diff blat_coverage_report.xml @ 0:30f0948c649c draft default tip

Imported from capsule None

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/blat_coverage_report.xml	Mon May 19 12:34:01 2014 -0400
@@ -0,0 +1,75 @@
+<tool id="generate_coverage_report" name="Polymorphism of the Reads" version="1.0.0">
+	<description>the percentage of reads supporting each nucleotide at each location</description>
+	<command interpreter="python">blat_coverage_report.py $input1 $output1</command>
+	<inputs>	
+		<param name="input1" type="data" format="tabular" label="Alignment result"/>
+	</inputs>
+	<outputs>
+		<data name="output1" format="tabular"/>
+	</outputs> 
+	<tests>
+		<test>
+		<param name="input1" value="blat_coverage_report_test1.txt" ftype="tabular" />
+		<output name="output1" file="blat_coverage_report_test1.out" />
+		</test>
+	</tests>
+	<help>
+
+.. class:: warningmark
+
+**IMPORTANT**. Only works for BLAT **standard** or **pslx** output formats (hint: to output pslx format, add **-out=pslx** in the command).
+
+-----
+	
+**What it does**
+ 
+ The tool will generate a table of 6 columns as following:
+ 
+- 1st column: chromosome id.
+
+- 2nd column: chromosome location.
+
+- 3rd column: the nucleotide from reference genome at the chromosome location (2nd column).
+
+- 4th column: total coverage of the reads (number of reads that were mapped to the chromosome location).
+
+- 5th column: percentage of reads that support nucleotide **A** at this location.
+
+- 6th column: percentage of reads that support nucleotide **T** at this location.
+
+- 7th column: percentage of reads that support nucleotide **C** at this location.
+
+- 8th column: percentage of reads that support nucleotide **G** at this location.
+ 
+ 
+-----
+
+**Example**
+
+- The BLAT pslx results look like the following (tab separated with sequence at the end)::
+
+	30	0	0	0	0	0	0	0	+	seq0	30	0	30	chr	4639675	4549207	4549237	1	30,	0,	4549207,	cggacagcgccgccaccaacaaagccacca,	cggacagcgccgccaccaacaaagccacca,
+	30	0	0	0	0	0	0	0	+	seq1	30	0	30	chr	4639675	614777	614807	1	30,	0,	614777,		aaaacaccggatgctccggcgctggcagat,	aaaacaccggatgctccggcgctggcagat,
+	28	1	0	0	0	0	0	0	+	seq2	30	0	29	chr	4639675	3289283	3289312	1	29,	0,	3289283,	tttgcttttagtacaccggattcagaacc,	tttgctttcagtacaccggattcagaacc,
+	30	0	0	0	0	0	0	0	+	seq4	30	0	30	chr	4639675	2665584	2665614	1	30,	0,	2665584,	cacgctacgtgcgcccccgcccagaaggcg,	cacgctacgtgcgcccccgcccagaaggcg,
+
+	The 14th column is the chromosome id, and the 16th and 17th columns shows the reads were mapped to chromosome start and end locations.	
+
+- The report showed overall coverage of reads on each chromosome location (partial result)::
+ 
+   +-------+----------+------+------+--------+------+--------+------+
+   | title | location | ref. | cov. |   A    |  T   |   C    |  G   |
+   +-------+----------+------+------+--------+------+--------+------+	
+   |   chr |   614777 |	 A   |  1   | A(100) | T(0) |	C(0) | G(0) |
+   |   chr |   614778 |  A   |	1   | A(100) | T(0) |   C(0) | G(0) |
+   |   chr |   614779 |  A   |  1   | A(100) | T(0) |   C(0) | G(0) |
+   +-------+----------+------+------+--------+------+--------+------+	
+	
+-----
+
+**Reference**
+ 
+ **BLAT**: Kent, W James, BLAT--the BLAST-like alignment tool. (2002) Genome Research:12(4) 656-664.
+	
+	</help>
+</tool>