Mercurial > repos > curtisross > remove_fasta_description
changeset 1:d85af06ab3db draft
Uploaded XML
author | curtisross |
---|---|
date | Thu, 23 Sep 2021 16:25:45 +0000 |
parents | 2b42545705fa |
children | 690fb5dbef1f |
files | fasta_remove_id.xml |
diffstat | 1 files changed, 57 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fasta_remove_id.xml Thu Sep 23 16:25:45 2021 +0000 @@ -0,0 +1,57 @@ +<?xml version="1.0"?> +<tool id="edu.tamu.cpt.fasta.remove_desc" name="Remove Description" version="19.1.0.0"> + <description>from fasta file</description> + <macros> + <import>macros.xml</import> + <import>cpt-macros.xml</import> + </macros> + <expand macro="requirements"/> + <command detect_errors="aggressive"> +$__tool_directory__/fasta_remove_id.py +@SEQUENCE@ +> $out +</command> + <inputs> + <expand macro="input/fasta" /> + </inputs> + <outputs> + <data format="fasta" name="out" /> + </outputs> + <tests> + <test> + <param name="sequences" value="T7_DESC.fasta"/> + <output name="out" file="T7_CLEAN.fasta" /> + </test> + <test> + <param name="sequences" value="regex.a3.fa"/> + <output name="out" file="regex.a3.clean.fa" /> + </test> + </tests> + <help> +**What it does** + +From an input FASTA file, removes the "description" field (all characters after +the first space in the top line until a return) after the FASTA ID (from the > +to the first space). + +This is a permanent removal of the description. It is useful for tools that +behave in unexpected ways if it is present, e.g. Glimmer/GeneMarkS. + +**Example Input/Output** + +For an input FASTA file:: + + >1|random sequence|A: 0.25|C: 0.25|G: 0.25|T: 0.25|length: 288 bp + acttacgcggagagatgagaccaacgctcgcctaggggcacgcttgtaattgacttatct + >2|random sequence|A: 0.25|C: 0.25|G: 0.25|T: 0.25|length: 232 bp + gttggggacccacctatcagggagtgtagtagtataagactgtccaataccccccaacat + +The resulting FASTA will contain only IDs without a description:: + + >1|random + acttacgcggagagatgagaccaacgctcgcctaggggcacgcttgtaattgacttatct + >2|random + gttggggacccacctatcagggagtgtagtagtataagactgtccaataccccccaacat + </help> + <expand macro="citations" /> +</tool>