annotate fasta_remove_id.xml @ 4:90f549221976 draft default tip

planemo upload commit f33bdf952d796c5d7a240b132af3c4cbd102decc

<tool id="edu.tamu.cpt.fasta.remove_desc" name="Remove Description" version="19.1.0.0">
    <description>from fasta file</description>
    <macros>
        <import>macros.xml</import>
    
    </macros>
    <expand macro="requirements"/>
    <command detect_errors="aggressive"><![CDATA[
'$__tool_directory__/fasta_remove_id.py'
@SEQUENCE@
> '$out' ]]>
</command>
    <inputs>
        <expand macro="input/fasta"/>
    </inputs>
    <outputs>
        <data format="fasta" name="out"/>
    </outputs>
    <tests>
        <test>
            <param name="sequences" value="T7_RemIDIn.fasta"/>
            <output name="out" file="T7_RemIDOut.fasta"/>
        </test>
    </tests>
    <help>
**What it does**

From an input FASTA file, removes the "description" field (all characters after
the first space in the top line until a return) after the FASTA ID (from the &gt; 
to the first space).
		
This is a permanent removal of the description. It is useful for tools that 
behave in unexpected ways if it is present, e.g. Glimmer/GeneMarkS.

**Example Input/Output**

For an input FASTA file::

	&gt;1|random sequence|A: 0.25|C: 0.25|G: 0.25|T: 0.25|length: 288 bp
	acttacgcggagagatgagaccaacgctcgcctaggggcacgcttgtaattgacttatct
	&gt;2|random sequence|A: 0.25|C: 0.25|G: 0.25|T: 0.25|length: 232 bp
	gttggggacccacctatcagggagtgtagtagtataagactgtccaataccccccaacat

The resulting FASTA will contain only IDs without a description::

	&gt;1|random
	acttacgcggagagatgagaccaacgctcgcctaggggcacgcttgtaattgacttatct
	&gt;2|random
	gttggggacccacctatcagggagtgtagtagtataagactgtccaataccccccaacat
	</help>
    <expand macro="citations"/>
</tool>