changeset 15:084bbd8ba7b8 draft default tip

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/trim_galore commit 10a9de2adae04249830c880cf0c55edaa196f3f7
author bgruening
date Tue, 30 Jul 2019 06:26:49 -0400
parents 949f01671246
children
files test-data/bwa-mem-fastq2.fq test-data/bwa-mem-fastq2.fq.gz test-data/paired_collection_example_pair1_results3.fastq.gz test-data/paired_collection_example_results3.txt test-data/paired_collection_example_results3gz.txt test-data/paired_collection_example_unpair1_results3.fastq.gz test-data/paired_example_pair1_results2.fastq.gz test-data/paired_example_pair2_results2.fastq.gz test-data/paired_example_results2.txt test-data/paired_example_results2gz.txt test-data/sanger_full_range_report_results1.txt test-data/sanger_full_range_report_results1gz.txt test-data/sanger_full_range_results1.fastq.gz test-data/sanger_full_range_results2.fastq.gz test-data/sanger_full_range_results3.fastq.gz trim_galore.xml
diffstat 16 files changed, 133 insertions(+), 137 deletions(-) [+]
line wrap: on
line diff
--- a/test-data/bwa-mem-fastq2.fq	Thu Jun 01 12:15:10 2017 -0400
+++ b/test-data/bwa-mem-fastq2.fq	Tue Jul 30 06:26:49 2019 -0400
@@ -394,7 +394,3 @@
 ATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGGCGACCATACTTACTAAAGTGTGTTAATTAATTAATGCTTGTAGGACTGTCTCTTATACACATT
 +
 CCCCCFFFFFFCGGGGGGGGGGHHHHHHHHHFFHHHHGGGGGHFFFHHFHHHHHHHHHHHHHHHGFEGGGHGEDFCDFHGHFG@@DGGHHHHHHGGGGCGGGGGEHGGCGBB?CF99EGFGGFGG?D9CFFFF/BBFFFFFEF9BFFAFFFFEFFFFFFFFFFFFFFFFFFFFF.FFBBFFFFFFFFFFFF-9;;;BFFFFFB9BFBFBFABFFEFFFFFFFFFF::BFFBFFFF.9//;FFFFF/BFFB/
-@M01368:8:000000000-A3GHV:1:1114:9184:6959/2
-AAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCCTGTCTCTTA
-+
-CCCCBFFFFFFFGGGGGGGGGGHHHHHHHHHHHHHHHHHHHHHHHHHHGHHHHHHEHIHHGGGGHHHHHHHHHHHHHGHHHHHHHHGGGGGHHFHHHHHBGHHHHHHHHHHHHHHHHHGHHHHHGGGGGHHHHGHHHHHHHHHHHHHHHHHGHGHGHHGGGGCFFFFFFFFFFFFFFFFFFFFFFFFFF.CFFFFAF=D=EAEFFF0B:0AF-DAFBFFFFFFFFFBFFFFFFFFFFBFFFEFF9B900B0
Binary file test-data/bwa-mem-fastq2.fq.gz has changed
Binary file test-data/paired_collection_example_pair1_results3.fastq.gz has changed
--- a/test-data/paired_collection_example_results3.txt	Thu Jun 01 12:15:10 2017 -0400
+++ b/test-data/paired_collection_example_results3.txt	Tue Jul 30 06:26:49 2019 -0400
@@ -3,8 +3,9 @@
 ==========================
 Input filename: input_1.fastq
 Trimming mode: paired-end
-Trim Galore version: 0.4.3
-Cutadapt version: 1.13
+Trim Galore version: 0.6.3
+Cutadapt version: 2.4
+Number of cores used for trimming: 1
 Quality Phred score cutoff: 20
 Quality encoding type selected: ASCII+33
 Adapter sequence: 'CTGTCTCTTATA' (Nextera Transposase sequence; auto-detected)
@@ -15,10 +16,10 @@
 Length cut-off for read 2: 35 bp (default)
 
 
-This is cutadapt 1.13 with Python 3.5.3
-Command line parameters: -f fastq -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_1.fastq
-Trimming 1 adapter with at most 10.0% errors in single-end mode ...
-Finished in 0.01 s (101 us/read; 0.59 M reads/minute).
+This is cutadapt 2.4 with Python 3.7.3
+Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_1.fastq
+Processing reads on 1 core in single-end mode ...
+Finished in 0.01 s (72 us/read; 0.83 M reads/minute).
 
 === Summary ===
 
@@ -75,7 +76,6 @@
 80	1	0.0	1	1
 86	1	0.0	1	1
 
-
 RUN STATISTICS FOR INPUT FILE: input_1.fastq
 =============================================
 99 sequences processed in total
@@ -85,8 +85,9 @@
 ==========================
 Input filename: input_2.fastq
 Trimming mode: paired-end
-Trim Galore version: 0.4.3
-Cutadapt version: 1.13
+Trim Galore version: 0.6.3
+Cutadapt version: 2.4
+Number of cores used for trimming: 1
 Quality Phred score cutoff: 20
 Quality encoding type selected: ASCII+33
 Adapter sequence: 'CTGTCTCTTATA' (Nextera Transposase sequence; auto-detected)
@@ -97,43 +98,43 @@
 Length cut-off for read 2: 35 bp (default)
 
 
-This is cutadapt 1.13 with Python 3.5.3
-Command line parameters: -f fastq -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_2.fastq
-Trimming 1 adapter with at most 10.0% errors in single-end mode ...
-Finished in 0.01 s (100 us/read; 0.60 M reads/minute).
+This is cutadapt 2.4 with Python 3.7.3
+Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_2.fastq
+Processing reads on 1 core in single-end mode ...
+Finished in 0.01 s (55 us/read; 1.08 M reads/minute).
 
 === Summary ===
 
-Total reads processed:                     100
-Reads with adapters:                        59 (59.0%)
-Reads written (passing filters):           100 (100.0%)
+Total reads processed:                      99
+Reads with adapters:                        58 (58.6%)
+Reads written (passing filters):            99 (100.0%)
 
-Total basepairs processed:        25,100 bp
-Quality-trimmed:                     746 bp (3.0%)
-Total written (filtered):         23,276 bp (92.7%)
+Total basepairs processed:        24,849 bp
+Quality-trimmed:                     745 bp (3.0%)
+Total written (filtered):         23,035 bp (92.7%)
 
 === Adapter 1 ===
 
-Sequence: CTGTCTCTTATA; Type: regular 3'; Length: 12; Trimmed: 59 times.
+Sequence: CTGTCTCTTATA; Type: regular 3'; Length: 12; Trimmed: 58 times.
 
 No. of allowed errors:
 0-9 bp: 0; 10-12 bp: 1
 
 Bases preceding removed adapters:
-  A: 11.9%
-  C: 39.0%
-  G: 8.5%
-  T: 40.7%
+  A: 12.1%
+  C: 37.9%
+  G: 8.6%
+  T: 41.4%
   none/other: 0.0%
 
 Overview of removed sequences
 length	count	expect	max.err	error counts
-1	16	25.0	0	16
+1	16	24.8	0	16
 2	7	6.2	0	7
-3	1	1.6	0	1
+3	1	1.5	0	1
 4	2	0.4	0	2
 6	2	0.0	0	2
-9	2	0.0	0	2
+9	1	0.0	0	1
 10	1	0.0	1	1
 13	1	0.0	1	1
 14	2	0.0	1	2
@@ -160,10 +161,9 @@
 67	1	0.0	1	1
 80	1	0.0	1	1
 
-
 RUN STATISTICS FOR INPUT FILE: input_2.fastq
 =============================================
-100 sequences processed in total
+99 sequences processed in total
 
 Total number of sequences analysed for the sequence pair length validation: 99
 
--- a/test-data/paired_collection_example_results3gz.txt	Thu Jun 01 12:15:10 2017 -0400
+++ b/test-data/paired_collection_example_results3gz.txt	Tue Jul 30 06:26:49 2019 -0400
@@ -3,8 +3,9 @@
 ==========================
 Input filename: input_1.fastq.gz
 Trimming mode: paired-end
-Trim Galore version: 0.4.3
-Cutadapt version: 1.13
+Trim Galore version: 0.6.3
+Cutadapt version: 2.4
+Number of cores used for trimming: 1
 Quality Phred score cutoff: 20
 Quality encoding type selected: ASCII+33
 Adapter sequence: 'CTGTCTCTTATA' (Nextera Transposase sequence; auto-detected)
@@ -16,10 +17,10 @@
 Output file will be GZIP compressed
 
 
-This is cutadapt 1.13 with Python 3.5.3
-Command line parameters: -f fastq -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_1.fastq.gz
-Trimming 1 adapter with at most 10.0% errors in single-end mode ...
-Finished in 0.01 s (101 us/read; 0.59 M reads/minute).
+This is cutadapt 2.4 with Python 3.7.3
+Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_1.fastq.gz
+Processing reads on 1 core in single-end mode ...
+Finished in 0.02 s (176 us/read; 0.34 M reads/minute).
 
 === Summary ===
 
@@ -76,7 +77,6 @@
 80	1	0.0	1	1
 86	1	0.0	1	1
 
-
 RUN STATISTICS FOR INPUT FILE: input_1.fastq.gz
 =============================================
 99 sequences processed in total
@@ -86,8 +86,9 @@
 ==========================
 Input filename: input_2.fastq.gz
 Trimming mode: paired-end
-Trim Galore version: 0.4.3
-Cutadapt version: 1.13
+Trim Galore version: 0.6.3
+Cutadapt version: 2.4
+Number of cores used for trimming: 1
 Quality Phred score cutoff: 20
 Quality encoding type selected: ASCII+33
 Adapter sequence: 'CTGTCTCTTATA' (Nextera Transposase sequence; auto-detected)
@@ -99,43 +100,43 @@
 Output file will be GZIP compressed
 
 
-This is cutadapt 1.13 with Python 3.5.3
-Command line parameters: -f fastq -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_2.fastq.gz
-Trimming 1 adapter with at most 10.0% errors in single-end mode ...
-Finished in 0.01 s (100 us/read; 0.60 M reads/minute).
+This is cutadapt 2.4 with Python 3.7.3
+Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_2.fastq.gz
+Processing reads on 1 core in single-end mode ...
+Finished in 0.02 s (169 us/read; 0.36 M reads/minute).
 
 === Summary ===
 
-Total reads processed:                     100
-Reads with adapters:                        59 (59.0%)
-Reads written (passing filters):           100 (100.0%)
+Total reads processed:                      99
+Reads with adapters:                        58 (58.6%)
+Reads written (passing filters):            99 (100.0%)
 
-Total basepairs processed:        25,100 bp
-Quality-trimmed:                     746 bp (3.0%)
-Total written (filtered):         23,276 bp (92.7%)
+Total basepairs processed:        24,849 bp
+Quality-trimmed:                     745 bp (3.0%)
+Total written (filtered):         23,035 bp (92.7%)
 
 === Adapter 1 ===
 
-Sequence: CTGTCTCTTATA; Type: regular 3'; Length: 12; Trimmed: 59 times.
+Sequence: CTGTCTCTTATA; Type: regular 3'; Length: 12; Trimmed: 58 times.
 
 No. of allowed errors:
 0-9 bp: 0; 10-12 bp: 1
 
 Bases preceding removed adapters:
-  A: 11.9%
-  C: 39.0%
-  G: 8.5%
-  T: 40.7%
+  A: 12.1%
+  C: 37.9%
+  G: 8.6%
+  T: 41.4%
   none/other: 0.0%
 
 Overview of removed sequences
 length	count	expect	max.err	error counts
-1	16	25.0	0	16
+1	16	24.8	0	16
 2	7	6.2	0	7
-3	1	1.6	0	1
+3	1	1.5	0	1
 4	2	0.4	0	2
 6	2	0.0	0	2
-9	2	0.0	0	2
+9	1	0.0	0	1
 10	1	0.0	1	1
 13	1	0.0	1	1
 14	2	0.0	1	2
@@ -162,10 +163,9 @@
 67	1	0.0	1	1
 80	1	0.0	1	1
 
-
 RUN STATISTICS FOR INPUT FILE: input_2.fastq.gz
 =============================================
-100 sequences processed in total
+99 sequences processed in total
 
 Total number of sequences analysed for the sequence pair length validation: 99
 
Binary file test-data/paired_collection_example_unpair1_results3.fastq.gz has changed
Binary file test-data/paired_example_pair1_results2.fastq.gz has changed
Binary file test-data/paired_example_pair2_results2.fastq.gz has changed
--- a/test-data/paired_example_results2.txt	Thu Jun 01 12:15:10 2017 -0400
+++ b/test-data/paired_example_results2.txt	Tue Jul 30 06:26:49 2019 -0400
@@ -3,8 +3,9 @@
 ==========================
 Input filename: input_1.fastq
 Trimming mode: paired-end
-Trim Galore version: 0.4.3
-Cutadapt version: 1.13
+Trim Galore version: 0.6.3
+Cutadapt version: 2.4
+Number of cores used for trimming: 1
 Quality Phred score cutoff: 20
 Quality encoding type selected: ASCII+33
 Adapter sequence: 'CTGTCTCTTATA' (Nextera Transposase sequence; auto-detected)
@@ -13,10 +14,10 @@
 Minimum required sequence length for both reads before a sequence pair gets removed: 20 bp
 
 
-This is cutadapt 1.13 with Python 3.5.3
-Command line parameters: -f fastq -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_1.fastq
-Trimming 1 adapter with at most 10.0% errors in single-end mode ...
-Finished in 0.01 s (101 us/read; 0.59 M reads/minute).
+This is cutadapt 2.4 with Python 3.7.3
+Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_1.fastq
+Processing reads on 1 core in single-end mode ...
+Finished in 0.01 s (75 us/read; 0.80 M reads/minute).
 
 === Summary ===
 
@@ -73,7 +74,6 @@
 80	1	0.0	1	1
 86	1	0.0	1	1
 
-
 RUN STATISTICS FOR INPUT FILE: input_1.fastq
 =============================================
 99 sequences processed in total
@@ -83,8 +83,9 @@
 ==========================
 Input filename: input_2.fastq
 Trimming mode: paired-end
-Trim Galore version: 0.4.3
-Cutadapt version: 1.13
+Trim Galore version: 0.6.3
+Cutadapt version: 2.4
+Number of cores used for trimming: 1
 Quality Phred score cutoff: 20
 Quality encoding type selected: ASCII+33
 Adapter sequence: 'CTGTCTCTTATA' (Nextera Transposase sequence; auto-detected)
@@ -93,43 +94,43 @@
 Minimum required sequence length for both reads before a sequence pair gets removed: 20 bp
 
 
-This is cutadapt 1.13 with Python 3.5.3
-Command line parameters: -f fastq -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_2.fastq
-Trimming 1 adapter with at most 10.0% errors in single-end mode ...
-Finished in 0.01 s (100 us/read; 0.60 M reads/minute).
+This is cutadapt 2.4 with Python 3.7.3
+Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_2.fastq
+Processing reads on 1 core in single-end mode ...
+Finished in 0.00 s (50 us/read; 1.19 M reads/minute).
 
 === Summary ===
 
-Total reads processed:                     100
-Reads with adapters:                        59 (59.0%)
-Reads written (passing filters):           100 (100.0%)
+Total reads processed:                      99
+Reads with adapters:                        58 (58.6%)
+Reads written (passing filters):            99 (100.0%)
 
-Total basepairs processed:        25,100 bp
-Quality-trimmed:                     746 bp (3.0%)
-Total written (filtered):         23,276 bp (92.7%)
+Total basepairs processed:        24,849 bp
+Quality-trimmed:                     745 bp (3.0%)
+Total written (filtered):         23,035 bp (92.7%)
 
 === Adapter 1 ===
 
-Sequence: CTGTCTCTTATA; Type: regular 3'; Length: 12; Trimmed: 59 times.
+Sequence: CTGTCTCTTATA; Type: regular 3'; Length: 12; Trimmed: 58 times.
 
 No. of allowed errors:
 0-9 bp: 0; 10-12 bp: 1
 
 Bases preceding removed adapters:
-  A: 11.9%
-  C: 39.0%
-  G: 8.5%
-  T: 40.7%
+  A: 12.1%
+  C: 37.9%
+  G: 8.6%
+  T: 41.4%
   none/other: 0.0%
 
 Overview of removed sequences
 length	count	expect	max.err	error counts
-1	16	25.0	0	16
+1	16	24.8	0	16
 2	7	6.2	0	7
-3	1	1.6	0	1
+3	1	1.5	0	1
 4	2	0.4	0	2
 6	2	0.0	0	2
-9	2	0.0	0	2
+9	1	0.0	0	1
 10	1	0.0	1	1
 13	1	0.0	1	1
 14	2	0.0	1	2
@@ -156,10 +157,9 @@
 67	1	0.0	1	1
 80	1	0.0	1	1
 
-
 RUN STATISTICS FOR INPUT FILE: input_2.fastq
 =============================================
-100 sequences processed in total
+99 sequences processed in total
 
 Total number of sequences analysed for the sequence pair length validation: 99
 
--- a/test-data/paired_example_results2gz.txt	Thu Jun 01 12:15:10 2017 -0400
+++ b/test-data/paired_example_results2gz.txt	Tue Jul 30 06:26:49 2019 -0400
@@ -3,8 +3,9 @@
 ==========================
 Input filename: input_1.fastq.gz
 Trimming mode: paired-end
-Trim Galore version: 0.4.3
-Cutadapt version: 1.13
+Trim Galore version: 0.6.3
+Cutadapt version: 2.4
+Number of cores used for trimming: 1
 Quality Phred score cutoff: 20
 Quality encoding type selected: ASCII+33
 Adapter sequence: 'CTGTCTCTTATA' (Nextera Transposase sequence; auto-detected)
@@ -14,10 +15,10 @@
 Output file will be GZIP compressed
 
 
-This is cutadapt 1.13 with Python 3.5.3
-Command line parameters: -f fastq -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_1.fastq.gz
-Trimming 1 adapter with at most 10.0% errors in single-end mode ...
-Finished in 0.01 s (101 us/read; 0.59 M reads/minute).
+This is cutadapt 2.4 with Python 3.7.3
+Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_1.fastq.gz
+Processing reads on 1 core in single-end mode ...
+Finished in 0.03 s (287 us/read; 0.21 M reads/minute).
 
 === Summary ===
 
@@ -74,7 +75,6 @@
 80	1	0.0	1	1
 86	1	0.0	1	1
 
-
 RUN STATISTICS FOR INPUT FILE: input_1.fastq.gz
 =============================================
 99 sequences processed in total
@@ -84,8 +84,9 @@
 ==========================
 Input filename: input_2.fastq.gz
 Trimming mode: paired-end
-Trim Galore version: 0.4.3
-Cutadapt version: 1.13
+Trim Galore version: 0.6.3
+Cutadapt version: 2.4
+Number of cores used for trimming: 1
 Quality Phred score cutoff: 20
 Quality encoding type selected: ASCII+33
 Adapter sequence: 'CTGTCTCTTATA' (Nextera Transposase sequence; auto-detected)
@@ -95,43 +96,43 @@
 Output file will be GZIP compressed
 
 
-This is cutadapt 1.13 with Python 3.5.3
-Command line parameters: -f fastq -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_2.fastq.gz
-Trimming 1 adapter with at most 10.0% errors in single-end mode ...
-Finished in 0.01 s (100 us/read; 0.60 M reads/minute).
+This is cutadapt 2.4 with Python 3.7.3
+Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a CTGTCTCTTATA input_2.fastq.gz
+Processing reads on 1 core in single-end mode ...
+Finished in 0.02 s (170 us/read; 0.35 M reads/minute).
 
 === Summary ===
 
-Total reads processed:                     100
-Reads with adapters:                        59 (59.0%)
-Reads written (passing filters):           100 (100.0%)
+Total reads processed:                      99
+Reads with adapters:                        58 (58.6%)
+Reads written (passing filters):            99 (100.0%)
 
-Total basepairs processed:        25,100 bp
-Quality-trimmed:                     746 bp (3.0%)
-Total written (filtered):         23,276 bp (92.7%)
+Total basepairs processed:        24,849 bp
+Quality-trimmed:                     745 bp (3.0%)
+Total written (filtered):         23,035 bp (92.7%)
 
 === Adapter 1 ===
 
-Sequence: CTGTCTCTTATA; Type: regular 3'; Length: 12; Trimmed: 59 times.
+Sequence: CTGTCTCTTATA; Type: regular 3'; Length: 12; Trimmed: 58 times.
 
 No. of allowed errors:
 0-9 bp: 0; 10-12 bp: 1
 
 Bases preceding removed adapters:
-  A: 11.9%
-  C: 39.0%
-  G: 8.5%
-  T: 40.7%
+  A: 12.1%
+  C: 37.9%
+  G: 8.6%
+  T: 41.4%
   none/other: 0.0%
 
 Overview of removed sequences
 length	count	expect	max.err	error counts
-1	16	25.0	0	16
+1	16	24.8	0	16
 2	7	6.2	0	7
-3	1	1.6	0	1
+3	1	1.5	0	1
 4	2	0.4	0	2
 6	2	0.0	0	2
-9	2	0.0	0	2
+9	1	0.0	0	1
 10	1	0.0	1	1
 13	1	0.0	1	1
 14	2	0.0	1	2
@@ -158,10 +159,9 @@
 67	1	0.0	1	1
 80	1	0.0	1	1
 
-
 RUN STATISTICS FOR INPUT FILE: input_2.fastq.gz
 =============================================
-100 sequences processed in total
+99 sequences processed in total
 
 Total number of sequences analysed for the sequence pair length validation: 99
 
--- a/test-data/sanger_full_range_report_results1.txt	Thu Jun 01 12:15:10 2017 -0400
+++ b/test-data/sanger_full_range_report_results1.txt	Tue Jul 30 06:26:49 2019 -0400
@@ -3,8 +3,9 @@
 ==========================
 Input filename: input_1.fastq
 Trimming mode: single-end
-Trim Galore version: 0.4.3
-Cutadapt version: 1.13
+Trim Galore version: 0.6.3
+Cutadapt version: 2.4
+Number of cores used for trimming: 1
 Quality Phred score cutoff: 20
 Quality encoding type selected: ASCII+33
 Adapter sequence: 'AGATCGGAAGAGC' (Illumina TruSeq, Sanger iPCR; default (inconclusive auto-detection))
@@ -13,10 +14,10 @@
 Minimum required sequence length before a sequence gets removed: 20 bp
 
 
-This is cutadapt 1.13 with Python 3.5.3
-Command line parameters: -f fastq -e 0.1 -q 20 -O 1 -a AGATCGGAAGAGC input_1.fastq
-Trimming 1 adapter with at most 10.0% errors in single-end mode ...
-Finished in 0.01 s (5000 us/read; 0.01 M reads/minute).
+This is cutadapt 2.4 with Python 3.7.3
+Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a AGATCGGAAGAGC input_1.fastq
+Processing reads on 1 core in single-end mode ...
+Finished in 0.00 s (1608 us/read; 0.04 M reads/minute).
 
 === Summary ===
 
@@ -46,7 +47,6 @@
 length	count	expect	max.err	error counts
 1	1	0.5	0	1
 
-
 RUN STATISTICS FOR INPUT FILE: input_1.fastq
 =============================================
 2 sequences processed in total
--- a/test-data/sanger_full_range_report_results1gz.txt	Thu Jun 01 12:15:10 2017 -0400
+++ b/test-data/sanger_full_range_report_results1gz.txt	Tue Jul 30 06:26:49 2019 -0400
@@ -3,8 +3,9 @@
 ==========================
 Input filename: input_1.fastq.gz
 Trimming mode: single-end
-Trim Galore version: 0.4.3
-Cutadapt version: 1.13
+Trim Galore version: 0.6.3
+Cutadapt version: 2.4
+Number of cores used for trimming: 1
 Quality Phred score cutoff: 20
 Quality encoding type selected: ASCII+33
 Adapter sequence: 'AGATCGGAAGAGC' (Illumina TruSeq, Sanger iPCR; default (inconclusive auto-detection))
@@ -14,10 +15,10 @@
 Output file will be GZIP compressed
 
 
-This is cutadapt 1.13 with Python 3.5.3
-Command line parameters: -f fastq -e 0.1 -q 20 -O 1 -a AGATCGGAAGAGC input_1.fastq.gz
-Trimming 1 adapter with at most 10.0% errors in single-end mode ...
-Finished in 0.01 s (5000 us/read; 0.01 M reads/minute).
+This is cutadapt 2.4 with Python 3.7.3
+Command line parameters: -j 1 -e 0.1 -q 20 -O 1 -a AGATCGGAAGAGC input_1.fastq.gz
+Processing reads on 1 core in single-end mode ...
+Finished in 0.02 s (7871 us/read; 0.01 M reads/minute).
 
 === Summary ===
 
@@ -47,7 +48,6 @@
 length	count	expect	max.err	error counts
 1	1	0.5	0	1
 
-
 RUN STATISTICS FOR INPUT FILE: input_1.fastq.gz
 =============================================
 2 sequences processed in total
Binary file test-data/sanger_full_range_results1.fastq.gz has changed
Binary file test-data/sanger_full_range_results2.fastq.gz has changed
Binary file test-data/sanger_full_range_results3.fastq.gz has changed
--- a/trim_galore.xml	Thu Jun 01 12:15:10 2017 -0400
+++ b/trim_galore.xml	Tue Jul 30 06:26:49 2019 -0400
@@ -1,5 +1,5 @@
-<tool id="trim_galore" name="Trim Galore!" version="0.4.3.1" profile="17.01">
-    <!-- Wrapper compatible with Trim Galore! version 0.4.3 -->
+<tool id="trim_galore" name="Trim Galore!" version="0.6.3" profile="17.01">
+    <!-- Wrapper compatible with Trim Galore! version 0.6.3 -->
     <description>Quality and adapter trimmer of reads</description>
     <macros>
         <macro name="adapter_trimming">
@@ -43,7 +43,7 @@
         </macro>
     </macros>
     <requirements>
-        <requirement type="package" version="0.4.3">trim-galore</requirement>
+        <requirement type="package" version="0.6.3">trim-galore</requirement>
     </requirements>
     <version_command>
         trim_galore --version