diff tRNAscan.xml @ 2:0fef99b5f63f draft default tip

apply patch from Nicola Soranzo

--- a/tRNAscan.xml	Tue Mar 19 16:56:25 2013 -0400
+++ b/tRNAscan.xml	Sun Mar 24 14:35:48 2013 -0400
@@ -1,43 +1,42 @@
-<tool id="trnascan" name="tRNAscan" version="0.2.1">
+<tool id="trnascan" name="tRNAscan" version="0.2.2">
     <description>tRNA Scan</description>
     <requirements>
         <requirement type="package" version="1.3.1">tRNAscan-SE</requirement>
+        <requirement type="python-module">biopython</requirement>
     </requirements>
     <command interpreter="python">
         tRNAscan.py $organism $mode $showPrimSecondOpt $disablePseudo $showCodons -o $tabular_output $inputfile $fasta_output
     </command>
     <inputs>
         <param name="inputfile" type="data" format="fasta" label="Genome Sequence" help="Dataset missing? See TIP below"/>
-        <param name="organism" type="select" format="text">
-            <label>Select Organsim</label>
+        <param name="organism" type="select" label="Select Organism">
+            <option value="">Eukaryotic</option>
             <option value="-G">general tRNA model</option>
             <option value="-B">Bacterial</option>
             <option value="-A">Archaeal</option>
             <option value="-O">Mitochondrial/Chloroplast</option>
         </param>
-        <param name="mode" type="select" format="text">
-            <label>Select Mode</label>		
-            <option value=""> Default</option>
+        <param name="mode" type="select" label="Select Mode">
+            <option value="">Default</option>
             <option value="-C">Covariance model analysis only (slow)</option>
             <option value="-T">tRNAscan only</option>
             <option value="-E">EufindtRNA only</option>
             <option value="--infernal">Infernal cm analysis (max sensitivity, very slow)</option>
             <option value="--newscan">Infernal and new cm models</option>
         </param>
-        <param name='disablePseudo' type='boolean' label='Disable pseudo gene checking' truevalue='-D' falsevalue='' >	</param>
-        <param name='showPrimSecondOpt' type='boolean' label='Show primary and secondary structure components to Cove scores' truevalue="-H" falsevalue=''></param>
-        <param name='showCodons' type='boolean' label='Show codons instead of tRNA anticodons' truevalue='-N' falsevalue=''></param>
+        <param name="disablePseudo" type="boolean" label="Disable pseudogene checking" truevalue="-D" falsevalue="" />
+        <param name="showPrimSecondOpt" type="boolean" label="Show primary and secondary structure components to Cove scores" truevalue="-H" falsevalue="" />
+        <param name="showCodons" type="boolean" label="Show codons instead of tRNA anticodons" truevalue="-N" falsevalue="" />
     </inputs>
     <outputs>
-        <data format="tabular" name="tabular_output"/>
-        <data format="fasta" name="fasta_output"/>
+        <data format="tabular" name="tabular_output" label="${tool.name} on ${on_string}: tabular" />
+        <data format="fasta" name="fasta_output" label="${tool.name} on ${on_string}: fasta" />
     </outputs>
     <tests>
         <test>
         </test>
     </tests>
-
-<help>
+    <help>
 
 .. class:: warningmark
 
@@ -56,26 +55,30 @@
 
 -----
 
-**Organisim**
+**Organism**
+
+- search for eukaryotic cytoplasmic tRNAs:
+
+    This is the default.
 
 - use general tRNA model:
 
 	This option selects the general tRNA covariance model that was trained
-	on tRNAs from all three phylogenetic domains (archaea, bacteria, and
-	eukarya).  This mode can be used when analyzing a mixed collection of
+	on tRNAs from all three phylogenetic domains (Archaea, Bacteria, and
+	Eukarya). This mode can be used when analyzing a mixed collection of
 	sequences from more than one phylogenetic domain, with only slight
-	loss of sensitivity and selectivity.  The original publication
+	loss of sensitivity and selectivity. The original publication
 	describing this program and tRNAscan-SE version 1.0 used this general
-	tRNA model exclusively.  If you wish to compare scores to those found
-	in the paper or scans using v1.0, use this option.  Use of this option
+	tRNA model exclusively. If you wish to compare scores to those found
+	in the paper or scans using v1.0, use this option. Use of this option
 	is compatible with all other search mode options described in this
 	section.
 
 - search for bacterial tRNAs
 
-	This option selects the bacterial covariace model for tRNA analysis,
+	This option selects the bacterial covariance model for tRNA analysis,
 	and loosens the search parameters for EufindtRNA to improve detection
-	of bacterial tRNAs.  Use of this mode with bacterial sequences
+	of bacterial tRNAs. Use of this mode with bacterial sequences
 	will also improve bounds prediction of the 3' end (the terminal CAA
 	triplet).
 
@@ -88,11 +91,11 @@
 - search for organellar (mitochondrial/chloroplast) tRNAs
 
 	This parameter bypasses the fast first-pass scanners that are poor at
-	detecting organellar tRNAs and runs Cove analysis only.  Since true
+	detecting organellar tRNAs and runs Cove analysis only. Since true
 	organellar tRNAs have been found to have Cove scores between 15 and 20
-	bits, the search cutoff is lowered from 20 to 15 bits.  Also,
+	bits, the search cutoff is lowered from 20 to 15 bits. Also,
 	pseudogene checking is disabled since it is only applicable to
-	eukaryotic cytoplasmic tRNA pseudogenes.  Since Cove-only mode is
+	eukaryotic cytoplasmic tRNA pseudogenes. Since Cove-only mode is
 	used, searches will be very slow (see -C option below) relative to the
 	default mode.
 
@@ -105,22 +108,22 @@
 	Directs tRNAscan-SE to analyze sequences using Cove analysis only.
 	This option allows a slightly more sensitive search than the default
 	tRNAscan + EufindtRNA -> Cove mode, but is much slower (by approx. 250
-	to 3,000 fold).  Output format and other program defaults are
+	to 3,000 fold). Output format and other program defaults are
 	otherwise identical to the normal analysis.
 
 - search using Eukaryotic tRNA finder (EufindtRNA) only:
 
-	This option runs EufindtRNA alone to search for tRNAs.  Since Cove is
+	This option runs EufindtRNA alone to search for tRNAs. Since Cove is
 	not being used as a secondary filter to remove false positives, this
 	run mode defaults to "Normal" parameters which more closely
 	approximates the sensitivity and selectivity of the original algorithm
 	describe by Pavesi and colleagues.
 
-- search using tRNAscan only (defaults to strict search params)
+- search using tRNAscan only (defaults to strict search parameters)
 
-	Directs tRNAscan-SE to use only tRNAscan to analyze sequences.  This
+	Directs tRNAscan-SE to use only tRNAscan to analyze sequences. This
 	mode will cause tRNAscan to default to using "strict" parameters
-	(similar to tRNAscan version 1.3 operation).  This mode of operation
+	(similar to tRNAscan version 1.3 operation). This mode of operation
 	is faster (about 3-5 times faster than default mode analysis), but
 	will result in approximately 0.2 to 0.6 false positive tRNAs per Mbp,
 	decreased sensitivity, and less reliable prediction of anticodons,
@@ -131,7 +134,7 @@
 **disable pseudogene checking**
 
 	Manually disable checking tRNAs for poor primary or secondary
-	structure scores often indicative of eukaryotic pseudogenes.  This
+	structure scores often indicative of eukaryotic pseudogenes. This
 	will slightly speed the program and may be necessary for non-eukaryotic
 	sequences that are flagged as possible pseudogenes but are known to be
 	functional tRNAs.
@@ -141,13 +144,13 @@
 **Show both primary and secondary structure score components to covariance model bit scores**
 
 	This option displays the breakdown of the two components of the
-	covariance model bit score.  Since tRNA pseudogenes often have one
+	covariance model bit score. Since tRNA pseudogenes often have one
 	very low component (good secondary structure but poor primary sequence
 	similarity to the tRNA model, or vice versa), this information may be
 	useful in deciding whether a low-scoring tRNA is likely to be a
-	pseudogene.  The heuristic pseudogene detection filter uses this
+	pseudogene. The heuristic pseudogene detection filter uses this
 	information to flag possible pseudogenes -- use this option to see why
-	a hit is marked as a possible pseudogene.  The user may wish to
+	a hit is marked as a possible pseudogene. The user may wish to
 	examine score breakdowns from known tRNAs in the organism of interest 
 	to get a frame of reference.
 
@@ -183,7 +186,7 @@
 	AAATTATCTAGGTAAAACTAGAAGGTTATGCTTTAATAGTCTCACCTTAC
 	GAATCGGTAAATCCTTCAAAAACTCCATAATCGCGTTTTTATCATTTTCT
 	.....
-	- organisim : Mixed (general tRNA model)
+	- organism : Mixed (general tRNA model)
 	- mode : Default
 	- disable pseudogene checking : not checked
 	- Show both primary and secondary structure score components to covariance model bit scores : not checked
@@ -210,6 +213,5 @@
 tRNAscan-SE: A Program for Improved Detection of Transfer RNA Genes in Genomic Sequence Nucl. Acids Res. (1997) 25(5): 0955-964
 doi:10.1093/nar/25.5.0955 
 
- </help>
-
+    </help>
 </tool>