Mercurial > repos > devteam > emboss_5

view test-data/emboss_primersearch.fasta @ 5:2cf967772a40

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Fix for emboss_format_corrector.py. Datatypes should be changed before the job is run.
author Daniel Blankenberg <dan@bx.psu.edu>
date Fri, 11 Oct 2013 14:10:00 -0400
parents 7334f6d0ac17
children
line wrap: on
line source

# This is my primer file
D1S243  cacacaggctcacatgcc      gctccagcgtcatggact
D1S468 aattaaccgttttggtcct     gcgacacacacttccc 
D1S2845 ccaaagggtgcttctc        gtggcattccaacctc
D1S1608 gatggcttttggggactatt    cactgagccaagtgacacag
D1S2893 aaaacatcaactctcccctg    ctcaaaccccaataagcctt
D1S2660 cacacatgcacatgcac       agtgacaccagcaggg