Mercurial > repos > bjoern-gruening > trna_prediction

comparison tRNAscan.xml @ 2:0fef99b5f63f draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
apply patch from Nicola Soranzo
author bjoern-gruening
date Sun, 24 Mar 2013 14:35:48 -0400
parents 65d282ef088e
children
comparison
equal deleted inserted replaced
1:65d282ef088e 2:0fef99b5f63f
1 <tool id="trnascan" name="tRNAscan" version="0.2.1"> 1 <tool id="trnascan" name="tRNAscan" version="0.2.2">
2 <description>tRNA Scan</description> 2 <description>tRNA Scan</description>
3 <requirements> 3 <requirements>
4 <requirement type="package" version="1.3.1">tRNAscan-SE</requirement> 4 <requirement type="package" version="1.3.1">tRNAscan-SE</requirement>
5 <requirement type="python-module">biopython</requirement>
5 </requirements> 6 </requirements>
6 <command interpreter="python"> 7 <command interpreter="python">
7 tRNAscan.py $organism $mode $showPrimSecondOpt $disablePseudo $showCodons -o $tabular_output $inputfile $fasta_output 8 tRNAscan.py $organism $mode $showPrimSecondOpt $disablePseudo $showCodons -o $tabular_output $inputfile $fasta_output
8 </command> 9 </command>
9 <inputs> 10 <inputs>
10 <param name="inputfile" type="data" format="fasta" label="Genome Sequence" help="Dataset missing? See TIP below"/> 11 <param name="inputfile" type="data" format="fasta" label="Genome Sequence" help="Dataset missing? See TIP below"/>
11 <param name="organism" type="select" format="text"> 12 <param name="organism" type="select" label="Select Organism">
12 <label>Select Organsim</label> 13 <option value="">Eukaryotic</option>
13 <option value="-G">general tRNA model</option> 14 <option value="-G">general tRNA model</option>
14 <option value="-B">Bacterial</option> 15 <option value="-B">Bacterial</option>
15 <option value="-A">Archaeal</option> 16 <option value="-A">Archaeal</option>
16 <option value="-O">Mitochondrial/Chloroplast</option> 17 <option value="-O">Mitochondrial/Chloroplast</option>
17 </param> 18 </param>
18 <param name="mode" type="select" format="text"> 19 <param name="mode" type="select" label="Select Mode">
19 <label>Select Mode</label> 20 <option value="">Default</option>
20 <option value=""> Default</option>
21 <option value="-C">Covariance model analysis only (slow)</option> 21 <option value="-C">Covariance model analysis only (slow)</option>
22 <option value="-T">tRNAscan only</option> 22 <option value="-T">tRNAscan only</option>
23 <option value="-E">EufindtRNA only</option> 23 <option value="-E">EufindtRNA only</option>
24 <option value="--infernal">Infernal cm analysis (max sensitivity, very slow)</option> 24 <option value="--infernal">Infernal cm analysis (max sensitivity, very slow)</option>
25 <option value="--newscan">Infernal and new cm models</option> 25 <option value="--newscan">Infernal and new cm models</option>
26 </param> 26 </param>
27 <param name='disablePseudo' type='boolean' label='Disable pseudo gene checking' truevalue='-D' falsevalue='' > </param> 27 <param name="disablePseudo" type="boolean" label="Disable pseudogene checking" truevalue="-D" falsevalue="" />
28 <param name='showPrimSecondOpt' type='boolean' label='Show primary and secondary structure components to Cove scores' truevalue="-H" falsevalue=''></param> 28 <param name="showPrimSecondOpt" type="boolean" label="Show primary and secondary structure components to Cove scores" truevalue="-H" falsevalue="" />
29 <param name='showCodons' type='boolean' label='Show codons instead of tRNA anticodons' truevalue='-N' falsevalue=''></param> 29 <param name="showCodons" type="boolean" label="Show codons instead of tRNA anticodons" truevalue="-N" falsevalue="" />
30 </inputs> 30 </inputs>
31 <outputs> 31 <outputs>
32 <data format="tabular" name="tabular_output"/> 32 <data format="tabular" name="tabular_output" label="${tool.name} on ${on_string}: tabular" />
33 <data format="fasta" name="fasta_output"/> 33 <data format="fasta" name="fasta_output" label="${tool.name} on ${on_string}: fasta" />
34 </outputs> 34 </outputs>
35 <tests> 35 <tests>
36 <test> 36 <test>
37 </test> 37 </test>
38 </tests> 38 </tests>
39 39 <help>
40 <help>
41 40
42 .. class:: warningmark 41 .. class:: warningmark
43 42
44 **TIP** This tool requires *fasta* format. 43 **TIP** This tool requires *fasta* format.
45 44
54 slight reduction in sensitivity . 53 slight reduction in sensitivity .
55 http://lowelab.ucsc.edu/tRNAscan-SE/ 54 http://lowelab.ucsc.edu/tRNAscan-SE/
56 55
57 ----- 56 -----
58 57
59 **Organisim** 58 **Organism**
59
60 - search for eukaryotic cytoplasmic tRNAs:
61
62 This is the default.
60 63
61 - use general tRNA model: 64 - use general tRNA model:
62 65
63 This option selects the general tRNA covariance model that was trained 66 This option selects the general tRNA covariance model that was trained
64 on tRNAs from all three phylogenetic domains (archaea, bacteria, and 67 on tRNAs from all three phylogenetic domains (Archaea, Bacteria, and
65 eukarya). This mode can be used when analyzing a mixed collection of 68 Eukarya). This mode can be used when analyzing a mixed collection of
66 sequences from more than one phylogenetic domain, with only slight 69 sequences from more than one phylogenetic domain, with only slight
67 loss of sensitivity and selectivity. The original publication 70 loss of sensitivity and selectivity. The original publication
68 describing this program and tRNAscan-SE version 1.0 used this general 71 describing this program and tRNAscan-SE version 1.0 used this general
69 tRNA model exclusively. If you wish to compare scores to those found 72 tRNA model exclusively. If you wish to compare scores to those found
70 in the paper or scans using v1.0, use this option. Use of this option 73 in the paper or scans using v1.0, use this option. Use of this option
71 is compatible with all other search mode options described in this 74 is compatible with all other search mode options described in this
72 section. 75 section.
73 76
74 - search for bacterial tRNAs 77 - search for bacterial tRNAs
75 78
76 This option selects the bacterial covariace model for tRNA analysis, 79 This option selects the bacterial covariance model for tRNA analysis,
77 and loosens the search parameters for EufindtRNA to improve detection 80 and loosens the search parameters for EufindtRNA to improve detection
78 of bacterial tRNAs. Use of this mode with bacterial sequences 81 of bacterial tRNAs. Use of this mode with bacterial sequences
79 will also improve bounds prediction of the 3' end (the terminal CAA 82 will also improve bounds prediction of the 3' end (the terminal CAA
80 triplet). 83 triplet).
81 84
82 - search for archaeal tRNAs 85 - search for archaeal tRNAs
83 86
86 cutoffs. 89 cutoffs.
87 90
88 - search for organellar (mitochondrial/chloroplast) tRNAs 91 - search for organellar (mitochondrial/chloroplast) tRNAs
89 92
90 This parameter bypasses the fast first-pass scanners that are poor at 93 This parameter bypasses the fast first-pass scanners that are poor at
91 detecting organellar tRNAs and runs Cove analysis only. Since true 94 detecting organellar tRNAs and runs Cove analysis only. Since true
92 organellar tRNAs have been found to have Cove scores between 15 and 20 95 organellar tRNAs have been found to have Cove scores between 15 and 20
93 bits, the search cutoff is lowered from 20 to 15 bits. Also, 96 bits, the search cutoff is lowered from 20 to 15 bits. Also,
94 pseudogene checking is disabled since it is only applicable to 97 pseudogene checking is disabled since it is only applicable to
95 eukaryotic cytoplasmic tRNA pseudogenes. Since Cove-only mode is 98 eukaryotic cytoplasmic tRNA pseudogenes. Since Cove-only mode is
96 used, searches will be very slow (see -C option below) relative to the 99 used, searches will be very slow (see -C option below) relative to the
97 default mode. 100 default mode.
98 101
99 ------ 102 ------
100 103
103 - search using Cove analysis only (max sensitivity, slow) 106 - search using Cove analysis only (max sensitivity, slow)
104 107
105 Directs tRNAscan-SE to analyze sequences using Cove analysis only. 108 Directs tRNAscan-SE to analyze sequences using Cove analysis only.
106 This option allows a slightly more sensitive search than the default 109 This option allows a slightly more sensitive search than the default
107 tRNAscan + EufindtRNA -> Cove mode, but is much slower (by approx. 250 110 tRNAscan + EufindtRNA -> Cove mode, but is much slower (by approx. 250
108 to 3,000 fold). Output format and other program defaults are 111 to 3,000 fold). Output format and other program defaults are
109 otherwise identical to the normal analysis. 112 otherwise identical to the normal analysis.
110 113
111 - search using Eukaryotic tRNA finder (EufindtRNA) only: 114 - search using Eukaryotic tRNA finder (EufindtRNA) only:
112 115
113 This option runs EufindtRNA alone to search for tRNAs. Since Cove is 116 This option runs EufindtRNA alone to search for tRNAs. Since Cove is
114 not being used as a secondary filter to remove false positives, this 117 not being used as a secondary filter to remove false positives, this
115 run mode defaults to "Normal" parameters which more closely 118 run mode defaults to "Normal" parameters which more closely
116 approximates the sensitivity and selectivity of the original algorithm 119 approximates the sensitivity and selectivity of the original algorithm
117 describe by Pavesi and colleagues. 120 describe by Pavesi and colleagues.
118 121
119 - search using tRNAscan only (defaults to strict search params) 122 - search using tRNAscan only (defaults to strict search parameters)
120 123
121 Directs tRNAscan-SE to use only tRNAscan to analyze sequences. This 124 Directs tRNAscan-SE to use only tRNAscan to analyze sequences. This
122 mode will cause tRNAscan to default to using "strict" parameters 125 mode will cause tRNAscan to default to using "strict" parameters
123 (similar to tRNAscan version 1.3 operation). This mode of operation 126 (similar to tRNAscan version 1.3 operation). This mode of operation
124 is faster (about 3-5 times faster than default mode analysis), but 127 is faster (about 3-5 times faster than default mode analysis), but
125 will result in approximately 0.2 to 0.6 false positive tRNAs per Mbp, 128 will result in approximately 0.2 to 0.6 false positive tRNAs per Mbp,
126 decreased sensitivity, and less reliable prediction of anticodons, 129 decreased sensitivity, and less reliable prediction of anticodons,
127 tRNA isotype, and introns. 130 tRNA isotype, and introns.
128 131
129 ----- 132 -----
130 133
131 **disable pseudogene checking** 134 **disable pseudogene checking**
132 135
133 Manually disable checking tRNAs for poor primary or secondary 136 Manually disable checking tRNAs for poor primary or secondary
134 structure scores often indicative of eukaryotic pseudogenes. This 137 structure scores often indicative of eukaryotic pseudogenes. This
135 will slightly speed the program and may be necessary for non-eukaryotic 138 will slightly speed the program and may be necessary for non-eukaryotic
136 sequences that are flagged as possible pseudogenes but are known to be 139 sequences that are flagged as possible pseudogenes but are known to be
137 functional tRNAs. 140 functional tRNAs.
138 141
139 ----- 142 -----
140 143
141 **Show both primary and secondary structure score components to covariance model bit scores** 144 **Show both primary and secondary structure score components to covariance model bit scores**
142 145
143 This option displays the breakdown of the two components of the 146 This option displays the breakdown of the two components of the
144 covariance model bit score. Since tRNA pseudogenes often have one 147 covariance model bit score. Since tRNA pseudogenes often have one
145 very low component (good secondary structure but poor primary sequence 148 very low component (good secondary structure but poor primary sequence
146 similarity to the tRNA model, or vice versa), this information may be 149 similarity to the tRNA model, or vice versa), this information may be
147 useful in deciding whether a low-scoring tRNA is likely to be a 150 useful in deciding whether a low-scoring tRNA is likely to be a
148 pseudogene. The heuristic pseudogene detection filter uses this 151 pseudogene. The heuristic pseudogene detection filter uses this
149 information to flag possible pseudogenes -- use this option to see why 152 information to flag possible pseudogenes -- use this option to see why
150 a hit is marked as a possible pseudogene. The user may wish to 153 a hit is marked as a possible pseudogene. The user may wish to
151 examine score breakdowns from known tRNAs in the organism of interest 154 examine score breakdowns from known tRNAs in the organism of interest
152 to get a frame of reference. 155 to get a frame of reference.
153 156
154 ----- 157 -----
155 158
181 AAAGGGTATAGGTTCTTCTTCAGATTCATATCACCAACAGTTTGAATATC 184 AAAGGGTATAGGTTCTTCTTCAGATTCATATCACCAACAGTTTGAATATC
182 CATTGCTTTCAGTTGAGCTTCGCATACACGACCAATTCCTCCAACCTAAA 185 CATTGCTTTCAGTTGAGCTTCGCATACACGACCAATTCCTCCAACCTAAA
183 AAATTATCTAGGTAAAACTAGAAGGTTATGCTTTAATAGTCTCACCTTAC 186 AAATTATCTAGGTAAAACTAGAAGGTTATGCTTTAATAGTCTCACCTTAC
184 GAATCGGTAAATCCTTCAAAAACTCCATAATCGCGTTTTTATCATTTTCT 187 GAATCGGTAAATCCTTCAAAAACTCCATAATCGCGTTTTTATCATTTTCT
185 ..... 188 .....
186 - organisim : Mixed (general tRNA model) 189 - organism : Mixed (general tRNA model)
187 - mode : Default 190 - mode : Default
188 - disable pseudogene checking : not checked 191 - disable pseudogene checking : not checked
189 - Show both primary and secondary structure score components to covariance model bit scores : not checked 192 - Show both primary and secondary structure score components to covariance model bit scores : not checked
190 - Show codons instead of tRNA anticodons : not checked 193 - Show codons instead of tRNA anticodons : not checked
191 194
208 211
209 Todd M. Lowe and Sean R. Eddy 212 Todd M. Lowe and Sean R. Eddy
210 tRNAscan-SE: A Program for Improved Detection of Transfer RNA Genes in Genomic Sequence Nucl. Acids Res. (1997) 25(5): 0955-964 213 tRNAscan-SE: A Program for Improved Detection of Transfer RNA Genes in Genomic Sequence Nucl. Acids Res. (1997) 25(5): 0955-964
211 doi:10.1093/nar/25.5.0955 214 doi:10.1093/nar/25.5.0955
212 215
213 </help> 216 </help>
214
215 </tool> 217 </tool>