605517089753	-2.874968879865529	-0.5285056361126661	-0.32108899071015246	2.182275910834502	1.0
+0.32870245607283527	1.4480014208760492	-0.43728724254382445	0.9114744851303214	-1.1268282836571295	1.114733892631557	-1.2265674316518074	1.3552725615328403	-0.08885766708388806	-0.694949123737318	1.0
+-1.0144720406973653	0.8712160137184647	-0.9194792276680201	0.2876311214263635	-0.5327923727826095	0.16564178605539887	0.016672373423269438	-0.6314322515594253	-1.0040158066788205	-1.3120985315266447	-1.0
+0.44682624679647864	0.14853198602056514	1.8363081603106133	0.1396675784886334	-1.7651938506826501	1.4476040528943543	-1.1417786944082575	0.7464021537026985	-0.46902780374760905	0.7869814652437135	1.0
+-0.1820208348243829	-1.003380717730042	-0.9369221110721804	-0.9442706004373587	-0.7275212508545039	2.0654861372867295	0.1360612935062583	0.20181386383006028	1.2707549044789055	-1.0034745347115275	1.0
+-0.7323378102483927	-0.6479921130452116	-0.7855214383236936	1.7347311831934773	-0.44615385943239716	-1.2399203282859266	-0.29178644639701495	-0.6601392708428152	-1.0917976649357448	0.5648569127221107	-1.0
+-1.9445402822954807	0.26393122365044175	1.5387536595031532	2.397073067233959	1.5562083709832442	-0.20268282272443056	-0.1089062616381093	1.1352016674683758	1.0097935422904265	-0.9134206948382958	1.0
+-2.2292589330885986	-0.46273031364217426	1.6282076357873105	-0.0758997670485449	-1.3945327153213618	-0.7799983027126963	0.6986307702990094	0.4729134646484038	-0.2724518087709634	0.18479275551351085	1.0
+-0.3389835320929106	-0.14231230753550203	-1.44904592785806	-1.3227165003614927	-0.7109024225989671	-0.606184110109761	-1.0722422723792842	0.5454540297228883	0.5391724452767099	1.1988239385167685	-1.0
+-0.07684033970519674	-0.6933878511104847	-0.9469760525902353	-2.268619962246101	0.21359010083019977	-1.265057694018798	0.9636968648987307	0.5183435151558969	0.5900261263151266	1.1311811909202247	1.0
+-0.1090739625676252	-0.05816611715256052	-0.8425159924738271	-0.7529456042925735	-0.48256531456153773	0.5245478462345327	-0.2645836803644654	0.3530051834614323	0.2238241190906629	-0.37219899010144253	-1.0
+2.6474189892831026	0.1332902420274303	0.8100978673990902	-2.066453723784956	-0.3284080793917298	0.2854489945462638	0.9127282586749043	-0.8853951972314839	0.662893215100046	-1.548077411041423	1.0
+-0.5558744255462802	-0.20939878024355807	1.8398709351830922	-0.012035767922212968	1.544249561568332	-2.185153803257982	-0.9052536407792096	0.21306591909620448	-0.9657156624472774	1.0094897718684082	1.0
+-1.0122112207459872	0.9050528629328798	-0.9129893226159165	-0.45036832301510676	1.0407174952822522	-0.7555250892846609	0.42441824827810354	0.06644430233106957	-0.08799540550164092	1.954430088902813	-1.0
+0.5679433816499357	-0.1016379743818435	0.0692509618345264	-1.1616019467282765	0.32702615652721884	0.5673334205644196	0.9015922583874204	1.8771428706377922	0.4306132751340653	-1.190784254860191	-1.0
+0.2262121311410064	-0.5693165703158743	-0.7322607097367665	-0.711741585516688	0.05687216122626013	-0.8234988716333305	0.30663585257868975	-1.8338737352874381	-2.89224040536514	-0.15859132011071364	1.0
+-1.5316018230959503	-0.5779462669917929	-1.9059055368464786	-2.008942616762241	0.23889598302964352	-0.5084528851522548	-0.04826170379593097	-0.03502705018890768	-0.7273069057149364	1.5183620699261768	1.0
+0.36102541634537905	2.576977679031155	1.5873212424728582	0.687677616154882	-0.018212347104613166	-0.5895820679190702	-0.7301662802248373	0.13438281144361666	0.9715535632493052	-1.0583794427218747	1.0
+-0.02860552628379647	-1.2522775141080984	0.10659762229930982	0.5422573331869172	0.9912188508026412	0.2872129861981349	-0.6359698186412605	-0.3785028025591672	0.01632286834064877	-0.20958795245614859	-1.0
+0.3214442712943701	0.23351936921649144	1.0149522887472011	-1.365343241823016	0.27653105409089324	-0.9552158838227957	-0.2605126207976518	-1.3274909827312888	0.03730765585464991	-1.4526406739111428	-1.0
+-0.8276017374999237	2.2921936458109897	0.6278876784461687	0.9527052435093047	-0.8296277386100398	1.1604663708722944	-0.3115251054922687	-0.5393910228200474	0.540432755366913	0.1406950564673274	1.0
+1.2382624131362387	-1.2855738604138573	-0.7804341795136254	-0.4661721263852442	0.096940343318409	-0.45823039827601697	-0.07936631605575531	-0.3182853136155345	0.9195436457578192	-0.5611773427197669	-1.0
+-0.4101120092081721	0.06812570823584903	-0.09891912036094928	0.23925986087456783	-1.2674959941594357	0.0915712442891479	-0.16935301763051838	-0.8856978941958283	-1.645607964622266	0.16979751913292426	-1.0
+-0.1378586963310319	-0.07149411774529733	-0.38621990548929036	1.3449502719441988	-1.081258571215189	-0.06307879670506915	-0.50356048600791	-2.050905763049373	0.087257980752205	-1.3294456177962388	1.0
+0.7563768879274201	0.8242892015046335	0.37967322200031345	0.5242236519537231	-0.45271329511708064	0.687592786751324	0.9167469515279244	1.1197161016785873	1.2635448363305384	-1.4561055975293318	-1.0
+0.32128693891873533	-2.4370266994140035	0.9733737109300644	-0.642481126749871	0.2928325635717791	-0.46398126201591683	0.38673364020325446	0.6724964425333426	-1.0909759530149077	-0.5270034201986623	1.0
+-0.30440284592936967	0.770818433376395	-0.23575096986827987	-0.17778292517384178	2.288635291333243	-2.5289475108846857	0.5677535540962639	0.07355255089438108	0.7483241867237762	0.9146566431112833	1.0
+1.2522315626273022	-0.8847286012386693	1.175609480746336	0.4796962084572591	-0.5899674340661235	0.8621689184981023	-1.4726571262457677	0.6523101983645719	-0.1516899652786653	1.3432368831212602	1.0
+-0.6594840624629351	-0.4090657931046078	-0.33858048238968697	-0.3966186853856485	-1.4582418462866669	-0.010906592167949567	-0.7665729756746352	0.8421724903224964	0.7918792014178204	-1.317627725338646	-1.0
+0.013153036557870796	0.15323002771333824	-0.7863950304118423	1.3681052191345213	0.004008795533567026	0.453194204359973	-0.4063786899313203	0.6841194893268114	2.883969251775838	-0.5881887751399346	1.0
+0.36522540717596585	0.3231095013887879	0.5824042646735971	-0.008457486200020091	-1.7236514338073596	-1.0255372547670172	0.5349275937487872	-1.6500251948243565	0.6689473090641462	0.2803223035037342	-1.0
+0.40271751266444333	0.59519151467352	-0.04489492214522473	0.6453464430821444	-1.1274591498928925	0.2245144207327693	0.10571095020938731	-1.0013467840435817	-0.1861816445428681	1.9979515177687335	-1.0
+0.5725567515972323	-1.3687162010707115	-1.1577200461261594	1.0658262297925543	-1.6549967992364703	1.4771353822876396	-0.9328609421342365	0.13042091725382485	-0.031028697570925873	-0.08768373982573438	1.0
+0.6177594707762792	2.8857517953922764	1.7598211003608997	1.0913309075290665	-2.2134606073911924	-0.023980761898605114	1.2372535126873845	-0.45619206614093344	2.124745399513117	0.2407422845881994	1.0
+-0.05864391264016893	-0.8739999199474732	-0.12278570026442888	0.9117965623133085	-0.10746411474278562	-0.7274708346047783	1.5957629012804186	0.9877470273404159	-0.4881110169164618	0.6296948056302356	-1.0
+-0.4533996984310992	0.6090995914299342	-0.8522489506584864	-0.05454962931514019	1.0907946273414781	-1.8463416145538356	-0.41243382161399256	-0.41546602951164513	-1.3017565892197434	-1.1360989745400003	-1.0
+-1.7976375781681988	-0.6615569434901911	2.5492856987737014	-1.6376756241371526	0.006317661817300752	0.5417126512741955	-0.13210003839031914	-0.378736298456714	1.9406228046678644	-1.0418743710911664	1.0
+-0.28559377932836866	-0.59892262579212	-0.3823403780460225	-0.9859808115749349	-1.3644765720109107	-0.823533424001803	-1.6813868155498577	-0.9162199391704404	0.5436279322698345	1.5248626005482613	1.0
+1.1974173477959238	-1.2225052973966217	-2.023763530020729	0.0537117476660896	-0.5362903624231383	0.10714253527293145	0.6151521853927577	0.9050654404010442	1.6525856413988107	-0.8428196875999223	1.0
+-0.06340532135397717	0.48905360189011937	0.7045354278052993	-1.0717355675879099	0.4137586484133794	-0.345025274037323	1.2401898182121198	0.10342901781618742	-2.1418516144035475	-0.6836501416815086	-1.0
+-1.1807980275906318	1.1810021618172988	-1.0660552581621128	-0.7430459223148423	-0.8859252495127169	-0.49581833514279516	0.527387687628702	-0.30175139488690217	0.35564438892659067	1.3281321131436516	-1.0
+0.2380742569517034	0.17185882517030615	1.1167682468088798	-0.013688855208146944	1.2829097566144694	-1.1299710458171193	0.7587214440890531	-1.0986042355701349	-0.3029040483924579	1.49961056170431	-1.0
+0.14614254213307512	1.9034164161920542	-0.3062063943698761	-0.45706533906364627	-2.38861407368411	-0.8617991799058063	-0.5343938353030584	-1.2626042854762183	-1.0231988412194268	0.5384660112416041	1.0
+1.7165027742351253	0.17912390469970796	-0.4559683500449692	0.32669169909966733	0.6819648840132921	-0.7379887070817857	1.3263448403293359	0.9270035239969678	0.21309224825039347	1.3283330921381156	-1.0
+-0.2108673539727271	-0.6769151658288148	0.1351177762474505	-0.16425303413718284	1.099720527820615	-0.5857366554551754	1.0326537546555192	-0.786824522255031	1.617741961423047	1.7668617516726024	1.0
+0.026714277801613007	-0.6938752020747251	1.9753281712575461	-1.2203869916654786	-1.1314983848532563	2.527070920782692	-0.7368148416525208	0.2499136810467275	-0.4072015719616529	-0.5283333516589073	1.0
+0.7000452723146847	0.07455981071053643	-0.09180805144899466	-0.8105601159173703	1.9998578404574014	-0.790472710889662	1.2720349278692757	0.12340670941539608	-0.14471976544476078	0.06339992712334852	-1.0
+0.031047952046710476	-1.7390992728519505	0.08649405653783686	-0.49104596911569837	-2.674354948547689	0.6443593624326104	-0.14505356097389743	0.8116910518786606	-0.24481231922778438	-0.696350741910387	1.0
+0.44909883424446956	-0.823087860995007	-0.402495596969506	1.385783766454507	0.5845207431072055	-0.24814981566368804	0.32847783781427603	1.1430734254415746	0.7158372997438407	1.3508013650170736	-1.0
+-0.17345609362160444	0.03192366589002642	-0.8603704762851204	1.4178789398571483	-0.21636159151507584	-1.0154893571166628	-0.7259753124258116	1.2277054932407083	-1.1264854630318841	-0.601702497867707	-1.0
+0.26686482080895313	-1.0280706824933712	1.6204683987456092	0.07902571896854252	-0.5695736471796179	-0.14829295739477777	-0.1504880604676619	-0.887961134764646	0.28675094725200034	0.2859729425182367	-1.0
+0.3074302518646544	-0.6575191404509574	-0.1251848370827014	-0.9041652092433549	0.07971000908831376	0.4892337648335795	-2.267876921091358	-1.4363920287788075	0.5923394212109696	-0.12518243894874598	-1.0
+-0.5372191508425196	-0.8699566545276876	0.2098594845826785	-0.6514435841992149	0.7644150970416564	-1.0594997311547119	-0.23003580655162623	1.8847060544535634	-0.5498117799824236	0.25069797962239826	-1.0
+0.2629482684151777	0.40492907257520244	-1.6024845301638289	-0.06048301501585981	-0.697530591149039	0.1503781049950916	-0.07780687825586112	0.1252126858419551	-0.9984660716843727	-0.255975214092637	-1.0
+1.479116981117545	0.4759463602670577	-0.18580560212243427	1.0540424748134019	-0.7858761582110539	1.3190200056340993	-0.17228886477186073	-1.8460295965152045	-0.7247573669263252	-0.013805770284701622	1.0
+0.5844426958957524	-1.079448951686073	0.7146958272683516	0.22357751470350606	-0.9060867789442381	0.21453403707113433	-1.4313384494982322	-2.2704132021611114	1.6680351279664263	0.6877174913431068	1.0
+1.4692083028521956	-0.4470343315836607	0.9692133398427439	0.8466872377493828	0.6108180939736211	-0.6652888855585158	-0.5390686415774785	-0.5699517962545901	-1.4893434370374596	-0.04884518704139992	-1.0
+0.5499305970570395	1.3048378295965286	0.5223109585785488	0.8438100462780511	0.055686488142052015	1.563792608618236	-0.6380407350109051	-0.7047392202425459	-1.0466273798176675	2.049778771444076	1.0
+0.3899429971033616	-0.2279594058376745	1.2652993760910154	1.6850310129308619	-0.4307541449118705	2.4944056179800698	0.6062782036825521	1.897495684900051	-0.3652339819814644	-0.3501200079640903	1.0
+0.8968935558620045	-1.2961422703619865	-0.7661022207718267	-2.2362527882016288	0.046327557310846944	-0.05535106725613376	0.42491286095294456	0.6228215147539629	-0.20458977846842988	-0.9035207258064066	1.0
+-0.7077880082031884	-0.28824269480756903	0.3752751708285271	0.04209531864771717	-0.0899568402734146	1.3144282945889445	-0.2055219060653654	-0.9611185195569437	-0.8770797047105753	-0.3493805390110045	-1.0
+0.6595634650916563	0.6790203045104227	-0.4093739891492758	-0.35331772809174306	0.4293192866086668	1.3487878682901	-0.2728913561712938	0.18393634027606567	0.5588657879489666	-1.3713232471471188	-1.0
+-0.33064387147695085	0.4522332723500524	-0.5305183143587244	-0.28145821900384405	-0.6441278738693271	-1.1300262257452833	-1.1617665339422667	0.16933309281863	-0.059698139612798386	1.105836446597426	-1.0
+-0.6618912758728542	-0.35850443734187276	-0.07117035012372852	0.09786380091576943	1.770668260834617	0.7161109143496656	-0.25203469271235573	1.668179441254334	-0.833481645415412	1.165181781246556	-1.0
+0.16824138572933983	-0.0970197604214342	-1.108371640458861	1.1631257343736865	-2.204226920077547	-0.12336287720355432	-0.4391047192362273	0.6299876168291397	-0.8695507065224324	-0.6080810819389247	-1.0
+1.1993328107538388	2.7250208073497655	0.45076298555579936	-0.8394777244112416	-0.040195475275759104	0.8850898918686639	1.5860651416439473	2.02577923393804	1.5303010308595233	1.8327334301292564	1.0
+0.9689045577333327	0.170770931967963	0.7079943796338916	1.3016102245353771	0.377426024051308	-0.787901129200937	0.9282123550423084	2.0333233170635046	0.5812629099886915	1.560723423781778	1.0
+0.07371157701560777	-0.022356711144941453	0.6855820937261274	-0.22007309599774338	-2.068890495355913	0.6336131127287113	-2.340925516401822	-0.4198460795464502	1.0173191686261756	-0.38910754054643126	1.0
+-0.7372621615773305	-0.006598203487616498	0.27650295204355396	-0.5852677365383244	2.2812721074024944	1.1535198870555938	1.2972505366193468	-0.22290652406605962	0.34421346303858386	-1.998282087632246	1.0
+0.5515401814060694	-0.8347002345785401	-0.8106258122291109	0.10382736210532115	-0.2885403301648238	-0.9294976841312648	0.4487887875734142	-0.5560681594651091	1.3099523237532418	-0.6863958655184795	-1.0
+-1.1332472710708152	-0.16433173228337156	1.0604911834109119	-0.5296495025503906	-0.4208166097429164	-2.593049387823186	0.28768107786745795	0.8101916422542774	0.10193764725371153	-0.2805096318513892	1.0
+-0.5777727170864493	-0.24321111498677203	-1.4925201736211136	0.24204583536789437	-1.4130407277334363	-0.9453346120985947	1.5221528599715186	2.000672024084738	-0.6563789851711918	-0.4729131940164531	1.0
+1.746256318275166	1.443087583454784	-0.9194491847633625	1.0901528926431487	1.0925633619786013	-0.32415019818829954	0.8237126081224749	1.9550554438780816	-0.6511305169582245	0.968886848221698	1.0
+0.4202392504617797	-1.7077148903852681	-0.005924072251181685	-0.7404970062580767	1.3521367585609907	-0.6449885420999844	-0.1551428089500599	-0.06865025280146782	-0.43232000255589664	-2.197691926666584	1.0
+0.892257884749868	0.14386099595965895	1.275597323305137	-0.46898715506363886	0.4741248277718854	0.66839521890313	-1.2047158798971238	-0.8511320881692872	0.8991245292770655	0.9371915337062796	-1.0
+0.9535866516994639	-2.2051034645754948	-2.281305792694086	-0.6116310759188245	2.8097011435732293	0.17584571165005292	-0.6307555906525206	1.8555455403701624	0.16029074988453906	-1.4228495469631228	1.0
+-0.3676598535224105	-1.8862883675077626	0.7548220931778789	1.7812245781622742	0.6526294599846313	0.2375037940405147	0.5942014265411584	-1.1329343313282814	0.4974278727895833	-0.24423451883692596	1.0
+1.0406815179638391	-0.2670710335696844	-0.6772836861850628	-0.6716078230151616	2.6256144457846546	-1.1168006401508905	0.9362535725466031	-0.5661823837482267	-0.5053469214826972	-0.8664172853019196	1.0
+1.397031114430776	-0.8619219742938617	-0.11515634319648775	0.010536697447195188	-0.5196163599941902	-0.24957125769621874	2.2436594507282206	-0.4829965988829622	-2.3689801750315524	-0.9215808226333405	1.0
+1.5190033138842483	0.5524984188665393	-0.6926816136990898	-1.0600082591583286	1.4671555504106528	-0.1679131727874871	0.7597959068113311	-0.2086217318530937	-0.0482216355946755	-0.18337459189215918	-1.0
+1.2830307747086311	0.6847631554909649	0.5078271760432795	0.41614597578860496	0.1429569524514458	-0.06162756634039431	-0.31480674559033817	0.6610574334671373	-1.094868489559057	-0.3473542636872249	-1.0
+1.3583611934492914	-0.2980589001770356	-0.08008290659022492	0.49468129909971936	1.3733264119781319	-0.9287657608462492	-1.0562806080043665	0.2022550669003972	-0.6782509079000207	-0.022012467048051917	-1.0
+-1.9003696914644261	-1.0239364192571805	0.21506804700839205	-0.5266982026448499	-0.524434980542717	0.547052797574943	0.11873192576862872	-2.3053224234261527	0.719991138685963	-1.2845045596199125	1.0
+1.3569787876682777	0.48468627798385755	-0.2561154143302568	1.3546263068343696	2.0759505803869307	0.6668801993571806	-1.0137197024379423	0.19659506908435523	0.2108731700382351	-1.5523887064375035	1.0
+-1.1106346720321985	0.4504456177691022	2.2803112732391826	1.6925906279849425	0.8841718182048186	-0.5384799446573829	-0.37667434221349183	-0.43238636618530835	1.580659829411814	-1.6847064151587414	1.0
+2.135839579661295	-0.012045236853271031	-0.29108659019024025	0.5624562546330725	0.7315635547473112	0.2080936834521666	0.14688445026802582	0.5095493726194038	1.5405555309799355	1.6862402750755072	1.0
+-1.1769248912579864	-0.1895277822930986	0.034288605346101064	-0.3339099307005731	-0.38212536558313037	0.9727972485358709	0.30867526144867835	0.45675680055100876	-0.3597035854371358	-0.8476549112820619	-1.0
+1.2116386663488123	-1.5451347924726995	0.6830976831702715	0.35618373486097415	-0.11846930012185257	-0.12660063112597814	-0.35432027228237667	1.6226344780340827	0.4878147649765918	-1.1219892377344292	-1.0
+-1.2718116679596179	-0.24320231504242704	-0.5666412777157238	0.630742979769623	-0.12917328933680922	0.8308526010187456	-0.9537377215409267	0.46020710543895615	1.6608354030583428	-0.7640402478085184	-1.0
+0.12771181052702799	-0.8291825633597693	-0.5004744114139862	0.6876259510533493	1.5345529929213104	-1.0372415290485972	-1.1409669611458368	0.586065961267128	-0.7203819922636215	0.3136974470241752	-1.0
+0.5708166717972424	0.9114872277854996	-0.3022998396168013	-2.091922245950683	-0.3783418745400049	-0.9778311716440287	-0.5024439301629023	1.1137324694427062	-0.6702242261982462	-0.3544401787737543	-1.0
+1.6359138753477174	2.929660893432376	1.0249635446624175	0.8263678474871072	-1.204722529676112	1.103931098477063	0.41080891898717925	-1.1632958763488586	-0.711126068648103	-0.7776883945882607	1.0
+-0.7014811472600427	0.5167863504871545	-0.4143994932544478	-0.5615847942521986	0.3437170326220349	1.7475220863842662	0.5398998770150264	-0.49519737438896855	0.46301689909689936	0.23737629933432333	-1.0
+-0.5918632272605117	0.6551705283348923	0.09451199914284816	1.183412573203491	-0.2216084475817371	-0.7767689612363475	0.05633894424120396	0.36247267480026046	0.43035789354356024	0.061607686265927775	-1.0
+-2.8186530025073595	0.827177562356735	0.8621190134296215	-0.5240201725381137	0.5558064722220939	-0.2997158513385201	-0.8570825503940438	0.6675880922360743	0.9417552666999109	-0.646962111575448	1.0
+2.297885578997527	1.276247945989341	-0.47009316461768835	-0.7192061272862257	-0.15806847832806897	-0.5482813446368637	-0.6950098823438737	-0.5080798628815741	0.8451070985370979	-0.3641863572992026	1.0
+0.10415185780639113	-1.1327291781835451	0.9951843831205078	1.5038046653372112	-0.35779084437972	0.43925107369417943	0.9761767931804848	0.5485566605075846	0.27987375745446136	0.4605439023890654	-1.0
+-1.8155995691953226	0.7389509974901849	0.33409134205811086	-1.1366259127066474	0.33687080618689497	-1.93022327109422	0.9404548194318197	-0.07844206283832174	-0.6885408976578092	-0.7230597875372071	1.0
+0.814324613537393	1.2140595171215174	-1.6119503393696952	0.38265856161425904	0.8459134704189475	0.32351256640857523	0.17759075527122256	0.022725782621203446	1.1092738552242762	0.7463122829548583	-1.0
+0.8493202690407095	-0.7171971284211488	0.6271956315522539	-0.844608668797061	0.12548690045124972	0.01971106661270503	0.3312851879047735	1.392872207641418	-0.365800592740796	2.2751079842809023	1.0
+-0.41089883250021403	-0.863695134710848	0.6091057104482803	1.2619572530223984	1.2455241795966359	-0.6045175428606584	0.2092762944699149	0.06886762106070753	0.920622863636502	0.8686502617410066	-1.0
+0.11248681150043587	0.5333662646860791	0.2657401234141504	0.5106942988951843	-0.6255334005329436	1.1907316086258812	0.6701565503321437	-0.5369047713298828	-0.8750993854125558	-1.3820347260227162	-1.0
+-2.6192806035910072	0.5861653271698655	-0.7624907593835051	0.6397705674189378	2.1560252861535147	1.0854940115848073	-1.5795988238989795	-0.0843840216296024	-0.10678367894303217	-0.8713026470236783	1.0
+0.7085263301324782	-0.17704463664703687	-1.7077448427289017	0.49356800079005453	-2.2668849557948265	0.9592831641658773	0.9973927328851383	0.12372879270054708	-0.6987088119151889	0.29032122469609184	1.0
+-0.8707192095484595	1.4456183940991385	0.4949902726326138	-0.8451664655381013	-0.2628130337984583	3.1974829539733727	-0.0010588423370812654	-0.37829745272534815	1.0110108162654712	-0.6334300503835257	1.0
+-0.5856061645692245	0.7771447267055485	-0.7685061144460843	-1.2970277152025405	0.7375706675328788	0.7529184295240164	-2.306182941147614	-0.809273033397095	-0.23693404546697278	0.3239072506712229	1.0
+1.0720688438114894	0.08645024003597679	0.12369973790391253	-1.0622293344492408	-0.8347039847535137	0.8983820725024066	-1.1004879462237114	0.6338708137850724	-0.9152704846639929	-1.297471755359271	-1.0
+-0.4322117530530746	1.059455516811933	-2.1595920504682318	0.2736075032324234	0.2178924553288528	1.0759409181533681	0.06937008395653746	0.46665199638203264	-1.5287869947378168	-0.9256383920977915	1.0
+-0.6631329812615014	-2.274070053731467	1.1667980284973485	-0.7249330776348837	0.7411405179848544	-1.0020134142607244	-0.7316650418582739	0.5963143554325262	0.5363444440333102	-1.379225616134922	1.0
+0.1390867505544731	-0.06451309551365764	-0.09527290234272089	0.3379535699933314	1.5807860908438993	-0.6953396335230776	1.5870889370740489	0.40043811487947506	-0.6418145875587414	-0.6926221975020497	-1.0
+-0.5627558800719191	-0.4694866980716366	-0.9429787966287079	-0.3586531509541748	0.5813591730005884	0.11220827271785544	1.5988127102205738	0.30430567959512733	0.9287687328933728	-1.890064241013992	-1.0
+0.9911844589581342	0.5476098176306101	1.3874400614164746	0.8696564647003973	0.5418393251037328	0.5706552646301977	-0.2677426807372017	0.39242735549607893	-0.7126300388983264	-1.2510825198094822	-1.0
+1.7893962060023398	-0.38542737502404606	-0.33937719999794	-0.4653767839296524	-0.8543980754353178	0.17840259925316965	0.23731164772086588	0.7427861661062981	0.24930998597507595	-1.9315293250980572	-1.0
+0.7929518975841817	-1.5376848226493998	1.3897142939008622	1.1836559269554183	-1.23787039502056	2.135545601595113	-0.1667210430129357	-0.7169675793179096	-0.4438538195629017	0.6325447969724978	1.0
+-0.3704887551777182	-1.9260882651788052	-0.9895111468738925	-1.0938410824485512	-0.01527361681359736	-2.2724393778493805	2.5707645107660437	-0.055598926892828825	-0.7091400944632673	-0.7448891733298583	1.0
+-1.1604505895963486	0.29442208903978195	-1.0099153635800724	-0.08405908275243704	0.6364125215344348	-0.12031642840440407	-0.29672975912512006	0.2543420370586476	1.6347076109296752	-0.7216707082208504	-1.0
+1.0219251961145952	0.19299500589830051	-0.47729389928282157	-0.27166980167059496	-0.24751855177125084	-1.1322412716856916	-0.8110222905403106	-0.10473605798933078	-0.035928362941471184	-0.6534723222613076	-1.0
+-0.8154578692172377	3.2529008023011587	-0.32230874972038603	-1.5958813690320397	-0.9471392661729446	-0.4661557022161254	-1.1963099714035128	-0.6788102101595077	-0.2281547965833843	-1.4737655176136435	1.0
+-0.8116419957449114	-0.093173526942104	0.11250426233136833	0.09207904862564406	-1.3867146526153864	0.8282908984570213	0.009430420454783334	0.38416436496131556	0.7831220308214599	-0.028677866459869465	-1.0
+0.5748209312636592	-0.22085148462505744	1.483178916134393	0.5384714676400842	-1.93736462781153	-0.7742446220627313	0.9863681649066736	1.1375377820834534	-1.328483968518206	0.9314007484353164	1.0
+0.4152987016284749	2.565917360177608	1.3110909185719273	-0.20429550994058496	-0.5277830403219427	-0.05624642393738156	-0.18726676450257188	0.41535786515366985	-0.180323324487924	-1.2377573117811096	1.0
+0.40944806598520256	0.9710150739398405	0.055893360103507414	-0.13442562190597213	-0.7935082792305357	1.2485130631114325	-1.1446482896282357	-0.922849593193101	-1.5573740255791648	-1.153885792720572	-1.0
+0.49790841207097386	-2.338273386722357	-0.7735959733304064	0.6807164316349167	-0.7210278452213854	0.6232216740312264	-1.3283248730961463	1.8356854615940046	0.596469164632437	1.11694972800202	1.0
+0.952868090977543	-0.5457976028267867	0.5450784715193229	-0.9275320032879893	0.5568882027647745	-2.6545414330136725	-0.24928762363265858	-2.533714900686942	0.20604165648494577	0.5416161166668478	1.0
+0.5219979705833208	0.563949339433897	-0.05818985492234962	1.0778035873134737	0.6791380636681086	0.49256225202705956	-0.10405164557505987	0.07530237581078959	-0.38465598282466923	-1.6645104329617095	-1.0
+0.39058426076124503	1.3925260779906183	0.16841451395907342	-0.3925687758796	-0.30229931902300344	-0.5383113936858084	-0.40544947525878355	2.308417411264717	-1.161481950236712	0.365229811440301	1.0
+-0.3876465197231077	-0.32107571525219936	0.14753580887585138	0.32032143845469147	2.4540699865725952	1.48165499306989	1.3912563489889982	0.6065672606903332	-1.3270484988969211	-0.3071043136579491	1.0
+-0.9436975883785224	-0.7878701909688464	-1.041432014546035	-0.9819405159147886	0.850917690412449	-0.03764483160530487	-0.10897822398419477	0.2702901295410002	0.23171425886031422	-1.5288911390500588	-1.0
+1.4864063190360182	-1.6282177718096182	0.8515169424047723	1.5754546206896403	-1.751877375915603	-0.6674561400646665	0.6228160705098441	-1.37673177011338	2.257105652325047	0.36492588017405486	1.0
+-1.2768418032135684	-1.4794523507233939	-0.1685525212259554	-1.0534077869037715	0.44210387411914803	1.9197425585151304	0.9729328493326022	-0.1293144508869995	0.6322480767243195	0.6500211894577178	1.0
+-1.0413287186178035	-1.8994347398217741	-2.2513351691435166	-0.5091252178684762	-0.4773688571263915	0.8826732417762103	0.2220474489058974	0.9023035325256057	0.5047301964557872	1.27770675903322	1.0
+-1.91867051463498	1.2395346950463286	0.13276628757162603	-0.934163742863351	-0.6753613928234674	-1.1173468591748723	-0.9193386835215931	-1.6450597503739999	0.49964503885837985	-0.14793977663719407	1.0
+0.8010132025641555	-0.6561683914188803	-0.7303432134669876	1.052612213798156	0.20588204620130146	-0.7089437447106754	-0.27750871888408135	0.5253208656130269	-0.10263740350804132	-1.4718024022204228	-1.0
+-0.1720016407720518	-0.03485269020051633	-1.1259395963309522	0.11353638062792963	-1.8022338122384196	0.07794539839355762	-1.6455630924194975	-1.0832724606105695	0.27391970907521396	-0.22261666691449442	-1.0
+-0.6712985654658538	-0.4248872082482339	-0.23156601234163043	-0.25204009950055384	-0.03998527731893999	0.08845019567417375	0.7332010817000086	-1.7952223314367777	-0.8608340520871763	-0.3592844573981156	-1.0
+1.8615079791293867	0.07567969491410388	0.31671759658978915	-0.14088196706510941	-0.7959490828613497	-0.1957764631453973	0.3164135992879402	-0.8404959717607442	0.6950459152988785	2.5743774170572635	1.0
+-0.03850183629652526	-0.8831810933826825	-0.13261465381720608	1.245927327198678	-0.029215350616095467	-1.2447555297812523	0.7090071647807351	1.0932651544462924	-2.1179586882142183	0.5546032137785528	1.0
+0.373804500701193	-0.9447523971864591	0.6579063466555688	1.6907271573797713	0.19795807338872481	0.46313191383624364	0.16805519074751002	0.1433734811754914	-2.102572569565361	-1.5345185879811143	1.0
+0.5422009876544758	0.021137383803465484	-0.3913427396826717	1.1754220486327704	-0.1624128633612627	-0.32967599007509585	-0.6698999135505094	0.7957538616832794	-2.065460023750255	1.6479521897098153	1.0
+0.7916568619310699	0.026047949725217002	0.11980403894989199	0.4003349452088214	-0.532841258887561	0.5515228283280346	-0.04328498355773543	0.8360216198318237	-1.1019079628019965	1.8392396126142838	-1.0
+-0.8392787196734521	-0.9032612795228153	-1.0360155745433912	0.3584184300730976	1.6113278152934578	-1.1228714088538807	-0.00573629616464749	0.6785975071445123	0.7355141369648618	-1.1163298319323551	-1.0
+-0.42149791592154057	-0.8111909845152905	0.5133516206804658	0.5596049961465585	1.2372073277017173	-0.029767490708398948	0.6416766584030617	0.9613836526151365	0.021426850029034692	-0.26229033898779025	-1.0
+-0.8915907659902134	-1.0470853844510801	0.7256572920466966	0.8819141124077602	-0.24574077501449448	-0.6757986185783482	1.2732961690694489	-1.6422409059255298	0.11342576959257727	-0.7695159796932176	-1.0
+-0.9805822175698738	1.1710835036186504	-1.022439014153252	0.6323801688030679	-0.05879930999668546	-0.9621286662467072	0.8865990603268918	1.2650377385436393	1.9715212116479575	-2.194508803044697	1.0
+-0.057433473373490536	-0.5245170611148295	0.38976152676692705	-1.8915231712948801	-1.422653305437163	-1.2208600182797968	1.0533466475472533	0.42840060230529514	-0.49295571686581857	-0.8806309088471742	1.0
+0.5922088885647733	0.29682919133623076	-0.16467980281744263	0.2809370647501584	1.555888799783944	0.7458685849761907	-0.13393665804209826	-0.22214270831377508	0.43052180752145397	0.4102475225820112	-1.0
+1.457891544806671	-1.2523484066972168	1.3078130817146612	0.5956840523360536	-1.8473075659892315	0.05745400435124221	-0.4187251839163349	-0.7501323680171557	-0.35339746345380346	-0.5447691136683901	1.0
+-0.6908757450709337	3.6952997783501327	0.2540683382751721	-0.6497124569242408	0.585573607109268	-0.26597152644485383	-0.0788291979323768	0.7279390358755751	1.366949742955891	-1.6668805022599866	1.0
+0.3378011936961394	0.2079153346487379	-1.4988550541024916	0.9240925660100396	1.10919976721021	-0.8273725927527698	-0.8323621287038554	0.6853887592652913	2.0545326852812407	1.3910864838548966	1.0
+-0.2809232061201644	-0.48057596253157536	-0.24394028298366904	0.15383110884472104	1.9209391740285784	-2.471385542282654	0.1798731371545325	-0.5795073006729192	-0.8735195279560218	0.16597253072044424	1.0
+0.12864079034853612	0.004739821932777124	-0.14454495683807528	-0.9552885645951718	1.4737155224727905	-1.6829282968038337	0.7205167404505212	0.25820545739708217	0.7295539837812798	-0.49036321851585124	-1.0
+0.15571555789835304	0.1447498147110094	-0.5560116328869547	2.035112955294972	0.6657168027518681	-1.1608780143872193	-0.2272470773680726	-1.1455605077655542	-0.09382341620634098	-0.38713935944426353	-1.0
+-0.7917222269620469	0.801759770989161	0.141568200123504	0.11944449842230251	-0.5947131506390755	-0.9110894569987914	-0.21406430482932137	1.0320175821509128	1.0826263769551498	-0.6898432731353442	-1.0
+0.10189135481818157	-0.7470853046062996	1.7887899813212826	-0.6998980011621436	1.0263267172366544	1.1820482266236412	-0.6398412692249618	0.6930439757683763	-0.7353984733490649	1.4324451728810224	1.0
+0.002039989312795594	-0.05242307406751564	-1.4916482971486642	0.3503493253178818	-1.4304583513209488	0.5636399400377983	0.13284630812697834	0.6400652771209987	-0.024541300619146538	-0.038054654908441364	-1.0
+1.6540693588717	1.0077215829577184	-1.7790052198085884	-0.014624478743989654	0.6762497993725941	0.21076381406530026	-1.8618023512041566	0.2773460749128965	0.11957236699383392	0.09230308711426082	1.0
+1.0209239802272385	-0.5123607632950907	-0.04100745586155637	-0.33997777557902475	0.57406693541952	2.6628271918309028	-1.3683019563925773	-0.5927440624976305	-0.4985029881803607	-1.4491328383391289	1.0
+1.0479255394356404	-0.7097112074705344	1.1101865526683756	1.7212311976518058	1.6427267909939458	0.42604107028869614	1.8922403900043392	2.2255099612336893	-0.8836138953907986	1.0286079931145995	1.0
+0.5872594680978843	-0.45186439475168905	0.4742240303458316	-0.09572608603916524	0.36767347630475355	-0.2759071848328467	0.7257751086155199	1.3525883572448814	-1.7155404770963167	0.6894265106536129	-1.0
+-0.7172101122622849	-0.6258061948132327	-0.04862094515232531	-0.2835219064516102	0.020754117929975585	-0.6006192810888252	-1.1833638011279208	0.9812209106546904	1.0562356622512707	-1.3510974100758113	-1.0
+-1.1927082123484898	0.9059064556897761	-0.11033751258126516	-0.9668870356169144	1.5697333822572919	1.094534222872464	0.962437095583402	0.906700812097106	1.7602727182818783	1.0176284959132584	1.0
+1.6418534367248823	0.9787815967593494	0.45187539696617784	0.7517268573418665	0.4596208416025718	1.2175215926968426	0.41889930681094917	-1.0340715190019967	1.6461506538132258	-1.194368281479641	1.0
+-0.24434612500459743	0.8905795299551568	-0.5866455215458722	0.030531942351904175	1.5141044751068355	0.9293797179956591	0.5915653121373462	0.1407303175871868	-1.5214526807706006	1.021842667698157	-1.0
+-1.5822767860023326	0.5095145953119626	-0.3568770116156504	-2.2175685002493553	-0.5916821178781952	-1.2565064162970065	0.670571381059279	0.09924302883049717	1.5947769886550391	-0.9412733772954048	1.0
+-0.7385535329801526	0.19762742151241033	1.3557367974480028	0.5383065810535187	0.03551647259451544	-0.867003744799122	2.1780893391993934	-0.15880038306288738	-1.2309562517581967	0.2753602396027737	1.0
+-0.7688810631336986	-0.9792940772146265	1.1373522391416644	0.7008739180657806	0.5920515593160753	1.2598793765169944	0.1322846980257473	-1.2663524708219718	0.21908701821238732	-0.011800144206460887	-1.0
+-0.9253439813451969	-1.2524149439011607	1.4930226357142633	0.7854764528549868	-0.9027164538332099	-0.9333172012444224	0.5045797654704761	-0.036368833910613865	0.856155556836564	-0.051342912704208085	-1.0
+-0.3295430326335301	0.4548291714968719	-0.1594703264438506	-0.674331185486303	0.5601231610303146	0.9889128942913799	-0.446148032803478	-0.42788233263563014	-0.6510789642920245	-0.9385192820557556	-1.0
+0.38117292894343124	0.9364639460195264	-1.5928398829912223	-2.113494174527808	-1.7825335343918676	1.4449448654579424	0.365744491258538	0.8446652659045594	-0.590898304466056	0.983494902139982	1.0
+0.5759844406328872	-0.42120753173040376	-2.1752608562496487	0.8790187243834333	-0.6224258458551829	0.2749149959814443	0.19290973969550157	0.8322105519422051	0.6142851481201329	0.8851025149493374	-1.0
+0.48843220829071704	-0.47756825940893144	0.3764827219613796	0.2545873339241572	-0.2690378414815943	0.1273419395036818	0.6865082699832734	-0.3027387373729808	1.0800426342444311	1.532265249006984	-1.0
+0.6914348836708955	0.4049321078802233	-0.6241068764943583	-0.427783729987251	-0.5969293929158517	1.2246640552123897	-0.19278078851350763	-0.44838400048471444	-1.005297599943295	0.20618061071078814	-1.0
+1.4362901237563246	0.9729826951781718	1.3742180951336622	-1.2577357193446648	0.44267472266842484	-1.1052352429148984	0.751514201601818	1.0575306323740594	-0.5007833154550767	0.45993715118448286	1.0
+0.6560105088937781	0.005411040577460287	-0.737470633061621	1.1188902572116768	-1.0883669920250287	1.1835867409108132	0.3747819439333432	-1.0219953285263044	-0.20161303094544727	0.5008709554970783	-1.0
+-0.08454378176961004	0.06581590910791382	0.010182301205252762	1.7798243766533453	0.09721144394744807	0.2745242951730754	0.6114749324736095	0.3445533288016556	2.2414953786592435	-2.084639132454187	1.0
+0.29278037857569916	-0.32718066974612353	1.2374525408589556	1.0699691016892268	1.6795083582836285	2.6116720650317333	-0.3840869293209991	0.40445166836461177	-1.24677147070361	-1.2863441677084697	1.0
+0.1680772018666437	-1.362046957534967	0.5090308956583095	0.36586657398015354	-1.0101818427081926	1.3308530886738394	-0.7610443564264088	1.2702174634982397	-1.8420765927960854	0.4955700482049656	1.0
+0.6277206416217667	-0.28759791546421387	-1.0585617060817396	-2.20224147187092	-0.5300397580425709	0.6639947087477739	0.6903518195188416	-0.16525156924899576	-1.4238739032547831	1.7508021778248384	1.0
+0.6101809585146623	0.021983403711540825	0.05052246940084612	1.068809358298806	-0.5306282317454503	-1.577757912047736	-1.220352388121859	2.1045309968729025	-0.37333697669245425	-1.256736509931358	1.0
+0.67702986849365	-0.06329423876550211	-0.7854454500269243	-0.6596664669852498	-0.9920219309311785	-1.3480593072410196	-0.5218516926866221	2.4473464215266993	0.12593047317490033	-0.7734723290170594	1.0
+-1.6255296971778601	-0.8496028332724122	0.9854634218314932	0.35213740144334865	1.9025139205319999	-0.382032524538817	-0.48685100067278825	0.027027199178539327	0.36588164236314136	-0.16602861813409478	-1.0
+0.5404022758199989	-0.22359822709110108	0.2617010365210662	-0.8788256991222697	0.22338152449598941	0.2759418990779069	0.06464925530843595	0.25129617537815985	-0.23892745611740313	-1.2588940133861541	-1.0
+-2.5055621691037677	-0.33917079652490056	0.48349270599591304	-0.3323784630878313	0.7942499554780703	0.06333222100800502	0.5545025154210302	-0.7619025738249727	-1.0742220300731438	-1.2499063145267277	1.0
+0.9028676909648012	-0.40831520780284386	-0.33375727444634623	-1.0860944718884409	1.079404273274736	-0.8339293547395862	-0.9066933774116075	0.47914430143706177	0.42444351582043344	0.9966835305932787	-1.0
+-0.4585623717703027	0.08476026448906594	-0.7517887703057032	-1.0602489433219269	0.6105405603036862	0.40627103433728035	0.06945486058985327	1.9247295220379417	1.4539247011274994	2.0862381838376853	1.0
+-0.33901502980395704	-0.9472427030108499	-0.10187157236010007	-0.5649699251726251	-0.2805354315283516	-0.33665621874795576	-1.094112401850779	-0.5350047996610439	0.05140356784039861	-0.46015395801657283	-1.0
+-3.019478289127564	-0.8034789084221933	1.0155312441539965	-0.8423798812727651	0.6029855042946175	-0.021126861661468852	1.0596196518981214	0.5935863876326577	0.8621616676795987	0.3015015601554714	1.0
+-0.48152007909040123	0.12213336537981243	0.4667625263465448	0.29207422144612344	1.1905032745203572	-1.1644960047852317	-1.9118384764938943	0.5767659350881928	0.3129448076130652	-1.3664558272112886	-1.0
+-0.32094617970991796	-0.03218742948789234	0.9242571884155808	-0.10530188835403416	-0.1471363794092325	0.7639739519567249	-1.7750661246399277	0.5439800733216288	0.16920718894614695	-0.9260164082022244	-1.0
+-0.023876597295284383	1.285165082287723	0.36501060120400836	1.957147485251539	-1.5246206669302385	-0.5226247989378464	-0.8027494032332249	-0.5154219727994211	-0.5622819737026037	-0.6457140460803893	1.0
+0.5944669002646673	-1.1489963195247355	-0.8191788097193523	0.1834038489640686	1.9331494051476352	0.06339719161509598	-0.13231336136075628	-0.613147286313191	-1.5652686351165574	-0.97217252028459	1.0
+-0.17271456198533477	0.3318117528760616	0.7176342868325969	0.9238046790574793	0.7087684072732814	0.6326611553098112	-1.661077645229176	0.031528885502400274	1.6090347711218371	0.47177761480283514	-1.0
+2.0468956858442504	1.2229795703374287	0.6293960998434666	-0.9902737266289515	0.7855210421731049	0.744750904240967	0.6048503597711237	0.9479135293583886	0.02919824227611224	-0.1532949994121978	1.0
+-0.808253278056905	0.7148458150529693	0.03837002381133596	1.0886277258418602	-1.4201810549223448	0.19773612678223465	-0.10630799215816454	0.01777062822279798	0.35644111212353585	-0.14474255579499676	-1.0
+-1.2525300719713104	0.17099173202803972	2.7763254588000312	-1.2200783739047856	-0.34153074332485567	0.45476536272575707	0.23842571206455815	-0.11660753330508225	-0.48053705721973694	-0.1414497929074891	1.0
+0.7461143573591915	-0.2324492035301729	0.8550308458376977	-0.08217955576858212	1.227917194888763	-1.014912045053364	0.5826351796035163	-0.5605490108921727	1.5188709127713413	0.47973453921572196	-1.0
+-0.4848700259763014	0.18552322332850749	-0.6475897026924888	1.7643068907799073	-0.7623451772061194	0.1583505914466949	0.9389037772943867	0.6290985070965912	-0.32383251498638105	0.9517123999002982	-1.0
+0.2018708184922912	-1.1791149052826604	-1.1102859959976457	1.1454614336543856	-1.6270171962609803	-1.016235867126816	1.6557042382271825	0.4480092560521237	0.6324830961433667	-0.3293872870576077	1.0
+1.7609482909501006	-0.2731028334753048	0.926485195456782	-1.078985711212504	-0.580865395477609	-2.729044357089719	1.1020000973238673	-0.484610482060817	1.143988351254438	0.5991729916158207	1.0
+1.1171287573337647	1.6302750092650247	1.757352397931975	0.19216480176474013	0.6628117661526611	-2.0629441646040836	0.4435442534411382	-0.9662136543845258	0.18686589206270993	0.43966891204060843	1.0
+-0.1846462299060448	1.3034169184403073	1.0139442850591336	1.1956678167282278	0.9050264189533831	0.5604533970480537	-0.8770332527050415	1.538379851802693	1.7335413254921535	0.33781442919692056	1.0
+-0.24077939121999706	-1.3836466853338705	0.2762461940304474	0.16775394441283006	0.5209334119987634	1.6719726008266134	-1.1365518925887945	-0.6796747635067687	0.8957657547250679	0.9382279927349255	-1.0
+0.7930605524518372	-0.042382357726280115	-0.05705869182666073	0.031216052991360762	-1.3208173667695051	-0.21899848103126462	-0.42039445805125514	0.3100086777490648	2.180496319638774	0.6696772854660646	-1.0
+1.2990494852142003	0.7779730855208029	-0.5369847731644571	-0.18085904537193154	0.6254161731374436	-1.4107230271446614	-1.7136969019583213	-0.20792927144826429	-0.4432442621231197	0.21044802246357056	-1.0
+1.3371703539009159	0.8499909381531157	0.6554100699036137	0.5179461774231867	0.22641983526200565	-0.5240694201011481	2.7347220680651043	-0.34408047191205804	0.5732667698824925	0.1918011993362733	1.0
+0.5338752201638095	0.14259804246315522	-0.8295259483463495	0.24350121915887402	-1.214230449042842	2.140719635848265	1.3568188596698891	0.5146796450521871	0.3248884222147333	0.7496886609970755	1.0
+-0.5426344721669722	-0.9077853251360676	-1.8344258214845997	-2.189700557749177	0.8300700962365736	2.114972180111325	-0.36828110384225976	1.9408210391643	-0.8419015179841862	1.689279695660335	1.0
+-0.35241187715519434	-0.12169176759295995	-0.15487598945340703	2.4725130171322265	0.3679205193485643	-0.40139670771987895	-1.2854017963577087	1.624561836467517	-0.06673601881932618	0.32899969445642957	1.0
+-0.28519943718191715	1.0150680787154869	-0.600344327643504	-0.22476104884445314	-1.5619454906072574	0.5183963822937636	0.17884920877518767	-0.45540169600100905	0.29544075938586684	0.5438110446247724	-1.0
+0.24107892253465105	-1.4415215016608294	0.2502178683621191	0.5222957480920298	-0.6034812400286401	-1.590448585076191	-0.33384317523740825	-0.12214358859249375	-1.1820949222971797	0.5486006434913371	-1.0
+0.20734902788956122	-0.40800572079704767	-0.9847091574385742	-0.05325385960763708	-0.542557289278743	0.09498250661407558	1.8399714829058864	0.29505979145211914	-2.042499754030473	0.17774789041522038	-1.0
+-0.9811605302559214	0.5794306891279211	1.0475864823232	0.35384034605852205	1.7583556507338916	1.3239304992040541	1.7223972327686636	-1.6114291773243108	0.7811876559567983	-1.943568898471209	1.0
+1.7975728050475188	-0.2874425533098609	-0.01667833844315343	-1.6125403234856799	0.5182024680825486	0.8290558829961522	0.7413309178765323	-1.5378931704299477	-0.362006277249694	-1.103255160475914	1.0
+-0.43432765000649476	-1.0682041983192245	-1.8433302877699238	-0.27274824801804165	0.3488053490863389	-0.8600943494291856	-0.34606254157301014	0.1419471025452551	0.09826733603966904	0.13537551720562466	-1.0
+-0.21823473396034013	0.3807530101111061	0.2387255314389622	0.13454766011679728	1.6397105994939052	-0.614485139414611	-1.3590305596230507	-0.5872785126160613	-1.9435556958049454	-0.21788449197404788	1.0
+-0.9752585589861398	0.1843759532156277	0.11425073663180842	0.8443467794344975	-0.17082205638355702	-0.30948092562896473	0.4542808191914004	0.3060751549116735	0.6761459549434247	0.8564699279454369	-1.0
+-0.20909371912166236	0.665785498633312	0.3217034422101787	0.4943824186678361	-0.5947936852906712	-1.1187462934276506	-1.0976119097046964	-0.27444347957018306	-1.4599709537448777	-0.07670617897725707	-1.0
+0.5397480768896284	0.39088606986927693	-0.8810036123482284	-0.5130851371053993	-1.2452219420652897	-1.3947611590235895	1.5806695869774903	-0.0006720379849098784	-0.08369416433756069	1.3675180294726665	1.0
+-1.5820542590986817	-0.18275779202562703	2.9492855374096734	0.9639575319355081	0.1574353015012195	-0.7690873631719648	-1.1812334748461104	0.3535715383323811	0.956346932713027	-1.5133217667667775	1.0
+0.7881870169027756	1.04824906045827	1.5746553894223603	1.0170253989547804	1.9496533307886716	0.37024531375609704	1.0010282763901057	-0.14302139975791656	-0.044862191434083064	1.0771401217547978	1.0
+-1.3833498058301037	0.0025279239646442556	0.5763136382397881	1.433803197924469	0.8030227398150132	-0.10702764324001715	0.2507251848199401	-0.7448139907375828	1.4801376315014358	-0.521249070582926	-1.0
+1.9355886489317684	0.12349185339738267	-0.1969991164078336	-0.6581133412107176	1.3030715383083207	-0.75956032947863	0.9259122791687571	-0.9894692799652777	-0.23623684340347365	-0.33462033041774003	-1.0
+1.2239577433935098	-1.5668432870856983	-1.2284893624389799	0.9163491791065601	1.2717942682817653	1.032383087760309	2.080616713517142	-0.6152062076493705	-2.453566205304855	-0.7083325520375795	1.0
+-0.4411144809679514	0.011948329498576622	-0.10013781078316666	-1.513449097786955	-1.201645144307701	1.1522960518447183	1.9563702519337351	0.25062104075411146	-1.2875486268574527	0.5440546781879965	1.0
+-0.9763357630885623	0.8571913894615482	1.292514294557284	1.4746662077841246	-0.2852483446709177	-1.1948064341746663	-1.9011197332287124	1.6671130760643076	0.20898972573566402	-0.03779952942285314	1.0
+-1.3929278878016753	0.3368981950450936	0.14776654174954432	-0.33299341718695374	1.7727142034705503	0.15009042371487316	1.1225588706459595	0.8413201943874591	-1.8428646722800086	-2.0092545625599945	1.0
+-0.707626055897175	0.6018839402809352	1.8151234313297455	-1.000028927927789	0.24491740363809167	-0.35688989769157836	-0.9680396565200954	0.8260713388575298	0.33884697913903755	1.582552494087487	1.0
+0.009866873473095257	0.9534203375812438	-0.5552469227740527	0.522770323556712	-1.0407069691024984	0.00048299060133975326	1.0035073370534753	-1.2488077336524008	0.07328162495380929	-1.3741109817047519	-1.0
+-0.5990784485961277	0.6727425360323672	0.5603262261902678	0.004763581710500002	0.18166179174550157	1.4210483234928641	0.744332710029289	0.6856419731430565	-0.6940719880280536	-0.47472800853181424	-1.0
+1.2582382206409954	0.4019588706831498	0.36203891387029025	1.7263963929112118	-0.902404423902606	-0.41323336649747644	-1.4456540943517122	-0.5244280259438602	-1.3446697374620908	-2.480287465554709	1.0
+-0.16309013666903965	-0.5147867370947123	-0.5304094280300458	-1.1586206703649367	2.7226579854933752	-0.2879126895937779	2.7638556426243883	0.10416628741063334	0.8928517443370074	0.7447134032980525	1.0
+0.5876388752337978	0.14460914761244043	-0.41229910610961773	-2.3136583121609977	0.33249526217871134	0.16931042803721305	-0.7937807781429668	0.6627323963423138	-0.3608878678231499	0.020711239627139746	-1.0
+-0.7941234753550339	0.8802363021932996	0.6419632576038624	-1.4213378394308855	0.597857713334496	-1.308906920021401	0.34472059018565304	-0.7604693781582598	-0.1406772722856227	-0.600455406863254	-1.0
+0.6077192689730406	0.5614393396589403	0.5758643380026099	2.3036455913612075	-1.3521850848224095	0.40210659978009916	0.8990413385545436	-0.41057612192261933	-0.9382963538204352	1.4500512216749324	1.0
+-0.846281540145089	2.403227849746885	0.9245445397828729	1.1326544341391687	-0.5931063550125552	1.5138219350025444	0.4411823253796442	1.7295916255415493	-0.13072742282138733	0.0705517775160157	1.0
+-0.8587971088986452	-0.08707681322173097	1.0218105803276376	1.7899511444030378	-0.4417120965359326	-0.08314082723386619	0.8204867606039337	-0.5370960901432748	0.2929855844016277	-0.053153311160889775	-1.0
+-0.954528203228581	-1.2962325529079044	0.28922996107465865	0.39412136243439416	0.9574408494931212	-0.8347735000559878	-0.7222573654548228	-0.5197899006366578	0.660610340697349	-0.3525074506460879	-1.0
+-0.512561938428032	1.7834974202272331	-0.032143872684150275	0.9964032938239826	0.2563608162224948	1.6755845193589909	-1.040844033605032	-0.9075141058327602	1.2415823204823428	0.2699774455987329	1.0
+0.7305726548737476	0.32892274884153416	0.387036936995438	1.2506267841469898	0.2595430091883984	0.8358459997033395	-2.554814050397111	-0.8754962876583221	-1.2595523882418678	0.568989816200262	1.0
+0.36295138311198694	-0.2449316579347589	-0.890627187960851	0.22746085677059893	-1.358874202170808	1.1208866152739076	-0.8122786693590682	-1.3654998780993912	-0.2010601851997522	-0.19413827519552213	-1.0
+0.7614609058505148	0.5222339347763687	0.4366211902141396	-0.4638213629129547	-0.4303966068454211	-0.43945835995993865	0.8445375760837507	-0.34661930103527633	-1.8550623188238975	1.3376655897119476	-1.0
+-0.7167619828597596	0.2939662108682466	1.5823697336020464	1.2777781023739858	-0.3190156850701858	-0.21472822782873424	1.5668464460560432	1.6474738430928832	0.40983883442266467	-0.0015227145401484246	1.0
+0.4034986202367133	-0.5206128104740666	-1.1247227521080672	-0.4160634652067836	0.4987641057674319	0.07212492808792567	-1.9213963222948693	1.3682078241753455	1.4363634524155202	1.1318256004478195	1.0
+0.6577079271066337	0.22260596043089323	0.3318763604869935	1.3096961973406098	0.04613231639449186	-0.873506752741301	-0.0557449266511973	-1.4931085495929537	0.00857057873711778	-0.5994988634208177	-1.0
+-0.0549125179026859	2.4107573315584117	0.3100602971798463	0.4942312319586998	-1.4030081704512587	-0.39683153307267155	0.9289217690714815	0.8966357429103212	0.32275553462582884	2.017397578340806	1.0
+-1.1809766307020855	0.6233966684726192	-1.0613220038807043	0.8386992187684233	-2.674814438512866	-0.9145892322203668	0.615393492901773	0.11702435033107478	1.0166544966244935	-0.3866112904938636	1.0
+0.3128491785442516	1.5463151302209646	0.2665188298474402	-1.773902379796769	-0.31496343501988133	-0.4955365061567787	-0.7344758558142588	0.10719287249680484	-0.919793628868033	1.5701749836726397	1.0
+0.10011845364190239	0.7045091995263103	0.43371435429525856	-0.6301649907495976	0.20479266970356375	-1.6923388444453182	0.3847395431932847	0.21755165324757852	1.8486585402635474	1.2451768851066742	-1.0
+-0.8842697497439428	-0.7485795086261474	1.5250972072860398	-1.050549240910125	-0.14049754781225188	0.2063607191440174	1.7050752199158172	-1.065889385275902	-0.8310556101158835	-0.16704848061303224	1.0
+-0.22516071659483092	-1.2664169895910844	0.1823342685288408	0.4757179729515804	-0.00624749909608451	-0.4286006895038369	0.09281635295594677	-0.1530993652222406	1.0816642101965943	-0.6296621402997927	-1.0
+-0.3876766335113583	1.5482059998936735	0.9319163634092831	-0.3668328388540765	-1.5327674513107599	-0.6325507885752846	-0.8605729723885422	0.6926734140423703	-1.3995135467888482	-0.03900084187523604	1.0
+0.6869376770616449	0.024610924354389847	0.619951602914075	-0.018432613234157926	-0.41866790047304714	-0.506437138633781	0.11816520887303691	0.2801935087625301	0.17609060654774036	0.8532425839939517	-1.0
+-0.20772226152839787	-0.4036369774289267	-0.6376266407920901	0.9815725775432228	-1.2094225514937764	2.453333085059053	1.5853204184544887	-0.20640389337347098	0.8014995302321771	-0.8992991285777349	1.0
+-0.18178378221098612	0.4562579201281703	-2.298244977524934	-0.7571996627483097	-0.5123494614427917	-1.5291176127709625	1.578710018765323	-0.29179516831965935	-2.891511480266465	1.5813434316140553	1.0
+1.6790709139375262	1.8429948292589102	-0.2410490433934643	-0.4719770498589021	-0.04472071656060325	1.2485175519153422	0.21077639827867464	-0.7236007880901926	0.11570072469252614	1.568495238469606	1.0
+1.995204914958134	-2.0473869177809916	1.0422508937478188	-0.04894159950049813	-0.9883241555598781	0.06264861100813558	1.1726310798401003	-2.145906490992007	-0.8175495463745879	0.3380181076719186	1.0
+-0.010027245263731388	-0.7650440765531352	0.11139191480130796	-1.0831436373754542	-0.7752892613239524	0.13709833236789584	0.3982485625926226	0.4715904875160344	0.2672589441714726	-0.08696044863427461	-1.0
+-0.23623063578079662	-0.1923738760159783	0.6355857670152736	1.3387524515407794	1.733914404378866	-0.2823033089990523	-0.06746988975377556	0.12769130229012166	0.13357971925722345	-1.0170469446175625	-1.0
+0.703370129532403	2.018173105408419	-2.1184436022043336	0.9340750865112839	-1.2065215329274852	1.0973968223176775	0.45649848502097917	1.6812252448367369	0.7947226037501349	-0.0799031455189001	1.0
+-1.341192092810752	0.1379875725041552	0.7800431541551157	0.48669587923112334	-0.6647352056770366	-1.204047524426513	0.17254732987558635	0.8059834326652149	1.279221063744146	-0.46393585695803224	-1.0
+-0.5364912567801339	1.02388871112381	-0.17773979821252014	0.7349322928680153	0.21762562625293622	-1.3454961307000246	-0.23246046381217153	1.2701984850473267	1.3061053422646105	-1.3303550582969932	-1.0
+-0.27240144950646744	0.3994450386798551	0.7221275341358864	0.8509706508402413	-0.1649762963450529	-2.828130839035651	-0.8525632915864112	0.9481930155134397	-0.8229046821037809	-0.1926273103751093	1.0
+-0.5828427350759314	-1.116670914632246	-1.1470305042127322	1.0123301291535707	-0.6033969466944596	0.1690265657500107	0.9967769868870562	0.3075686296840664	1.2471602380126536	-0.32451917971977035	-1.0
+-0.5324216153785134	-0.8706231866538897	-1.5584676326209697	-1.72518170846262	0.6192917812367374	1.1142304312209723	-2.1726880350973126	-0.014061719858579569	-0.9810467702986106	0.7744539177078257	1.0
+-1.5213902937719854	0.5835337711580395	0.43229829833763994	-0.5832435290683634	-0.5526203252585131	0.285659043697623	0.47105343515245557	0.05389801515569181	2.4287544917989123	-0.5378665459552227	1.0
+0.4434335991832058	-0.8411355742162048	0.6071172007963179	-1.118340365126854	0.911583508699734	0.4957066058729871	0.21620530529444812	0.6694230802233578	-0.9262024412366738	0.13713873110152852	-1.0
+0.8222401155337418	0.39523394757451724	-0.29933287109747625	0.08802660199277589	-0.2390432735446173	0.8195566836206314	0.32615014517430196	1.4846690084683545	0.6467529287837123	-0.3641414700016927	-1.0
+-0.7173229583954034	-0.21098957751191205	0.668591250238042	2.6760202376865165	0.9805012447562048	-0.7630629800481941	0.7172732938007931	0.25515027597795337	-0.7604503951132184	-1.9636521318942264	1.0
+-1.0133070573583023	0.6665456916000502	0.10344156347143192	2.0222291803829266	-1.6648000541693977	0.23212711401667116	1.9243468647447306	0.8079931240320541	0.03784392223651478	-0.8781434407720886	1.0
+-0.23076981760867543	0.09532380010913132	-0.32644361861668264	1.5230948548283574	-2.0400054253288675	-0.36663718340930185	-0.9601797244749867	-0.722875853215207	-1.1826934605270367	-0.39546458167579474	1.0
+-0.3638443703524025	-0.6092348200836429	-0.131311193084348	0.8283367901896841	0.22468694646702378	1.2404394323664851	-2.223349107587579	0.3793429402542866	0.054161384621966145	-0.16728168369342303	-1.0
+-0.9032537457005727	-0.9304157040470137	1.8258276580150956	1.8415243301212108	-1.1615542498827922	0.5442609117868926	-0.44885245631262605	-2.7089623509255185	-0.9052194697450736	0.374271430104076	1.0
+-0.26786058872576685	0.19515911022954738	-0.9439915077147799	-1.0306334854354435	0.7104985101364456	-1.5347150370125728	0.47920744733531906	-2.1184421474367023	-1.1875457756687378	-1.4435398156990535	1.0
+-1.6556617787331176	-0.13897571459459568	0.12927613208903513	-0.15283744229134358	-0.6379826172359941	1.168447470328504	-0.35437033568282295	-0.00853987247179895	-2.0846611248751277	2.724110499215777	1.0
+1.1100008687629395	-0.8706358725550741	-0.0440429878313537	-0.08674639175942468	0.7138518649577155	0.18900662205753851	1.4694775818174413	-0.682173504830947	-0.08280882147580615	-1.5839917555507281	-1.0
+-0.715022270743163	1.8625366481181644	-0.482018003658117	-1.7253622415937468	2.6529458804159876	0.5808831105927824	-1.3089659187235936	-1.3910032114472841	-1.7898343210000371	-2.200183083335388	1.0
+0.9652522152071658	-0.7655097808025378	-1.1895748665241923	-1.5557696896724853	-0.47834564938154406	-0.33978304961742956	-0.38074612241068456	0.6596950619222537	0.23479550988515677	-0.5709036842181517	-1.0
+0.2725427308241023	-0.26836813835056045	0.13687042883690692	-0.06638489106889214	0.6190531295702778	-0.23438252214542632	0.07043187851424784	0.2494942809185112	-0.8484058423525904	1.184210292744333	-1.0
+0.04104710872568246	0.13548793223522979	-1.6952806929032889	0.17812227233907466	-0.0452785625108321	2.0519984093494554	-0.5927021697786364	-0.16521378061409495	-0.20034307182725242	-0.7168753887911383	-1.0
+0.016677117941437506	-0.47336487400886057	1.118495904915875	0.48607320858205894	-1.027701575056674	-1.7626461453123483	0.1043675630233738	-0.8348484075227088	1.0463334271019895	-0.8959576800770115	-1.0
+-1.3589161331214041	1.3304175909504288	0.9293131092505473	-0.04460441452114735	0.9508983777841041	-0.6324254613406854	-1.0611504135468595	0.3716595214338401	0.0959623504816614	1.3977308654404967	-1.0
+-2.062063795738857	0.8249172768005779	0.1179448395046468	0.4781326725715535	-0.5165213775997485	-0.5133155400958628	0.9491871040591117	0.7187735861356946	1.8614263032281273	0.025844223700076645	1.0
+1.3160200842685132	-0.6457011473164738	1.415124095979885	0.3970744553296857	-0.3611845021843006	-0.5299681009539092	0.9566637994975756	-1.4790002043608121	-1.3223021520659661	-2.6477887298406766	1.0
+-0.5344270753617962	-0.011301867936843329	-0.7563988536277235	-0.7569098478750196	1.159745068983059	0.7064061842456313	-0.6740797927549825	0.1060191820823213	0.74070365495494	-0.5585443102634757	-1.0
+-1.2039043726734797	-1.1586952897835594	-1.0953093674674277	-0.41196568854744897	0.26600487863011624	-0.8971418788703762	-2.0225411872111345	-0.3570371576956449	-2.193148276506922	-0.48781533994924786	1.0
+0.727043780090882	2.289768837338539	0.6849129271053535	0.02579473198903238	-2.235333221736388	-0.023779778236546614	-0.2429578662563032	-0.7796146033875059	1.3291709929064641	-0.9789337717895934	1.0
+-1.8452131337364401	0.652498417392727	0.9713885740592777	1.4513172664324696	1.9120131850731876	0.6150656941029948	-0.466844797182049	-1.7859331125727114	-1.3040788911790682	1.6317935693791248	1.0
+0.23692067333609343	-0.6556751111839084	-0.24275198853719682	-0.8883705780574261	-0.5740368981208421	0.013065526046470372	0.37728424085438655	-1.7204762305143522	-0.7190996352330463	0.6314445322823272	-1.0
+0.5928833846086298	0.9562377764353518	0.14160987398660052	0.10264288919982106	-0.377154304171655	0.5754897741159419	0.19854924559010725	1.1565484993871404	-0.544590937790256	-1.9279945408264916	-1.0
+0.8274128286361956	0.16397417435465422	0.3158578992291316	0.27490700974104015	-0.22900212736725978	-1.061829531326256	0.40996865462657905	-0.6493336048160309	0.7359422260973242	0.34947412980616427	-1.0
+-1.7820673133478881	1.3422476930833915	-0.8368802848084969	0.4844840213841734	2.021143213769883	-1.7886373970999514	-0.6100830677983373	-0.21359128937633137	1.3047792526370554	0.8637146477472304	1.0
+0.31611636397073506	-0.6855865825345617	0.6630525931066529	-1.296776393403824	1.2772191443082848	-0.25759205669569346	0.6140905894514174	1.325467379189292	2.1299625440970833	0.2561313626182929	1.0
+1.0255298390815415	-0.4891324449166501	0.01974972012542199	-0.658216554026494	0.5460547774001346	1.178632207660247	0.6440789949326535	0.4608463291053464	0.272215794616846	-0.5779019107698582	-1.0
+-1.5545166846266656	-0.622894695069416	0.37898274503459134	-0.021842146208187162	0.8842201885082102	-1.1330611818704395	-2.995659233063915	0.3831997976998351	-1.4203007583099139	0.08024791004508894	1.0
+-0.4804325339895928	-1.670011788423922	1.54015320346067	0.7026359395168148	-0.8216451961328126	-0.19949613625229912	1.818413133350673	0.6265407863780736	0.862952212302623	0.2517312752937742	1.0
+0.9583274046746033	2.477203941569252	-2.523263820164912	-1.0278475015154669	-0.9798282743626724	0.8851569078801869	1.3446426251461796	-0.14907056457726997	-0.751638492324697	-0.7941273269595929	1.0
+-0.32487923813193004	-0.8179547597426929	-0.6203946109376212	0.2756099526050954	-0.6036384776299004	1.1328562884910964	-0.6946370780006456	0.7919982792628879	1.7455242194304705	1.2046817049580716	-1.0
+-2.1364710128675486	-2.0741253704067573	-0.34752899289413064	-1.0620080413629769	-0.09626509905956808	-0.5402239128062823	0.8047997915349784	-0.582081898942726	1.355681829582407	0.33479222224752186	1.0
+-1.3237556203344953	0.05739620711732568	1.1725550563368747	-1.202268051991203	1.213198685931469	1.2387851442840487	0.8385173120430706	0.6262673312201238	-2.807021342875716	-0.9698023062124117	1.0
+1.0408148657380014	1.6366638716361075	0.8694104625859098	0.27995293275756494	0.7215168337402121	0.4847054917762712	-0.028968819246387372	0.29199124075082106	-0.15594119624565747	0.4384723609886291	-1.0
+-0.6649283544831086	0.6536491899457063	0.6427463354807537	-0.23061690629814352	0.8171204646905834	-0.305156288075076	-1.976294895730925	0.09135888719420779	-0.8813147145221318	-0.4866440867259624	-1.0
+-0.5355480466541341	0.07083612541005647	0.6202978159880296	-0.33602630838451275	0.26652334916816506	-0.01599908393883183	0.6102747482694508	0.3900756831914427	-0.5479595862037875	-1.7852286887467474	-1.0
+-0.9286541093425598	0.3544517990843895	0.2658154213566088	-0.5614622188822107	-0.32725492547191115	-0.8031505725783407	-0.006198233338073983	0.20317556111914978	-0.8306577383914422	1.0918468227292757	-1.0
+0.2772925172108457	1.2030187500810614	-0.05097909198986569	-0.6241849045203524	0.49735882101322426	-0.6984978222948512	-0.14904244468735744	-0.6449049680274449	-1.4176191308588217	-0.6137041991174018	-1.0
+0.3161693434777883	-0.17888572021406024	-1.0767850088217787	-1.1385197167177394	-0.13057675888246012	-0.3447938471613036	-0.6607359578802224	-0.049491009068181366	-0.37102435419105273	-0.13901760781044623	-1.0
+0.29921569652751856	-0.3831087417318337	1.070220492376271	-0.25735009443270523	-0.22877881799864538	-0.10011796387947308	-0.447602708006154	-0.5811961700590117	-1.0320348099520724	0.6388768159460956	-1.0
+-0.08985101768707786	1.0251448309701119	-0.019482394208877433	-0.7048056277502418	-0.19776492953636807	0.6609550877737689	-0.16572132238818135	-0.5269147362081124	0.8005240452151636	1.9901147977037512	-1.0
+1.5749611786648763	-1.2580102352752884	-0.6023871756911366	-2.343451103090524	1.1381667721605566	-1.4231365899858077	0.9142746604239324	0.22725393740230113	-0.4671491612940152	-0.9284070921758049	1.0
+0.004831809736324765	-0.025616676700960912	-2.657425895585784	1.7930252843222956	0.8763798704993517	-0.29509828981324193	-0.6402731797731381	0.18406998905191826	-1.395905535284401	-0.08307465728395254	1.0
+0.2217753462714224	-1.4841784339724746	0.834568090486547	0.7029284905459972	1.2773660132195808	2.376437138715728	0.009164431450487722	0.5754414984606511	-1.5121417472306429	0.8745738469370288	1.0
+3.209153971751537	0.5515188411550755	-0.0008089925731088823	-1.092256759834908	0.7514561773830121	-1.4484751316035767	1.174713707137013	0.41191998359893073	-1.5846094718497032	0.2659151424992497	1.0
+-1.9899921801787537	-1.0244698945624542	-0.7787312876838084	-2.4854216723645184	-1.0776544373364145	-1.420034018325001	1.5361952383822592	2.0905820190061566	-1.3773057955142256	1.0732452145615914	1.0
+0.13530051854730252	-0.07627348942622383	-0.26332748481914514	-1.1610723726428056	0.327619500886888	0.12936993315251655	-1.0031973795577793	0.5830776453738716	-0.2517110543744426	0.4716215616955218	-1.0
+2.6606277672419796	1.1377096548596732	0.317280727479626	-0.0944544297770226	1.0949187731553738	0.49889004555144395	0.1958029548889917	1.5673165762414485	0.6581687012466169	-1.2026720729140015	1.0
+1.509925098728897	1.6802391874113263	1.1856531865355087	0.1388636281468362	1.389119548125638	-0.47951423120958114	0.4701754284225408	-0.4947467625308443	0.3520113899978598	0.061606669970642645	-1.0
+-0.7800138708023232	-1.0507763770862628	-1.744835382031072	-0.4882288728853951	2.8644098213527793	1.289508891208988	-1.2851795042388277	-0.7840641593872114	0.25534181555395397	0.05408430234131625	1.0
+0.6363177555180423	1.6506105751542899	-1.8827391233856279	1.3157324260086198	-0.33750264324332296	-0.39040121423881363	1.1464879638124925	0.13277769142147758	-1.8981997649674243	1.01715782762861	1.0
+-2.4621493596535826	-1.0445261881952568	0.8227359851763542	0.9738577532852073	1.1604110866390398	-0.36022735174714365	-0.6176547883496321	0.2295764862428117	1.501734771150253	0.48126589816264936	1.0
+0.31785297189550127	0.04039473148272651	-1.6640717602594555	1.332101250904695	-0.8628948040503263	-0.03536832084080098	-1.7407288999988542	0.9258714554717684	-0.9972740478126174	0.20114044005615042	1.0
+0.6347269068525845	-1.7838370167658224	1.589866170365828	0.6198144899963995	-0.6289621412789438	-0.6879085319880399	1.8124164830502372	0.9615072025278373	-0.17457636669612384	0.636449258496893	1.0
+0.8036033261292801	1.7216841461861443	-0.8302571967859304	-1.1089279697958838	0.2583488604199059	0.21232513672500902	-0.7223573787112462	0.8883512147301251	0.3166691308233561	-0.46794493092435396	-1.0
+0.08029282816137749	-0.39312638369341096	-0.6142748814719917	1.7380527923726572	-0.05479647337548602	-0.6038787725190028	0.05189800571520062	0.9954806939718748	1.6465914074247279	-0.8520696055246548	-1.0
+1.2261930927092	-1.409652531811256	-0.9574978383458912	-0.1541851062716691	-0.6174128843489624	-0.11158158538996504	-1.2529628046745824	0.18017323736952684	0.13850840695623634	-0.5803456009038908	-1.0
+-0.7099434210201616	-0.05156342459302195	-0.13070247449713596	1.0122950638811103	0.8156845906793413	-0.3258448697514023	-0.2584707683063445	-0.890440463887327	-0.4581725076778308	3.4585968161148313	1.0
+-0.9704182178744319	2.6871612033392807	0.9312776144665534	-0.5331297226042839	-0.28529427255598	-0.9489437188256667	2.5099520677229528	-0.5465987844690795	-0.5904557741063047	0.04478654086972869	1.0
+-0.3501032412749507	-2.337417503090751	-0.39193394121557984	-1.4363442097827432	-0.7701440029913201	-0.751261832842014	-0.4729099359137562	-1.04884099046814	1.0984440899245669	-0.245925155686946	1.0
+0.8414256923875825	0.7408384241924824	-0.29871029318940123	0.1501840455008384	-0.09293132743622026	0.344470886220594	0.33251104369687506	0.3165900441554864	-0.22101348869903115	2.207083055966505	-1.0
+1.8243643293802945	-0.9480842974626666	-0.17907621643171537	0.6488732865451622	-2.415277929830738	0.5644460066626728	-1.2189514192824145	0.6491554919069787	-0.07814405455485418	1.712469914106728	1.0
+0.018121884498976865	1.2868566271279418	-0.9536770899957918	0.6249716158046588	-2.1079351824824952	1.2595831671666744	0.052295540824464054	-1.6935875397920435	0.7796546981181711	0.2515641406830677	1.0
+0.41680075873531786	-0.6575045305090914	1.4951196920790684	-0.2619036835541532	0.14332671267990338	0.40856170791345753	1.821563134570578	-0.6658197923569463	-1.029488426544686	-0.558484210951185	-1.0
+0.07169915686160251	0.3893148498230126	1.2381498220937583	0.5426349173834273	0.4176054720783757	-0.2490561286573809	1.7616558697903575	-0.7777266438374596	1.5845692748476627	0.24618496271496182	-1.0
+1.6197290353316953	-1.3890458396185827	-0.5136899421847392	0.6504889220137874	-0.686815870021942	0.15730681894997947	0.8258365757680074	0.9439084133192779	-0.32031813273183546	-0.130653139879242	-1.0
+1.1501890912387072	0.2904261887580579	1.160748238014778	0.9182095893938784	0.7519723402914408	0.5192382722793035	-1.605753253917022	-0.033091365718498744	-0.9964102453866795	1.4763015223058649	1.0
+-0.4425368790048132	1.3291162068337181	-1.385684240835405	-0.13919576433460026	-1.3723823577478322	0.002803519238126999	-0.2918292935710012	-1.8617821074490928	1.2818872727038764	0.7126490965775344	1.0
+-0.9245172984168462	0.40097526845531034	-1.20719783751236	0.6268169549322398	0.6811546164057318	1.2135602547880702	1.7332575914059876	-0.4947735292489333	0.6599942882559131	0.6714990303012663	-1.0
+-0.4141657753152125	0.013931884062029111	0.6418711256367103	2.2227303982634825	-0.3185297520381022	-0.7249530356667065	-0.4675991570875114	-0.47357745730860157	-0.07378020274486616	0.781370586381089	-1.0
+0.7934656446980911	-0.3971329454505919	0.09663161980912527	-1.6706243937903251	-0.4379895202325848	1.2577647190314776	-0.12603917503187925	2.271128614746993	-0.7626192245513409	-1.1627225171270834	1.0
+-1.2958611369121733	0.422911581084335	-0.13601396986120382	-1.398174609265351	-0.2803738374657816	2.2024455512226138	0.7787572061225748	-0.05927088042973824	-2.7470742895985643	0.1815634160148399	1.0
+0.29950210736329086	0.08361582073075834	1.857782860912462	0.5313699140284313	-0.09266556751861033	1.7685456712520204	1.1405056678571437	0.9961028356042567	-1.2375443219342774	-2.2097727877045124	1.0
+-0.20846892700574535	-0.35871014116976846	-0.6277248828430068	-0.5857047946451434	-0.7691722834512744	-0.7417231654487858	0.6940508344300708	-0.09522896898741048	0.37052873102232564	-1.070719442325414	-1.0
+-0.18979187817704551	-1.0725280734010154	0.6116726570430779	1.393065042332096	0.1953546483284296	1.0756236847005496	-0.4917823498818806	-0.9422425381459699	-0.14539920223680033	0.6362622660182599	-1.0
+0.04182810570369838	-0.21389287889052677	0.9221005619948534	-1.0145012312627588	1.8084032028340882	-0.8318502703849049	-0.7894887567609739	0.12701619644361684	-0.2387012305970065	1.9634211024617778	1.0
+0.10993177853936541	0.9685026229505048	-0.9683099812962441	-1.3241985366554574	0.05661601077254427	-2.041702766902053	-0.6492040463211859	-0.34881462586888945	-0.4965690407282463	0.8535335828323091	-1.0
+-0.643045183874729	-1.5882613451116485	0.2925567529725315	-0.05617111868065574	0.5317790146621224	-1.045246693166808	0.8774664641676921	-0.43158147314664974	-0.6642192227574251	2.2653967676368247	1.0
+-1.8769461514474393	0.8892307520480537	-0.3179449821771378	-0.4766879951427944	0.9604741760190169	3.4475126742848925	0.5304907477149375	0.8663997626708924	0.9246234205674352	0.7942625449144928	1.0
+0.8100030867232416	0.6141880273253673	2.2115273174497565	2.0201763881177	2.2299768416162977	-1.8889332764473823	-0.0457826600766222	-0.480478955880425	0.5145418501104667	-1.4761719350983622	1.0
+-0.42575171287638475	0.14058402603523037	-0.15851392021065866	-0.872302654977026	0.14648587809511712	-0.03357519221112542	-0.4080154539519419	0.08819553550108837	0.18335151677198827	0.6844372767706286	-1.0
+0.9458112722616882	-2.927304704348112	0.8014166734215404	-0.5663108224809246	1.0189672270394743	0.11324150930846172	0.5381268052348954	1.4988954072433454	1.1793068449570414	0.7155930932214164	1.0
+-1.080939823647883	-0.6179873072445213	-0.3516117183571954	-0.7443842297097287	-0.47508681280967346	0.8423678769062792	0.042190119056874774	-1.6199172256197443	-1.7230392999293536	0.33117003378724386	-1.0
+-0.8749915057800132	-1.4773998022894945	0.9256439164624767	0.029093660613648917	1.678392470149881	1.00620739655509	0.016557839903286888	0.15137696817955865	1.22020141180993	-1.1843477618121876	1.0
+0.3421770737151188	0.06430029220993591	-2.061498022104379	-0.38827991711771337	-0.13295242646086372	1.8307323417303063	-1.4732740619712523	1.0474075406899583	0.7556180978803672	0.15696581407372606	1.0
+0.8422578090621243	0.21319822408300687	0.6799541317450675	0.612648793673014	0.5952694519636597	-0.016001642670510897	0.2960826612014467	0.9049347694502661	-0.6010354787057175	0.5728107261751832	-1.0
+-0.6742405599653695	0.28133115394510155	-1.5547614876731002	-1.7393790793226862	-2.1605733664984617	-1.9595779545979073	1.5562981706347543	0.32728124011410537	0.486092600733593	-1.2414069599767943	1.0
+-0.5401858548179809	-0.10834784260106886	-0.8408623030902963	0.48073817168724686	-1.475534963196491	0.4171746410423148	1.5014811721094392	1.1179590978428897	-1.9376868674497207	-1.9697136001108857	1.0
+-1.017518838507636	1.1360786136783447	-2.0666179431033234	-1.4952775357482488	0.6728983149600875	-1.7646669442646186	-0.8516531247897089	-0.6053065628603461	-0.805287314139546	2.5335959087111886	1.0
+0.8332325727246073	-1.08700857434471	-0.032037029893050815	0.6695554604008281	-0.3575058700104287	-0.7368814695745995	-0.5966825940094563	-0.43947623292375165	0.21677041583681572	-1.2096548068912265	-1.0
+-0.9755548536722656	-0.125466779395108	-1.1430569955624306	-0.5396988359143291	-0.3674542417040041	0.5034836625654164	-1.7797751671497195	-1.4463339497228298	-0.5435201436060404	-0.4275059256463771	-1.0
+2.0631448749847663	-0.4111700191985071	-1.891606682178762	0.17977180277517338	-1.298540715115769	0.35551752752193405	0.09274956037327829	-1.3285237951341968	-1.2757732144524097	2.4438249851845635	1.0
+-0.38507447926985844	1.2989811339218187	-0.17385947328690715	-1.1684047852234463	-1.8219219743289388	1.1746905711623892	0.3906535323200916	0.9949376189760822	-0.5038829444383564	0.12121828145689056	1.0
+-1.3340145897738582	-0.40134564691807384	-1.035809984241503	0.07866249867006612	-0.1224765509407554	-0.5223796446578067	-0.8387447289475078	-1.2506844517244984	1.064831877984919	-1.734925892944343	1.0
+0.17238422867530945	0.10587185773538538	0.48087086224395265	-0.08869658792811017	-0.039457009161627275	-0.1525679565060907	0.20589152720837792	0.7867450333743096	-0.8199048542848791	0.41978802366657564	-1.0
+-0.9573067670235533	-1.017770320158939	-1.296034917766649	-0.85371799439649	1.2030979299837534	0.4138143760547242	-1.3451154438408859	0.27566056886642765	-0.730490758180352	-0.7898495137721478	-1.0
+2.898206192665544	1.581118423907682	0.2546897614656763	0.5845354927441562	1.2971464008101792	-0.5138276703707552	-0.7868486794299897	0.21748307116911922	-0.05584787328109693	0.7686846431581891	1.0
+0.7175283358464812	1.2965505381984608	-0.35458486574299486	0.30134810389252903	0.5087450441097501	1.6558199248490792	-0.6285283185235373	-0.865350802899046	0.9688869843141352	1.2843833844998855	-1.0
+0.7708144857819786	1.3687101235777408	0.6578142121716842	-0.9321575759441507	0.29475161885456724	0.10073964563304727	0.7910324771639785	-0.8278180302853848	-0.4999911205918866	0.9521361936816606	-1.0
+0.5855210670667337	0.3643353296774034	0.9244198448430797	0.12427879489590012	1.3065408647235515	-0.4274612752821048	-0.710357806772508	0.08673275328357181	1.6634750097378082	0.14836066686102148	-1.0
+-0.52337299276143	-0.6245437813002771	-0.8209808795705086	-1.0706569628754747	-0.961968164552676	-0.6152142476185017	0.25000879229760875	-0.6927355914290916	0.7906049831554218	0.9406114771862971	-1.0
+0.11067652064372907	0.0801603914440327	0.06735076268881417	0.14509497472688596	1.3105465081512713	-0.2889018186210855	-0.08386604949329904	1.5798217697783816	0.34897645936960003	0.9142473796752125	-1.0
+-0.25065505333995647	-1.7773567748390031	-0.8546117717920864	1.2984193443944538	1.508473699859843	0.13920799755829105	1.3627940878365463	0.8447186821681648	-0.7977028622292253	1.3456585334724918	1.0
+0.5258908184900898	-0.887097003955972	0.257253592463951	0.2150704430734008	0.4786940539255531	1.5852181114834052	-1.5521676208283357	1.7065717754284204	-1.0851290057726983