view tRNAscan.xml @ 2:358f58401cd6 draft default tip

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/trna_prediction commit cfb19d75629f02e0dea4475c16c016ed5510eb44

<tool id="trnascan" name="tRNA prediction" version="0.4">
    <description>(tRNAscan)</description>
    <requirements>
      <requirement type="package" version="1.3.1">trnascan-se</requirement>
      <requirement type="package" version="1.0.2">infernal</requirement>
      <requirement type="package" version="1.70">biopython</requirement>
      <requirement type="package" version="2.7">python</requirement>
    </requirements>
    <command>
      <![CDATA[
python '$__tool_directory__/tRNAscan.py'
#if $organism
    $organism
#end if
#if $mode
    $mode
#end if
#if $showPrimSecondOpt
    $showPrimSecondOpt
#end if
#if $disablePseudo
    $disablePseudo
#end if
#if $showCodons
    $showCodons
#end if
-o
'$tabular_output'
'$inputfile'
'$fasta_output'
      ]]>
    </command>
    <inputs>
        <param name="inputfile" type="data" format="fasta" label="Genome Sequence" help="Dataset missing? See TIP below"/>
        <param name="organism" type="select" label="Select Organism">
            <option value="" selected="true">Eukaryotic</option>
            <option value="-G">general tRNA model</option>
            <option value="-B">Bacterial</option>
            <option value="-A">Archaeal</option>
            <option value="-O">Mitochondrial/Chloroplast</option>
        </param>
        <param name="mode" type="select" label="Select Mode">
            <option value="" selected="true">Default</option>
            <option value="-C">Covariance model analysis only (slow)</option>
            <option value="-T">tRNAscan only</option>
            <option value="-E">EufindtRNA only</option>
            <option value="--infernal">Infernal cm analysis (max sensitivity, very slow)</option> 
            <option value="--newscan">Infernal and new cm models</option>
        </param>
        <param name="disablePseudo" type="boolean" label="Disable pseudogene checking" truevalue="-D" falsevalue="" />
        <param name="showPrimSecondOpt" type="boolean" label="Show primary and secondary structure components to Cove scores" truevalue="-H" falsevalue="" />
        <param name="showCodons" type="boolean" label="Show codons instead of tRNA anticodons" truevalue="-N" falsevalue="" />
    </inputs>
    <outputs>
        <data format="tabular" name="tabular_output" label="${tool.name} on ${on_string}: tabular" />
        <data format="fasta" name="fasta_output" label="${tool.name} on ${on_string}: fasta" />
    </outputs>
    <tests>
        <test>
            <param name="inputfile" value="trna_arabidopsis.fasta" ftype="fasta" />
            <param name="organism" value="" />
            <param name="mode" value="--infernal" /> <!-- Infernal test not working due to cmsearch error-->
            <param name="disablePseudo" value="" />
            <param name="showPrimSecondOpt" value="" />
            <param name="showCodons" value="" />
            <output name="fasta_output" file="tRNAscan_eukaryotic_infernal.fasta" ftype="fasta" />
            <output name="tabular_output" file="tRNAscan_eukaryotic_infernal.tabular" ftype="tabular" />
        </test>
    </tests>
    <help>
<![CDATA[


**What it does**

tRNAscan-SE_ was designed to make rapid, sensitive searches of genomic
sequence feasible using the selectivity of the Cove analysis package.
We have optimized search sensitivity with eukaryote cytoplasmic and
eubacterial sequences, but it may be applied more broadly with a
slight reduction in sensitivity.

.. _tRNAscan-SE: http://lowelab.ucsc.edu/tRNAscan-SE/

**Input**

Nucleotide sequence in FASTA format.


**Organism**

- search for eukaryotic cytoplasmic tRNAs:

    This is the default.

- use general tRNA model:

    This option selects the general tRNA covariance model that was trained
    on tRNAs from all three phylogenetic domains (Archaea, Bacteria, and
    Eukarya). This mode can be used when analyzing a mixed collection of
    sequences from more than one phylogenetic domain, with only slight
    loss of sensitivity and selectivity. The original publication
    describing this program and tRNAscan-SE version 1.0 used this general
    tRNA model exclusively. If you wish to compare scores to those found
    in the paper or scans using v1.0, use this option. Use of this option
    is compatible with all other search mode options described in this
    section.

- search for bacterial tRNAs

    This option selects the bacterial covariance model for tRNA analysis,
    and loosens the search parameters for EufindtRNA to improve detection
    of bacterial tRNAs. Use of this mode with bacterial sequences
    will also improve bounds prediction of the 3' end (the terminal CAA
    triplet).

- search for archaeal tRNAs

    This option selects an archaeal-specific covariance model for tRNA
    analysis, as well as slightly loosening the EufindtRNA search
    cutoffs.

- search for organellar (mitochondrial/chloroplast) tRNAs

    This parameter bypasses the fast first-pass scanners that are poor at
    detecting organellar tRNAs and runs Cove analysis only. Since true
    organellar tRNAs have been found to have Cove scores between 15 and 20
    bits, the search cutoff is lowered from 20 to 15 bits. Also,
    pseudogene checking is disabled since it is only applicable to
    eukaryotic cytoplasmic tRNA pseudogenes. Since Cove-only mode is
    used, searches will be very slow (see -C option below) relative to the
    default mode.



**Mode**

- search using Cove analysis only (max sensitivity, slow)

    Directs tRNAscan-SE to analyze sequences using Cove analysis only.
    This option allows a slightly more sensitive search than the default
    tRNAscan + EufindtRNA -> Cove mode, but is much slower (by approx. 250
    to 3,000 fold). Output format and other program defaults are
    otherwise identical to the normal analysis.

- search using Eukaryotic tRNA finder (EufindtRNA) only:

    This option runs EufindtRNA alone to search for tRNAs. Since Cove is
    not being used as a secondary filter to remove false positives, this
    run mode defaults to "Normal" parameters which more closely
    approximates the sensitivity and selectivity of the original algorithm
    describe by Pavesi and colleagues.

- search using tRNAscan only (defaults to strict search parameters)

    Directs tRNAscan-SE to use only tRNAscan to analyze sequences. This
    mode will cause tRNAscan to default to using "strict" parameters
    (similar to tRNAscan version 1.3 operation). This mode of operation
    is faster (about 3-5 times faster than default mode analysis), but
    will result in approximately 0.2 to 0.6 false positive tRNAs per Mbp,
    decreased sensitivity, and less reliable prediction of anticodons,
    tRNA isotype, and introns.

- search using Infernal cm analysis only (max sensitivity, very slow)


- search using Infernal and new cm models instead of Cove



**disable pseudogene checking**

    Manually disable checking tRNAs for poor primary or secondary
    structure scores often indicative of eukaryotic pseudogenes. This
    will slightly speed the program and may be necessary for non-eukaryotic
    sequences that are flagged as possible pseudogenes but are known to be
    functional tRNAs.


**Show both primary and secondary structure score components to covariance model bit scores**

    This option displays the breakdown of the two components of the
    covariance model bit score. Since tRNA pseudogenes often have one
    very low component (good secondary structure but poor primary sequence
    similarity to the tRNA model, or vice versa), this information may be
    useful in deciding whether a low-scoring tRNA is likely to be a
    pseudogene. The heuristic pseudogene detection filter uses this
    information to flag possible pseudogenes -- use this option to see why
    a hit is marked as a possible pseudogene. The user may wish to
    examine score breakdowns from known tRNAs in the organism of interest
    to get a frame of reference.



**Show codons instead of tRNA anticodons**

    This option causes tRNAscan-SE to output a tRNA's corresponding codon
    in place of its anticodon.



**Example**

**input**

    >CELF22B7  C.aenorhabditis elegans (Bristol N2) cosmid F22B7
    GATCCTTGTAGATTTTGAATTTGAAGTTTTTTCTCATTCCAAAACTCTGT
    GATCTGAAATAAAATGTCTCAAAAAAATAGAAGAAAACATTGCTTTATAT
    TTATCAGTTATGGTTTTCAAAATTTTCTGACATACCGTTTTGCTTCTTTT
    TTTCTCATCTTCTTCAAATATCAATTGTGATAATCTGACTCCTAACAATC
    GAATTTCTTTTCCTTTTTCTTTTTCCAACAACTCCAGTGAGAACTTTTGA
    ATATCTTCAAGTGACTTCACCACATCAGAAGGTGTCAACGATCTTGTGAG
    AACATCGAATGAAGATAATTTTAATTTTAGAGTTACAGTTTTTCCTCCGA
    .....


**output**


    ========     ======    =====     ======    ====    ==========    ======    ======    ==========    ==========
                              tRNA Bounds                              Intron Bonds
    --------     ------    ----------------    ----    ----------    ----------------    ----------    ----------
    Name         # tRNA    Begin     End       tRNA    Anti Codon    Begin     End       Cove Score    Hit Origin
    ========     ======    =====     ======    ====    ==========    ======    ======    ==========    ==========
    CELF22B7     1         12619     12738     Leu     CAA           12657     12692     55.12         Bo
    CELF22B7     2         19480     19561     Ser     AGA           0         0         66.90         Bo
    CELF22B7     3         26367     26439     Phe     GAA           0         0         73.88         Bo
    CELF22B7     4         26992     26920     Phe     GAA           0         0         73.88         Bo
    CELF22B7     5         23765     23694     Pro     CGG           0         0         60.58         Bo
    ========     ======    =====     ======    ====    ==========    ======    ======    ==========    ==========


]]>
    </help>
    <citations>
        <citation type="doi">10.1093/nar/25.5.0955</citation>
    </citations>
</tool>