Mercurial > repos > bvalot > panisa

changeset 0:349c2fbd38a0 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
"planemo upload for repository https://github.com/bvalot/panISa commit 13edfab02a5da9e374c38ecbd0e229ec0f8d53bb"
author bvalot
date Thu, 16 Jun 2022 12:37:30 +0000
parents
children
files isfinder_search.xml panisa.xml test-data/input.bam test-data/isfinder.txt test-data/panisa.txt
diffstat 5 files changed, 165 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/isfinder_search.xml	Thu Jun 16 12:37:30 2022 +0000
@@ -0,0 +1,87 @@
+<tool id="isfinder_search_wrapper" name="ISFinder search" version="0.1.6">
+  <description>Search IS homology in ISFinder from panISa output</description>
+  <requirements>
+	<requirement type="package" version="0.1.6">panisa</requirement>
+  </requirements>
+  <stdio>
+    <exit_code range="1:" level="fatal" />
+  </stdio>  
+  <version_command>ISFinder_search.py -v</version_command>
+  <command>
+    ISFinder_search.py
+    -r ' '
+    #if str($length)
+      -l $length
+    #end if
+    #if str($identity)
+      -i $identity
+    #end if
+    #if str($evalue)
+	  -e $evalue
+    #end if
+    #if str($alignment)
+	  -a $alignment
+    #end if
+	#for $panisa in $panisa_list:
+        #if $panisa:
+            '$panisa'
+        #end if
+    #end for
+	#for $panisa in $panisa_list:
+        #if $panisa:
+            | sed -e "~s/`echo $panisa.file_name | sed -e
+			'~s/.*\///'`/$panisa.name.replace('panISa on ', '')/"
+        #end if
+	#end for
+	> '$output'
+	2> /dev/null
+  </command>
+  <inputs>
+    <param name="panisa_list" type="data"
+		   format="tabular" multiple="true"
+		   label="Panisa result to merge"
+		   help="Panisa output in tabular format" />
+	<param name="length" type="integer" value="30"
+		   optional="true"
+		   label="Length of the IRR-IRL search" />
+	<param name="identity" type="integer" value="90"
+		   optional="true" min="0" max="100"
+		   label="Percentage of expected identity" />
+	<param name="evalue" type="float" value="0.001"
+		   optional="true"
+		   label="Expected max evalue" />
+	<param name="alignment" type="integer" value="80"
+		   optional="true" min="0" max="100"
+		   label="Percentage of expected coverage" />	
+  </inputs>
+  <outputs>
+    <data name="output" format="tabular" label="${tool.name} on	${on_string}">
+	  <!-- <actions> -->
+      <!--   <action name="column_names" type="metadata" default="Chromosome,End position,End clipped reads,Direct repeats,Start position,Start clipped reads,Inverted repeats,Left sequence,Right sequence" /> -->
+      <!-- </actions> -->
+	</data>
+  </outputs>
+  <tests>
+	<test expect_num_outputs="1">
+      <param name="panisa_list" ftype="tabular" value="panisa.txt" />
+      <output name="output" file="isfinder.txt" ftype="tabular" />	  
+	</test>
+  </tests>
+  <help>
+**What it does**
+
+Automate search integrative element (IS) homology in ISFinder from panISa output.
+
+**License and citation**
+
+This Galaxy tool is Copyright © 2018 `B. Valot` and is released under the `GPL3 license`.
+
+PanISa program was publised recently:
+
+Treepong, P., Guyeux, C., Meunier, A., Couchoud, C., Hocquet, D. et Valot, B. (2018). PanISa : Ab initio detection of insertion sequences in bacterial genomes from short read sequence
+data. Bioinformatics.
+  </help>
+  <citations>
+	<citation type="doi">10.1093/bioinformatics/bty479</citation>
+  </citations>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/panisa.xml	Thu Jun 16 12:37:30 2022 +0000
@@ -0,0 +1,74 @@
+<tool id="panisa2_wrapper" name="PanISa: IS search" version="0.1.6">
+  <description>Search integrative element (IS) insertion on a genome using BAM alignment</description>
+  <requirements>
+	<requirement type="package" version="0.1.6">panisa</requirement>
+  </requirements>
+  <stdio>
+    <exit_code range="1:" level="fatal" />
+  </stdio>
+  <version_command>panISa.py -v</version_command>
+  <command>
+    panISa.py
+    #if str($quality)
+      -q $quality
+    #end if
+    #if str($minimun)
+      -m $minimun
+    #end if
+    #if str($size)
+      -s $size
+    #end if
+    #if str($percentage)
+	  -p $percentage
+    #end if
+	'$bam' > '$output'
+  </command>
+  <inputs>
+    <param name="bam" type="data"
+		   format="bam"
+		   label="Alignment result"
+		   help="Bam format" />
+	<param name="quality" type="integer" value="20"
+		   optional="true"
+		   label="Minimun alignment quality value to conserve a clipped" />
+	<param name="minimun" type="integer" value="5"
+		   optional="true"
+		   label="Minimun number of clipped reads to look at IS on a position" />
+	<param name="size" type="integer" value="20"
+		   optional="true"
+		   label="Maximun size of direct repeat region" />
+	<param name="percentage" type="float" value="0.8"
+		   optional="true"
+		   label="Minimum percentage of same base to create consensus" />
+  </inputs>
+  <outputs>
+    <data name="output" format="tabular" label="panISa on ${bam.name}">
+	  <!-- <actions> -->
+      <!--   <action name="column_names" type="metadata" default="Chromosome,End position,End clipped reads,Direct repeats,Start position,Start clipped reads,Inverted repeats,Left sequence,Right sequence" /> -->
+      <!-- </actions> -->
+	</data>
+  </outputs>
+  <tests>
+	<test expect_num_outputs="1">
+      <param name="bam" value="input.bam" />
+      <output name="output" file="panisa.txt" ftype="tabular" />	  
+	</test>
+  </tests>
+  <help>
+**What it does**
+
+Search integrative element (IS) insertion on a genome using BAM alignment.
+
+**License and citation**
+
+This Galaxy tool is Copyright © 2018 `B. Valot` and is released under the `GPL3 license`.
+
+PanISa program was publised :
+
+Treepong, P., Guyeux, C., Meunier, A., Couchoud, C., Hocquet, D. et Valot, B. (2018). PanISa : Ab initio detection of insertion sequences in bacterial genomes from short read sequence
+data. Bioinformatics.
+  </help>
+  <citations>
+	<citation type="doi">10.1093/bioinformatics/bty479</citation>
+  </citations>
+</tool>
Binary file test-data/input.bam has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/isfinder.txt	Thu Jun 16 12:37:30 2022 +0000
@@ -0,0 +1,2 @@
+Sample	Chromosome	Start_Position	Stop_Position	Potential_sequence	Potential_IS	Alignment
+panisa.txt	contig-2000003	334442	334451	CAATGTCATCAACTTTGGAAATTATCCATA-GCAGGGCTGCAGCTTAGGTTGATGACATTG	ISPa1635	two side
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/panisa.txt	Thu Jun 16 12:37:30 2022 +0000
@@ -0,0 +1,2 @@
+Chromosome	End position	End clipped reads	Direct repeats	Start position	Start clipped reads	Inverted repeats	Left sequence	Right sequence
+contig-2000003	334451	59	GTCCTGGAGC	334442	40	No IR	CAATGTCATCAACTTTGGAAATTATCCATAAATATCATATAATTAGCGCTCAAATCAGTGCATGGGAGNNGNC	NNNNNGGCCATGGCGGCTGGCTGCTTCGGGGGGCTTGCCTTGGGCAGGGCTGCAGCTTAGGTTGATGACATTG