0
|
1 <tool id="plant_microRNA_v1" name="microRNA_pipeline" veision="1.0.0">
|
|
2 <description>Program for plant microRNA analysis (rawdata preprocess -> genome mapping -> non-coding RNA(exclude miRNAs) annotation -> microRNA analysis)</description>
|
|
3
|
|
4 <requirements>
|
|
5 <requirement type="package" version="0.0.13">fastx_toolkit </requirement>
|
|
6 <requirement type="package" version="0.12.7">bowtie</requirement>
|
|
7 <requirement type="set_environment">SCRIPT_PATH</requirement>
|
|
8 <!--requirement type="package" version="3.0.1">R</requirement!-->
|
|
9 <requirement type="package" version="1.96">threads</requirement>
|
|
10 <requirement type="package" version="2.59">SVG</requirement>
|
|
11 <!--requirement type="package" version="0.228">parent</requirement-->
|
|
12 <requirement type="package" version="2.1.8">ViennaRNA</requirement>
|
|
13 </requirements>
|
|
14
|
|
15 <!--command interpreter="perl">miPlant.pl -i $input -format $format -gfa $gfa -idx $index -pre $pre -mat $mat -rfam $rfam -idx2 $idx2 -D $D -a $a -M $M -min $min -max $max -mis $mis -e $e -f $f -v $v -r $r -dis $dis -flank $flank -mfe $mfe -t $t -o $output</command-->
|
|
16
|
|
17 <command interpreter="perl">microRNA_pipeline.pl
|
|
18 ## Change this to accommodate the number of threads you have available.
|
|
19 -t \${GALAXY_SLOTS:-4}
|
|
20 -path \$SCRIPT_PATH
|
|
21
|
|
22 #for $j, $s in enumerate( $series )
|
|
23 ##rank_of_series=$j
|
|
24 -i ${s.input}
|
|
25 -tag ${s.tag}
|
|
26 #end for
|
|
27
|
|
28 ## prepare bowtie index
|
|
29 #set index_path = ''
|
|
30 #if str($reference_genome.source) == "history":
|
|
31 #####bowtie-build "$reference_genome.own_file" genome; ln -s "$reference_genome.own_file" genome.fa;
|
|
32 #set index_path = $reference_genome.own_file
|
|
33 -gfa $index_path
|
|
34 #else:
|
|
35 #set index_path = $reference_genome.index.fields.path
|
|
36 -gfa ${index_path}.fa -idx $index_path
|
|
37 #end if
|
|
38
|
|
39
|
|
40 ## Do or not annotate rfam non-miRNA RNAs
|
|
41 #if $params.annotate_rfam == "yes":
|
|
42
|
|
43 ## prepare Rfam bowtie index
|
|
44 #set rfam_index_path = ''
|
|
45 #if str($params.reference_rfam.source) == "history":
|
|
46 ######## bowtie-build "$params.reference_rfam.own_file" rfam; ln -s "$params.reference_rfam.own_file" rfam.fa;
|
|
47 #set rfam_index_path = $params.reference_rfam.own_file
|
|
48 -rfam $rfam_index_path
|
|
49 #else:
|
|
50 #set rfam_index_path = $params.reference_rfam.index.fields.path
|
|
51 -rfam ${rfam_index_path}.fa -idx2 $rfam_index_path
|
|
52 #end if
|
|
53
|
|
54 -v $params.v
|
|
55 ## Do or not delete rfam mapped tags
|
|
56 #if $params.delete_rfam == "yes":
|
|
57 -D
|
|
58 #end if
|
|
59 #end if
|
|
60
|
|
61
|
|
62 ## Do or not annotate known microRNAs
|
|
63 #if $mirbase.known_microRNA == "yes":
|
|
64 -pre $mirbase.pre -mat $mirbase.mat
|
|
65 #end if
|
|
66
|
|
67
|
|
68 -format $format -phred $phred -a $a -M $mapnt -min $min -max $max -mis $mismatch -e $e -f $f -r $r -dis $dis -flank $flank -mfe $mfe > run.log
|
|
69 </command>
|
|
70
|
|
71 <inputs>
|
|
72
|
|
73 <repeat name="series" title="Raw sequence data">
|
|
74 <param name="input" type="data" label="Raw data"/>
|
|
75 <param name="tag" type="text" data_ref="input" label="Sample name of raw data"/>
|
|
76 </repeat>
|
|
77
|
|
78 <param name="format" type="select" label="Raw data format" multiple="false">
|
|
79 <option value="fastq">Raw data is fastq. format</option>
|
|
80 <option value="fasta">Raw data is fasta. format</option>
|
|
81 </param>
|
|
82
|
|
83 <param name="phred" type="select" label="Input quals are Phred+64 or Phred+33" multiple="false">
|
|
84 <option value="64">Phred+64</option>
|
|
85 <option value="33" selected="true">Phred+33</option>
|
|
86 </param>
|
|
87
|
|
88 <conditional name="reference_genome">
|
|
89 <param name="source" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options">
|
|
90 <option value="indexed">Use a built-in index</option>
|
|
91 <option value="history">Use one from the history</option>
|
|
92 </param>
|
|
93 <when value="indexed">
|
|
94 <param name="index" type="select" label="Select a reference genome" help="If your genome of interest is not listed, contact the Galaxy team">
|
|
95 <options from_data_table="bowtie_indexes">
|
|
96 <filter type="sort_by" column="2"/>
|
|
97 <validator type="no_options" message="No indexes are available for the selected input dataset"/>
|
|
98 </options>
|
|
99 </param>
|
|
100 </when>
|
|
101 <when value="history">
|
|
102 <param name="own_file" type="data" format="fasta" metadata_name="dbkey" label="Select the reference genome" />
|
|
103 </when>
|
|
104 </conditional>
|
|
105
|
|
106 <conditional name="params">
|
|
107 <param name="annotate_rfam" type="select" label="annotate rfam nocoding RNAs(excluding miRNA)">
|
|
108 <option value="yes" selected="true">yes</option>
|
|
109 <option value="no">no</option>
|
|
110 </param>
|
|
111 <when value="yes">
|
|
112 <!--param name="rfam" type="data" label="rfam sequence file" /-->
|
|
113 <conditional name="reference_rfam">
|
|
114 <param name="source" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options">
|
|
115 <option value="indexed">Use a built-in index</option>
|
|
116 <option value="history">Use one from the history</option>
|
|
117 </param>
|
|
118 <when value="indexed">
|
|
119 <param name="index" type="select" label="Select a non-coding RNA reference" help="If your reference of interest is not listed, contact the Galaxy team">
|
|
120 <options from_data_table="rfam_bowtie_indexes">
|
|
121 <filter type="sort_by" column="2"/>
|
|
122 <validator type="no_options" message="No indexes are available for the selected input dataset"/>
|
|
123 </options>
|
|
124 </param>
|
|
125 </when>
|
|
126 <when value="history">
|
|
127 <param name="own_file" type="data" format="fasta" metadata_name="dbkey" label="Select the reference" />
|
|
128 </when>
|
|
129 </conditional>
|
|
130
|
|
131 <param name="v" type="integer" value="0" label="report end-to-end hits less than v mismatches for rfam mapping"/>
|
|
132
|
|
133 <param name="delete_rfam" type="select" label="delet rfam mapped reads">
|
|
134 <option value="yes" selected="true">yes</option>
|
|
135 <option value="no">no</option>
|
|
136 </param>
|
|
137 </when>
|
|
138
|
|
139 </conditional>
|
|
140
|
|
141 <conditional name="mirbase">
|
|
142 <param name="known_microRNA" type="select" label="Analysis known microRNAs(eg. from mirbase)">
|
|
143 <option value="yes" selected="true">yes</option>
|
|
144 <option value="no">no</option>
|
|
145 </param>
|
|
146 <when value="yes">
|
|
147 <param name="mat" type="data" label="mature microRNA sequence file" />
|
|
148 <param name="pre" type="data" label="precursor microRNA sequence file" />
|
|
149 </when>
|
|
150
|
|
151 </conditional>
|
|
152
|
|
153
|
|
154 <param name="a" type="text" value="TGGAATTCTCGGGTGCCAAGG" label="3' adapter sequence" />
|
|
155 <param name="mapnt" type="integer" value="8" label="minimum adapter map nts" />
|
|
156 <param name="min" type="integer" value="19" label="minimum microRNA length" />
|
|
157 <param name="max" type="integer" value="28" label="maximum microRNA length" />
|
|
158 <param name="mismatch" type="integer" value="0" label="number of allowed mismatches when mapping reads to precursors" />
|
|
159 <param name="e" type="integer" value="2" label="number of nucleotides upstream of the mature sequence to consider" />
|
|
160 <param name="f" type="integer" value="5" label="number of nucleotides downstream of the mature sequence to consider" />
|
|
161 <param name="r" type="integer" value="25" label="a read is allowed to map up to this number of positions in the genome" />
|
|
162 <param name="dis" type="integer" value="200" label="Maximal space between miRNA and miRNA*" />
|
|
163 <param name="flank" type="integer" value="10" label="Flank sequence length of miRNA precursor" />
|
|
164 <param name="mfe" type="float" value="-30" label="Maximal free energy allowed for a miRNA precursor" />
|
|
165 </inputs>
|
|
166
|
|
167 <outputs>
|
|
168 <data format="txt" name="known microRNA express list" from_work_dir="miRPlant_out/known_microRNA_express.txt" label="${tool.name} on ${on_string}: known microRNA express list">
|
|
169 <filter>(mirbase['known_microRNA'] == 'yes')</filter>
|
|
170 </data>
|
|
171 <data format="txt" name="known microRNA express alignment" from_work_dir="miRPlant_out/known_microRNA_express.aln" label="${tool.name} on ${on_string}: known microRNA express alignment">
|
|
172 <filter>(mirbase['known_microRNA'] == 'yes')</filter>
|
|
173 </data>
|
|
174 <data format="txt" name="known microRNA moRs result" from_work_dir="miRPlant_out/known_microRNA_express.moRs" label="${tool.name} on ${on_string}: known microRNA moRs result">
|
|
175 <filter>(mirbase['known_microRNA'] == 'yes')</filter>
|
|
176 </data>
|
|
177 <data format="txt" name="known microRNA precursor file" from_work_dir="miRPlant_out/known_microRNA_precursor.fa" label="${tool.name} on ${on_string}: known microRNA precursor file">
|
|
178 <filter>(mirbase['known_microRNA'] == 'yes')</filter>
|
|
179 </data>
|
|
180 <data format="txt" name="known microRNA mature file" from_work_dir="miRPlant_out/known_microRNA_mature.fa" label="${tool.name} on ${on_string}: known microRNA mature file">
|
|
181 <filter>(mirbase['known_microRNA'] == 'yes')</filter>
|
|
182 </data>
|
|
183 <data format="txt" name="novel microRNA express list" from_work_dir="miRPlant_out/novel_microRNA_express.txt" label="${tool.name} on ${on_string}: novel microRNA express list"/>
|
|
184 <data format="txt" name="novel microRNA precursor file" from_work_dir="miRPlant_out/novel_microRNA_precursor.fa" label="${tool.name} on ${on_string}: novel microRNA precursor file"/>
|
|
185 <data format="txt" name="novel microRNA mature sequence file" from_work_dir="miRPlant_out/novel_microRNA_mature.fa" label="${tool.name} on ${on_string}: novel microRNA mature sequence file"/>
|
|
186 <data format="html" name="analysis result" from_work_dir="miRPlant_out/result.html" label="${tool.name} on ${on_string}: analysis result"/>
|
|
187 </outputs>
|
|
188
|
|
189 <help>
|
|
190
|
|
191 </help>
|
|
192 </tool>
|