Mercurial > repos > bgruening > trim_galore
changeset 15:084bbd8ba7b8 draft
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/trim_galore commit 10a9de2adae04249830c880cf0c55edaa196f3f7
line wrap: on
line diff
--- a/test-data/bwa-mem-fastq2.fq Thu Jun 01 12:15:10 2017 -0400 +++ b/test-data/bwa-mem-fastq2.fq Tue Jul 30 06:26:49 2019 -0400 @@ -394,7 +394,3 @@ ATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGGCGACCATACTTACTAAAGTGTGTTAATTAATTAATGCTTGTAGGACTGTCTCTTATACACATT + CCCCCFFFFFFCGGGGGGGGGGHHHHHHHHHFFHHHHGGGGGHFFFHHFHHHHHHHHHHHHHHHGFEGGGHGEDFCDFHGHFG@@DGGHHHHHHGGGGCGGGGGEHGGCGBB?CF99EGFGGFGG?D9CFFFF/BBFFFFFEF9BFFAFFFFEFFFFFFFFFFFFFFFFFFFFF.FFBBFFFFFFFFFFFF-9;;;BFFFFFB9BFBFBFABFFEFFFFFFFFFF::BFFBFFFF.9//;FFFFF/BFFB/ -@M01368:8:000000000-A3GHV:1:1114:9184:6959/2 -AAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCCTGTCTCTTA -+ -CCCCBFFFFFFFGGGGGGGGGGHHHHHHHHHHHHHHHHHHHHHHHHHHGHHHHHHEHIHHGGGGHHHHHHHHHHHHHGHHHHHHHHGGGGGHHFHHHHHBGHHHHHHHHHHHHHHHHHGHHHHHGGGGGHHHHGHHHHHHHHHHHHHHHHHGHGHGHHGGGGCFFFFFFFFFFFFFFFFFFFFFFFFFF.CFFFFAF=D=EAEFFF0B:0AF-DAFBFFFFFFFFFBFFFFFFFFFFBFFFEFF9B900B0
--- a/test-data/paired_collection_example_results3.txt Thu Jun 01 12:15:10 2017 -0400 +++ b/test-data/paired_collection_example_results3.txt Tue Jul 30 06:26:49 2019 -0400 @@ -3,8 +3,9 @@ ========================== Input filename: input_1.fastq Trimming mode: paired-end -Trim Galore version: 0.4.3 -Cutadapt version: 1.13 +Trim Galore version: 0.6.3 +Cutadapt version: 2.4 +Number of cores used for trimming: 1 Quality Phred score cutoff: 20 Quality encoding type selected: ASCII+33 Adapter sequence: 'CTGTCTCTTATA' (Nextera Transposase sequence; auto-detected) @@ -15,10 +16,10 @@ Length cut-off for read 2: 35 bp (default) -This is cutadapt 1.13 with Python 3.5.3 -Command line parameters: -f fastq -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_1.fastq -Trimming 1 adapter with at most 10.0% errors in single-end mode ... -Finished in 0.01 s (101 us/read; 0.59 M reads/minute). +This is cutadapt 2.4 with Python 3.7.3 +Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_1.fastq +Processing reads on 1 core in single-end mode ... +Finished in 0.01 s (72 us/read; 0.83 M reads/minute). === Summary === @@ -75,7 +76,6 @@ 80 1 0.0 1 1 86 1 0.0 1 1 - RUN STATISTICS FOR INPUT FILE: input_1.fastq ============================================= 99 sequences processed in total @@ -85,8 +85,9 @@ ========================== Input filename: input_2.fastq Trimming mode: paired-end -Trim Galore version: 0.4.3 -Cutadapt version: 1.13 +Trim Galore version: 0.6.3 +Cutadapt version: 2.4 +Number of cores used for trimming: 1 Quality Phred score cutoff: 20 Quality encoding type selected: ASCII+33 Adapter sequence: 'CTGTCTCTTATA' (Nextera Transposase sequence; auto-detected) @@ -97,43 +98,43 @@ Length cut-off for read 2: 35 bp (default) -This is cutadapt 1.13 with Python 3.5.3 -Command line parameters: -f fastq -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_2.fastq -Trimming 1 adapter with at most 10.0% errors in single-end mode ... -Finished in 0.01 s (100 us/read; 0.60 M reads/minute). +This is cutadapt 2.4 with Python 3.7.3 +Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_2.fastq +Processing reads on 1 core in single-end mode ... +Finished in 0.01 s (55 us/read; 1.08 M reads/minute). === Summary === -Total reads processed: 100 -Reads with adapters: 59 (59.0%) -Reads written (passing filters): 100 (100.0%) +Total reads processed: 99 +Reads with adapters: 58 (58.6%) +Reads written (passing filters): 99 (100.0%) -Total basepairs processed: 25,100 bp -Quality-trimmed: 746 bp (3.0%) -Total written (filtered): 23,276 bp (92.7%) +Total basepairs processed: 24,849 bp +Quality-trimmed: 745 bp (3.0%) +Total written (filtered): 23,035 bp (92.7%) === Adapter 1 === -Sequence: CTGTCTCTTATA; Type: regular 3'; Length: 12; Trimmed: 59 times. +Sequence: CTGTCTCTTATA; Type: regular 3'; Length: 12; Trimmed: 58 times. No. of allowed errors: 0-9 bp: 0; 10-12 bp: 1 Bases preceding removed adapters: - A: 11.9% - C: 39.0% - G: 8.5% - T: 40.7% + A: 12.1% + C: 37.9% + G: 8.6% + T: 41.4% none/other: 0.0% Overview of removed sequences length count expect max.err error counts -1 16 25.0 0 16 +1 16 24.8 0 16 2 7 6.2 0 7 -3 1 1.6 0 1 +3 1 1.5 0 1 4 2 0.4 0 2 6 2 0.0 0 2 -9 2 0.0 0 2 +9 1 0.0 0 1 10 1 0.0 1 1 13 1 0.0 1 1 14 2 0.0 1 2 @@ -160,10 +161,9 @@ 67 1 0.0 1 1 80 1 0.0 1 1 - RUN STATISTICS FOR INPUT FILE: input_2.fastq ============================================= -100 sequences processed in total +99 sequences processed in total Total number of sequences analysed for the sequence pair length validation: 99
--- a/test-data/paired_collection_example_results3gz.txt Thu Jun 01 12:15:10 2017 -0400 +++ b/test-data/paired_collection_example_results3gz.txt Tue Jul 30 06:26:49 2019 -0400 @@ -3,8 +3,9 @@ ========================== Input filename: input_1.fastq.gz Trimming mode: paired-end -Trim Galore version: 0.4.3 -Cutadapt version: 1.13 +Trim Galore version: 0.6.3 +Cutadapt version: 2.4 +Number of cores used for trimming: 1 Quality Phred score cutoff: 20 Quality encoding type selected: ASCII+33 Adapter sequence: 'CTGTCTCTTATA' (Nextera Transposase sequence; auto-detected) @@ -16,10 +17,10 @@ Output file will be GZIP compressed -This is cutadapt 1.13 with Python 3.5.3 -Command line parameters: -f fastq -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_1.fastq.gz -Trimming 1 adapter with at most 10.0% errors in single-end mode ... -Finished in 0.01 s (101 us/read; 0.59 M reads/minute). +This is cutadapt 2.4 with Python 3.7.3 +Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_1.fastq.gz +Processing reads on 1 core in single-end mode ... +Finished in 0.02 s (176 us/read; 0.34 M reads/minute). === Summary === @@ -76,7 +77,6 @@ 80 1 0.0 1 1 86 1 0.0 1 1 - RUN STATISTICS FOR INPUT FILE: input_1.fastq.gz ============================================= 99 sequences processed in total @@ -86,8 +86,9 @@ ========================== Input filename: input_2.fastq.gz Trimming mode: paired-end -Trim Galore version: 0.4.3 -Cutadapt version: 1.13 +Trim Galore version: 0.6.3 +Cutadapt version: 2.4 +Number of cores used for trimming: 1 Quality Phred score cutoff: 20 Quality encoding type selected: ASCII+33 Adapter sequence: 'CTGTCTCTTATA' (Nextera Transposase sequence; auto-detected) @@ -99,43 +100,43 @@ Output file will be GZIP compressed -This is cutadapt 1.13 with Python 3.5.3 -Command line parameters: -f fastq -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_2.fastq.gz -Trimming 1 adapter with at most 10.0% errors in single-end mode ... -Finished in 0.01 s (100 us/read; 0.60 M reads/minute). +This is cutadapt 2.4 with Python 3.7.3 +Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_2.fastq.gz +Processing reads on 1 core in single-end mode ... +Finished in 0.02 s (169 us/read; 0.36 M reads/minute). === Summary === -Total reads processed: 100 -Reads with adapters: 59 (59.0%) -Reads written (passing filters): 100 (100.0%) +Total reads processed: 99 +Reads with adapters: 58 (58.6%) +Reads written (passing filters): 99 (100.0%) -Total basepairs processed: 25,100 bp -Quality-trimmed: 746 bp (3.0%) -Total written (filtered): 23,276 bp (92.7%) +Total basepairs processed: 24,849 bp +Quality-trimmed: 745 bp (3.0%) +Total written (filtered): 23,035 bp (92.7%) === Adapter 1 === -Sequence: CTGTCTCTTATA; Type: regular 3'; Length: 12; Trimmed: 59 times. +Sequence: CTGTCTCTTATA; Type: regular 3'; Length: 12; Trimmed: 58 times. No. of allowed errors: 0-9 bp: 0; 10-12 bp: 1 Bases preceding removed adapters: - A: 11.9% - C: 39.0% - G: 8.5% - T: 40.7% + A: 12.1% + C: 37.9% + G: 8.6% + T: 41.4% none/other: 0.0% Overview of removed sequences length count expect max.err error counts -1 16 25.0 0 16 +1 16 24.8 0 16 2 7 6.2 0 7 -3 1 1.6 0 1 +3 1 1.5 0 1 4 2 0.4 0 2 6 2 0.0 0 2 -9 2 0.0 0 2 +9 1 0.0 0 1 10 1 0.0 1 1 13 1 0.0 1 1 14 2 0.0 1 2 @@ -162,10 +163,9 @@ 67 1 0.0 1 1 80 1 0.0 1 1 - RUN STATISTICS FOR INPUT FILE: input_2.fastq.gz ============================================= -100 sequences processed in total +99 sequences processed in total Total number of sequences analysed for the sequence pair length validation: 99
--- a/test-data/paired_example_results2.txt Thu Jun 01 12:15:10 2017 -0400 +++ b/test-data/paired_example_results2.txt Tue Jul 30 06:26:49 2019 -0400 @@ -3,8 +3,9 @@ ========================== Input filename: input_1.fastq Trimming mode: paired-end -Trim Galore version: 0.4.3 -Cutadapt version: 1.13 +Trim Galore version: 0.6.3 +Cutadapt version: 2.4 +Number of cores used for trimming: 1 Quality Phred score cutoff: 20 Quality encoding type selected: ASCII+33 Adapter sequence: 'CTGTCTCTTATA' (Nextera Transposase sequence; auto-detected) @@ -13,10 +14,10 @@ Minimum required sequence length for both reads before a sequence pair gets removed: 20 bp -This is cutadapt 1.13 with Python 3.5.3 -Command line parameters: -f fastq -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_1.fastq -Trimming 1 adapter with at most 10.0% errors in single-end mode ... -Finished in 0.01 s (101 us/read; 0.59 M reads/minute). +This is cutadapt 2.4 with Python 3.7.3 +Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_1.fastq +Processing reads on 1 core in single-end mode ... +Finished in 0.01 s (75 us/read; 0.80 M reads/minute). === Summary === @@ -73,7 +74,6 @@ 80 1 0.0 1 1 86 1 0.0 1 1 - RUN STATISTICS FOR INPUT FILE: input_1.fastq ============================================= 99 sequences processed in total @@ -83,8 +83,9 @@ ========================== Input filename: input_2.fastq Trimming mode: paired-end -Trim Galore version: 0.4.3 -Cutadapt version: 1.13 +Trim Galore version: 0.6.3 +Cutadapt version: 2.4 +Number of cores used for trimming: 1 Quality Phred score cutoff: 20 Quality encoding type selected: ASCII+33 Adapter sequence: 'CTGTCTCTTATA' (Nextera Transposase sequence; auto-detected) @@ -93,43 +94,43 @@ Minimum required sequence length for both reads before a sequence pair gets removed: 20 bp -This is cutadapt 1.13 with Python 3.5.3 -Command line parameters: -f fastq -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_2.fastq -Trimming 1 adapter with at most 10.0% errors in single-end mode ... -Finished in 0.01 s (100 us/read; 0.60 M reads/minute). +This is cutadapt 2.4 with Python 3.7.3 +Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_2.fastq +Processing reads on 1 core in single-end mode ... +Finished in 0.00 s (50 us/read; 1.19 M reads/minute). === Summary === -Total reads processed: 100 -Reads with adapters: 59 (59.0%) -Reads written (passing filters): 100 (100.0%) +Total reads processed: 99 +Reads with adapters: 58 (58.6%) +Reads written (passing filters): 99 (100.0%) -Total basepairs processed: 25,100 bp -Quality-trimmed: 746 bp (3.0%) -Total written (filtered): 23,276 bp (92.7%) +Total basepairs processed: 24,849 bp +Quality-trimmed: 745 bp (3.0%) +Total written (filtered): 23,035 bp (92.7%) === Adapter 1 === -Sequence: CTGTCTCTTATA; Type: regular 3'; Length: 12; Trimmed: 59 times. +Sequence: CTGTCTCTTATA; Type: regular 3'; Length: 12; Trimmed: 58 times. No. of allowed errors: 0-9 bp: 0; 10-12 bp: 1 Bases preceding removed adapters: - A: 11.9% - C: 39.0% - G: 8.5% - T: 40.7% + A: 12.1% + C: 37.9% + G: 8.6% + T: 41.4% none/other: 0.0% Overview of removed sequences length count expect max.err error counts -1 16 25.0 0 16 +1 16 24.8 0 16 2 7 6.2 0 7 -3 1 1.6 0 1 +3 1 1.5 0 1 4 2 0.4 0 2 6 2 0.0 0 2 -9 2 0.0 0 2 +9 1 0.0 0 1 10 1 0.0 1 1 13 1 0.0 1 1 14 2 0.0 1 2 @@ -156,10 +157,9 @@ 67 1 0.0 1 1 80 1 0.0 1 1 - RUN STATISTICS FOR INPUT FILE: input_2.fastq ============================================= -100 sequences processed in total +99 sequences processed in total Total number of sequences analysed for the sequence pair length validation: 99
--- a/test-data/paired_example_results2gz.txt Thu Jun 01 12:15:10 2017 -0400 +++ b/test-data/paired_example_results2gz.txt Tue Jul 30 06:26:49 2019 -0400 @@ -3,8 +3,9 @@ ========================== Input filename: input_1.fastq.gz Trimming mode: paired-end -Trim Galore version: 0.4.3 -Cutadapt version: 1.13 +Trim Galore version: 0.6.3 +Cutadapt version: 2.4 +Number of cores used for trimming: 1 Quality Phred score cutoff: 20 Quality encoding type selected: ASCII+33 Adapter sequence: 'CTGTCTCTTATA' (Nextera Transposase sequence; auto-detected) @@ -14,10 +15,10 @@ Output file will be GZIP compressed -This is cutadapt 1.13 with Python 3.5.3 -Command line parameters: -f fastq -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_1.fastq.gz -Trimming 1 adapter with at most 10.0% errors in single-end mode ... -Finished in 0.01 s (101 us/read; 0.59 M reads/minute). +This is cutadapt 2.4 with Python 3.7.3 +Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_1.fastq.gz +Processing reads on 1 core in single-end mode ... +Finished in 0.03 s (287 us/read; 0.21 M reads/minute). === Summary === @@ -74,7 +75,6 @@ 80 1 0.0 1 1 86 1 0.0 1 1 - RUN STATISTICS FOR INPUT FILE: input_1.fastq.gz ============================================= 99 sequences processed in total @@ -84,8 +84,9 @@ ========================== Input filename: input_2.fastq.gz Trimming mode: paired-end -Trim Galore version: 0.4.3 -Cutadapt version: 1.13 +Trim Galore version: 0.6.3 +Cutadapt version: 2.4 +Number of cores used for trimming: 1 Quality Phred score cutoff: 20 Quality encoding type selected: ASCII+33 Adapter sequence: 'CTGTCTCTTATA' (Nextera Transposase sequence; auto-detected) @@ -95,43 +96,43 @@ Output file will be GZIP compressed -This is cutadapt 1.13 with Python 3.5.3 -Command line parameters: -f fastq -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_2.fastq.gz -Trimming 1 adapter with at most 10.0% errors in single-end mode ... -Finished in 0.01 s (100 us/read; 0.60 M reads/minute). +This is cutadapt 2.4 with Python 3.7.3 +Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_2.fastq.gz +Processing reads on 1 core in single-end mode ... +Finished in 0.02 s (170 us/read; 0.35 M reads/minute). === Summary === -Total reads processed: 100 -Reads with adapters: 59 (59.0%) -Reads written (passing filters): 100 (100.0%) +Total reads processed: 99 +Reads with adapters: 58 (58.6%) +Reads written (passing filters): 99 (100.0%) -Total basepairs processed: 25,100 bp -Quality-trimmed: 746 bp (3.0%) -Total written (filtered): 23,276 bp (92.7%) +Total basepairs processed: 24,849 bp +Quality-trimmed: 745 bp (3.0%) +Total written (filtered): 23,035 bp (92.7%) === Adapter 1 === -Sequence: CTGTCTCTTATA; Type: regular 3'; Length: 12; Trimmed: 59 times. +Sequence: CTGTCTCTTATA; Type: regular 3'; Length: 12; Trimmed: 58 times. No. of allowed errors: 0-9 bp: 0; 10-12 bp: 1 Bases preceding removed adapters: - A: 11.9% - C: 39.0% - G: 8.5% - T: 40.7% + A: 12.1% + C: 37.9% + G: 8.6% + T: 41.4% none/other: 0.0% Overview of removed sequences length count expect max.err error counts -1 16 25.0 0 16 +1 16 24.8 0 16 2 7 6.2 0 7 -3 1 1.6 0 1 +3 1 1.5 0 1 4 2 0.4 0 2 6 2 0.0 0 2 -9 2 0.0 0 2 +9 1 0.0 0 1 10 1 0.0 1 1 13 1 0.0 1 1 14 2 0.0 1 2 @@ -158,10 +159,9 @@ 67 1 0.0 1 1 80 1 0.0 1 1 - RUN STATISTICS FOR INPUT FILE: input_2.fastq.gz ============================================= -100 sequences processed in total +99 sequences processed in total Total number of sequences analysed for the sequence pair length validation: 99
--- a/test-data/sanger_full_range_report_results1.txt Thu Jun 01 12:15:10 2017 -0400 +++ b/test-data/sanger_full_range_report_results1.txt Tue Jul 30 06:26:49 2019 -0400 @@ -3,8 +3,9 @@ ========================== Input filename: input_1.fastq Trimming mode: single-end -Trim Galore version: 0.4.3 -Cutadapt version: 1.13 +Trim Galore version: 0.6.3 +Cutadapt version: 2.4 +Number of cores used for trimming: 1 Quality Phred score cutoff: 20 Quality encoding type selected: ASCII+33 Adapter sequence: 'AGATCGGAAGAGC' (Illumina TruSeq, Sanger iPCR; default (inconclusive auto-detection)) @@ -13,10 +14,10 @@ Minimum required sequence length before a sequence gets removed: 20 bp -This is cutadapt 1.13 with Python 3.5.3 -Command line parameters: -f fastq -e 0.1 -q 20 -O 1 -a AGATCGGAAGAGC input_1.fastq -Trimming 1 adapter with at most 10.0% errors in single-end mode ... -Finished in 0.01 s (5000 us/read; 0.01 M reads/minute). +This is cutadapt 2.4 with Python 3.7.3 +Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a AGATCGGAAGAGC input_1.fastq +Processing reads on 1 core in single-end mode ... +Finished in 0.00 s (1608 us/read; 0.04 M reads/minute). === Summary === @@ -46,7 +47,6 @@ length count expect max.err error counts 1 1 0.5 0 1 - RUN STATISTICS FOR INPUT FILE: input_1.fastq ============================================= 2 sequences processed in total
--- a/test-data/sanger_full_range_report_results1gz.txt Thu Jun 01 12:15:10 2017 -0400 +++ b/test-data/sanger_full_range_report_results1gz.txt Tue Jul 30 06:26:49 2019 -0400 @@ -3,8 +3,9 @@ ========================== Input filename: input_1.fastq.gz Trimming mode: single-end -Trim Galore version: 0.4.3 -Cutadapt version: 1.13 +Trim Galore version: 0.6.3 +Cutadapt version: 2.4 +Number of cores used for trimming: 1 Quality Phred score cutoff: 20 Quality encoding type selected: ASCII+33 Adapter sequence: 'AGATCGGAAGAGC' (Illumina TruSeq, Sanger iPCR; default (inconclusive auto-detection)) @@ -14,10 +15,10 @@ Output file will be GZIP compressed -This is cutadapt 1.13 with Python 3.5.3 -Command line parameters: -f fastq -e 0.1 -q 20 -O 1 -a AGATCGGAAGAGC input_1.fastq.gz -Trimming 1 adapter with at most 10.0% errors in single-end mode ... -Finished in 0.01 s (5000 us/read; 0.01 M reads/minute). +This is cutadapt 2.4 with Python 3.7.3 +Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a AGATCGGAAGAGC input_1.fastq.gz +Processing reads on 1 core in single-end mode ... +Finished in 0.02 s (7871 us/read; 0.01 M reads/minute). === Summary === @@ -47,7 +48,6 @@ length count expect max.err error counts 1 1 0.5 0 1 - RUN STATISTICS FOR INPUT FILE: input_1.fastq.gz ============================================= 2 sequences processed in total
--- a/trim_galore.xml Thu Jun 01 12:15:10 2017 -0400 +++ b/trim_galore.xml Tue Jul 30 06:26:49 2019 -0400 @@ -1,5 +1,5 @@ -<tool id="trim_galore" name="Trim Galore!" version="0.4.3.1" profile="17.01"> - <!-- Wrapper compatible with Trim Galore! version 0.4.3 --> +<tool id="trim_galore" name="Trim Galore!" version="0.6.3" profile="17.01"> + <!-- Wrapper compatible with Trim Galore! version 0.6.3 --> <description>Quality and adapter trimmer of reads</description> <macros> <macro name="adapter_trimming"> @@ -43,7 +43,7 @@ </macro> </macros> <requirements> - <requirement type="package" version="0.4.3">trim-galore</requirement> + <requirement type="package" version="0.6.3">trim-galore</requirement> </requirements> <version_command> trim_galore --version