|
1
|
1 <tool id="aragorn_trna" name="Aragon" version="0.2">
|
|
|
2 <description>Prediction of tRNAs</description>
|
|
|
3 <requirements>
|
|
|
4 <requirement type="package" version="1.2.36">aragorn</requirement>
|
|
|
5 </requirements>
|
|
|
6 <command>
|
|
|
7 aragorn
|
|
|
8 $input
|
|
|
9 -gc$genbank_gencode
|
|
|
10 $tmRNA
|
|
|
11 $tRNA
|
|
|
12 $mtRNA
|
|
|
13 $mam_mtRNA
|
|
|
14 $topology
|
|
|
15 -o $output
|
|
|
16 $secondary_structure
|
|
|
17 $introns
|
|
|
18 </command>
|
|
|
19 <inputs>
|
|
|
20 <param name="input" type="data" format="fasta" label="Genome Sequence"/>
|
|
|
21 <param name="genbank_gencode" type="select" label="Genetic code">
|
|
|
22 <option value="1" select="True">1. Standard</option>
|
|
|
23 <option value="2">2. Vertebrate Mitochondrial</option>
|
|
|
24 <option value="3">3. Yeast Mitochondrial</option>
|
|
|
25 <option value="4">4. Mold, Protozoan, and Coelenterate Mitochondrial Code and the Mycoplasma/Spiroplasma Code</option>
|
|
|
26 <option value="5">5. Invertebrate Mitochondrial</option>
|
|
|
27 <option value="6">6. Ciliate, Dasycladacean and Hexamita Nuclear Code</option>
|
|
|
28 <option value="9">9. Echinoderm Mitochondrial</option>
|
|
|
29 <option value="10">10. Euplotid Nuclear</option>
|
|
|
30 <option value="11">11. Bacteria and Archaea</option>
|
|
|
31 <option value="12">12. Alternative Yeast Nuclear</option>
|
|
|
32 <option value="13">13. Ascidian Mitochondrial</option>
|
|
|
33 <option value="14">14. Flatworm Mitochondrial</option>
|
|
|
34 <option value="15">15. Blepharisma Macronuclear</option>
|
|
|
35 <option value="16">16. Chlorophycean Mitochondrial</option>
|
|
|
36 <option value="21">21. Trematode Mitochondrial</option>
|
|
|
37 <option value="22">22. Scenedesmus obliquus mitochondrial</option>
|
|
|
38 <option value="23">23. Thraustochytrium Mitochondrial</option>
|
|
|
39 <option value="24">24. Pterobranchia mitochondrial</option>
|
|
|
40 </param>
|
|
|
41 <param name="topology" type="select" label="Topology">
|
|
|
42 <option value="-c">Assume that each sequence has a circular topology</option>
|
|
|
43 <option value="-l">Assume that each sequence has a linear topology</option>
|
|
|
44 </param>
|
|
|
45 <param name='tmRNA' type='boolean' label='Search for tmRNA genes (-m)' truevalue='-m' falsevalue='' checked="true" help='' />
|
|
|
46 <param name='tRNA' type='boolean' label='Search for tRNA genes (-t)' truevalue='-t' falsevalue='' checked="true" help='' />
|
|
|
47 <param name='mtRNA' type='boolean' label='Search for Metazoan mitochondrial tRNA genes (-mt)' truevalue='-mt' falsevalue='' checked="false" help='-i switch ignored. Composite Metazoan mitochondrial genetic code used.' />
|
|
|
48 <param name='mam_mtRNA' type='boolean' label='Search for Mammalian mitochondrial tRNA genes (-mtmam)' truevalue='-mtmam' falsevalue='' checked="false" help='-i switch ignored. -tv switch set. Mammalian mitochondrial genetic code used.' />
|
|
|
49 <param name='introns' type='boolean' label='Search for tRNA genes with introns in anticodon loop ...' truevalue='-i' falsevalue='' checked="false" help='...with maximum length 3000 bases (-i).' />
|
|
|
50 <param name='secondary_structure' type='boolean' label='Print out secondary structure (-fasta,-fon)' truevalue='-fasta' falsevalue='-fon' checked="false" help='' />
|
|
|
51 </inputs>
|
|
|
52 <outputs>
|
|
|
53 <data name="output" format="fasta">
|
|
|
54 <change_format>
|
|
|
55 <when input="secondary_structure" value="true" format="text"/>
|
|
|
56 </change_format>
|
|
|
57 </data>
|
|
|
58 </outputs>
|
|
|
59 <tests>
|
|
|
60 <test>
|
|
|
61 </test>
|
|
|
62 </tests>
|
|
|
63 <help>
|
|
|
64
|
|
|
65 **What it does**
|
|
|
66
|
|
|
67 This tool predicts, tRNA (and tmRNA) detection in nucleotide sequences.
|
|
|
68 http://130.235.46.10/ARAGORN/
|
|
|
69 -----
|
|
|
70
|
|
|
71 **Example**
|
|
|
72
|
|
|
73 Suppose you have the following DNA formatted sequences::
|
|
|
74
|
|
|
75 >SQ Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other;
|
|
|
76 cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg
|
|
|
77 ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag
|
|
|
78 cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc
|
|
|
79 cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc
|
|
|
80 ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg
|
|
|
81
|
|
|
82 Running this tool will produce this::
|
|
|
83 --snip--
|
|
|
84 87.
|
|
|
85
|
|
|
86 c
|
|
|
87 c
|
|
|
88 a
|
|
|
89 g-c
|
|
|
90 g-c
|
|
|
91 g-c
|
|
|
92 c-g
|
|
|
93 g-c
|
|
|
94 a-t
|
|
|
95 t-a ca
|
|
|
96 t tgacc a
|
|
|
97 ga a !!!!! g
|
|
|
98 t ctcg actgg c
|
|
|
99 g !!!! c tt
|
|
|
100 g gagc t
|
|
|
101 aa g g
|
|
|
102 c-gag
|
|
|
103 t-a
|
|
|
104 t-a
|
|
|
105 c-g
|
|
|
106 g-c
|
|
|
107 t c
|
|
|
108 t a
|
|
|
109 cac
|
|
|
110
|
|
|
111
|
|
|
112
|
|
|
113 tRNA-Val(cac)
|
|
|
114 74 bases, %GC = 58.1
|
|
|
115 Sequence [6669703,6669776]
|
|
|
116
|
|
|
117
|
|
|
118
|
|
|
119
|
|
|
120 tRNA Anticodon Frequency
|
|
|
121 AAA Phe GAA Phe 1 CAA Leu 1 TAA Leu 1
|
|
|
122 AGA Ser GGA Ser 1 CGA Ser 2 TGA Ser 1
|
|
|
123 ACA Cys GCA Cys 2 CCA Trp 2 TCA seC
|
|
|
124 ATA Tyr GTA Tyr 1 CTA Pyl TTA Stop
|
|
|
125 AAG Leu GAG Leu 3 CAG Leu 1 TAG Leu 2
|
|
|
126 AGG Pro GGG Pro 2 CGG Pro 2 TGG Pro 2
|
|
|
127 ACG Arg 1 GCG Arg 2 CCG Arg 1 TCG Arg
|
|
|
128 ATG His GTG His 2 CTG Gln 2 TTG Gln 1
|
|
|
129 AAC Val GAC Val 3 CAC Val 2 TAC Val 1
|
|
|
130 AGC Ala GGC Ala 2 CGC Ala 3 TGC Ala 1
|
|
|
131 ACC Gly GCC Gly 5 CCC Gly 1 TCC Gly 2
|
|
|
132 ATC Asp GTC Asp 3 CTC Glu 2 TTC Glu 2
|
|
|
133 AAT Ile GAT Ile 3 CAT Met 6 TAT Ile
|
|
|
134 AGT Thr GGT Thr 2 CGT Thr 1 TGT Thr 2
|
|
|
135 ACT Ser GCT Ser 1 CCT Arg 1 TCT Arg 1
|
|
|
136 ATT Asn GTT Asn 3 CTT Lys 3 TTT Lys 2
|
|
|
137 Ambiguous: 1
|
|
|
138
|
|
|
139 tRNA Codon Frequency
|
|
|
140 TTT Phe TTC Phe 1 TTG Leu 1 TTA Leu 1
|
|
|
141 TCT Ser TCC Ser 1 TCG Ser 2 TCA Ser 1
|
|
|
142 TGT Cys TGC Cys 2 TGG Trp 2 TGA seC
|
|
|
143 TAT Tyr TAC Tyr 1 TAG Pyl TAA Stop
|
|
|
144 CTT Leu CTC Leu 3 CTG Leu 1 CTA Leu 2
|
|
|
145 CCT Pro CCC Pro 2 CCG Pro 2 CCA Pro 2
|
|
|
146 CGT Arg 1 CGC Arg 2 CGG Arg 1 CGA Arg
|
|
|
147 CAT His CAC His 2 CAG Gln 2 CAA Gln 1
|
|
|
148 GTT Val GTC Val 3 GTG Val 2 GTA Val 1
|
|
|
149 GCT Ala GCC Ala 2 GCG Ala 3 GCA Ala 1
|
|
|
150 GGT Gly GGC Gly 5 GGG Gly 1 GGA Gly 2
|
|
|
151 GAT Asp GAC Asp 3 GAG Glu 2 GAA Glu 2
|
|
|
152 ATT Ile ATC Ile 3 ATG Met 6 ATA Ile
|
|
|
153 ACT Thr ACC Thr 2 ACG Thr 1 ACA Thr 2
|
|
|
154 AGT Ser AGC Ser 1 AGG Arg 1 AGA Arg 1
|
|
|
155 AAT Asn AAC Asn 3 AAG Lys 3 AAA Lys 2
|
|
|
156 Ambiguous: 1
|
|
|
157
|
|
|
158 Number of tRNA genes = 86
|
|
|
159 tRNA GC range = 50.0% to 85.1%
|
|
|
160 Number of tmRNA genes = 1
|
|
|
161
|
|
|
162 -------
|
|
|
163
|
|
|
164 **References**
|
|
|
165
|
|
|
166 Dean Laslett and Bjorn Canback
|
|
|
167 ARAGORN, a program to detect tRNA genes and tmRNA genes in nucleotide sequences Nucl. Acids Res. (2004) 32(1): 11-16
|
|
|
168 doi:10.1093/nar/gkh152
|
|
|
169
|
|
|
170
|
|
|
171
|
|
|
172 </help>
|
|
|
173 </tool>
|
