Mercurial > repos > davidvanzessen > argalaxy_tools
changeset 20:9185c3dfc679 draft
Uploaded
| author | davidvanzessen |
|---|---|
| date | Fri, 27 Jan 2017 03:44:18 -0500 |
| parents | 3ef457aa5df6 |
| children | 9c843eb06416 |
| files | complete.sh.old complete_immunerepertoire.xml.old experimental_design.xml igblastn.xml igparse.xml imgt_loader.xml imgt_loader/imgt_loader.r imgt_loader/imgt_loader.sh report_clonality/RScript.r report_clonality/RScript.r.old report_clonality/r_wrapper.sh.old report_clonality_igg.xml |
| diffstat | 12 files changed, 1901 insertions(+), 9 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/complete.sh.old Fri Jan 27 03:44:18 2017 -0500 @@ -0,0 +1,67 @@ +#!/bin/bash +set -e +inputFiles=($1) +outputDir=$3 +outputFile=$3/index.html #$1 +clonalType=$4 +species=$5 +locus=$6 +filterproductive=$7 +clonality_method=$8 + +html=$2 +dir="$(cd "$(dirname "$0")" && pwd)" +array=("$@") +echo "<html><h3>Progress</h3><table><tr><td>info</td></tr>" > $html +echo "<tr><td>-----------------------------------</td></tr>" >> $html + +#mkdir $PWD/igblastdatabase +#unzip $dir/database.zip -d $PWD/igblastdatabase/ +#export IGDATA=$PWD/igblastdatabase/ + +id="" +forwardSlash="/" +mergerInput=() +echo "Before loop" +count=1 +for current in "${inputFiles[@]}" +do + if [[ "$current" != *"$forwardSlash"* ]]; then + id="$current" + mergerInput+=($id) + count=1 + continue + fi + echo "working on $current" + fileName=$(basename $current) + fileName="${fileName%.*}" + parsedFileName="$PWD/$fileName.parsed" + f=$(file $current) + zipType="Zip archive" + zxType="XZ compressed data" + if [[ "$f" == *"$zipType"* ]] || [[ "$f" == *"$zxType"* ]] + then + echo "<tr><td>Sample $count of patient $id is an archive file, using IMGT Loader</td></tr>" >> $html + fileName=$(basename $current) + bash ${dir}/imgt_loader/imgt_loader.sh $current $parsedFileName "${fileName}" + else + echo "<tr><td>Sample $count of patient $id is not a zip file so assuming fasta/fastq, using igBLASTn</td></tr>" >> $html + bash ${dir}/igblast/igblast.sh $current "$species" $locus $parsedFileName + fi + mergerInput+=($parsedFileName) + count=$((count+1)) +done + +echo "<tr><td>-----------------------------------</td></tr>" >> $html +echo "<tr><td>merging</td></tr>" >> $html + +bash $dir/experimental_design/experimental_design.sh ${mergerInput[*]} $PWD/merged.txt + +echo "<tr><td>done</td></tr>" >> $html +echo "<tr><td>-----------------------------------</td></tr>" >> $html +echo "<tr><td>plotting</td></tr>" >> $html + +echo "after ED" + +bash $dir/report_clonality/r_wrapper.sh $PWD/merged.txt $2 $outputDir $clonalType "$species" "$locus" $filterproductive $clonality_method +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/complete_immunerepertoire.xml.old Fri Jan 27 03:44:18 2017 -0500 @@ -0,0 +1,203 @@ +<tool id="complete_immunerepertoire_igg" name="Immune Repertoire pipeline" version="1.0"> + <description> </description> + <command interpreter="bash"> +complete.sh " +#for $i, $f in enumerate($patients) + "${f.id}" + #for $j, $g in enumerate($f.samples) + ${g.sample} + #end for +#end for +" $out_file $out_file.files_path "$clonaltype" +#if $gene_selection.source == "imgtdb" + "${gene_selection.species}" "${gene_selection.locus}" $filterproductive ${clonality_method} +#else + "custom" "${gene_selection.vgenes};${gene_selection.dgenes};${gene_selection.jgenes}" $filterproductive $clonality_method +#end if + </command> + <inputs> + <repeat name="patients" title="Donor" min="1" default="1"> + <repeat name="samples" title="Sample" min="1" default="1"> + <param name="sample" type="data" label="Sample to Process" /> + </repeat> + <param name="id" type="text" label="ID" /> + </repeat> + <param name="clonaltype" type="select" label="Clonal Type Definition"> + <option value="none">Don't remove duplicates based on clonaltype</option> + <option value="Top.V.Gene,CDR3.Seq">Top.V.Gene, CDR3 (AA)</option> + <option value="Top.V.Gene,CDR3.Seq.DNA">Top.V.Gene, CDR3 (nt)</option> + <option value="Top.V.Gene,Top.J.Gene,CDR3.Seq">Top.V.Gene, Top.J.Gene, CDR3 (AA)</option> + <option value="Top.V.Gene,Top.J.Gene,CDR3.Seq.DNA">Top.V.Gene, Top.J.Gene, CDR3 (nt)</option> + <option value="Top.V.Gene,Top.D.Gene,Top.J.Gene,CDR3.Seq.DNA">Top.V.Gene, Top.D.Gene, Top.J.Gene, CDR3 (nt)</option> + </param> + + <conditional name="gene_selection" > + <param name="source" type="select" label="Order of V(D)J genes in graphs" help="" > + <option value="imgtdb" selected="true">IMGT-DB</option> + <option value="custom">User defined</option> + </param> + <when value="imgtdb"> + <param name="species" type="select" label="Species"> + <option value="Homo sapiens functional">Homo sapiens functional</option> + <option value="Homo sapiens">Homo sapiens</option> + <option value="Homo sapiens non-functional">Homo sapiens non-functional</option> + <option value="Bos taurus">Bos taurus</option> + <option value="Bos taurus functional">Bos taurus functional</option> + <option value="Bos taurus non-functional">Bos taurus non-functional</option> + <option value="Camelus dromedarius">Camelus dromedarius</option> + <option value="Camelus dromedarius functional">Camelus dromedarius functional</option> + <option value="Camelus dromedarius non-functional">Camelus dromedarius non-functional</option> + <option value="Canis lupus familiaris">Canis lupus familiaris</option> + <option value="Canis lupus familiaris functional">Canis lupus familiaris functional</option> + <option value="Canis lupus familiaris non-functional">Canis lupus familiaris non-functional</option> + <option value="Danio rerio">Danio rerio</option> + <option value="Danio rerio functional">Danio rerio functional</option> + <option value="Danio rerio non-functional">Danio rerio non-functional</option> + <option value="Macaca mulatta">Macaca mulatta</option> + <option value="Macaca mulatta functional">Macaca mulatta functional</option> + <option value="Macaca mulatta non-functional">Macaca mulatta non-functional</option> + <option value="Mus musculus">Mus musculus</option> + <option value="Mus musculus functional">Mus musculus functional</option> + <option value="Mus musculus non-functional">Mus musculus non-functional</option> + <option value="Mus spretus">Mus spretus</option> + <option value="Mus spretus functional">Mus spretus functional</option> + <option value="Mus spretus non-functional">Mus spretus non-functional</option> + <option value="Oncorhynchus mykiss">Oncorhynchus mykiss</option> + <option value="Oncorhynchus mykiss functional">Oncorhynchus mykiss functional</option> + <option value="Oncorhynchus mykiss non-functional">Oncorhynchus mykiss non-functional</option> + <option value="Ornithorhynchus anatinus">Ornithorhynchus anatinus</option> + <option value="Ornithorhynchus anatinus functional">Ornithorhynchus anatinus functional</option> + <option value="Ornithorhynchus anatinus non-functional">Ornithorhynchus anatinus non-functional</option> + <option value="Oryctolagus cuniculus">Oryctolagus cuniculus</option> + <option value="Oryctolagus cuniculus functional">Oryctolagus cuniculus functional</option> + <option value="Oryctolagus cuniculus non-functional">Oryctolagus cuniculus non-functional</option> + <option value="Rattus norvegicus">Rattus norvegicus</option> + <option value="Rattus norvegicus functional">Rattus norvegicus functional</option> + <option value="Rattus norvegicus non-functional">Rattus norvegicus non-functional</option> + <option value="Sus scrofa">Sus scrofa</option> + <option value="Sus scrofa functional">Sus scrofa functional</option> + <option value="Sus scrofa non-functional">Sus scrofa non-functional</option> + </param> + + <param name="locus" type="select" label="Locus"> + <option value="TRA">TRA</option> + <option value="TRD">TRD</option> + <option value="TRG">TRG</option> + <option value="TRB">TRB</option> + <option value="IGH">IGH</option> + <option value="IGI">IGI</option> + <option value="IGK">IGK</option> + <option value="IGL">IGL</option> + </param> + </when> + <when value="custom"> + <param name="species" type="hidden" value="custom" size="50" /> + <param name="vgenes" type="text" label="V Genes, add the custom genes comma seperated, no spaces" size="100" /> + <param name="dgenes" type="text" label="D Genes" size="100" /> + <param name="jgenes" type="text" label="J Genes" size="100" /> + </when> + </conditional> + + <param name="filterproductive" type="select" label="Remove the unproductive sequences from graphs "> + <option value="yes">Yes</option> + <option value="no">No</option> + </param> + + <param name="clonality_method" type="select" label="Old clonality algorithm or the newer R package"> + <option value="old">Old</option> + <option value="boyd">R Package (needs 3 replicate minimum)</option> + </param> + </inputs> + <outputs> + <data format="html" name="out_file" /> + </outputs> + <requirements> + <requirement type="package" version="0.6">igblastwrp</requirement> + <requirement type="package" version="3.3">weblogo</requirement> + <!--<requirement type="package" version="0.20">circostools</requirement>--> + </requirements> + <help> + The entire Immune Repertoire pipeline as a single tool, input several FASTA files or IMGT zip/txz files, give them an ID and it will BLAST/parse, merge and plot them. + + .. class:: warningmark + +Custom gene ordering based on position on genome: + +**Human** + +IGH:: + + V: + IGHV7-81,IGHV3-74,IGHV3-73,IGHV3-72,IGHV3-71,IGHV2-70,IGHV1-69,IGHV3-66,IGHV3-64,IGHV4-61,IGHV4-59,IGHV1-58,IGHV3-53,IGHV3-52,IGHV5-a,IGHV5-51,IGHV3-49,IGHV3-48,IGHV3-47,IGHV1-46,IGHV1-45,IGHV3-43,IGHV4-39,IGHV3-35,IGHV4-34,IGHV3-33,IGHV4-31,IGHV4-30-4,IGHV4-30-2,IGHV3-30-3,IGHV3-30,IGHV4-28,IGHV2-26,IGHV1-24,IGHV3-23,IGHV3-22,IGHV3-21,IGHV3-20,IGHV3-19,IGHV1-18,IGHV3-15,IGHV3-13,IGHV3-11,IGHV3-9,IGHV1-8,IGHV3-7,IGHV2-5,IGHV7-4-1,IGHV4-4,IGHV4-b,IGHV1-3,IGHV1-2,IGHV6-1 + D: + IGHD1-1,IGHD2-2,IGHD3-3,IGHD6-6,IGHD1-7,IGHD2-8,IGHD3-9,IGHD3-10,IGHD4-11,IGHD5-12,IGHD6-13,IGHD1-14,IGHD2-15,IGHD3-16,IGHD4-17,IGHD5-18,IGHD6-19,IGHD1-20,IGHD2-21,IGHD3-22,IGHD4-23,IGHD5-24,IGHD6-25,IGHD1-26,IGHD7-27 + J: + IGHJ1,IGHJ2,IGHJ3,IGHJ4,IGHJ5,IGHJ6 + + +IGK:: + + V: + IGKV3D-7,IGKV1D-8,IGKV1D-43,IGKV3D-11,IGKV1D-12,IGKV1D-13,IGKV3D-15,IGKV1D-16,IGKV1D-17,IGKV3D-20,IGKV2D-26,IGKV2D-28,IGKV2D-29,IGKV2D-30,IGKV1D-33,IGKV1D-39,IGKV2D-40,IGKV2-40,IGKV1-39,IGKV1-33,IGKV2-30,IGKV2-29,IGKV2-28,IGKV1-27,IGKV2-24,IGKV3-20,IGKV1-17,IGKV1-16,IGKV3-15,IGKV1-13,IGKV1-12,IGKV3-11,IGKV1-9,IGKV1-8,IGKV1-6,IGKV1-5,IGKV5-2,IGKV4-1 + J: + IGKJ1,IGKJ2,IGKJ3,IGKJ4,IGKJ5 + + +IGL:: + + V: + IGLV4-69,IGLV8-61,IGLV4-60,IGLV6-57,IGLV5-52,IGLV1-51,IGLV9-49,IGLV1-47,IGLV7-46,IGLV5-45,IGLV1-44,IGLV7-43,IGLV1-41,IGLV1-40,IGLV5-39,IGLV5-37,IGLV1-36,IGLV3-27,IGLV3-25,IGLV2-23,IGLV3-22,IGLV3-21,IGLV3-19,IGLV2-18,IGLV3-16,IGLV2-14,IGLV3-12,IGLV2-11,IGLV3-10,IGLV3-9,IGLV2-8,IGLV4-3,IGLV3-1 + J: + IGLJ1,IGLJ2,IGLJ3,IGLJ6,IGLJ7 + + +TRB:: + + V: + TRBV2,TRBV3-1,TRBV4-1,TRBV5-1,TRBV6-1,TRBV4-2,TRBV6-2,TRBV4-3,TRBV6-3,TRBV7-2,TRBV6-4,TRBV7-3,TRBV9,TRBV10-1,TRBV11-1,TRBV10-2,TRBV11-2,TRBV6-5,TRBV7-4,TRBV5-4,TRBV6-6,TRBV5-5,TRBV7-6,TRBV5-6,TRBV6-8,TRBV7-7,TRBV6-9,TRBV7-8,TRBV5-8,TRBV7-9,TRBV13,TRBV10-3,TRBV11-3,TRBV12-3,TRBV12-4,TRBV12-5,TRBV14,TRBV15,TRBV16,TRBV18,TRBV19,TRBV20-1,TRBV24-1,TRBV25-1,TRBV27,TRBV28,TRBV29-1,TRBV30 + D: + TRBD1,TRBD2 + J: + TRBJ1-1,TRBJ1-2,TRBJ1-3,TRBJ1-4,TRBJ1-5,TRBJ1-6,TRBJ2-1,TRBJ2-2,TRBJ2-3,TRBJ2-4,TRBJ2-5,TRBJ2-6,TRBJ2-7 + + +TRA:: + + V: + TRAV1-1,TRAV1-2,TRAV2,TRAV3,TRAV4,TRAV5,TRAV6,TRAV7,TRAV8-1,TRAV9-1,TRAV10,TRAV12-1,TRAV8-2,TRAV8-3,TRAV13-1,TRAV12-2,TRAV8-4,TRAV13-2,TRAV14/DV4,TRAV9-2,TRAV12-3,TRAV8-6,TRAV16,TRAV17,TRAV18,TRAV19,TRAV20,TRAV21,TRAV22,TRAV23/DV6,TRAV24,TRAV25,TRAV26-1,TRAV27,TRAV29/DV5,TRAV30,TRAV26-2,TRAV34,TRAV35,TRAV36/DV7,TRAV38-1,TRAV38-2/DV8,TRAV39,TRAV40,TRAV41 + J: + TRAJ57,TRAJ56,TRAJ54,TRAJ53,TRAJ52,TRAJ50,TRAJ49,TRAJ48,TRAJ47,TRAJ46,TRAJ45,TRAJ44,TRAJ43,TRAJ42,TRAJ41,TRAJ40,TRAJ39,TRAJ38,TRAJ37,TRAJ36,TRAJ34,TRAJ33,TRAJ32,TRAJ31,TRAJ30,TRAJ29,TRAJ28,TRAJ27,TRAJ26,TRAJ24,TRAJ23,TRAJ22,TRAJ21,TRAJ20,TRAJ18,TRAJ17,TRAJ16,TRAJ15,TRAJ14,TRAJ13,TRAJ12,TRAJ11,TRAJ10,TRAJ9,TRAJ8,TRAJ7,TRAJ6,TRAJ5,TRAJ4,TRAJ3 + + +TRG:: + + V: + TRGV9,TRGV8,TRGV5,TRGV4,TRGV3,TRGV2 + J: + TRGJ2,TRGJP2,TRGJ1,TRGJP1 + + +TRD:: + + V: + TRDV1,TRDV2,TRDV3 + D: + TRDD1,TRDD2,TRDD3 + J: + TRDJ1,TRDJ4,TRDJ2,TRDJ3 + + +**Mouse** + +TRB:: + + V: + TRBV1,TRBV2,TRBV3,TRBV4,TRBV5,TRBV12-1,TRBV13-1,TRBV12-2,TRBV13-2,TRBV13-3,TRBV14,TRBV15,TRBV16,TRBV17,TRBV19,TRBV20,TRBV23,TRBV24,TRBV26,TRBV29,TRBV30,TRBV31 + D: + TRBD1,TRBD2 + J: + TRBJ1-1,TRBJ1-2,TRBJ1-3,TRBJ1-4,TRBJ1-5,TRBJ2-1,TRBJ2-2,TRBJ2-3,TRBJ2-4,TRBJ2-5,TRBJ2-6,TRBJ2-7 + + </help> + +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/experimental_design.xml Fri Jan 27 03:44:18 2017 -0500 @@ -0,0 +1,57 @@ +<tool id="experimentaldesign_igg" name="ExperimentalDesign" version="1.0"> + <description> </description> + <command interpreter="bash"> + experimental_design/experimental_design.sh + #for $i, $f in enumerate($patients) + "$f.id" + #for $j, $g in enumerate($f.samples) + ${g.sample} + #end for + #end for + $out_file + </command> + <inputs> + <repeat name="patients" title="Patient" min="1" default="1"> + <repeat name="samples" title="Sample" min="1" default="1"> + <param name="sample" format="tabular" type="data" label="Sample to Process" /> + </repeat> + <param name="id" type="text" label="ID" /> + </repeat> + </inputs> + <outputs> + <data format="tabular" name="out_file"/> + </outputs> + <help> +Takes the ARGalaxy proprietary format and merges several samples and/or patients together. + </help> + <citations> + <!-- Example of annotating a citation using a DOI. --> + <citation type="doi">10.1093/bioinformatics/btq281</citation> + + <!-- Example of annotating a citation using a BibTex entry. --> + <citation type="bibtex">@ARTICLE{Kim07aninterior-point, + author = {Seung-jean Kim and Kwangmoo Koh and Michael Lustig and Stephen Boyd and Dimitry Gorinevsky}, + title = {An interior-point method for large-scale l1-regularized logistic regression}, + journal = {Journal of Machine Learning Research}, + year = {2007}, + volume = {8}, + pages = {1519-1555} + }</citation> + </citations> + <tests> + <test> + <param name="input" value="1.bed"/> + <param name="column" value="1"/> + <param name="order" value="ASC"/> + <param name="style" value="num"/> + <output name="out_file1" file="sort1_num.bed"/> + </test> + <test> + <param name="input" value="7.bed"/> + <param name="column" value="1"/> + <param name="order" value="ASC"/> + <param name="style" value="alpha"/> + <output name="out_file1" file="sort1_alpha.bed"/> + </test> + </tests> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/igblastn.xml Fri Jan 27 03:44:18 2017 -0500 @@ -0,0 +1,107 @@ +<tool id="igblastn" name="igBLASTn" version="0.1.0"> + <description> </description> + <command interpreter="bash"> + igblast/igblast.sh $input $species $locus $output + </command> + <inputs> + <param name="input" type="data" format="fasta" label="Fasta file"/> + <param name="species" type="select" label="Species"> + <option value="human">Homo sapiens</option> + <option value="mouse">Mus musculus</option> + <option value="rat">Rattus norvegicus</option> + <option value="rabbit">Oryctolagus cuniculus</option> + <option value="rhesus_monkey">Macaca mulatta</option> + <option value="BosTaurus">BosTaurus</option> + <option value="CamelusDromedarius">CamelusDromedarius</option> + <option value="CanisLupusFamiliaris">CanisLupusFamiliaris</option> + <option value="DanioRerio">DanioRerio</option> + <option value="MusSpretus">MusSpretus</option> + <option value="OncorhynchusMykiss">OncorhynchusMykiss</option> + <option value="SusScrofa">SusScrofa</option> + <option value="GallusGallus">GallusGallus</option> + <option value="AnasPlatyrhynchos">AnasPlatyrhynchos</option> + </param> + <param name="locus" type="select" label="Locus"> + <option value="TRA">TRA</option> + <option value="TRB">TRB</option> + <option value="TRG">TRG</option> + <option value="TRD">TRD</option> + <option value="IGH">IGH</option> + <option value="IGK">IGK</option> + <option value="IGL">IGL</option> + </param> + </inputs> + <outputs> + <data name="output" format="tabular" type="data" label="${input.name}-igBLASTn aligned"/> + <!--<data name="log" format="text" label="log"/>--> + </outputs> + <requirements> + <requirement type="package" version="0.6">igblastwrp</requirement> + </requirements> + <help> +============ +iReport +============ + +This tool uses the online igBLAST website hosted by NCBI to blast a FASTA file, it retrieves the result and generates a convenient tabular format for further processing. + +**NOTE** + +.. class:: warningmark + +- Everything goes through the servers of NCBI, so if you have sensitive data that that isn't allowed to leave your local network, this isn't the tool the use. + +**USAGE** + +.. class:: infomark + +- This tool uses a free service provided by NCBI, and although there doesn't seem to be any restrictions on usage, avoid unnecessary usage to lighten the load on NCBI's servers. + + +**INPUT** + +This tool accepts FASTA files as input: + +:: + + >lcl|FLN1FA002RWEZA.1| + ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatc + tccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgc + gagagcgatcccccggtattactatgatactagtggcccaaacgactactggggccagggaaccctggtcaccgtctcct + cag + >lcl|FLN1FA001BLION.1| + aggcttgagtggatgggatggatcaacgctggcaatggtaacacaaaatattcacagaagttccagggcagagtcaccat + taccagggacacatccgcgagcacagcctacatggagctgagcagcctgagatctgaagacacggctgtgtattactgtg + cgagagtgggcagcagctggtctgatgcttttgattatctggggccaagggacaatggtcaccgtctcctcag + +**OUTPUT** + +The following data is used for ARGalaxy + ++-----------------+----------------------------------------------+ +| Column name | Column contents | ++-----------------+----------------------------------------------+ +| ID | The Sequence ID provided by the sequencer. | ++-----------------+----------------------------------------------+ +| VDJ Frame | In-frame/Out-frame | ++-----------------+----------------------------------------------+ +| Top V Gene | The best matching V gene found. | ++-----------------+----------------------------------------------+ +| Top D Gene | The best matching D gene found. | ++-----------------+----------------------------------------------+ +| Top J Gene | The best matching J gene found. | ++-----------------+----------------------------------------------+ +| CDR3 Seq | The CDR3 region. | ++-----------------+----------------------------------------------+ +| CDR3 Length | The length of the CDR3 region. | ++-----------------+----------------------------------------------+ +| CDR3 Seq DNA | The CDR3 sequence region. | ++-----------------+----------------------------------------------+ +| CDR3 Length DNA | The length of the CDR3 sequence region. | ++-----------------+----------------------------------------------+ +| Functionality | If sequence is productive/unproductive | ++-----------------+----------------------------------------------+ + + + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/igparse.xml Fri Jan 27 03:44:18 2017 -0500 @@ -0,0 +1,15 @@ +<tool id="igblastparser_igg" name="igBLASTparser" version="0.2.0"> + <description> </description> + <command interpreter="perl"> + igblastparser/igparse.pl $input 0 2>/dev/null | grep -v "D:" | cut -f2- > $output + </command> + <inputs> + <param name="input" type="data" format="text" label="igBLASTn report"/> + </inputs> + <outputs> + <data name="output" format="tabular" label="${input.name}-parsed" /> + </outputs> + <help> + Step 2 of the Immune Repertoire tools, extracts the relevant information needed from the reports generated by igblast (Step 1) + </help> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/imgt_loader.xml Fri Jan 27 03:44:18 2017 -0500 @@ -0,0 +1,48 @@ +<tool id="imgt_loader_igg" name="IMGT Loader" version="1.0"> + <description> </description> + <command interpreter="bash"> + imgt_loader/imgt_loader.sh $in_file $out_file "tmp" + </command> + <inputs> + <param name="in_file" type="data" label="Archive with files" /> + </inputs> + <outputs> + <data format="tabular" name="out_file" label="IMGT Loader on ${in_file.name}"/> + </outputs> + <help> +**INPUT** + +This tool accepts an IMGT/HIGHV-QUEST ZIP file + +**OUTPUT** + +The following data is used for ARGalaxy + ++-----------------+----------------------------------------------+ +| Column name | Column contents | ++-----------------+----------------------------------------------+ +| ID | The Sequence ID provided by the sequencer. | ++-----------------+----------------------------------------------+ +| VDJ Frame | In-frame/Out-frame | ++-----------------+----------------------------------------------+ +| Top V Gene | The best matching V gene found. | ++-----------------+----------------------------------------------+ +| Top D Gene | The best matching D gene found. | ++-----------------+----------------------------------------------+ +| Top J Gene | The best matching J gene found. | ++-----------------+----------------------------------------------+ +| CDR3 Seq | The CDR3 region. | ++-----------------+----------------------------------------------+ +| CDR3 Length | The length of the CDR3 region. | ++-----------------+----------------------------------------------+ +| CDR3 Seq DNA | The CDR3 sequence region. | ++-----------------+----------------------------------------------+ +| CDR3 Length DNA | The length of the CDR3 sequence region. | ++-----------------+----------------------------------------------+ +| Functionality | If sequence is productive/unproductive | ++-----------------+----------------------------------------------+ + + + </help> + +</tool>
--- a/imgt_loader/imgt_loader.r Thu Dec 22 03:43:02 2016 -0500 +++ b/imgt_loader/imgt_loader.r Fri Jan 27 03:44:18 2017 -0500 @@ -1,11 +1,13 @@ args <- commandArgs(trailingOnly = TRUE) summ.file = args[1] -aa.file = args[2] -junction.file = args[3] -out.file = args[4] +sequences.file = args[2] +aa.file = args[3] +junction.file = args[4] +out.file = args[5] summ = read.table(summ.file, sep="\t", header=T, quote="", fill=T) +sequences = read.table(sequences.file, sep="\t", header=T, quote="", fill=T) aa = read.table(aa.file, sep="\t", header=T, quote="", fill=T) junction = read.table(junction.file, sep="\t", header=T, quote="", fill=T) @@ -30,8 +32,8 @@ out[,"CDR3.Seq"] = aa[,"CDR3.IMGT"] out[,"CDR3.Length"] = summ[,"CDR3.IMGT.length"] -out[,"CDR3.Seq.DNA"] = junction[,"JUNCTION"] -out[,"CDR3.Length.DNA"] = nchar(as.character(junction[,"JUNCTION"])) +out[,"CDR3.Seq.DNA"] = sequences[,"CDR3.IMGT"] +out[,"CDR3.Length.DNA"] = nchar(as.character(sequences[,"CDR3.IMGT"])) out[,"Strand"] = summ[,"Orientation"] out[,"CDR3.Found.How"] = "a"
--- a/imgt_loader/imgt_loader.sh Thu Dec 22 03:43:02 2016 -0500 +++ b/imgt_loader/imgt_loader.sh Fri Jan 27 03:44:18 2017 -0500 @@ -61,9 +61,10 @@ tar xJf $input -C $PWD/$name/files fi find $PWD/$name/files -iname "1_*" -exec cat {} + > $PWD/$name/summ.txt +find $PWD/$name/files -iname "3_*" -exec cat {} + > $PWD/$name/sequences.txt find $PWD/$name/files -iname "5_*" -exec cat {} + > $PWD/$name/aa.txt find $PWD/$name/files -iname "6_*" -exec cat {} + > $PWD/$name/junction.txt #python $dir/imgt_loader.py --summ $PWD/$name/summ.txt --aa $PWD/$name/aa.txt --junction $PWD/$name/junction.txt --output $output -Rscript --verbose $dir/imgt_loader.r $PWD/$name/summ.txt $PWD/$name/aa.txt $PWD/$name/junction.txt $output 2>&1 +Rscript --verbose $dir/imgt_loader.r $PWD/$name/summ.txt $PWD/$name/sequences.txt $PWD/$name/aa.txt $PWD/$name/junction.txt $output 2>&1
--- a/report_clonality/RScript.r Thu Dec 22 03:43:02 2016 -0500 +++ b/report_clonality/RScript.r Fri Jan 27 03:44:18 2017 -0500 @@ -596,19 +596,22 @@ res[is.na(res)] = 0 - write.table(res, file=paste("raw_clonality_", sample_id, ".csv", sep=""), sep=",",quote=F,row.names=F,col.names=F) + write.table(res, file=paste("raw_clonality_", sample_id, ".txt", sep=""), sep="\t",quote=F,row.names=F,col.names=F) + write.table(as.matrix(res[,2:ncol(res)]), file=paste("raw_clonality2_", sample_id, ".txt", sep=""), sep="\t",quote=F,row.names=F,col.names=F) + + res = read.table(paste("raw_clonality_", sample_id, ".txt", sep=""), header=F, sep="\t", quote="", stringsAsFactors=F, fill=T, comment.char="") infer.result = infer.clonality(as.matrix(res[,2:ncol(res)])) #print(infer.result) - write.table(data.table(infer.result[[12]]), file=paste("lymphclon_clonality_", sample_id, ".csv", sep=""), sep=",",quote=F,row.names=F,col.names=F) + write.table(data.table(infer.result[[12]]), file=paste("lymphclon_clonality_", sample_id, ".txt", sep=""), sep="\t",quote=F,row.names=F,col.names=F) res$type = rowSums(res[,2:ncol(res)]) coincidence.table = data.frame(table(res$type)) colnames(coincidence.table) = c("Coincidence Type", "Raw Coincidence Freq") - write.table(coincidence.table, file=paste("lymphclon_coincidences_", sample_id, ".csv", sep=""), sep=",",quote=F,row.names=F,col.names=T) + write.table(coincidence.table, file=paste("lymphclon_coincidences_", sample_id, ".txt", sep=""), sep="\t",quote=F,row.names=F,col.names=T) } } else if(clonality_method == "old") { clonalFreq = data.frame(data.table(clonalityFrame)[, list(Type=.N), by=c("Sample", "clonaltype")])
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/report_clonality/RScript.r.old Fri Jan 27 03:44:18 2017 -0500 @@ -0,0 +1,877 @@ +# ---------------------- load/install packages ---------------------- + +if (!("gridExtra" %in% rownames(installed.packages()))) { + install.packages("gridExtra", repos="http://cran.xl-mirror.nl/") +} +library(gridExtra) +if (!("ggplot2" %in% rownames(installed.packages()))) { + install.packages("ggplot2", repos="http://cran.xl-mirror.nl/") +} +library(ggplot2) +if (!("plyr" %in% rownames(installed.packages()))) { + install.packages("plyr", repos="http://cran.xl-mirror.nl/") +} +library(plyr) + +if (!("data.table" %in% rownames(installed.packages()))) { + install.packages("data.table", repos="http://cran.xl-mirror.nl/") +} +library(data.table) + +if (!("reshape2" %in% rownames(installed.packages()))) { + install.packages("reshape2", repos="http://cran.xl-mirror.nl/") +} +library(reshape2) + +if (!("lymphclon" %in% rownames(installed.packages()))) { + install.packages("lymphclon", repos="http://cran.xl-mirror.nl/") +} +library(lymphclon) + +# ---------------------- parameters ---------------------- + +args <- commandArgs(trailingOnly = TRUE) + +infile = args[1] #path to input file +outfile = args[2] #path to output file +outdir = args[3] #path to output folder (html/images/data) +clonaltype = args[4] #clonaltype definition, or 'none' for no unique filtering +ct = unlist(strsplit(clonaltype, ",")) +species = args[5] #human or mouse +locus = args[6] # IGH, IGK, IGL, TRB, TRA, TRG or TRD +filterproductive = ifelse(args[7] == "yes", T, F) #should unproductive sequences be filtered out? (yes/no) +clonality_method = args[8] + + +# ---------------------- Data preperation ---------------------- + +print("Report Clonality - Data preperation") + +inputdata = read.table(infile, sep="\t", header=TRUE, fill=T, comment.char="", stringsAsFactors=F) + +print(paste("nrows: ", nrow(inputdata))) + +setwd(outdir) + +# remove weird rows +inputdata = inputdata[inputdata$Sample != "",] + +print(paste("nrows: ", nrow(inputdata))) + +#remove the allele from the V,D and J genes +inputdata$Top.V.Gene = gsub("[*]([0-9]+)", "", inputdata$Top.V.Gene) +inputdata$Top.D.Gene = gsub("[*]([0-9]+)", "", inputdata$Top.D.Gene) +inputdata$Top.J.Gene = gsub("[*]([0-9]+)", "", inputdata$Top.J.Gene) + +print(paste("nrows: ", nrow(inputdata))) + +#filter uniques +inputdata.removed = inputdata[NULL,] + +print(paste("nrows: ", nrow(inputdata))) + +inputdata$clonaltype = 1:nrow(inputdata) + +#keep track of the count of sequences in samples or samples/replicates for the front page overview +input.sample.count = data.frame(data.table(inputdata)[, list(All=.N), by=c("Sample")]) +input.rep.count = data.frame(data.table(inputdata)[, list(All=.N), by=c("Sample", "Replicate")]) + +PRODF = inputdata +UNPROD = inputdata +if(filterproductive){ + if("Functionality" %in% colnames(inputdata)) { # "Functionality" is an IMGT column + #PRODF = inputdata[inputdata$Functionality == "productive" | inputdata$Functionality == "productive (see comment)", ] + PRODF = inputdata[inputdata$Functionality %in% c("productive (see comment)","productive"),] + + PRODF.count = data.frame(data.table(PRODF)[, list(count=.N), by=c("Sample")]) + + UNPROD = inputdata[inputdata$Functionality %in% c("unproductive (see comment)","unproductive"), ] + } else { + PRODF = inputdata[inputdata$VDJ.Frame != "In-frame with stop codon" & inputdata$VDJ.Frame != "Out-of-frame" & inputdata$CDR3.Found.How != "NOT_FOUND" , ] + UNPROD = inputdata[!(inputdata$VDJ.Frame != "In-frame with stop codon" & inputdata$VDJ.Frame != "Out-of-frame" & inputdata$CDR3.Found.How != "NOT_FOUND" ), ] + } +} + +for(i in 1:nrow(UNPROD)){ + if(!is.numeric(UNPROD[i,"CDR3.Length"])){ + UNPROD[i,"CDR3.Length"] = 0 + } +} + +prod.sample.count = data.frame(data.table(PRODF)[, list(Productive=.N), by=c("Sample")]) +prod.rep.count = data.frame(data.table(PRODF)[, list(Productive=.N), by=c("Sample", "Replicate")]) + +unprod.sample.count = data.frame(data.table(UNPROD)[, list(Unproductive=.N), by=c("Sample")]) +unprod.rep.count = data.frame(data.table(UNPROD)[, list(Unproductive=.N), by=c("Sample", "Replicate")]) + +clonalityFrame = PRODF + +#remove duplicates based on the clonaltype +if(clonaltype != "none"){ + clonaltype = paste(clonaltype, ",Sample", sep="") #add sample column to clonaltype, unique within samples + PRODF$clonaltype = do.call(paste, c(PRODF[unlist(strsplit(clonaltype, ","))], sep = ":")) + PRODF = PRODF[!duplicated(PRODF$clonaltype), ] + + UNPROD$clonaltype = do.call(paste, c(UNPROD[unlist(strsplit(clonaltype, ","))], sep = ":")) + UNPROD = UNPROD[!duplicated(UNPROD$clonaltype), ] + + #again for clonalityFrame but with sample+replicate + clonalityFrame$clonaltype = do.call(paste, c(clonalityFrame[unlist(strsplit(clonaltype, ","))], sep = ":")) + clonalityFrame$clonality_clonaltype = do.call(paste, c(clonalityFrame[unlist(strsplit(paste(clonaltype, ",Replicate", sep=""), ","))], sep = ":")) + clonalityFrame = clonalityFrame[!duplicated(clonalityFrame$clonality_clonaltype), ] +} + +print("SAMPLE TABLE:") +print(table(PRODF$Sample)) + +prod.unique.sample.count = data.frame(data.table(PRODF)[, list(Productive_unique=.N), by=c("Sample")]) +prod.unique.rep.count = data.frame(data.table(PRODF)[, list(Productive_unique=.N), by=c("Sample", "Replicate")]) + +unprod.unique.sample.count = data.frame(data.table(UNPROD)[, list(Unproductive_unique=.N), by=c("Sample")]) +unprod.unique.rep.count = data.frame(data.table(UNPROD)[, list(Unproductive_unique=.N), by=c("Sample", "Replicate")]) + +PRODF$freq = 1 + +if(any(grepl(pattern="_", x=PRODF$ID))){ #the frequency can be stored in the ID with the pattern ".*_freq_.*" + PRODF$freq = gsub("^[0-9]+_", "", PRODF$ID) + PRODF$freq = gsub("_.*", "", PRODF$freq) + PRODF$freq = as.numeric(PRODF$freq) + if(any(is.na(PRODF$freq))){ #if there was an "_" in the ID, but not the frequency, go back to frequency of 1 for every sequence + PRODF$freq = 1 + } +} + +#make a names list with sample -> color +naive.colors = c('blue4', 'darkred', 'olivedrab3', 'red', 'gray74', 'darkviolet', 'lightblue1', 'gold', 'chartreuse2', 'pink', 'Paleturquoise3', 'Chocolate1', 'Yellow', 'Deeppink3', 'Mediumorchid1', 'Darkgreen', 'Blue', 'Gray36', 'Hotpink', 'Yellow4') +unique.samples = unique(PRODF$Sample) + +if(length(unique.samples) <= length(naive.colors)){ + sample.colors = naive.colors[1:length(unique.samples)] +} else { + sample.colors = rainbow(length(unique.samples)) +} + +names(sample.colors) = unique.samples + +print("Sample.colors") +print(sample.colors) + + +#write the complete dataset that is left over, will be the input if 'none' for clonaltype and 'no' for filterproductive +write.table(PRODF, "allUnique.txt", sep="\t",quote=F,row.names=F,col.names=T) +write.table(PRODF, "allUnique.csv", sep=",",quote=F,row.names=F,col.names=T) +write.table(UNPROD, "allUnproductive.csv", sep=",",quote=F,row.names=F,col.names=T) + +#write the samples to a file +sampleFile <- file("samples.txt") +un = unique(inputdata$Sample) +un = paste(un, sep="\n") +writeLines(un, sampleFile) +close(sampleFile) + +# ---------------------- Counting the productive/unproductive and unique sequences ---------------------- + +print("Report Clonality - counting productive/unproductive/unique") + +#create the table on the overview page with the productive/unique counts per sample/replicate +#first for sample +sample.count = merge(input.sample.count, prod.sample.count, by="Sample", all.x=T) +sample.count$perc_prod = round(sample.count$Productive / sample.count$All * 100) +sample.count = merge(sample.count, prod.unique.sample.count, by="Sample", all.x=T) +sample.count$perc_prod_un = round(sample.count$Productive_unique / sample.count$All * 100) + +sample.count = merge(sample.count , unprod.sample.count, by="Sample", all.x=T) +sample.count$perc_unprod = round(sample.count$Unproductive / sample.count$All * 100) +sample.count = merge(sample.count, unprod.unique.sample.count, by="Sample", all.x=T) +sample.count$perc_unprod_un = round(sample.count$Unproductive_unique / sample.count$All * 100) + +#then sample/replicate +rep.count = merge(input.rep.count, prod.rep.count, by=c("Sample", "Replicate"), all.x=T) +rep.count$perc_prod = round(rep.count$Productive / rep.count$All * 100) +rep.count = merge(rep.count, prod.unique.rep.count, by=c("Sample", "Replicate"), all.x=T) +rep.count$perc_prod_un = round(rep.count$Productive_unique / rep.count$All * 100) + +rep.count = merge(rep.count, unprod.rep.count, by=c("Sample", "Replicate"), all.x=T) +rep.count$perc_unprod = round(rep.count$Unproductive / rep.count$All * 100) +rep.count = merge(rep.count, unprod.unique.rep.count, by=c("Sample", "Replicate"), all.x=T) +rep.count$perc_unprod_un = round(rep.count$Unproductive_unique / rep.count$All * 100) + +rep.count$Sample = paste(rep.count$Sample, rep.count$Replicate, sep="_") +rep.count = rep.count[,names(rep.count) != "Replicate"] + +count = rbind(sample.count, rep.count) + + + +write.table(x=count, file="productive_counting.txt", sep=",",quote=F,row.names=F,col.names=F) + +# ---------------------- V+J+CDR3 sequence count ---------------------- + +VJCDR3.count = data.frame(table(clonalityFrame$Top.V.Gene, clonalityFrame$Top.J.Gene, clonalityFrame$CDR3.Seq.DNA)) +names(VJCDR3.count) = c("Top.V.Gene", "Top.J.Gene", "CDR3.Seq.DNA", "Count") + +VJCDR3.count = VJCDR3.count[VJCDR3.count$Count > 0,] +VJCDR3.count = VJCDR3.count[order(-VJCDR3.count$Count),] + +write.table(x=VJCDR3.count, file="VJCDR3_count.txt", sep="\t",quote=F,row.names=F,col.names=T) + +# ---------------------- Frequency calculation for V, D and J ---------------------- + +print("Report Clonality - frequency calculation V, D and J") + +PRODFV = data.frame(data.table(PRODF)[, list(Length=sum(freq)), by=c("Sample", "Top.V.Gene")]) +Total = ddply(PRODFV, .(Sample), function(x) data.frame(Total = sum(x$Length))) +PRODFV = merge(PRODFV, Total, by.x='Sample', by.y='Sample', all.x=TRUE) +PRODFV = ddply(PRODFV, c("Sample", "Top.V.Gene"), summarise, relFreq= (Length*100 / Total)) + +PRODFD = data.frame(data.table(PRODF)[, list(Length=sum(freq)), by=c("Sample", "Top.D.Gene")]) +Total = ddply(PRODFD, .(Sample), function(x) data.frame(Total = sum(x$Length))) +PRODFD = merge(PRODFD, Total, by.x='Sample', by.y='Sample', all.x=TRUE) +PRODFD = ddply(PRODFD, c("Sample", "Top.D.Gene"), summarise, relFreq= (Length*100 / Total)) + +PRODFJ = data.frame(data.table(PRODF)[, list(Length=sum(freq)), by=c("Sample", "Top.J.Gene")]) +Total = ddply(PRODFJ, .(Sample), function(x) data.frame(Total = sum(x$Length))) +PRODFJ = merge(PRODFJ, Total, by.x='Sample', by.y='Sample', all.x=TRUE) +PRODFJ = ddply(PRODFJ, c("Sample", "Top.J.Gene"), summarise, relFreq= (Length*100 / Total)) + +# ---------------------- Setting up the gene names for the different species/loci ---------------------- + +print("Report Clonality - getting genes for species/loci") + +Vchain = "" +Dchain = "" +Jchain = "" + +if(species == "custom"){ + print("Custom genes: ") + splt = unlist(strsplit(locus, ";")) + print(paste("V:", splt[1])) + print(paste("D:", splt[2])) + print(paste("J:", splt[3])) + + Vchain = unlist(strsplit(splt[1], ",")) + Vchain = data.frame(v.name = Vchain, chr.orderV = 1:length(Vchain)) + + Dchain = unlist(strsplit(splt[2], ",")) + if(length(Dchain) > 0){ + Dchain = data.frame(v.name = Dchain, chr.orderD = 1:length(Dchain)) + } else { + Dchain = data.frame(v.name = character(0), chr.orderD = numeric(0)) + } + + Jchain = unlist(strsplit(splt[3], ",")) + Jchain = data.frame(v.name = Jchain, chr.orderJ = 1:length(Jchain)) + +} else { + genes = read.table("genes.txt", sep="\t", header=TRUE, fill=T, comment.char="") + + Vchain = genes[grepl(species, genes$Species) & genes$locus == locus & genes$region == "V",c("IMGT.GENE.DB", "chr.order")] + colnames(Vchain) = c("v.name", "chr.orderV") + Dchain = genes[grepl(species, genes$Species) & genes$locus == locus & genes$region == "D",c("IMGT.GENE.DB", "chr.order")] + colnames(Dchain) = c("v.name", "chr.orderD") + Jchain = genes[grepl(species, genes$Species) & genes$locus == locus & genes$region == "J",c("IMGT.GENE.DB", "chr.order")] + colnames(Jchain) = c("v.name", "chr.orderJ") +} +useD = TRUE +if(nrow(Dchain) == 0){ + useD = FALSE + cat("No D Genes in this species/locus") +} +print(paste(nrow(Vchain), "genes in V")) +print(paste(nrow(Dchain), "genes in D")) +print(paste(nrow(Jchain), "genes in J")) + +# ---------------------- merge with the frequency count ---------------------- + +PRODFV = merge(PRODFV, Vchain, by.x='Top.V.Gene', by.y='v.name', all.x=TRUE) + +PRODFD = merge(PRODFD, Dchain, by.x='Top.D.Gene', by.y='v.name', all.x=TRUE) + +PRODFJ = merge(PRODFJ, Jchain, by.x='Top.J.Gene', by.y='v.name', all.x=TRUE) + +# ---------------------- Create the V, D and J frequency plots and write the data.frame for every plot to a file ---------------------- + +print("Report Clonality - V, D and J frequency plots") + +pV = ggplot(PRODFV) +pV = pV + geom_bar( aes( x=factor(reorder(Top.V.Gene, chr.orderV)), y=relFreq, fill=Sample), stat='identity', position="dodge") + theme(axis.text.x = element_text(angle = 90, hjust = 1)) +pV = pV + xlab("Summary of V gene") + ylab("Frequency") + ggtitle("Relative frequency of V gene usage") + scale_fill_manual(values=sample.colors) +pV = pV + theme(panel.background = element_rect(fill = "white", colour="black"),text = element_text(size=15, colour="black"), axis.text.x = element_text(angle = 45, hjust = 1), panel.grid.major.y = element_line(colour = "black"), panel.grid.major.x = element_blank()) +write.table(x=PRODFV, file="VFrequency.csv", sep=",",quote=F,row.names=F,col.names=T) + +png("VPlot.png",width = 1280, height = 720) +pV +dev.off(); + +if(useD){ + pD = ggplot(PRODFD) + pD = pD + geom_bar( aes( x=factor(reorder(Top.D.Gene, chr.orderD)), y=relFreq, fill=Sample), stat='identity', position="dodge") + theme(axis.text.x = element_text(angle = 90, hjust = 1)) + pD = pD + xlab("Summary of D gene") + ylab("Frequency") + ggtitle("Relative frequency of D gene usage") + scale_fill_manual(values=sample.colors) + pD = pD + theme(panel.background = element_rect(fill = "white", colour="black"),text = element_text(size=15, colour="black"), axis.text.x = element_text(angle = 45, hjust = 1), panel.grid.major.y = element_line(colour = "black"), panel.grid.major.x = element_blank()) + write.table(x=PRODFD, file="DFrequency.csv", sep=",",quote=F,row.names=F,col.names=T) + + png("DPlot.png",width = 800, height = 600) + print(pD) + dev.off(); +} + +pJ = ggplot(PRODFJ) +pJ = pJ + geom_bar( aes( x=factor(reorder(Top.J.Gene, chr.orderJ)), y=relFreq, fill=Sample), stat='identity', position="dodge") + theme(axis.text.x = element_text(angle = 90, hjust = 1)) +pJ = pJ + xlab("Summary of J gene") + ylab("Frequency") + ggtitle("Relative frequency of J gene usage") + scale_fill_manual(values=sample.colors) +pJ = pJ + theme(panel.background = element_rect(fill = "white", colour="black"),text = element_text(size=15, colour="black"), axis.text.x = element_text(angle = 45, hjust = 1), panel.grid.major.y = element_line(colour = "black"), panel.grid.major.x = element_blank()) +write.table(x=PRODFJ, file="JFrequency.csv", sep=",",quote=F,row.names=F,col.names=T) + +png("JPlot.png",width = 800, height = 600) +pJ +dev.off(); + +# ---------------------- Now the frequency plots of the V, D and J families ---------------------- + +print("Report Clonality - V, D and J family plots") + +VGenes = PRODF[,c("Sample", "Top.V.Gene")] +VGenes$Top.V.Gene = gsub("-.*", "", VGenes$Top.V.Gene) +VGenes = data.frame(data.table(VGenes)[, list(Count=.N), by=c("Sample", "Top.V.Gene")]) +TotalPerSample = data.frame(data.table(VGenes)[, list(total=sum(.SD$Count)), by=Sample]) +VGenes = merge(VGenes, TotalPerSample, by="Sample") +VGenes$Frequency = VGenes$Count * 100 / VGenes$total +VPlot = ggplot(VGenes) +VPlot = VPlot + geom_bar(aes( x = Top.V.Gene, y = Frequency, fill = Sample), stat='identity', position='dodge' ) + theme(axis.text.x = element_text(angle = 90, hjust = 1)) + + ggtitle("Distribution of V gene families") + + ylab("Percentage of sequences") + + scale_fill_manual(values=sample.colors) + + theme(panel.background = element_rect(fill = "white", colour="black"),text = element_text(size=15, colour="black"), axis.text.x = element_text(angle = 45, hjust = 1), panel.grid.major.y = element_line(colour = "black"), panel.grid.major.x = element_blank()) +png("VFPlot.png") +VPlot +dev.off(); +write.table(x=VGenes, file="VFFrequency.csv", sep=",",quote=F,row.names=F,col.names=T) + +if(useD){ + DGenes = PRODF[,c("Sample", "Top.D.Gene")] + DGenes$Top.D.Gene = gsub("-.*", "", DGenes$Top.D.Gene) + DGenes = data.frame(data.table(DGenes)[, list(Count=.N), by=c("Sample", "Top.D.Gene")]) + TotalPerSample = data.frame(data.table(DGenes)[, list(total=sum(.SD$Count)), by=Sample]) + DGenes = merge(DGenes, TotalPerSample, by="Sample") + DGenes$Frequency = DGenes$Count * 100 / DGenes$total + DPlot = ggplot(DGenes) + DPlot = DPlot + geom_bar(aes( x = Top.D.Gene, y = Frequency, fill = Sample), stat='identity', position='dodge' ) + theme(axis.text.x = element_text(angle = 90, hjust = 1)) + + ggtitle("Distribution of D gene families") + + ylab("Percentage of sequences") + + scale_fill_manual(values=sample.colors) + + theme(panel.background = element_rect(fill = "white", colour="black"),text = element_text(size=15, colour="black"), axis.text.x = element_text(angle = 45, hjust = 1), panel.grid.major.y = element_line(colour = "black"), panel.grid.major.x = element_blank()) + png("DFPlot.png") + print(DPlot) + dev.off(); + write.table(x=DGenes, file="DFFrequency.csv", sep=",",quote=F,row.names=F,col.names=T) +} + +# ---------------------- Plotting the cdr3 length ---------------------- + +print("Report Clonality - CDR3 length plot") + +CDR3Length = data.frame(data.table(PRODF)[, list(Count=.N), by=c("Sample", "CDR3.Length")]) +TotalPerSample = data.frame(data.table(CDR3Length)[, list(total=sum(.SD$Count)), by=Sample]) +CDR3Length = merge(CDR3Length, TotalPerSample, by="Sample") +CDR3Length$Frequency = CDR3Length$Count * 100 / CDR3Length$total +CDR3LengthPlot = ggplot(CDR3Length) +CDR3LengthPlot = CDR3LengthPlot + geom_bar(aes( x = factor(reorder(CDR3.Length, as.numeric(CDR3.Length))), y = Frequency, fill = Sample), stat='identity', position='dodge' ) + theme(axis.text.x = element_text(angle = 90, hjust = 1)) + + ggtitle("Length distribution of CDR3") + + xlab("CDR3 Length") + + ylab("Percentage of sequences") + + scale_fill_manual(values=sample.colors) + + theme(panel.background = element_rect(fill = "white", colour="black"),text = element_text(size=15, colour="black"), axis.text.x = element_text(angle = 45, hjust = 1), panel.grid.major.y = element_line(colour = "black"), panel.grid.major.x = element_blank()) +png("CDR3LengthPlot.png",width = 1280, height = 720) +CDR3LengthPlot +dev.off() +write.table(x=CDR3Length, file="CDR3LengthPlot.csv", sep=",",quote=F,row.names=F,col.names=T) + +# ---------------------- Plot the heatmaps ---------------------- + +#get the reverse order for the V and D genes +revVchain = Vchain +revDchain = Dchain +revVchain$chr.orderV = rev(revVchain$chr.orderV) +revDchain$chr.orderD = rev(revDchain$chr.orderD) + +if(useD){ + print("Report Clonality - Heatmaps VD") + plotVD <- function(dat){ + if(length(dat[,1]) == 0){ + return() + } + + img = ggplot() + + geom_tile(data=dat, aes(x=factor(reorder(Top.D.Gene, chr.orderD)), y=factor(reorder(Top.V.Gene, chr.orderV)), fill=relLength)) + + theme(axis.text.x = element_text(angle = 90, hjust = 1)) + + scale_fill_gradient(low="gold", high="blue", na.value="white") + + ggtitle(paste(unique(dat$Sample), " (N=" , sum(dat$Length, na.rm=T) ,")", sep="")) + + xlab("D genes") + + ylab("V Genes") + + theme(panel.background = element_rect(fill = "white", colour="black"),text = element_text(size=15, colour="black"), panel.grid.major = element_line(colour = "gainsboro")) + + png(paste("HeatmapVD_", unique(dat[3])[1,1] , ".png", sep=""), width=150+(15*length(Dchain$v.name)), height=100+(15*length(Vchain$v.name))) + print(img) + dev.off() + write.table(x=acast(dat, Top.V.Gene~Top.D.Gene, value.var="Length"), file=paste("HeatmapVD_", unique(dat[3])[1,1], ".csv", sep=""), sep=",",quote=F,row.names=T,col.names=NA) + } + + VandDCount = data.frame(data.table(PRODF)[, list(Length=.N), by=c("Top.V.Gene", "Top.D.Gene", "Sample")]) + + VandDCount$l = log(VandDCount$Length) + maxVD = data.frame(data.table(VandDCount)[, list(max=max(l)), by=c("Sample")]) + VandDCount = merge(VandDCount, maxVD, by.x="Sample", by.y="Sample", all.x=T) + VandDCount$relLength = VandDCount$l / VandDCount$max + check = is.nan(VandDCount$relLength) + if(any(check)){ + VandDCount[check,"relLength"] = 0 + } + + cartegianProductVD = expand.grid(Top.V.Gene = Vchain$v.name, Top.D.Gene = Dchain$v.name) + + completeVD = merge(VandDCount, cartegianProductVD, by.x=c("Top.V.Gene", "Top.D.Gene"), by.y=c("Top.V.Gene", "Top.D.Gene"), all=TRUE) + + completeVD = merge(completeVD, revVchain, by.x="Top.V.Gene", by.y="v.name", all.x=TRUE) + + completeVD = merge(completeVD, Dchain, by.x="Top.D.Gene", by.y="v.name", all.x=TRUE) + + fltr = is.nan(completeVD$relLength) + if(all(fltr)){ + completeVD[fltr,"relLength"] = 0 + } + + VDList = split(completeVD, f=completeVD[,"Sample"]) + lapply(VDList, FUN=plotVD) +} + +print("Report Clonality - Heatmaps VJ") + +plotVJ <- function(dat){ + if(length(dat[,1]) == 0){ + return() + } + cat(paste(unique(dat[3])[1,1])) + img = ggplot() + + geom_tile(data=dat, aes(x=factor(reorder(Top.J.Gene, chr.orderJ)), y=factor(reorder(Top.V.Gene, chr.orderV)), fill=relLength)) + + theme(axis.text.x = element_text(angle = 90, hjust = 1)) + + scale_fill_gradient(low="gold", high="blue", na.value="white") + + ggtitle(paste(unique(dat$Sample), " (N=" , sum(dat$Length, na.rm=T) ,")", sep="")) + + xlab("J genes") + + ylab("V Genes") + + theme(panel.background = element_rect(fill = "white", colour="black"),text = element_text(size=15, colour="black"), panel.grid.major = element_line(colour = "gainsboro")) + + png(paste("HeatmapVJ_", unique(dat[3])[1,1] , ".png", sep=""), width=150+(15*length(Jchain$v.name)), height=100+(15*length(Vchain$v.name))) + print(img) + dev.off() + write.table(x=acast(dat, Top.V.Gene~Top.J.Gene, value.var="Length"), file=paste("HeatmapVJ_", unique(dat[3])[1,1], ".csv", sep=""), sep=",",quote=F,row.names=T,col.names=NA) +} + +VandJCount = data.frame(data.table(PRODF)[, list(Length=.N), by=c("Top.V.Gene", "Top.J.Gene", "Sample")]) + +VandJCount$l = log(VandJCount$Length) +maxVJ = data.frame(data.table(VandJCount)[, list(max=max(l)), by=c("Sample")]) +VandJCount = merge(VandJCount, maxVJ, by.x="Sample", by.y="Sample", all.x=T) +VandJCount$relLength = VandJCount$l / VandJCount$max + +check = is.nan(VandJCount$relLength) +if(any(check)){ + VandJCount[check,"relLength"] = 0 +} + +cartegianProductVJ = expand.grid(Top.V.Gene = Vchain$v.name, Top.J.Gene = Jchain$v.name) + +completeVJ = merge(VandJCount, cartegianProductVJ, all.y=TRUE) +completeVJ = merge(completeVJ, revVchain, by.x="Top.V.Gene", by.y="v.name", all.x=TRUE) +completeVJ = merge(completeVJ, Jchain, by.x="Top.J.Gene", by.y="v.name", all.x=TRUE) + +fltr = is.nan(completeVJ$relLength) +if(any(fltr)){ + completeVJ[fltr,"relLength"] = 1 +} + +VJList = split(completeVJ, f=completeVJ[,"Sample"]) +lapply(VJList, FUN=plotVJ) + + + +if(useD){ + print("Report Clonality - Heatmaps DJ") + plotDJ <- function(dat){ + if(length(dat[,1]) == 0){ + return() + } + img = ggplot() + + geom_tile(data=dat, aes(x=factor(reorder(Top.J.Gene, chr.orderJ)), y=factor(reorder(Top.D.Gene, chr.orderD)), fill=relLength)) + + theme(axis.text.x = element_text(angle = 90, hjust = 1)) + + scale_fill_gradient(low="gold", high="blue", na.value="white") + + ggtitle(paste(unique(dat$Sample), " (N=" , sum(dat$Length, na.rm=T) ,")", sep="")) + + xlab("J genes") + + ylab("D Genes") + + theme(panel.background = element_rect(fill = "white", colour="black"),text = element_text(size=15, colour="black"), panel.grid.major = element_line(colour = "gainsboro")) + + png(paste("HeatmapDJ_", unique(dat[3])[1,1] , ".png", sep=""), width=150+(15*length(Jchain$v.name)), height=100+(15*length(Dchain$v.name))) + print(img) + dev.off() + write.table(x=acast(dat, Top.D.Gene~Top.J.Gene, value.var="Length"), file=paste("HeatmapDJ_", unique(dat[3])[1,1], ".csv", sep=""), sep=",",quote=F,row.names=T,col.names=NA) + } + + + DandJCount = data.frame(data.table(PRODF)[, list(Length=.N), by=c("Top.D.Gene", "Top.J.Gene", "Sample")]) + + DandJCount$l = log(DandJCount$Length) + maxDJ = data.frame(data.table(DandJCount)[, list(max=max(l)), by=c("Sample")]) + DandJCount = merge(DandJCount, maxDJ, by.x="Sample", by.y="Sample", all.x=T) + DandJCount$relLength = DandJCount$l / DandJCount$max + + check = is.nan(DandJCount$relLength) + if(any(check)){ + DandJCount[check,"relLength"] = 0 + } + + cartegianProductDJ = expand.grid(Top.D.Gene = Dchain$v.name, Top.J.Gene = Jchain$v.name) + + completeDJ = merge(DandJCount, cartegianProductDJ, all.y=TRUE) + completeDJ = merge(completeDJ, revDchain, by.x="Top.D.Gene", by.y="v.name", all.x=TRUE) + completeDJ = merge(completeDJ, Jchain, by.x="Top.J.Gene", by.y="v.name", all.x=TRUE) + + fltr = is.nan(completeDJ$relLength) + if(any(fltr)){ + completeDJ[fltr, "relLength"] = 1 + } + + DJList = split(completeDJ, f=completeDJ[,"Sample"]) + lapply(DJList, FUN=plotDJ) +} + + +# ---------------------- output tables for the circos plots ---------------------- + +print("Report Clonality - Circos data") + +for(smpl in unique(PRODF$Sample)){ + PRODF.sample = PRODF[PRODF$Sample == smpl,] + + fltr = PRODF.sample$Top.V.Gene == "" + if(any(fltr, na.rm=T)){ + PRODF.sample[fltr, "Top.V.Gene"] = "NA" + } + + fltr = PRODF.sample$Top.D.Gene == "" + if(any(fltr, na.rm=T)){ + PRODF.sample[fltr, "Top.D.Gene"] = "NA" + } + + fltr = PRODF.sample$Top.J.Gene == "" + if(any(fltr, na.rm=T)){ + PRODF.sample[fltr, "Top.J.Gene"] = "NA" + } + + v.d = table(PRODF.sample$Top.V.Gene, PRODF.sample$Top.D.Gene) + v.j = table(PRODF.sample$Top.V.Gene, PRODF.sample$Top.J.Gene) + d.j = table(PRODF.sample$Top.D.Gene, PRODF.sample$Top.J.Gene) + + write.table(v.d, file=paste(smpl, "_VD_circos.txt", sep=""), sep="\t", quote=F, row.names=T, col.names=NA) + write.table(v.j, file=paste(smpl, "_VJ_circos.txt", sep=""), sep="\t", quote=F, row.names=T, col.names=NA) + write.table(d.j, file=paste(smpl, "_DJ_circos.txt", sep=""), sep="\t", quote=F, row.names=T, col.names=NA) +} + +# ---------------------- calculating the clonality score ---------------------- + +if("Replicate" %in% colnames(inputdata)) #can only calculate clonality score when replicate information is available +{ + print("Report Clonality - Clonality") + write.table(clonalityFrame, "clonalityComplete.csv", sep=",",quote=F,row.names=F,col.names=T) + if(clonality_method == "boyd"){ + samples = split(clonalityFrame, clonalityFrame$Sample, drop=T) + + for (sample in samples){ + res = data.frame(paste=character(0)) + sample_id = unique(sample$Sample)[[1]] + for(replicate in unique(sample$Replicate)){ + tmp = sample[sample$Replicate == replicate,] + clone_table = data.frame(table(tmp$clonaltype)) + clone_col_name = paste("V", replicate, sep="") + colnames(clone_table) = c("paste", clone_col_name) + res = merge(res, clone_table, by="paste", all=T) + } + + res[is.na(res)] = 0 + infer.result = infer.clonality(as.matrix(res[,2:ncol(res)])) + + #print(infer.result) + + write.table(data.table(infer.result[[12]]), file=paste("lymphclon_clonality_", sample_id, ".csv", sep=""), sep=",",quote=F,row.names=F,col.names=F) + + res$type = rowSums(res[,2:ncol(res)]) + + coincidence.table = data.frame(table(res$type)) + colnames(coincidence.table) = c("Coincidence Type", "Raw Coincidence Freq") + write.table(coincidence.table, file=paste("lymphclon_coincidences_", sample_id, ".csv", sep=""), sep=",",quote=F,row.names=F,col.names=T) + } + } else { + clonalFreq = data.frame(data.table(clonalityFrame)[, list(Type=.N), by=c("Sample", "clonaltype")]) + + #write files for every coincidence group of >1 + samples = unique(clonalFreq$Sample) + for(sample in samples){ + clonalFreqSample = clonalFreq[clonalFreq$Sample == sample,] + if(max(clonalFreqSample$Type) > 1){ + for(i in 2:max(clonalFreqSample$Type)){ + clonalFreqSampleType = clonalFreqSample[clonalFreqSample$Type == i,] + clonalityFrame.sub = clonalityFrame[clonalityFrame$clonaltype %in% clonalFreqSampleType$clonaltype,] + clonalityFrame.sub = clonalityFrame.sub[order(clonalityFrame.sub$clonaltype),] + write.table(clonalityFrame.sub, file=paste("coincidences_", sample, "_", i, ".txt", sep=""), sep="\t",quote=F,row.names=F,col.names=T) + } + } + } + + clonalFreqCount = data.frame(data.table(clonalFreq)[, list(Count=.N), by=c("Sample", "Type")]) + clonalFreqCount$realCount = clonalFreqCount$Type * clonalFreqCount$Count + clonalSum = data.frame(data.table(clonalFreqCount)[, list(Reads=sum(realCount)), by=c("Sample")]) + clonalFreqCount = merge(clonalFreqCount, clonalSum, by.x="Sample", by.y="Sample") + + ct = c('Type\tWeight\n2\t1\n3\t3\n4\t6\n5\t10\n6\t15') + tcct = textConnection(ct) + CT = read.table(tcct, sep="\t", header=TRUE) + close(tcct) + clonalFreqCount = merge(clonalFreqCount, CT, by.x="Type", by.y="Type", all.x=T) + clonalFreqCount$WeightedCount = clonalFreqCount$Count * clonalFreqCount$Weight + + ReplicateReads = data.frame(data.table(clonalityFrame)[, list(Type=.N), by=c("Sample", "Replicate", "clonaltype")]) + ReplicateReads = data.frame(data.table(ReplicateReads)[, list(Reads=.N), by=c("Sample", "Replicate")]) + clonalFreqCount$Reads = as.numeric(clonalFreqCount$Reads) + ReplicateReads$Reads = as.numeric(ReplicateReads$Reads) + ReplicateReads$squared = as.numeric(ReplicateReads$Reads * ReplicateReads$Reads) + + ReplicatePrint <- function(dat){ + write.table(dat[-1], paste("ReplicateReads_", unique(dat[1])[1,1] , ".csv", sep=""), sep=",",quote=F,na="-",row.names=F,col.names=F) + } + + ReplicateSplit = split(ReplicateReads, f=ReplicateReads[,"Sample"]) + lapply(ReplicateSplit, FUN=ReplicatePrint) + + ReplicateReads = data.frame(data.table(ReplicateReads)[, list(ReadsSum=sum(as.numeric(Reads)), ReadsSquaredSum=sum(as.numeric(squared))), by=c("Sample")]) + clonalFreqCount = merge(clonalFreqCount, ReplicateReads, by.x="Sample", by.y="Sample", all.x=T) + + ReplicateSumPrint <- function(dat){ + write.table(dat[-1], paste("ReplicateSumReads_", unique(dat[1])[1,1] , ".csv", sep=""), sep=",",quote=F,na="-",row.names=F,col.names=F) + } + + ReplicateSumSplit = split(ReplicateReads, f=ReplicateReads[,"Sample"]) + lapply(ReplicateSumSplit, FUN=ReplicateSumPrint) + + clonalFreqCountSum = data.frame(data.table(clonalFreqCount)[, list(Numerator=sum(WeightedCount, na.rm=T)), by=c("Sample")]) + clonalFreqCount = merge(clonalFreqCount, clonalFreqCountSum, by.x="Sample", by.y="Sample", all.x=T) + clonalFreqCount$ReadsSum = as.numeric(clonalFreqCount$ReadsSum) #prevent integer overflow + clonalFreqCount$Denominator = (((clonalFreqCount$ReadsSum * clonalFreqCount$ReadsSum) - clonalFreqCount$ReadsSquaredSum) / 2) + clonalFreqCount$Result = (clonalFreqCount$Numerator + 1) / (clonalFreqCount$Denominator + 1) + + ClonalityScorePrint <- function(dat){ + write.table(dat$Result, paste("ClonalityScore_", unique(dat[1])[1,1] , ".csv", sep=""), sep=",",quote=F,na="-",row.names=F,col.names=F) + } + + clonalityScore = clonalFreqCount[c("Sample", "Result")] + clonalityScore = unique(clonalityScore) + + clonalityScoreSplit = split(clonalityScore, f=clonalityScore[,"Sample"]) + lapply(clonalityScoreSplit, FUN=ClonalityScorePrint) + + clonalityOverview = clonalFreqCount[c("Sample", "Type", "Count", "Weight", "WeightedCount")] + + + + ClonalityOverviewPrint <- function(dat){ + dat = dat[order(dat[,2]),] + write.table(dat[-1], paste("ClonalityOverView_", unique(dat[1])[1,1] , ".csv", sep=""), sep=",",quote=F,na="-",row.names=F,col.names=F) + } + + clonalityOverviewSplit = split(clonalityOverview, f=clonalityOverview$Sample) + lapply(clonalityOverviewSplit, FUN=ClonalityOverviewPrint) + } +} + +bak = PRODF + +imgtcolumns = c("X3V.REGION.trimmed.nt.nb","P3V.nt.nb", "N1.REGION.nt.nb", "P5D.nt.nb", "X5D.REGION.trimmed.nt.nb", "X3D.REGION.trimmed.nt.nb", "P3D.nt.nb", "N2.REGION.nt.nb", "P5J.nt.nb", "X5J.REGION.trimmed.nt.nb", "X3V.REGION.trimmed.nt.nb", "X5D.REGION.trimmed.nt.nb", "X3D.REGION.trimmed.nt.nb", "X5J.REGION.trimmed.nt.nb", "N1.REGION.nt.nb", "N2.REGION.nt.nb", "P3V.nt.nb", "P5D.nt.nb", "P3D.nt.nb", "P5J.nt.nb") +if(all(imgtcolumns %in% colnames(inputdata))) +{ + print("found IMGT columns, running junction analysis") + + if(locus %in% c("IGK","IGL", "TRA", "TRG")){ + print("VJ recombination, no filtering on absent D") + } else { + print("VDJ recombination, using N column for junction analysis") + fltr = nchar(PRODF$Top.D.Gene) < 4 + print(paste("Removing", sum(fltr), "sequences without a identified D")) + PRODF = PRODF[!fltr,] + } + + + #ensure certain columns are in the data (files generated with older versions of IMGT Loader) + col.checks = c("N.REGION.nt.nb", "N1.REGION.nt.nb", "N2.REGION.nt.nb", "N3.REGION.nt.nb", "N4.REGION.nt.nb") + for(col.check in col.checks){ + if(!(col.check %in% names(PRODF))){ + print(paste(col.check, "not found adding new column")) + if(nrow(PRODF) > 0){ #because R is anoying... + PRODF[,col.check] = 0 + } else { + PRODF = cbind(PRODF, data.frame(N3.REGION.nt.nb=numeric(0), N4.REGION.nt.nb=numeric(0))) + } + if(nrow(UNPROD) > 0){ + UNPROD[,col.check] = 0 + } else { + UNPROD = cbind(UNPROD, data.frame(N3.REGION.nt.nb=numeric(0), N4.REGION.nt.nb=numeric(0))) + } + } + } + + num_median = function(x, na.rm=T) { as.numeric(median(x, na.rm=na.rm)) } + + newData = data.frame(data.table(PRODF)[,list(unique=.N, + VH.DEL=mean(.SD$X3V.REGION.trimmed.nt.nb, na.rm=T), + P1=mean(.SD$P3V.nt.nb, na.rm=T), + N1=mean(rowSums(.SD[,c("N.REGION.nt.nb", "N1.REGION.nt.nb"), with=F], na.rm=T)), + P2=mean(.SD$P5D.nt.nb, na.rm=T), + DEL.DH=mean(.SD$X5D.REGION.trimmed.nt.nb, na.rm=T), + DH.DEL=mean(.SD$X3D.REGION.trimmed.nt.nb, na.rm=T), + P3=mean(.SD$P3D.nt.nb, na.rm=T), + N2=mean(rowSums(.SD[,c("N2.REGION.nt.nb", "N3.REGION.nt.nb", "N4.REGION.nt.nb"), with=F], na.rm=T)), + P4=mean(.SD$P5J.nt.nb, na.rm=T), + DEL.JH=mean(.SD$X5J.REGION.trimmed.nt.nb, na.rm=T), + Total.Del=mean(rowSums(.SD[,c("X3V.REGION.trimmed.nt.nb", "X5D.REGION.trimmed.nt.nb", "X3D.REGION.trimmed.nt.nb", "X5J.REGION.trimmed.nt.nb"), with=F], na.rm=T)), + Total.N=mean(rowSums(.SD[,c("N.REGION.nt.nb", "N1.REGION.nt.nb", "N2.REGION.nt.nb", "N3.REGION.nt.nb", "N4.REGION.nt.nb"), with=F], na.rm=T)), + Total.P=mean(rowSums(.SD[,c("P3V.nt.nb", "P5D.nt.nb", "P3D.nt.nb", "P5J.nt.nb"), with=F], na.rm=T)), + Median.CDR3.l=as.double(median(.SD$CDR3.Length))), + by=c("Sample")]) + newData[,sapply(newData, is.numeric)] = round(newData[,sapply(newData, is.numeric)],1) + write.table(newData, "junctionAnalysisProd_mean.csv" , sep=",",quote=F,na="-",row.names=F,col.names=F) + + newData = data.frame(data.table(PRODF)[,list(unique=.N, + VH.DEL=num_median(.SD$X3V.REGION.trimmed.nt.nb, na.rm=T), + P1=num_median(.SD$P3V.nt.nb, na.rm=T), + N1=num_median(rowSums(.SD[,c("N.REGION.nt.nb", "N1.REGION.nt.nb"), with=F], na.rm=T)), + P2=num_median(.SD$P5D.nt.nb, na.rm=T), + DEL.DH=num_median(.SD$X5D.REGION.trimmed.nt.nb, na.rm=T), + DH.DEL=num_median(.SD$X3D.REGION.trimmed.nt.nb, na.rm=T), + P3=num_median(.SD$P3D.nt.nb, na.rm=T), + N2=num_median(rowSums(.SD[,c("N2.REGION.nt.nb", "N3.REGION.nt.nb", "N4.REGION.nt.nb"), with=F], na.rm=T)), + P4=num_median(.SD$P5J.nt.nb, na.rm=T), + DEL.JH=num_median(.SD$X5J.REGION.trimmed.nt.nb, na.rm=T), + Total.Del=num_median(rowSums(.SD[,c("X3V.REGION.trimmed.nt.nb", "X5D.REGION.trimmed.nt.nb", "X3D.REGION.trimmed.nt.nb", "X5J.REGION.trimmed.nt.nb"), with=F], na.rm=T)), + Total.N=num_median(rowSums(.SD[,c("N.REGION.nt.nb", "N1.REGION.nt.nb", "N2.REGION.nt.nb", "N3.REGION.nt.nb", "N4.REGION.nt.nb"), with=F], na.rm=T)), + Total.P=num_median(rowSums(.SD[,c("P3V.nt.nb", "P5D.nt.nb", "P3D.nt.nb", "P5J.nt.nb"), with=F], na.rm=T)), + Median.CDR3.l=as.double(median(.SD$CDR3.Length))), + by=c("Sample")]) + newData[,sapply(newData, is.numeric)] = round(newData[,sapply(newData, is.numeric)],1) + write.table(newData, "junctionAnalysisProd_median.csv" , sep=",",quote=F,na="-",row.names=F,col.names=F) + + newData = data.frame(data.table(UNPROD)[,list(unique=.N, + VH.DEL=mean(.SD$X3V.REGION.trimmed.nt.nb, na.rm=T), + P1=mean(.SD$P3V.nt.nb, na.rm=T), + N1=mean(rowSums(.SD[,c("N.REGION.nt.nb", "N1.REGION.nt.nb"), with=F], na.rm=T)), + P2=mean(.SD$P5D.nt.nb, na.rm=T), + DEL.DH=mean(.SD$X5D.REGION.trimmed.nt.nb, na.rm=T), + DH.DEL=mean(.SD$X3D.REGION.trimmed.nt.nb, na.rm=T), + P3=mean(.SD$P3D.nt.nb, na.rm=T), + N2=mean(rowSums(.SD[,c("N2.REGION.nt.nb", "N3.REGION.nt.nb", "N4.REGION.nt.nb"), with=F], na.rm=T)), + P4=mean(.SD$P5J.nt.nb, na.rm=T), + DEL.JH=mean(.SD$X5J.REGION.trimmed.nt.nb, na.rm=T), + Total.Del=mean(rowSums(.SD[,c("X3V.REGION.trimmed.nt.nb", "X5D.REGION.trimmed.nt.nb", "X3D.REGION.trimmed.nt.nb", "X5J.REGION.trimmed.nt.nb"), with=F], na.rm=T)), + Total.N=mean(rowSums(.SD[,c("N.REGION.nt.nb", "N1.REGION.nt.nb", "N2.REGION.nt.nb", "N3.REGION.nt.nb", "N4.REGION.nt.nb"), with=F], na.rm=T)), + Total.P=mean(rowSums(.SD[,c("P3V.nt.nb", "P5D.nt.nb", "P3D.nt.nb", "P5J.nt.nb"), with=F], na.rm=T)), + Median.CDR3.l=as.double(median(.SD$CDR3.Length))), + by=c("Sample")]) + newData[,sapply(newData, is.numeric)] = round(newData[,sapply(newData, is.numeric)],1) + write.table(newData, "junctionAnalysisUnProd_mean.csv" , sep=",",quote=F,na="-",row.names=F,col.names=F) + + newData = data.frame(data.table(UNPROD)[,list(unique=.N, + VH.DEL=num_median(.SD$X3V.REGION.trimmed.nt.nb, na.rm=T), + P1=num_median(.SD$P3V.nt.nb, na.rm=T), + N1=num_median(rowSums(.SD[,c("N.REGION.nt.nb", "N1.REGION.nt.nb"), with=F], na.rm=T)), + P2=num_median(.SD$P5D.nt.nb, na.rm=T), + DEL.DH=num_median(.SD$X5D.REGION.trimmed.nt.nb, na.rm=T), + DH.DEL=num_median(.SD$X3D.REGION.trimmed.nt.nb, na.rm=T), + P3=num_median(.SD$P3D.nt.nb, na.rm=T), + N2=num_median(rowSums(.SD[,c("N2.REGION.nt.nb", "N3.REGION.nt.nb", "N4.REGION.nt.nb"), with=F], na.rm=T)), + P4=num_median(.SD$P5J.nt.nb, na.rm=T), + DEL.JH=num_median(.SD$X5J.REGION.trimmed.nt.nb, na.rm=T), + Total.Del=num_median(rowSums(.SD[,c("X3V.REGION.trimmed.nt.nb", "X5D.REGION.trimmed.nt.nb", "X3D.REGION.trimmed.nt.nb", "X5J.REGION.trimmed.nt.nb"), with=F], na.rm=T)), + Total.N=num_median(rowSums(.SD[,c("N.REGION.nt.nb", "N1.REGION.nt.nb", "N2.REGION.nt.nb", "N3.REGION.nt.nb", "N4.REGION.nt.nb"), with=F], na.rm=T)), + Total.P=num_median(rowSums(.SD[,c("P3V.nt.nb", "P5D.nt.nb", "P3D.nt.nb", "P5J.nt.nb"), with=F], na.rm=T)), + Median.CDR3.l=as.double(median(.SD$CDR3.Length))), + by=c("Sample")]) + + newData[,sapply(newData, is.numeric)] = round(newData[,sapply(newData, is.numeric)],1) + write.table(newData, "junctionAnalysisUnProd_median.csv" , sep=",",quote=F,na="-",row.names=F,col.names=F) +} + +PRODF = bak + + +# ---------------------- D reading frame ---------------------- + +D.REGION.reading.frame = PRODF[,c("Sample", "D.REGION.reading.frame")] + +chck = is.na(D.REGION.reading.frame$D.REGION.reading.frame) +if(any(chck)){ + D.REGION.reading.frame[chck,"D.REGION.reading.frame"] = "No D" +} + +D.REGION.reading.frame = data.frame(data.table(D.REGION.reading.frame)[, list(Freq=.N), by=c("Sample", "D.REGION.reading.frame")]) + +write.table(D.REGION.reading.frame, "DReadingFrame.csv" , sep="\t",quote=F,row.names=F,col.names=T) + +D.REGION.reading.frame = ggplot(D.REGION.reading.frame) +D.REGION.reading.frame = D.REGION.reading.frame + geom_bar(aes( x = D.REGION.reading.frame, y = Freq, fill=Sample), stat='identity', position='dodge' ) + ggtitle("D reading frame") + xlab("Frequency") + ylab("Frame") +D.REGION.reading.frame = D.REGION.reading.frame + scale_fill_manual(values=sample.colors) +D.REGION.reading.frame = D.REGION.reading.frame + theme(panel.background = element_rect(fill = "white", colour="black"),text = element_text(size=15, colour="black"), axis.text.x = element_text(angle = 45, hjust = 1), panel.grid.major.y = element_line(colour = "black"), panel.grid.major.x = element_blank()) + +png("DReadingFrame.png") +D.REGION.reading.frame +dev.off() + + + + +# ---------------------- AA composition in CDR3 ---------------------- + +AACDR3 = PRODF[,c("Sample", "CDR3.Seq")] + +TotalPerSample = data.frame(data.table(AACDR3)[, list(total=sum(nchar(as.character(.SD$CDR3.Seq)))), by=Sample]) + +AAfreq = list() + +for(i in 1:nrow(TotalPerSample)){ + sample = TotalPerSample$Sample[i] + AAfreq[[i]] = data.frame(table(unlist(strsplit(as.character(AACDR3[AACDR3$Sample == sample,c("CDR3.Seq")]), "")))) + AAfreq[[i]]$Sample = sample +} + +AAfreq = ldply(AAfreq, data.frame) +AAfreq = merge(AAfreq, TotalPerSample, by="Sample", all.x = T) +AAfreq$freq_perc = as.numeric(AAfreq$Freq / AAfreq$total * 100) + + +AAorder = read.table(sep="\t", header=TRUE, text="order.aa\tAA\n1\tR\n2\tK\n3\tN\n4\tD\n5\tQ\n6\tE\n7\tH\n8\tP\n9\tY\n10\tW\n11\tS\n12\tT\n13\tG\n14\tA\n15\tM\n16\tC\n17\tF\n18\tL\n19\tV\n20\tI") +AAfreq = merge(AAfreq, AAorder, by.x='Var1', by.y='AA', all.x=TRUE) + +AAfreq = AAfreq[!is.na(AAfreq$order.aa),] + +AAfreqplot = ggplot(AAfreq) +AAfreqplot = AAfreqplot + geom_bar(aes( x=factor(reorder(Var1, order.aa)), y = freq_perc, fill = Sample), stat='identity', position='dodge' ) +AAfreqplot = AAfreqplot + annotate("rect", xmin = 0.5, xmax = 2.5, ymin = 0, ymax = Inf, fill = "red", alpha = 0.2) +AAfreqplot = AAfreqplot + annotate("rect", xmin = 3.5, xmax = 4.5, ymin = 0, ymax = Inf, fill = "blue", alpha = 0.2) +AAfreqplot = AAfreqplot + annotate("rect", xmin = 5.5, xmax = 6.5, ymin = 0, ymax = Inf, fill = "blue", alpha = 0.2) +AAfreqplot = AAfreqplot + annotate("rect", xmin = 6.5, xmax = 7.5, ymin = 0, ymax = Inf, fill = "red", alpha = 0.2) +AAfreqplot = AAfreqplot + ggtitle("Amino Acid Composition in the CDR3") + xlab("Amino Acid, from Hydrophilic (left) to Hydrophobic (right)") + ylab("Percentage") + scale_fill_manual(values=sample.colors) +AAfreqplot = AAfreqplot + theme(panel.background = element_rect(fill = "white", colour="black"),text = element_text(size=15, colour="black"), axis.text.x = element_text(angle = 45, hjust = 1), panel.grid.major.y = element_line(colour = "black"), panel.grid.major.x = element_blank()) + +png("AAComposition.png",width = 1280, height = 720) +AAfreqplot +dev.off() +write.table(AAfreq, "AAComposition.csv" , sep=",",quote=F,na="-",row.names=F,col.names=T) + +# ---------------------- AA median CDR3 length ---------------------- + +median.aa.l = data.frame(data.table(PRODF)[, list(median=as.double(median(.SD$CDR3.Length))), by=c("Sample")]) +write.table(median.aa.l, "AAMedianBySample.csv" , sep=",",quote=F,na="-",row.names=F,col.names=F) +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/report_clonality/r_wrapper.sh.old Fri Jan 27 03:44:18 2017 -0500 @@ -0,0 +1,315 @@ +#!/bin/bash + +inputFile=$1 +outputDir=$3 +outputFile=$3/index.html #$2 +clonalType=$4 +species=$5 +locus=$6 +filterproductive=$7 +clonality_method=$8 + +dir="$(cd "$(dirname "$0")" && pwd)" +useD="false" +if grep -q "$species.*${locus}D" "$dir/genes.txt" ; then + echo "species D region in reference db" + useD="true" +fi +echo "$species" +if [[ "$species" == *"custom"* ]] ; then + loci=(${locus//;/ }) + useD="true" + echo "${loci[@]}" + if [[ "${#loci[@]}" -eq "2" ]] ; then + useD="false" + fi +fi +mkdir $3 +cp $dir/genes.txt $outputDir +Rscript --verbose $dir/RScript.r $inputFile $outputDir $outputDir $clonalType "$species" "$locus" $filterproductive ${clonality_method} 2>&1 +cp $dir/tabber.js $outputDir +cp $dir/style.css $outputDir +cp $dir/script.js $outputDir +cp $dir/jquery-1.11.0.min.js $outputDir +cp $dir/pure-min.css $outputDir +samples=`cat $outputDir/samples.txt` + +echo "<html><center><h1><a href='index.html'>Click here for the results</a></h1>Tip: Open it in a new tab (middle mouse button or right mouse button -> 'open in new tab' on the link above)<br />" > $2 +echo "<table border = 1>" >> $2 +echo "<thead><tr><th>Sample/Replicate</th><th>All</th><th>Productive</th><th>Unique Productive</th><th>Unproductive</th><th>Unique Unproductive</th></tr></thead>" >> $2 +while IFS=, read sample all productive perc_prod productive_unique perc_prod_un unproductive perc_unprod unproductive_unique perc_unprod_un + do + echo "<tr><td>$sample</td>" >> $2 + echo "<td>$all</td>" >> $2 + echo "<td>$productive (${perc_prod}%)</td>" >> $2 + echo "<td>$productive_unique (${perc_prod_un}%)</td>" >> $2 + echo "<td>$unproductive (${perc_unprod}%)</td>" >> $2 + echo "<td>$unproductive_unique (${perc_unprod_un}%)</td></tr>" >> $2 +done < $outputDir/productive_counting.txt +echo "</table border></center></html>" >> $2 + +echo "<html><head><title>Report on:" >> $outputFile + +mkdir $outputDir/circos +cp $dir/circos/* $outputDir/circos/ +#CIRCOSTOOLS="/data/galaxy/galaxy-dist/toolsheddependencies/circos/0.64/saskia-hiltemann/cg_circos_plots/bbfdd52d64fd/circos-tools-0.21/tools" +#CIRCOSDIR="/data/galaxy/galaxy-dist/toolsheddependencies/circos/0.64/saskia-hiltemann/cg_circos_plots/bbfdd52d64fd/bin/" + +#CIRCOSTOOLS="/home/galaxy/circos/circos-tools-0.22/tools" +#CIRCOSDIR="/home/galaxy/Anaconda3/bin" + +USECIRCOS="no" +if [ -d "$CIRCOSDIR" ]; then + USECIRCOS="yes" +else + if [ -d "/data/galaxy/galaxy-dist/toolsheddependencies/circos/0.64/saskia-hiltemann/cg_circos_plots/bbfdd52d64fd/bin/" ]; then #hopefully temporary fix + USECIRCOS="yes" + CIRCOSTOOLS="/data/galaxy/galaxy-dist/toolsheddependencies/circos/0.64/saskia-hiltemann/cg_circos_plots/bbfdd52d64fd/circos-tools-0.21/tools" + CIRCOSDIR="/data/galaxy/galaxy-dist/toolsheddependencies/circos/0.64/saskia-hiltemann/cg_circos_plots/bbfdd52d64fd/bin/" + fi + + if [ -d "/home/galaxy/Anaconda3/bin" ]; then #hopefully temporary fix + USECIRCOS="yes" + CIRCOSTOOLS="/home/galaxy/circos/circos-tools-0.22/tools" + CIRCOSDIR="/home/galaxy/Anaconda3/bin" + fi +fi + +echo "Using Circos: $USECIRCOS" +sed -i "s%DATA_DIR%$outputDir/circos%" $outputDir/circos/circos.conf +for sample in $samples; do #output the samples to a file and create the circos plots with the R script output + echo " $sample" >> $outputFile + + if [[ "$USECIRCOS" != "yes" ]]; then + continue + fi + + circos_file="$outputDir/${sample}_VJ_circos.txt" + echo -e -n "labels$(cat ${circos_file})" > ${circos_file} + cat "${circos_file}" | $CIRCOSTOOLS/tableviewer/bin/parse-table -configfile $dir/circos/parse-table.conf 2>&1 | $CIRCOSTOOLS/tableviewer/bin/make-conf -dir $outputDir/circos/ + $CIRCOSDIR/circos -conf $outputDir/circos/circos.conf 2>&1 + mv $outputDir/circos/circos.png $outputDir/circosVJ_${sample}.png + + + if [[ "$useD" == "true" ]] ; then + circos_file="$outputDir/${sample}_VD_circos.txt" + echo -e -n "labels$(cat ${circos_file})" > ${circos_file} + cat "${circos_file}" | $CIRCOSTOOLS/tableviewer/bin/parse-table -configfile $dir/circos/parse-table.conf 2>&1 | $CIRCOSTOOLS/tableviewer/bin/make-conf -dir $outputDir/circos/ + $CIRCOSDIR/circos -conf $outputDir/circos/circos.conf 2>&1 + mv $outputDir/circos/circos.png $outputDir/circosVD_${sample}.png + + circos_file="$outputDir/${sample}_DJ_circos.txt" + echo -e -n "labels$(cat ${circos_file})" > ${circos_file} + cat "${circos_file}" | $CIRCOSTOOLS/tableviewer/bin/parse-table -configfile $dir/circos/parse-table.conf 2>&1 | $CIRCOSTOOLS/tableviewer/bin/make-conf -dir $outputDir/circos/ + $CIRCOSDIR/circos -conf $outputDir/circos/circos.conf 2>&1 + mv $outputDir/circos/circos.png $outputDir/circosDJ_${sample}.png + + fi +done +echo "</title><script type='text/javascript' src='jquery-1.11.0.min.js'></script>" >> $outputFile +echo "<link rel='stylesheet' type='text/css' href='pure-min.css'>" >> $outputFile +echo "<script type='text/javascript' src='tabber.js'></script>" >> $outputFile +echo "<script type='text/javascript' src='script.js'></script>" >> $outputFile +echo "<link rel='stylesheet' type='text/css' href='style.css'></head>" >> $outputFile +echo "<div class='tabber'><div class='tabbertab' title='Gene frequencies'>" >> $outputFile + + +echo "<img src='VFPlot.png'/>" >> $outputFile +if [[ "$useD" == "true" ]] ; then + echo "<img src='DFPlot.png'/>" >> $outputFile +fi +echo "<img src='VPlot.png'/>" >> $outputFile +if [[ "$useD" == "true" ]] ; then + echo "<img src='DPlot.png'/>" >> $outputFile +fi +echo "<img src='JPlot.png'/>" >> $outputFile +echo "</div>" >> $outputFile + +echo "<div class='tabbertab' title='CDR3 Characteristics'>" >> $outputFile +echo "<img src='CDR3LengthPlot.png'/><br />" >> $outputFile +echo "<img src='AAComposition.png'/>" >> $outputFile +echo "<img src='DReadingFrame.png'/>" >> $outputFile + +echo "<table class='pure-table pure-table-striped'>" >> $outputFile +echo "<thead><tr><th>Sample</th><th>Median CDR3 Length</th></tr></thead>" >> $outputFile +while IFS=, read Sample median +do + echo "<tr><td>$Sample</td><td>$median</td></tr>" >> $outputFile +done < $outputDir/AAMedianBySample.csv +echo "</table>" >> $outputFile + +echo "</div>" >> $outputFile + +#Heatmaps + +count=1 +echo "<div class='tabbertab' title='Heatmaps'><div class='tabber'>" >> $outputFile +for sample in $samples; do + echo "<div class='tabbertab' title='$sample'><table border='1'><tr>" >> $outputFile + if [[ "$useD" == "true" ]] ; then + echo "<td><img src='HeatmapVD_$sample.png'/></td>" >> $outputFile + fi + echo "<td><img src='HeatmapVJ_$sample.png'/></td>" >> $outputFile + if [[ "$useD" == "true" ]] ; then + echo "<td><img src='HeatmapDJ_$sample.png'/></td>" >> $outputFile + fi + echo "</tr></table></div>" >> $outputFile + count=$((count+1)) +done +echo "</div></div>" >> $outputFile + +#circos + +if [[ "$USECIRCOS" == "yes" ]]; then + + echo "<div class='tabbertab' title='Circos'><div class='tabber'>" >> $outputFile + for sample in $samples; do + echo "<div class='tabbertab' title='$sample'><table border='1'><center>" >> $outputFile + if [[ "$useD" == "true" ]] ; then + echo "<tr><td>V-D</td><td><img src='circosVD_${sample}.png' width='700' height='700'/></td></tr>" >> $outputFile + fi + echo "<tr><td>V-J</td><td><img src='circosVJ_${sample}.png' width='700' height='700'/></td></tr>" >> $outputFile + if [[ "$useD" == "true" ]] ; then + echo "<tr><td>D-J</td><td><img src='circosDJ_${sample}.png' width='700' height='700'/></td></tr>" >> $outputFile + fi + echo "<center></table></div>" >> $outputFile + count=$((count+1)) + done + echo "</div></div>" >> $outputFile +fi +#echo "<div class='tabbertab' title='Interactive'><svg class='chart'></svg><script src='http://d3js.org/d3.v3.min.js'></script></div>" >> $outputFile + +hasReplicateColumn="$(if head -n 1 $inputFile | grep -q 'Replicate'; then echo 'Yes'; else echo 'No'; fi)" +echo "$hasReplicateColumn" +#if its a 'new' merged file with replicate info +if [[ "$hasReplicateColumn" == "Yes" ]] ; then + echo "<div class='tabbertab' title='Clonality'><div class='tabber'>" >> $outputFile + for sample in $samples; do + echo "${clonality_method}" + if [[ "${clonality_method}" == "old" ]] ; then + echo "in old" + clonalityScore="$(cat $outputDir/ClonalityScore_$sample.csv)" + echo "<div class='tabbertab' title='$sample'><table class='pure-table pure-table-striped'>" >> $outputFile + echo "<thead><tr><th colspan='4'>Clonality Score: $clonalityScore</th></tr></thead>" >> $outputFile + + #replicate,reads,squared + echo "<tr><td>Replicate ID</td><td>Number of Reads</td></tr>" >> $outputFile + while IFS=, read replicate reads squared + do + echo "<tr><td>$replicate</td><td>$reads</td></tr>" >> $outputFile + done < $outputDir/ReplicateReads_$sample.csv + + #sum of reads and reads squared + while IFS=, read readsSum squaredSum + do + echo "<tr><td>Sum</td><td>$readsSum</td></tr>" >> $outputFile + done < $outputDir/ReplicateSumReads_$sample.csv + + #overview + echo "<tr><td>Coincidence Type</td><td>Raw Coincidence Freq</td></tr>" >> $outputFile + while IFS=, read type count weight weightedCount + do + if [[ "$type" -eq "1" ]]; then + echo "<tr><td>$type</td><td>$count</td></tr>" >> $outputFile + else + echo "<tr><td><a href='coincidences_${sample}_${type}.txt'>$type</a></td><td>$count</td></tr>" >> $outputFile + fi + + done < $outputDir/ClonalityOverView_$sample.csv + echo "</table></div>" >> $outputFile + else + echo "in new" + clonalityScore="$(cat $outputDir/lymphclon_clonality_${sample}.csv)" + echo "<div class='tabbertab' title='$sample'>" >> $outputFile + echo "Lymphclon clonality score: <br />$clonalityScore<br /><br />" >> $outputFile + echo "<table border = 1>" >> $outputFile + while IFS=, read type count + do + echo "<tr><td>$type</td><td>$count</td></tr>" >> $outputFile + done < $outputDir/lymphclon_coincidences_$sample.csv + echo "</table></div>" >> $outputFile + fi + done + echo "</div></div>" >> $outputFile +fi + +#hasJunctionData="$(if head -n 1 $inputFile | grep -qE '3V.REGION.trimmed.nt.nb'; then echo 'Yes'; else echo 'No'; fi)" + +#if [[ "$hasJunctionData" == "Yes" ]] ; then +if [ -a "$outputDir/junctionAnalysisProd_mean.csv" ] ; then + echo "<div class='tabbertab' title='Junction Analysis'>" >> $outputFile + echo "<table class='pure-table pure-table-striped' id='junction_table'> <caption>Productive mean</caption><thead><tr><th>Sample</th><th>count</th><th>V.DEL</th><th>P1</th><th>N1</th><th>P2</th><th>DEL.D</th><th>D.DEL</th><th>P3</th><th>N2</th><th>P4</th><th>DEL.J</th><th>Total.Del</th><th>Total.N</th><th>Total.P</th><th>Median.CDR3</th><thead></tr><tbody>" >> $outputFile + while IFS=, read Sample unique VDEL P1 N1 P2 DELD DDEL P3 N2 P4 DELJ TotalDel TotalN TotalP median + do + echo "<tr><td>$Sample</td><td>$unique</td><td>$VDEL</td><td>$P1</td><td>$N1</td><td>$P2</td><td>$DELD</td><td>$DDEL</td><td>$P3</td><td>$N2</td><td>$P4</td><td>$DELJ</td><td>$TotalDel</td><td>$TotalN</td><td>$TotalP</td><td>$median</td></tr>" >> $outputFile + done < $outputDir/junctionAnalysisProd_mean.csv + echo "</tbody></table>" >> $outputFile + + echo "<table class='pure-table pure-table-striped' id='junction_table'> <caption>Unproductive mean</caption><thead><tr><th>Sample</th><th>count</th><th>V.DEL</th><th>P1</th><th>N1</th><th>P2</th><th>DEL.D</th><th>D.DEL</th><th>P3</th><th>N2</th><th>P4</th><th>DEL.J</th><th>Total.Del</th><th>Total.N</th><th>Total.P</th><th>Median.CDR3</th><thead></tr><tbody>" >> $outputFile + while IFS=, read Sample unique VDEL P1 N1 P2 DELD DDEL P3 N2 P4 DELJ TotalDel TotalN TotalP median + do + echo "<tr><td>$Sample</td><td>$unique</td><td>$VDEL</td><td>$P1</td><td>$N1</td><td>$P2</td><td>$DELD</td><td>$DDEL</td><td>$P3</td><td>$N2</td><td>$P4</td><td>$DELJ</td><td>$TotalDel</td><td>$TotalN</td><td>$TotalP</td><td>$median</td></tr>" >> $outputFile + done < $outputDir/junctionAnalysisUnProd_mean.csv + echo "</tbody></table>" >> $outputFile + + echo "<table class='pure-table pure-table-striped' id='junction_table'> <caption>Productive median</caption><thead><tr><th>Sample</th><th>count</th><th>V.DEL</th><th>P1</th><th>N1</th><th>P2</th><th>DEL.D</th><th>D.DEL</th><th>P3</th><th>N2</th><th>P4</th><th>DEL.J</th><th>Total.Del</th><th>Total.N</th><th>Total.P</th><th>Median.CDR3</th><thead></tr><tbody>" >> $outputFile + while IFS=, read Sample unique VDEL P1 N1 P2 DELD DDEL P3 N2 P4 DELJ TotalDel TotalN TotalP median + do + echo "<tr><td>$Sample</td><td>$unique</td><td>$VDEL</td><td>$P1</td><td>$N1</td><td>$P2</td><td>$DELD</td><td>$DDEL</td><td>$P3</td><td>$N2</td><td>$P4</td><td>$DELJ</td><td>$TotalDel</td><td>$TotalN</td><td>$TotalP</td><td>$median</td></tr>" >> $outputFile + done < $outputDir/junctionAnalysisProd_median.csv + echo "</tbody></table>" >> $outputFile + + echo "<table class='pure-table pure-table-striped' id='junction_table'> <caption>Unproductive median</caption><thead><tr><th>Sample</th><th>count</th><th>V.DEL</th><th>P1</th><th>N1</th><th>P2</th><th>DEL.D</th><th>D.DEL</th><th>P3</th><th>N2</th><th>P4</th><th>DEL.J</th><th>Total.Del</th><th>Total.N</th><th>Total.P</th><th>Median.CDR3</th><thead></tr><tbody>" >> $outputFile + while IFS=, read Sample unique VDEL P1 N1 P2 DELD DDEL P3 N2 P4 DELJ TotalDel TotalN TotalP median + do + echo "<tr><td>$Sample</td><td>$unique</td><td>$VDEL</td><td>$P1</td><td>$N1</td><td>$P2</td><td>$DELD</td><td>$DDEL</td><td>$P3</td><td>$N2</td><td>$P4</td><td>$DELJ</td><td>$TotalDel</td><td>$TotalN</td><td>$TotalP</td><td>$median</td></tr>" >> $outputFile + done < $outputDir/junctionAnalysisUnProd_median.csv + echo "</tbody></table>" >> $outputFile + + echo "</div>" >> $outputFile +fi + +echo "<div class='tabbertab' title='Comparison'><table class='pure-table pure-table-striped'><thead><tr><th>ID</th><th>Include</th></tr></thead>" >> $outputFile +for sample in $samples; do + echo "<tr><td>$sample</td><td><input type='checkbox' onchange=\"javascript:compareAdd('$sample')\" id='compare_checkbox_$sample'/></td></tr>" >> $outputFile +done +echo "</table><div name='comparisonarea'>" >> $outputFile +echo "<table><tr id='comparison_table_vd'></tr></table>" >> $outputFile +echo "<table><tr id='comparison_table_vj'></tr></table>" >> $outputFile +echo "<table><tr id='comparison_table_dj'></tr></table>" >> $outputFile +echo "</div></div>" >> $outputFile + +echo "<div class='tabbertab' title='Downloads'>" >> $outputFile +echo "<table class='pure-table pure-table-striped'>" >> $outputFile +echo "<thead><tr><th>Description</th><th>Link</th></tr></thead>" >> $outputFile +echo "<tr><td>The dataset used to generate the frequency graphs and the heatmaps (Unique based on clonaltype, $clonalType)</td><td><a href='allUnique.csv'>Download</a></td></tr>" >> $outputFile +echo "<tr><td>The dataset used to calculate clonality score (Unique based on clonaltype, $clonalType)</td><td><a href='clonalityComplete.csv'>Download</a></td></tr>" >> $outputFile + +echo "<tr><td>The dataset used to generate the CDR3 length frequency graph</td><td><a href='CDR3LengthPlot.csv'>Download</a></td></tr>" >> $outputFile + +echo "<tr><td>The dataset used to generate the V gene family frequency graph</td><td><a href='VFFrequency.csv'>Download</a></td></tr>" >> $outputFile +if [[ "$useD" == "true" ]] ; then + echo "<tr><td>The dataset used to generate the D gene family frequency graph</td><td><a href='DFFrequency.csv'>Download</a></td></tr>" >> $outputFile +fi + +echo "<tr><td>The dataset used to generate the V gene frequency graph</td><td><a href='VFrequency.csv'>Download</a></td></tr>" >> $outputFile +if [[ "$useD" == "true" ]] ; then + echo "<tr><td>The dataset used to generate the D gene frequency graph</td><td><a href='DFrequency.csv'>Download</a></td></tr>" >> $outputFile +fi +echo "<tr><td>The dataset used to generate the J gene frequency graph</td><td><a href='JFrequency.csv'>Download</a></td></tr>" >> $outputFile +echo "<tr><td>The dataset used to generate the AA composition graph</td><td><a href='AAComposition.csv'>Download</a></td></tr>" >> $outputFile + +for sample in $samples; do + if [[ "$useD" == "true" ]] ; then + echo "<tr><td>The data used to generate the VD heatmap for $sample.</td><td><a href='HeatmapVD_$sample.csv'>Download</a></td></tr>" >> $outputFile + fi + echo "<tr><td>The data used to generate the VJ heatmap for $sample.</td><td><a href='HeatmapVJ_$sample.csv'>Download</a></td></tr>" >> $outputFile + if [[ "$useD" == "true" ]] ; then + echo "<tr><td>The data used to generate the DJ heatmap for $sample.</td><td><a href='HeatmapDJ_$sample.csv'>Download</a></td></tr>" >> $outputFile + fi +done + +echo "<tr><td>A frequency count of V Gene + J Gene + CDR3</td><td><a href='VJCDR3_count.txt'>Download</a></td></tr>" >> $outputFile + +echo "</table>" >> $outputFile +echo "</div></html>" >> $outputFile
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/report_clonality_igg.xml Fri Jan 27 03:44:18 2017 -0500 @@ -0,0 +1,197 @@ +<tool id="report_clonality_igg" name="Report Clonality" version="1.0"> + <description> </description> + <command interpreter="bash"> +#if $gene_selection.source == "imgtdb" + report_clonality/r_wrapper.sh $in_file $out_file $out_file.files_path "$clonaltype" "${gene_selection.species}" "${gene_selection.locus}" $filterproductive $clonality_method +#else + report_clonality/r_wrapper.sh $in_file $out_file $out_file.files_path "$clonaltype" "custom" "${gene_selection.vgenes};${gene_selection.dgenes};${gene_selection.jgenes}" $filterproductive $clonality_method +#end if + </command> + <inputs> + <param name="in_file" format="tabular" type="data" label="Data to Process" /> + <param name="clonaltype" type="select" label="Clonal Type Definition (Needed for clonality calculation)"> + <option value="none">Don't remove duplicates based on clonaltype</option> + <option value="Top.V.Gene,CDR3.Seq">Top.V.Gene, CDR3 (AA)</option> + <option value="Top.V.Gene,CDR3.Seq.DNA">Top.V.Gene, CDR3 (nt)</option> + <option value="Top.V.Gene,Top.J.Gene,CDR3.Seq">Top.V.Gene, Top.J.Gene, CDR3 (AA)</option> + <option value="Top.V.Gene,Top.J.Gene,CDR3.Seq.DNA">Top.V.Gene, Top.J.Gene, CDR3 (nt)</option> + <option value="Top.V.Gene,Top.D.Gene,Top.J.Gene,CDR3.Seq.DNA">Top.V.Gene, Top.D.Gene, Top.J.Gene, CDR3 (nt)</option> + <option value="Top.V.Gene,Top.D.Gene,Top.J.Gene,CDR3.Seq">Top.V.Gene, Top.D.Gene, Top.J.Gene, CDR3 (AA)</option> + </param> + + <conditional name="gene_selection" > + <param name="source" type="select" label="Gene reference" help="" > + <option value="imgtdb" selected="true">IMGT-DB</option> + <option value="custom">User defined</option> + </param> + <when value="imgtdb"> + <param name="species" type="select" label="Species"> + <option value="Homo sapiens functional">Homo sapiens functional</option> + <option value="Homo sapiens">Homo sapiens</option> + <option value="Homo sapiens non-functional">Homo sapiens non-functional</option> + <option value="Bos taurus">Bos taurus</option> + <option value="Bos taurus functional">Bos taurus functional</option> + <option value="Bos taurus non-functional">Bos taurus non-functional</option> + <option value="Camelus dromedarius">Camelus dromedarius</option> + <option value="Camelus dromedarius functional">Camelus dromedarius functional</option> + <option value="Camelus dromedarius non-functional">Camelus dromedarius non-functional</option> + <option value="Canis lupus familiaris">Canis lupus familiaris</option> + <option value="Canis lupus familiaris functional">Canis lupus familiaris functional</option> + <option value="Canis lupus familiaris non-functional">Canis lupus familiaris non-functional</option> + <option value="Danio rerio">Danio rerio</option> + <option value="Danio rerio functional">Danio rerio functional</option> + <option value="Danio rerio non-functional">Danio rerio non-functional</option> + <option value="Macaca mulatta">Macaca mulatta</option> + <option value="Macaca mulatta functional">Macaca mulatta functional</option> + <option value="Macaca mulatta non-functional">Macaca mulatta non-functional</option> + <option value="Mus musculus">Mus musculus</option> + <option value="Mus musculus functional">Mus musculus functional</option> + <option value="Mus musculus non-functional">Mus musculus non-functional</option> + <option value="Mus spretus">Mus spretus</option> + <option value="Mus spretus functional">Mus spretus functional</option> + <option value="Mus spretus non-functional">Mus spretus non-functional</option> + <option value="Oncorhynchus mykiss">Oncorhynchus mykiss</option> + <option value="Oncorhynchus mykiss functional">Oncorhynchus mykiss functional</option> + <option value="Oncorhynchus mykiss non-functional">Oncorhynchus mykiss non-functional</option> + <option value="Ornithorhynchus anatinus">Ornithorhynchus anatinus</option> + <option value="Ornithorhynchus anatinus functional">Ornithorhynchus anatinus functional</option> + <option value="Ornithorhynchus anatinus non-functional">Ornithorhynchus anatinus non-functional</option> + <option value="Oryctolagus cuniculus">Oryctolagus cuniculus</option> + <option value="Oryctolagus cuniculus functional">Oryctolagus cuniculus functional</option> + <option value="Oryctolagus cuniculus non-functional">Oryctolagus cuniculus non-functional</option> + <option value="Rattus norvegicus">Rattus norvegicus</option> + <option value="Rattus norvegicus functional">Rattus norvegicus functional</option> + <option value="Rattus norvegicus non-functional">Rattus norvegicus non-functional</option> + <option value="Sus scrofa">Sus scrofa</option> + <option value="Sus scrofa functional">Sus scrofa functional</option> + <option value="Sus scrofa non-functional">Sus scrofa non-functional</option> + </param> + + <param name="locus" type="select" label="Locus"> + <option value="TRA">TRA</option> + <option value="TRD">TRD</option> + <option value="TRG">TRG</option> + <option value="TRB">TRB</option> + <option value="IGH">IGH</option> + <option value="IGI">IGI</option> + <option value="IGK">IGK</option> + <option value="IGL">IGL</option> + </param> + </when> + <when value="custom"> + <param name="species" type="hidden" value="custom" size="50" /> + <param name="vgenes" type="text" label="V Genes, add the custom genes comma seperated, no spaces" size="100" /> + <param name="dgenes" type="text" label="D Genes" size="100" /> + <param name="jgenes" type="text" label="J Genes" size="100" /> + </when> + </conditional> + + <param name="filterproductive" type="select" label="Remove the unproductive sequences from graphs "> + <option value="yes">Yes</option> + <option value="no">No</option> + </param> + + <param name="clonality_method" type="select" label="Old clonality algorithm or the newer R package"> + <option value="old">Old</option> + <option value="boyd">R Package</option> + </param> + + </inputs> + <outputs> + <data format="html" name="out_file" /> + </outputs> + <requirements> + <requirement type="package" version="3.3">weblogo</requirement> + <!--<requirement type="package" version="0.20">circostools</requirement>--> + </requirements> + <help> +**INPUT** + +One or more ARGalaxy proprietary format files combined with the ARGalaxy Experimental Design tool + + +.. class:: warningmark + +Custom gene ordering based on position on genome: + +**Human** + +IGH:: + + V: + IGHV7-81,IGHV3-74,IGHV3-73,IGHV3-72,IGHV3-71,IGHV2-70,IGHV1-69,IGHV3-66,IGHV3-64,IGHV4-61,IGHV4-59,IGHV1-58,IGHV3-53,IGHV3-52,IGHV5-a,IGHV5-51,IGHV3-49,IGHV3-48,IGHV3-47,IGHV1-46,IGHV1-45,IGHV3-43,IGHV4-39,IGHV3-35,IGHV4-34,IGHV3-33,IGHV4-31,IGHV4-30-4,IGHV4-30-2,IGHV3-30-3,IGHV3-30,IGHV4-28,IGHV2-26,IGHV1-24,IGHV3-23,IGHV3-22,IGHV3-21,IGHV3-20,IGHV3-19,IGHV1-18,IGHV3-15,IGHV3-13,IGHV3-11,IGHV3-9,IGHV1-8,IGHV3-7,IGHV2-5,IGHV7-4-1,IGHV4-4,IGHV4-b,IGHV1-3,IGHV1-2,IGHV6-1 + D: + IGHD1-1,IGHD2-2,IGHD3-3,IGHD6-6,IGHD1-7,IGHD2-8,IGHD3-9,IGHD3-10,IGHD4-11,IGHD5-12,IGHD6-13,IGHD1-14,IGHD2-15,IGHD3-16,IGHD4-17,IGHD5-18,IGHD6-19,IGHD1-20,IGHD2-21,IGHD3-22,IGHD4-23,IGHD5-24,IGHD6-25,IGHD1-26,IGHD7-27 + J: + IGHJ1,IGHJ2,IGHJ3,IGHJ4,IGHJ5,IGHJ6 + + +IGK:: + + V: + IGKV3D-7,IGKV1D-8,IGKV1D-43,IGKV3D-11,IGKV1D-12,IGKV1D-13,IGKV3D-15,IGKV1D-16,IGKV1D-17,IGKV3D-20,IGKV2D-26,IGKV2D-28,IGKV2D-29,IGKV2D-30,IGKV1D-33,IGKV1D-39,IGKV2D-40,IGKV2-40,IGKV1-39,IGKV1-33,IGKV2-30,IGKV2-29,IGKV2-28,IGKV1-27,IGKV2-24,IGKV3-20,IGKV1-17,IGKV1-16,IGKV3-15,IGKV1-13,IGKV1-12,IGKV3-11,IGKV1-9,IGKV1-8,IGKV1-6,IGKV1-5,IGKV5-2,IGKV4-1 + J: + IGKJ1,IGKJ2,IGKJ3,IGKJ4,IGKJ5 + + +IGL:: + + V: + IGLV4-69,IGLV8-61,IGLV4-60,IGLV6-57,IGLV5-52,IGLV1-51,IGLV9-49,IGLV1-47,IGLV7-46,IGLV5-45,IGLV1-44,IGLV7-43,IGLV1-41,IGLV1-40,IGLV5-39,IGLV5-37,IGLV1-36,IGLV3-27,IGLV3-25,IGLV2-23,IGLV3-22,IGLV3-21,IGLV3-19,IGLV2-18,IGLV3-16,IGLV2-14,IGLV3-12,IGLV2-11,IGLV3-10,IGLV3-9,IGLV2-8,IGLV4-3,IGLV3-1 + J: + IGLJ1,IGLJ2,IGLJ3,IGLJ6,IGLJ7 + + +TRB:: + + V: + TRBV2,TRBV3-1,TRBV4-1,TRBV5-1,TRBV6-1,TRBV4-2,TRBV6-2,TRBV4-3,TRBV6-3,TRBV7-2,TRBV6-4,TRBV7-3,TRBV9,TRBV10-1,TRBV11-1,TRBV10-2,TRBV11-2,TRBV6-5,TRBV7-4,TRBV5-4,TRBV6-6,TRBV5-5,TRBV7-6,TRBV5-6,TRBV6-8,TRBV7-7,TRBV6-9,TRBV7-8,TRBV5-8,TRBV7-9,TRBV13,TRBV10-3,TRBV11-3,TRBV12-3,TRBV12-4,TRBV12-5,TRBV14,TRBV15,TRBV16,TRBV18,TRBV19,TRBV20-1,TRBV24-1,TRBV25-1,TRBV27,TRBV28,TRBV29-1,TRBV30 + D: + TRBD1,TRBD2 + J: + TRBJ1-1,TRBJ1-2,TRBJ1-3,TRBJ1-4,TRBJ1-5,TRBJ1-6,TRBJ2-1,TRBJ2-2,TRBJ2-3,TRBJ2-4,TRBJ2-5,TRBJ2-6,TRBJ2-7 + + +TRA:: + + V: + TRAV1-1,TRAV1-2,TRAV2,TRAV3,TRAV4,TRAV5,TRAV6,TRAV7,TRAV8-1,TRAV9-1,TRAV10,TRAV12-1,TRAV8-2,TRAV8-3,TRAV13-1,TRAV12-2,TRAV8-4,TRAV13-2,TRAV14/DV4,TRAV9-2,TRAV12-3,TRAV8-6,TRAV16,TRAV17,TRAV18,TRAV19,TRAV20,TRAV21,TRAV22,TRAV23/DV6,TRAV24,TRAV25,TRAV26-1,TRAV27,TRAV29/DV5,TRAV30,TRAV26-2,TRAV34,TRAV35,TRAV36/DV7,TRAV38-1,TRAV38-2/DV8,TRAV39,TRAV40,TRAV41 + J: + TRAJ57,TRAJ56,TRAJ54,TRAJ53,TRAJ52,TRAJ50,TRAJ49,TRAJ48,TRAJ47,TRAJ46,TRAJ45,TRAJ44,TRAJ43,TRAJ42,TRAJ41,TRAJ40,TRAJ39,TRAJ38,TRAJ37,TRAJ36,TRAJ34,TRAJ33,TRAJ32,TRAJ31,TRAJ30,TRAJ29,TRAJ28,TRAJ27,TRAJ26,TRAJ24,TRAJ23,TRAJ22,TRAJ21,TRAJ20,TRAJ18,TRAJ17,TRAJ16,TRAJ15,TRAJ14,TRAJ13,TRAJ12,TRAJ11,TRAJ10,TRAJ9,TRAJ8,TRAJ7,TRAJ6,TRAJ5,TRAJ4,TRAJ3 + + +TRG:: + + V: + TRGV9,TRGV8,TRGV5,TRGV4,TRGV3,TRGV2 + J: + TRGJ2,TRGJP2,TRGJ1,TRGJP1 + + +TRD:: + + V: + TRDV1,TRDV2,TRDV3 + D: + TRDD1,TRDD2,TRDD3 + J: + TRDJ1,TRDJ4,TRDJ2,TRDJ3 + + +**Mouse** + +TRB:: + + V: + TRBV1,TRBV2,TRBV3,TRBV4,TRBV5,TRBV12-1,TRBV13-1,TRBV12-2,TRBV13-2,TRBV13-3,TRBV14,TRBV15,TRBV16,TRBV17,TRBV19,TRBV20,TRBV23,TRBV24,TRBV26,TRBV29,TRBV30,TRBV31 + D: + TRBD1,TRBD2 + J: + TRBJ1-1,TRBJ1-2,TRBJ1-3,TRBJ1-4,TRBJ1-5,TRBJ2-1,TRBJ2-2,TRBJ2-3,TRBJ2-4,TRBJ2-5,TRBJ2-6,TRBJ2-7 + + +**OUTPUT** + +It generates the following result: + </help> +</tool>