annotate VCF2Hapmap/vcf2FastaAndHapmap.xml @ 10:c6640c49fd01 draft

planemo upload commit 475f4d7d8442a0d75e103af326ae5881c4d2a4ac

<tool id="sniplay_vcf2fastaandhapmap" name="VCF to Hapmap" version="2.0.0">
    
    <!-- [REQUIRED] Tool description displayed after the tool name -->
    <description> Convert VCF to Hapmap  </description>
    
    <!-- [OPTIONAL] 3rd party tools, binaries, modules... required for the tool to work -->
    <requirements>
        <requirement type="binary">perl</requirement>
    </requirements>
    
    <!-- [STRONGLY RECOMMANDED] Exit code rules -->
    <stdio>
        <!-- [HELP] If no exit code rule is defined, the tool will stop if anything is written to STDERR -->
        <exit_code range="1:" level="fatal" />
    </stdio>

    <!-- [OPTIONAL] Command to be executed to get the tool's version string -->
    <version_command>
<!--
        tool_binary -v
-->
    </version_command>
    
    <!-- [REQUIRED] The command to execute -->
    <command interpreter="bash">
	vcf2FastaAndHapmap.sh $filein $fileout $optional.file_opt 
	#if str( $optional.file_opt ) != "none":
		$fileout_seq $fileout_fa1 $filefasta 
		#if str( $optional.file_opt ) == "fasta_gff":
		$filegff
		#end if
	#end if
    </command>
     
    <!-- [REQUIRED] Input files and tool parameters -->
    <inputs>
	<param name="filein" type="data" format="vcf" optional="false" label="VCF input" />
	<param name="fileout_label" type="text" value="input" optional="false" label="Output file basename"/>
	<conditional name="optional" >
	    <param name="file_opt" type="select" label="Optional files" >
	    	<option value="none" selected="true">No</option>
	    	<option value="fasta">Fasta</option>
            	<option value="fasta_gff">Fasta and GFF</option>
            </param>
	    <when value="none" />
            <when value="fasta">
		<param name="filefasta" type="data" format="fasta" optional="false" label="Fasta file input" />
            </when>
	    <when value="fasta_gff">
		<param name="filefasta" type="data" format="fasta" optional="false" label="Fasta file input" />
		<param name="filegff" type="data" format="gff" optional="false" label="GFF file input" help="VCF file must be annotated" />
            </when>
        </conditional>
    </inputs>
    
    <!-- [REQUIRED] Output files -->
    <outputs>
	<data name="fileout" format="txt" label="${fileout_label}.hapmap" />
	<data name="fileout_seq" format="txt" label="${fileout_label}.flanking.txt">
		<filter>(optional['file_opt'] != 'none')</filter>
	</data>
	<data name="fileout_fa1" format="fasta" label="${fileout_label}.gene_alignment.fas">
		<filter>(optional['file_opt'] == 'fasta_gff')</filter>
	</data>
    </outputs>
    
    <!-- [OPTIONAL] Tests to be run manually by the Galaxy admin -->
    <tests>
        <!-- [HELP] Test files have to be in the ~/test-data directory -->
        <test>
         <param name="filein" value="vcf2fastaAndHapmap-sample.vcf" />
         <param name="file_opt" value="none" />
         <output name="fileout" file="vcf2fastaAndHapmap-result1.hapmap" />
        </test>
	<test>
         <param name="filein" value="vcf2fastaAndHapmap-sample.vcf" />
	 <param name="file_opt" value="fasta" />
         <param name="filefasta" value="vcf2fastaAndHapmap-reference.fa" />
         <output name="fileout" file="vcf2fastaAndHapmap-result2.hapmap" />
         <output name="fileout_seq" file="vcf2fastaAndHapmap-result2.flanking.txt" />
        </test>
	<test>
         <param name="filein" value="vcf2fastaAndHapmap-sample.vcf" />
	 <param name="file_opt" value="fasta_gff" />
         <param name="filefasta" value="vcf2fastaAndHapmap-reference.fa" />
         <param name="filegff" value="vcf2fastaAndHapmap-reference.gff" />
         <output name="fileout" file="vcf2fastaAndHapmap-result3.hapmap" />
         <output name="fileout_seq" file="vcf2fastaAndHapmap-result3.flanking.txt" />
         <output name="fileout_fa1" file="vcf2fastaAndHapmap-result3.gene_alignment.fas" compare="sim_size" delta="0"/>
        </test>
    </tests>
    
    <!-- [OPTIONAL] Help displayed in Galaxy -->
    <help><![CDATA[


.. class:: infomark

**Authors** Dereeper Alexis ([e-mail]), IRD, South Green platform

 | **Please cite** "SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations", **Dereeper A. et al.**, Nucl. Acids Res. (1 july 2015) 43 (W1).

.. class:: infomark

**Galaxy integration** Provided by Southgreen & Andres Gwendoline (Institut Français de Bioinformatique) & Marcon Valentin (IFB & INRA)

.. class:: infomark

**Support** For any questions about Galaxy integration, please send an e-mail to [e-mail]

---------------------------------------------------

=======================
VCF to Hapmap
=======================

-----------
Description
-----------

  | Convert VCF to Hapmap. Additionnaly it creates flanking sequences of variants if fasta reference is provided.
  | Furthermore it also creates fasta alignment of genes if GFF annotation is provided 

----------
Input file
----------

VCF file
	VCF file with all SNPs

----------
Parameters
----------

Output file basename
	Prefix for the output VCF file

Optional files
        To add additional files fasta file and GFF file.

------------
Output files
------------

Hapmap file 
	Hapmap converted file

Additional files 
	If you add fasta and/or GFF file as reference, you obtain 3 more files : One with flanking sequence and a fasta file

---------------------------------------------------

---------------
Working example
---------------

Input files
===========

VCF file
---------

::

	#fileformat=VCFv4.1
	#FILTER=&lt;ID=LowQual,Description="Low quality">
	#FORMAT=&lt;ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed">
	[...]
	CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	CATB1
	chr1	2209	.	G	T	213.84	.	AC=2;AF=1.00;AN=2;DP=7;Dels=0.00;FS=0.000;HaplotypeScore=0.0000;MLEAC=2;MLEAF=1.00;MQ=41.50;MQ0=0;QD=30.55;EFF=DOWNSTREAM(MODIFIER||||Cc01g00020|mRNA||GSCOCT00012438001|),UPSTREAM(MODIFIER||||Cc01g00010|mRNA||GSCOCT00012439001|)	GT:AD:DP:GQ:PL	1/1:0,7:7:18:242,18,0

Fasta file
----------


::

	>chr1
	CAGTAAAGTTTGCAAAGAGATTCTGGCAAAGTT

Parameters
==========

Output name -> input

Optional files -> Fasta


Output files
============

input.hapmap
------------

::

        rs#	alleles	chrom	pos	strand	assembly#	center	protLSID	assayLSID	panelLSID	QCcode	CATB1
	chr1:2209	G/T	chr1	2209	+	NA	NA	NA	NA	NA	NA	GG	TT
	chr1:2232	A/C	chr1	2232	+	NA	NA	NA	NA	NA	NA	AA	CC

input.flanking.txt
------------------

::

	chr1-2209,GTCGCATCTGCAGCATATAGCCAACCTTCAACTTGCAGCTAAAACTCATCATCTCTTTCT[G/T]ACTGGCTTAACGATATTGTAAGMTGACTCAGAGGCCCACTTTTTTTTTAAAAATYAGCCT,0,0,0,Project_name,0,diploid,Other,Forward
	chr1-2232,ACCTTCAACTTGCAGCTAAAACTCATCATCTCTTTCTKACTGGCTTAACGATATTGTAAG[A/C]TGACTCAGAGGCCCACTTTTTTTTTAAAAATYAGCCTGTCCCCAGCCGTGCTGACTGGGC,0,0,0,Project_name,0,diploid,Other,Forward

input.gene_alignment.fas
------------------------

::

	>chr1_CATB1_1
	TCCTCAAACTTTCTTCAGCGCCTATGAATACAGCGTGCTATAGTTACGTGGGGCGTTT

	
    ]]></help>

    <citations>
        <!-- [HELP] As DOI or BibTex entry -->
    	<citation type="bibtex">@article{Dereeper03062015,
author = {Dereeper, Alexis and Homa, Felix and Andres, Gwendoline and Sempere, Guilhem and Sarah, Gautier and Hueber, Yann and Dufayard, Jean-François and Ruiz, Manuel}, 
title = {SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations},
year = {2015}, 
doi = {10.1093/nar/gkv351}, 
abstract ={SNiPlay is a web-based tool for detection, management and analysis of genetic variants including both single nucleotide polymorphisms (SNPs) and InDels. Version 3 now extends functionalities in order to easily manage and exploit SNPs derived from next generation sequencing technologies, such as GBS (genotyping by sequencing), WGRS (whole gre-sequencing) and RNA-Seq technologies. Based on the standard VCF (variant call format) format, the application offers an intuitive interface for filtering and comparing polymorphisms using user-defined sets of individuals and then establishing a reliable genotyping data matrix for further analyses. Namely, in addition to the various scaled-up analyses allowed by the application (genomic annotation of SNP, diversity analysis, haplotype reconstruction and network, linkage disequilibrium), SNiPlay3 proposes new modules for GWAS (genome-wide association studies), population stratification, distance tree analysis and visualization of SNP density. Additionally, we developed a suite of Galaxy wrappers for each step of the SNiPlay3 process, so that the complete pipeline can also be deployed on a Galaxy instance using the Galaxy ToolShed procedure and then be computed as a Galaxy workflow. SNiPlay is accessible at http://sniplay.southgreen.fr.}, 
URL = {http://nar.oxfordjournals.org/content/early/2015/06/03/nar.gkv351.abstract}, 
eprint = {http://nar.oxfordjournals.org/content/early/2015/06/03/nar.gkv351.full.pdf+html}, 
journal = {Nucleic Acids Research} 
}

    	}</citation>

    </citations>
    
</tool>