Mercurial > repos > devteam > emboss_5

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_antigenic.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,58 @@
+<tool id="EMBOSS: antigenic1" name="antigenic" version="5.0.0">
+  <description>Predicts potentially antigenic regions of a protein sequence, using the method of Kolaskar and Tongaonkar.</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>antigenic -sequence $input1 -outfile $out_file1 -minlen $minlen -rformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>On query</label>
+    </param>
+    <param name="minlen" size="4" type="text" value="6">
+      <label>Minimum Length of region</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output format</label>
+      <option value="gff">GFF</option>
+      <option value="pir">PIR</option>
+      <option value="swiss">SwissProt</option>
+      <option value="dbmotif">DbMotif</option>
+      <option value="diffseq">diffseq</option>
+      <option value="excel">Excel (TAB Delimited)</option>
+      <option value="feattable">FeatTable</option>
+      <option value="motif">Motif</option>
+      <option value="nametable">NameTable</option>
+      <option value="regions">Regions</option>
+      <option value="seqtable">SeqTable</option>
+      <option value="simple">SRS simple</option>
+      <option value="srs">SRS</option>
+      <option value="table">Table</option>
+      <option value="tagseq">Tagseq</option>
+      <option value="antigenic">Antigenic Output File</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="antigenic" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="minlen" value="6"/>
+      <param name="out_format1" value="excel"/>
+      <output name="out_file1" file="emboss_antigenic_out.tabular"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/antigenic.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_backtranseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,228 @@
+<tool id="EMBOSS: backtranseq2" name="backtranseq" version="5.0.0">
+  <description>Back translate a protein sequence</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>backtranseq -sequence $input1 -outfile $out_file1 -cfile $cfile -osformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>On query</label>
+    </param>
+    <param name="cfile" type="select">
+      <label>Codon Usage File</label>
+      <option value="Ehum.cut">Ehum.cut</option>
+      <option value="Eacc.cut">Eacc.cut</option>
+      <option value="Eadenovirus5.cut">Eadenovirus5.cut</option>
+      <option value="Eadenovirus7.cut">Eadenovirus7.cut</option>
+      <option value="Eaidlav.cut">Eaidlav.cut</option>
+      <option value="Eanasp.cut">Eanasp.cut</option>
+      <option value="Eani.cut">Eani.cut</option>
+      <option value="Eani_h.cut">Eani_h.cut</option>
+      <option value="Eanidmit.cut">Eanidmit.cut</option>
+      <option value="Easn.cut">Easn.cut</option>
+      <option value="Eath.cut">Eath.cut</option>
+      <option value="Eatu.cut">Eatu.cut</option>
+      <option value="Eavi.cut">Eavi.cut</option>
+      <option value="Ebja.cut">Ebja.cut</option>
+      <option value="Ebly.cut">Ebly.cut</option>
+      <option value="Ebme.cut">Ebme.cut</option>
+      <option value="Ebmo.cut">Ebmo.cut</option>
+      <option value="Ebna.cut">Ebna.cut</option>
+      <option value="Ebov.cut">Ebov.cut</option>
+      <option value="Ebovsp.cut">Ebovsp.cut</option>
+      <option value="Ebst.cut">Ebst.cut</option>
+      <option value="Ebsu.cut">Ebsu.cut</option>
+      <option value="Ebsu_h.cut">Ebsu_h.cut</option>
+      <option value="Ecac.cut">Ecac.cut</option>
+      <option value="Ecal.cut">Ecal.cut</option>
+      <option value="Eccr.cut">Eccr.cut</option>
+      <option value="Ecel.cut">Ecel.cut</option>
+      <option value="Echi.cut">Echi.cut</option>
+      <option value="Echicken.cut">Echicken.cut</option>
+      <option value="Echisp.cut">Echisp.cut</option>
+      <option value="Echk.cut">Echk.cut</option>
+      <option value="Echmp.cut">Echmp.cut</option>
+      <option value="Echnt.cut">Echnt.cut</option>
+      <option value="Echos.cut">Echos.cut</option>
+      <option value="Echzm.cut">Echzm.cut</option>
+      <option value="Echzmrubp.cut">Echzmrubp.cut</option>
+      <option value="Ecpx.cut">Ecpx.cut</option>
+      <option value="Ecre.cut">Ecre.cut</option>
+      <option value="Ecrisp.cut">Ecrisp.cut</option>
+      <option value="Ectr.cut">Ectr.cut</option>
+      <option value="Edayhoff.cut">Edayhoff.cut</option>
+      <option value="Eddi.cut">Eddi.cut</option>
+      <option value="Eddi_h.cut">Eddi_h.cut</option>
+      <option value="Edog.cut">Edog.cut</option>
+      <option value="Edro.cut">Edro.cut</option>
+      <option value="Edro_h.cut">Edro_h.cut</option>
+      <option value="Edrosophila.cut">Edrosophila.cut</option>
+      <option value="Eeca.cut">Eeca.cut</option>
+      <option value="Eeco.cut">Eeco.cut</option>
+      <option value="Eeco_h.cut">Eeco_h.cut</option>
+      <option value="Eecoli.cut">Eecoli.cut</option>
+      <option value="Ef1.cut">Ef1.cut</option>
+      <option value="Efish.cut">Efish.cut</option>
+      <option value="Efmdvpolyp.cut">Efmdvpolyp.cut</option>
+      <option value="Eham.cut">Eham.cut</option>
+      <option value="Ehha.cut">Ehha.cut</option>
+      <option value="Ehin.cut">Ehin.cut</option>
+      <option value="Ehma.cut">Ehma.cut</option>
+      <option value="Ehuman.cut">Ehuman.cut</option>
+      <option value="Ekla.cut">Ekla.cut</option>
+      <option value="Ekpn.cut">Ekpn.cut</option>
+      <option value="Ella.cut">Ella.cut</option>
+      <option value="Emac.cut">Emac.cut</option>
+      <option value="Emaize.cut">Emaize.cut</option>
+      <option value="Emam_h.cut">Emam_h.cut</option>
+      <option value="Emixlg.cut">Emixlg.cut</option>
+      <option value="Emouse.cut">Emouse.cut</option>
+      <option value="Emsa.cut">Emsa.cut</option>
+      <option value="Emse.cut">Emse.cut</option>
+      <option value="Emta.cut">Emta.cut</option>
+      <option value="Emtu.cut">Emtu.cut</option>
+      <option value="Emus.cut">Emus.cut</option>
+      <option value="Emussp.cut">Emussp.cut</option>
+      <option value="Emva.cut">Emva.cut</option>
+      <option value="Emze.cut">Emze.cut</option>
+      <option value="Emzecp.cut">Emzecp.cut</option>
+      <option value="Encr.cut">Encr.cut</option>
+      <option value="Eneu.cut">Eneu.cut</option>
+      <option value="Engo.cut">Engo.cut</option>
+      <option value="Eoncsp.cut">Eoncsp.cut</option>
+      <option value="Epae.cut">Epae.cut</option>
+      <option value="Epea.cut">Epea.cut</option>
+      <option value="Epet.cut">Epet.cut</option>
+      <option value="Epfa.cut">Epfa.cut</option>
+      <option value="Ephix174.cut">Ephix174.cut</option>
+      <option value="Ephv.cut">Ephv.cut</option>
+      <option value="Ephy.cut">Ephy.cut</option>
+      <option value="Epig.cut">Epig.cut</option>
+      <option value="Epolyomaa2.cut">Epolyomaa2.cut</option>
+      <option value="Epombe.cut">Epombe.cut</option>
+      <option value="Epombecai.cut">Epombecai.cut</option>
+      <option value="Epot.cut">Epot.cut</option>
+      <option value="Eppu.cut">Eppu.cut</option>
+      <option value="Epse.cut">Epse.cut</option>
+      <option value="Epsy.cut">Epsy.cut</option>
+      <option value="Epvu.cut">Epvu.cut</option>
+      <option value="Erab.cut">Erab.cut</option>
+      <option value="Erabbit.cut">Erabbit.cut</option>
+      <option value="Erabsp.cut">Erabsp.cut</option>
+      <option value="Erat.cut">Erat.cut</option>
+      <option value="Eratsp.cut">Eratsp.cut</option>
+      <option value="Erca.cut">Erca.cut</option>
+      <option value="Erhm.cut">Erhm.cut</option>
+      <option value="Eric.cut">Eric.cut</option>
+      <option value="Erle.cut">Erle.cut</option>
+      <option value="Erme.cut">Erme.cut</option>
+      <option value="Ersp.cut">Ersp.cut</option>
+      <option value="Esalsp.cut">Esalsp.cut</option>
+      <option value="Esau.cut">Esau.cut</option>
+      <option value="Esco.cut">Esco.cut</option>
+      <option value="Esgi.cut">Esgi.cut</option>
+      <option value="Eshp.cut">Eshp.cut</option>
+      <option value="Eshpsp.cut">Eshpsp.cut</option>
+      <option value="Esli.cut">Esli.cut</option>
+      <option value="Eslm.cut">Eslm.cut</option>
+      <option value="Esma.cut">Esma.cut</option>
+      <option value="Esmi.cut">Esmi.cut</option>
+      <option value="Esmu.cut">Esmu.cut</option>
+      <option value="Esoy.cut">Esoy.cut</option>
+      <option value="Espi.cut">Espi.cut</option>
+      <option value="Espn.cut">Espn.cut</option>
+      <option value="Espo.cut">Espo.cut</option>
+      <option value="Espo_h.cut">Espo_h.cut</option>
+      <option value="Espu.cut">Espu.cut</option>
+      <option value="Esta.cut">Esta.cut</option>
+      <option value="Esty.cut">Esty.cut</option>
+      <option value="Esus.cut">Esus.cut</option>
+      <option value="Esv40.cut">Esv40.cut</option>
+      <option value="Esyhsp.cut">Esyhsp.cut</option>
+      <option value="Esynsp.cut">Esynsp.cut</option>
+      <option value="Etbr.cut">Etbr.cut</option>
+      <option value="Etcr.cut">Etcr.cut</option>
+      <option value="Eter.cut">Eter.cut</option>
+      <option value="Etetsp.cut">Etetsp.cut</option>
+      <option value="Etob.cut">Etob.cut</option>
+      <option value="Etobcp.cut">Etobcp.cut</option>
+      <option value="Etom.cut">Etom.cut</option>
+      <option value="Etrb.cut">Etrb.cut</option>
+      <option value="Evco.cut">Evco.cut</option>
+      <option value="Ewht.cut">Ewht.cut</option>
+      <option value="Exel.cut">Exel.cut</option>
+      <option value="Exenopus.cut">Exenopus.cut</option>
+      <option value="Eyeast.cut">Eyeast.cut</option>
+      <option value="Eyeastcai.cut">Eyeastcai.cut</option>
+      <option value="Eyen.cut">Eyen.cut</option>
+      <option value="Eysc.cut">Eysc.cut</option>
+      <option value="Eysc_h.cut">Eysc_h.cut</option>
+      <option value="Eyscmt.cut">Eyscmt.cut</option>
+      <option value="Eysp.cut">Eysp.cut</option>
+      <option value="Ezebrafish.cut">Ezebrafish.cut</option>
+      <option value="Ezma.cut">Ezma.cut</option>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="txt" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="cfile" value="Ehum.cut"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_backtranseq_out.fasta"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/backtranseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_banana.pl	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,16 @@
+#! /usr/bin/perl -w
+use strict;
+
+my $cmd_string = join (" ",@ARGV);
+#my $cmd_string = "/home/djb396/temp/emboss/bin/banana -sequence /home/djb396/universe-prototype/test.fasta -outfile result.txt -graph png -goutfile results -auto";
+my $results = `$cmd_string`;
+my @files = split("\n",$results);
+foreach my $thisLine (@files)
+{
+	if ($thisLine =~ /Created /i)
+	{
+		$thisLine =~ /[\w|\.]+$/;
+		$thisLine =$&;
+		print "outfile: $thisLine\n";
+	}
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_banana.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,32 @@
+<tool id="EMBOSS: banana3" name="banana" version="5.0.0">
+  <description>Bending and curvature plot in B-DNA</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>banana -sequence $input1 -outfile $out_file1 -graph none -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>On query</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="txt" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <output name="out_file1" file="emboss_banana_out.txt"/>
+    </test>
+  </tests>
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/banana.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_biosed.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,81 @@
+<tool id="EMBOSS: biosed4" name="biosed" version="5.0.0">
+  <description>Replace or delete sequence sections</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>biosed -sequence $input1 -outseq $out_file1 -target "$target" -replace "$replace" -osformat2 "$out_format1" -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>On query</label>
+    </param>
+    <param name="target" size="6" type="text" value="atg">
+      <label>Replace all</label>
+    </param>
+    <param name="replace" size="6" type="text" value="atg">
+      <label>with</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="txt" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="target" value="atg"/>
+      <param name="replace" value="agt"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_biosed_out.fasta"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/biosed.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_btwisted.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,32 @@
+<tool id="EMBOSS: btwisted5" name="btwisted" version="5.0.0">
+  <description>Calculates the twisting in a B-DNA sequence</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>btwisted -sequence $input1 -outfile $out_file1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>On query</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="btwisted" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <output name="out_file1" file="emboss_btwisted_out.btwisted"/>
+    </test>
+  </tests>
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/btwisted.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_cai.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,193 @@
+<tool id="EMBOSS: cai6" name="cai" version="5.0.0">
+  <description>CAI codon adaptation index</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>cai -seqall $input1 -outfile $out_file1 -cfile $cfile -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>On query</label>
+    </param>
+    <param name="cfile" type="select">
+      <label>Codon Usage File</label>
+      <option value="Eyeastcai.cut">Eyeastcai.cut</option>
+      <option value="Ehum.cut">Ehum.cut</option>
+      <option value="Eacc.cut">Eacc.cut</option>
+      <option value="Eadenovirus5.cut">Eadenovirus5.cut</option>
+      <option value="Eadenovirus7.cut">Eadenovirus7.cut</option>
+      <option value="Eaidlav.cut">Eaidlav.cut</option>
+      <option value="Eanasp.cut">Eanasp.cut</option>
+      <option value="Eani.cut">Eani.cut</option>
+      <option value="Eani_h.cut">Eani_h.cut</option>
+      <option value="Eanidmit.cut">Eanidmit.cut</option>
+      <option value="Easn.cut">Easn.cut</option>
+      <option value="Eath.cut">Eath.cut</option>
+      <option value="Eatu.cut">Eatu.cut</option>
+      <option value="Eavi.cut">Eavi.cut</option>
+      <option value="Ebja.cut">Ebja.cut</option>
+      <option value="Ebly.cut">Ebly.cut</option>
+      <option value="Ebme.cut">Ebme.cut</option>
+      <option value="Ebmo.cut">Ebmo.cut</option>
+      <option value="Ebna.cut">Ebna.cut</option>
+      <option value="Ebov.cut">Ebov.cut</option>
+      <option value="Ebovsp.cut">Ebovsp.cut</option>
+      <option value="Ebst.cut">Ebst.cut</option>
+      <option value="Ebsu.cut">Ebsu.cut</option>
+      <option value="Ebsu_h.cut">Ebsu_h.cut</option>
+      <option value="Ecac.cut">Ecac.cut</option>
+      <option value="Ecal.cut">Ecal.cut</option>
+      <option value="Eccr.cut">Eccr.cut</option>
+      <option value="Ecel.cut">Ecel.cut</option>
+      <option value="Echi.cut">Echi.cut</option>
+      <option value="Echicken.cut">Echicken.cut</option>
+      <option value="Echisp.cut">Echisp.cut</option>
+      <option value="Echk.cut">Echk.cut</option>
+      <option value="Echmp.cut">Echmp.cut</option>
+      <option value="Echnt.cut">Echnt.cut</option>
+      <option value="Echos.cut">Echos.cut</option>
+      <option value="Echzm.cut">Echzm.cut</option>
+      <option value="Echzmrubp.cut">Echzmrubp.cut</option>
+      <option value="Ecpx.cut">Ecpx.cut</option>
+      <option value="Ecre.cut">Ecre.cut</option>
+      <option value="Ecrisp.cut">Ecrisp.cut</option>
+      <option value="Ectr.cut">Ectr.cut</option>
+      <option value="Edayhoff.cut">Edayhoff.cut</option>
+      <option value="Eddi.cut">Eddi.cut</option>
+      <option value="Eddi_h.cut">Eddi_h.cut</option>
+      <option value="Edog.cut">Edog.cut</option>
+      <option value="Edro.cut">Edro.cut</option>
+      <option value="Edro_h.cut">Edro_h.cut</option>
+      <option value="Edrosophila.cut">Edrosophila.cut</option>
+      <option value="Eeca.cut">Eeca.cut</option>
+      <option value="Eeco.cut">Eeco.cut</option>
+      <option value="Eeco_h.cut">Eeco_h.cut</option>
+      <option value="Eecoli.cut">Eecoli.cut</option>
+      <option value="Ef1.cut">Ef1.cut</option>
+      <option value="Efish.cut">Efish.cut</option>
+      <option value="Efmdvpolyp.cut">Efmdvpolyp.cut</option>
+      <option value="Eham.cut">Eham.cut</option>
+      <option value="Ehha.cut">Ehha.cut</option>
+      <option value="Ehin.cut">Ehin.cut</option>
+      <option value="Ehma.cut">Ehma.cut</option>
+      <option value="Ehuman.cut">Ehuman.cut</option>
+      <option value="Ekla.cut">Ekla.cut</option>
+      <option value="Ekpn.cut">Ekpn.cut</option>
+      <option value="Ella.cut">Ella.cut</option>
+      <option value="Emac.cut">Emac.cut</option>
+      <option value="Emaize.cut">Emaize.cut</option>
+      <option value="Emam_h.cut">Emam_h.cut</option>
+      <option value="Emixlg.cut">Emixlg.cut</option>
+      <option value="Emouse.cut">Emouse.cut</option>
+      <option value="Emsa.cut">Emsa.cut</option>
+      <option value="Emse.cut">Emse.cut</option>
+      <option value="Emta.cut">Emta.cut</option>
+      <option value="Emtu.cut">Emtu.cut</option>
+      <option value="Emus.cut">Emus.cut</option>
+      <option value="Emussp.cut">Emussp.cut</option>
+      <option value="Emva.cut">Emva.cut</option>
+      <option value="Emze.cut">Emze.cut</option>
+      <option value="Emzecp.cut">Emzecp.cut</option>
+      <option value="Encr.cut">Encr.cut</option>
+      <option value="Eneu.cut">Eneu.cut</option>
+      <option value="Engo.cut">Engo.cut</option>
+      <option value="Eoncsp.cut">Eoncsp.cut</option>
+      <option value="Epae.cut">Epae.cut</option>
+      <option value="Epea.cut">Epea.cut</option>
+      <option value="Epet.cut">Epet.cut</option>
+      <option value="Epfa.cut">Epfa.cut</option>
+      <option value="Ephix174.cut">Ephix174.cut</option>
+      <option value="Ephv.cut">Ephv.cut</option>
+      <option value="Ephy.cut">Ephy.cut</option>
+      <option value="Epig.cut">Epig.cut</option>
+      <option value="Epolyomaa2.cut">Epolyomaa2.cut</option>
+      <option value="Epombe.cut">Epombe.cut</option>
+      <option value="Epombecai.cut">Epombecai.cut</option>
+      <option value="Epot.cut">Epot.cut</option>
+      <option value="Eppu.cut">Eppu.cut</option>
+      <option value="Epse.cut">Epse.cut</option>
+      <option value="Epsy.cut">Epsy.cut</option>
+      <option value="Epvu.cut">Epvu.cut</option>
+      <option value="Erab.cut">Erab.cut</option>
+      <option value="Erabbit.cut">Erabbit.cut</option>
+      <option value="Erabsp.cut">Erabsp.cut</option>
+      <option value="Erat.cut">Erat.cut</option>
+      <option value="Eratsp.cut">Eratsp.cut</option>
+      <option value="Erca.cut">Erca.cut</option>
+      <option value="Erhm.cut">Erhm.cut</option>
+      <option value="Eric.cut">Eric.cut</option>
+      <option value="Erle.cut">Erle.cut</option>
+      <option value="Erme.cut">Erme.cut</option>
+      <option value="Ersp.cut">Ersp.cut</option>
+      <option value="Esalsp.cut">Esalsp.cut</option>
+      <option value="Esau.cut">Esau.cut</option>
+      <option value="Esco.cut">Esco.cut</option>
+      <option value="Esgi.cut">Esgi.cut</option>
+      <option value="Eshp.cut">Eshp.cut</option>
+      <option value="Eshpsp.cut">Eshpsp.cut</option>
+      <option value="Esli.cut">Esli.cut</option>
+      <option value="Eslm.cut">Eslm.cut</option>
+      <option value="Esma.cut">Esma.cut</option>
+      <option value="Esmi.cut">Esmi.cut</option>
+      <option value="Esmu.cut">Esmu.cut</option>
+      <option value="Esoy.cut">Esoy.cut</option>
+      <option value="Espi.cut">Espi.cut</option>
+      <option value="Espn.cut">Espn.cut</option>
+      <option value="Espo.cut">Espo.cut</option>
+      <option value="Espo_h.cut">Espo_h.cut</option>
+      <option value="Espu.cut">Espu.cut</option>
+      <option value="Esta.cut">Esta.cut</option>
+      <option value="Esty.cut">Esty.cut</option>
+      <option value="Esus.cut">Esus.cut</option>
+      <option value="Esv40.cut">Esv40.cut</option>
+      <option value="Esyhsp.cut">Esyhsp.cut</option>
+      <option value="Esynsp.cut">Esynsp.cut</option>
+      <option value="Etbr.cut">Etbr.cut</option>
+      <option value="Etcr.cut">Etcr.cut</option>
+      <option value="Eter.cut">Eter.cut</option>
+      <option value="Etetsp.cut">Etetsp.cut</option>
+      <option value="Etob.cut">Etob.cut</option>
+      <option value="Etobcp.cut">Etobcp.cut</option>
+      <option value="Etom.cut">Etom.cut</option>
+      <option value="Etrb.cut">Etrb.cut</option>
+      <option value="Evco.cut">Evco.cut</option>
+      <option value="Ewht.cut">Ewht.cut</option>
+      <option value="Exel.cut">Exel.cut</option>
+      <option value="Exenopus.cut">Exenopus.cut</option>
+      <option value="Eyeast.cut">Eyeast.cut</option>
+      <option value="Eyen.cut">Eyen.cut</option>
+      <option value="Eysc.cut">Eysc.cut</option>
+      <option value="Eysc_h.cut">Eysc_h.cut</option>
+      <option value="Eyscmt.cut">Eyscmt.cut</option>
+      <option value="Eysp.cut">Eysp.cut</option>
+      <option value="Ezebrafish.cut">Ezebrafish.cut</option>
+      <option value="Ezma.cut">Ezma.cut</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="cai" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="cfile" value="Eyeastcai.cut"/>
+      <output name="out_file1" file="emboss_cai_out.cai"/>
+    </test>
+  </tests>
+  <help>
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/cai.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_cai_custom.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,35 @@
+<tool id="EMBOSS: cai_custom6" name="cai custom" version="5.0.0">
+  <description>CAI codon adaptation index using custom codon usage file</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>cai -seqall $input1 -outfile $out_file1 -cfile $input2 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>On query</label>
+    </param>
+    <param format="txt" name="input2" type="data">
+      <label>Codon Usage File</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="txt" name="out_file1" />
+  </outputs>
+  <help>
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/cai_custom.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_chaos.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,31 @@
+<tool id="EMBOSS: chaos7" name="chaos" version="5.0.0">
+  <description>Create a chaos game representation plot for a sequence</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command interpreter="perl">emboss_single_outputfile_wrapper.pl chaos -sequence $input1 -graph png -goutfile $out_file1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>On query</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="png" name="out_file1" />
+  </outputs>
+<!--    <tests>
+    <test>
+         puts name of file into the png
+    </test>
+  </tests> -->
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/chaos.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_charge.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,43 @@
+<tool id="EMBOSS: charge8" name="charge" version="5.0.0">
+  <description>Protein charge plot</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>charge -seqall $input1 -outfile $out_file1 -window $window -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>On query</label>
+    </param>
+    <param name="window" size="4" type="text" value="5">
+      <label>Window Size</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="charge" name="out_file1" />
+  </outputs>
+ <!--   <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="window" value="5"/>
+      <output name="out_file1" file="emboss_charge_out.charge"/>
+    </test>
+  </tests>-->
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/charge.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_checktrans.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,95 @@
+<tool id="EMBOSS: checktrans9" name="checktrans" version="5.0.0">
+  <description>Reports STOP codons and ORF statistics of a protein</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>checktrans -sequence $input1 -outfile $out_file1 -outseq $out_file2 -osformat3 $out_format2 -outfeat $out_file3 -offormat4 $out_format3 -orfml $orfml -addlast $addlast -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>On query</label>
+    </param>
+    <param name="orfml" size="4" type="text" value="100">
+      <label>Minimum ORF Length to report</label>
+    </param>
+    <param name="addlast" type="select">
+      <label>An asterisk in the protein sequence indicates the position of a STOP codon. Checktrans assumes that all ORFs end in a STOP codon. Forcing the sequence to end with an asterisk, if there
+      is not one there already, makes checktrans treat the end as a potential ORF. If an asterisk is added, it is not included in the reported count of STOPs</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="out_format2" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+    <param name="out_format3" type="select">
+      <label>Output Feature File Format</label>
+      <option value="gff">GFF</option>
+      <option value="embl">EMBL</option>
+      <option value="swiss">SwissProt</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="checktrans" name="out_file1" />
+    <data format="fasta" name="out_file2" />
+    <data format="gff" name="out_file3" />
+  </outputs>
+ <!--   <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="orfml" value="100"/>
+      <param name="addlast" value="yes"/>
+      <param name="out_format2" value="fasta"/>
+      <param name="out_format3" value="gff"/>
+      <output name="out_file1" file="emboss_checktrans_out1.txt"/>
+      <output name="out_file2" file="emboss_checktrans_out2.fasta"/>
+      <output name="out_file3" file="emboss_checktrans_out3.gff"/>
+    </test>
+  </tests> -->
+  <code file="emboss_format_corrector.py" />
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/checktrans.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_chips.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,38 @@
+<tool id="EMBOSS: chips10" name="chips" version="5.0.0">
+  <description>Codon usage statistics</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>chips -seqall $input1 -outfile $out_file1 -sum $sum -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>On query</label>
+    </param>
+    <param name="sum" type="select">
+      <label>Sum codons over all sequences</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="chips" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="sum" value="yes"/>
+      <output name="out_file1" file="emboss_chips_out.chips"/>
+    </test>
+  </tests>
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/chips.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_cirdna.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,31 @@
+<tool id="EMBOSS: cirdna11" name="cirdna" version="5.0.0">
+  <description>Draws circular maps of DNA constructs</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command interpreter="perl">emboss_single_outputfile_wrapper.pl cirdna -infile $input1 -graphout png -goutfile $out_file1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>On query</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="png" name="out_file1" />
+  </outputs>
+  <!--    <tests>
+    <test>
+         puts name of file into the png
+    </test>
+  </tests> -->
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/cirdna.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_codcmp.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,338 @@
+<tool id="EMBOSS: codcmp12" name="codcmp" version="5.0.0">
+  <description>Codon usage table comparison</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>codcmp -first $cfile1 -second $cfile2 -outfile $out_file1 -auto</command>
+  <inputs>
+    <param name="cfile1" type="select">
+      <label>Codon Usage File 1</label>
+      <option value="Ehum.cut">Ehum.cut</option>
+      <option value="Eacc.cut">Eacc.cut</option>
+      <option value="Eadenovirus5.cut">Eadenovirus5.cut</option>
+      <option value="Eadenovirus7.cut">Eadenovirus7.cut</option>
+      <option value="Eaidlav.cut">Eaidlav.cut</option>
+      <option value="Eanasp.cut">Eanasp.cut</option>
+      <option value="Eani.cut">Eani.cut</option>
+      <option value="Eani_h.cut">Eani_h.cut</option>
+      <option value="Eanidmit.cut">Eanidmit.cut</option>
+      <option value="Easn.cut">Easn.cut</option>
+      <option value="Eath.cut">Eath.cut</option>
+      <option value="Eatu.cut">Eatu.cut</option>
+      <option value="Eavi.cut">Eavi.cut</option>
+      <option value="Ebja.cut">Ebja.cut</option>
+      <option value="Ebly.cut">Ebly.cut</option>
+      <option value="Ebme.cut">Ebme.cut</option>
+      <option value="Ebmo.cut">Ebmo.cut</option>
+      <option value="Ebna.cut">Ebna.cut</option>
+      <option value="Ebov.cut">Ebov.cut</option>
+      <option value="Ebovsp.cut">Ebovsp.cut</option>
+      <option value="Ebst.cut">Ebst.cut</option>
+      <option value="Ebsu.cut">Ebsu.cut</option>
+      <option value="Ebsu_h.cut">Ebsu_h.cut</option>
+      <option value="Ecac.cut">Ecac.cut</option>
+      <option value="Ecal.cut">Ecal.cut</option>
+      <option value="Eccr.cut">Eccr.cut</option>
+      <option value="Ecel.cut">Ecel.cut</option>
+      <option value="Echi.cut">Echi.cut</option>
+      <option value="Echicken.cut">Echicken.cut</option>
+      <option value="Echisp.cut">Echisp.cut</option>
+      <option value="Echk.cut">Echk.cut</option>
+      <option value="Echmp.cut">Echmp.cut</option>
+      <option value="Echnt.cut">Echnt.cut</option>
+      <option value="Echos.cut">Echos.cut</option>
+      <option value="Echzm.cut">Echzm.cut</option>
+      <option value="Echzmrubp.cut">Echzmrubp.cut</option>
+      <option value="Ecpx.cut">Ecpx.cut</option>
+      <option value="Ecre.cut">Ecre.cut</option>
+      <option value="Ecrisp.cut">Ecrisp.cut</option>
+      <option value="Ectr.cut">Ectr.cut</option>
+      <option value="Edayhoff.cut">Edayhoff.cut</option>
+      <option value="Eddi.cut">Eddi.cut</option>
+      <option value="Eddi_h.cut">Eddi_h.cut</option>
+      <option value="Edog.cut">Edog.cut</option>
+      <option value="Edro.cut">Edro.cut</option>
+      <option value="Edro_h.cut">Edro_h.cut</option>
+      <option value="Edrosophila.cut">Edrosophila.cut</option>
+      <option value="Eeca.cut">Eeca.cut</option>
+      <option value="Eeco.cut">Eeco.cut</option>
+      <option value="Eeco_h.cut">Eeco_h.cut</option>
+      <option value="Eecoli.cut">Eecoli.cut</option>
+      <option value="Ef1.cut">Ef1.cut</option>
+      <option value="Efish.cut">Efish.cut</option>
+      <option value="Efmdvpolyp.cut">Efmdvpolyp.cut</option>
+      <option value="Eham.cut">Eham.cut</option>
+      <option value="Ehha.cut">Ehha.cut</option>
+      <option value="Ehin.cut">Ehin.cut</option>
+      <option value="Ehma.cut">Ehma.cut</option>
+      <option value="Ehuman.cut">Ehuman.cut</option>
+      <option value="Ekla.cut">Ekla.cut</option>
+      <option value="Ekpn.cut">Ekpn.cut</option>
+      <option value="Ella.cut">Ella.cut</option>
+      <option value="Emac.cut">Emac.cut</option>
+      <option value="Emaize.cut">Emaize.cut</option>
+      <option value="Emam_h.cut">Emam_h.cut</option>
+      <option value="Emixlg.cut">Emixlg.cut</option>
+      <option value="Emouse.cut">Emouse.cut</option>
+      <option value="Emsa.cut">Emsa.cut</option>
+      <option value="Emse.cut">Emse.cut</option>
+      <option value="Emta.cut">Emta.cut</option>
+      <option value="Emtu.cut">Emtu.cut</option>
+      <option value="Emus.cut">Emus.cut</option>
+      <option value="Emussp.cut">Emussp.cut</option>
+      <option value="Emva.cut">Emva.cut</option>
+      <option value="Emze.cut">Emze.cut</option>
+      <option value="Emzecp.cut">Emzecp.cut</option>
+      <option value="Encr.cut">Encr.cut</option>
+      <option value="Eneu.cut">Eneu.cut</option>
+      <option value="Engo.cut">Engo.cut</option>
+      <option value="Eoncsp.cut">Eoncsp.cut</option>
+      <option value="Epae.cut">Epae.cut</option>
+      <option value="Epea.cut">Epea.cut</option>
+      <option value="Epet.cut">Epet.cut</option>
+      <option value="Epfa.cut">Epfa.cut</option>
+      <option value="Ephix174.cut">Ephix174.cut</option>
+      <option value="Ephv.cut">Ephv.cut</option>
+      <option value="Ephy.cut">Ephy.cut</option>
+      <option value="Epig.cut">Epig.cut</option>
+      <option value="Epolyomaa2.cut">Epolyomaa2.cut</option>
+      <option value="Epombe.cut">Epombe.cut</option>
+      <option value="Epombecai.cut">Epombecai.cut</option>
+      <option value="Epot.cut">Epot.cut</option>
+      <option value="Eppu.cut">Eppu.cut</option>
+      <option value="Epse.cut">Epse.cut</option>
+      <option value="Epsy.cut">Epsy.cut</option>
+      <option value="Epvu.cut">Epvu.cut</option>
+      <option value="Erab.cut">Erab.cut</option>
+      <option value="Erabbit.cut">Erabbit.cut</option>
+      <option value="Erabsp.cut">Erabsp.cut</option>
+      <option value="Erat.cut">Erat.cut</option>
+      <option value="Eratsp.cut">Eratsp.cut</option>
+      <option value="Erca.cut">Erca.cut</option>
+      <option value="Erhm.cut">Erhm.cut</option>
+      <option value="Eric.cut">Eric.cut</option>
+      <option value="Erle.cut">Erle.cut</option>
+      <option value="Erme.cut">Erme.cut</option>
+      <option value="Ersp.cut">Ersp.cut</option>
+      <option value="Esalsp.cut">Esalsp.cut</option>
+      <option value="Esau.cut">Esau.cut</option>
+      <option value="Esco.cut">Esco.cut</option>
+      <option value="Esgi.cut">Esgi.cut</option>
+      <option value="Eshp.cut">Eshp.cut</option>
+      <option value="Eshpsp.cut">Eshpsp.cut</option>
+      <option value="Esli.cut">Esli.cut</option>
+      <option value="Eslm.cut">Eslm.cut</option>
+      <option value="Esma.cut">Esma.cut</option>
+      <option value="Esmi.cut">Esmi.cut</option>
+      <option value="Esmu.cut">Esmu.cut</option>
+      <option value="Esoy.cut">Esoy.cut</option>
+      <option value="Espi.cut">Espi.cut</option>
+      <option value="Espn.cut">Espn.cut</option>
+      <option value="Espo.cut">Espo.cut</option>
+      <option value="Espo_h.cut">Espo_h.cut</option>
+      <option value="Espu.cut">Espu.cut</option>
+      <option value="Esta.cut">Esta.cut</option>
+      <option value="Esty.cut">Esty.cut</option>
+      <option value="Esus.cut">Esus.cut</option>
+      <option value="Esv40.cut">Esv40.cut</option>
+      <option value="Esyhsp.cut">Esyhsp.cut</option>
+      <option value="Esynsp.cut">Esynsp.cut</option>
+      <option value="Etbr.cut">Etbr.cut</option>
+      <option value="Etcr.cut">Etcr.cut</option>
+      <option value="Eter.cut">Eter.cut</option>
+      <option value="Etetsp.cut">Etetsp.cut</option>
+      <option value="Etob.cut">Etob.cut</option>
+      <option value="Etobcp.cut">Etobcp.cut</option>
+      <option value="Etom.cut">Etom.cut</option>
+      <option value="Etrb.cut">Etrb.cut</option>
+      <option value="Evco.cut">Evco.cut</option>
+      <option value="Ewht.cut">Ewht.cut</option>
+      <option value="Exel.cut">Exel.cut</option>
+      <option value="Exenopus.cut">Exenopus.cut</option>
+      <option value="Eyeast.cut">Eyeast.cut</option>
+      <option value="Eyeastcai.cut">Eyeastcai.cut</option>
+      <option value="Eyen.cut">Eyen.cut</option>
+      <option value="Eysc.cut">Eysc.cut</option>
+      <option value="Eysc_h.cut">Eysc_h.cut</option>
+      <option value="Eyscmt.cut">Eyscmt.cut</option>
+      <option value="Eysp.cut">Eysp.cut</option>
+      <option value="Ezebrafish.cut">Ezebrafish.cut</option>
+      <option value="Ezma.cut">Ezma.cut</option>
+    </param>
+    <param name="cfile2" type="select">
+      <label>Codon Usage File 2</label>
+      <option value="Ehum.cut">Ehum.cut</option>
+      <option value="Eacc.cut">Eacc.cut</option>
+      <option value="Eadenovirus5.cut">Eadenovirus5.cut</option>
+      <option value="Eadenovirus7.cut">Eadenovirus7.cut</option>
+      <option value="Eaidlav.cut">Eaidlav.cut</option>
+      <option value="Eanasp.cut">Eanasp.cut</option>
+      <option value="Eani.cut">Eani.cut</option>
+      <option value="Eani_h.cut">Eani_h.cut</option>
+      <option value="Eanidmit.cut">Eanidmit.cut</option>
+      <option value="Easn.cut">Easn.cut</option>
+      <option value="Eath.cut">Eath.cut</option>
+      <option value="Eatu.cut">Eatu.cut</option>
+      <option value="Eavi.cut">Eavi.cut</option>
+      <option value="Ebja.cut">Ebja.cut</option>
+      <option value="Ebly.cut">Ebly.cut</option>
+      <option value="Ebme.cut">Ebme.cut</option>
+      <option value="Ebmo.cut">Ebmo.cut</option>
+      <option value="Ebna.cut">Ebna.cut</option>
+      <option value="Ebov.cut">Ebov.cut</option>
+      <option value="Ebovsp.cut">Ebovsp.cut</option>
+      <option value="Ebst.cut">Ebst.cut</option>
+      <option value="Ebsu.cut">Ebsu.cut</option>
+      <option value="Ebsu_h.cut">Ebsu_h.cut</option>
+      <option value="Ecac.cut">Ecac.cut</option>
+      <option value="Ecal.cut">Ecal.cut</option>
+      <option value="Eccr.cut">Eccr.cut</option>
+      <option value="Ecel.cut">Ecel.cut</option>
+      <option value="Echi.cut">Echi.cut</option>
+      <option value="Echicken.cut">Echicken.cut</option>
+      <option value="Echisp.cut">Echisp.cut</option>
+      <option value="Echk.cut">Echk.cut</option>
+      <option value="Echmp.cut">Echmp.cut</option>
+      <option value="Echnt.cut">Echnt.cut</option>
+      <option value="Echos.cut">Echos.cut</option>
+      <option value="Echzm.cut">Echzm.cut</option>
+      <option value="Echzmrubp.cut">Echzmrubp.cut</option>
+      <option value="Ecpx.cut">Ecpx.cut</option>
+      <option value="Ecre.cut">Ecre.cut</option>
+      <option value="Ecrisp.cut">Ecrisp.cut</option>
+      <option value="Ectr.cut">Ectr.cut</option>
+      <option value="Edayhoff.cut">Edayhoff.cut</option>
+      <option value="Eddi.cut">Eddi.cut</option>
+      <option value="Eddi_h.cut">Eddi_h.cut</option>
+      <option value="Edog.cut">Edog.cut</option>
+      <option value="Edro.cut">Edro.cut</option>
+      <option value="Edro_h.cut">Edro_h.cut</option>
+      <option value="Edrosophila.cut">Edrosophila.cut</option>
+      <option value="Eeca.cut">Eeca.cut</option>
+      <option value="Eeco.cut">Eeco.cut</option>
+      <option value="Eeco_h.cut">Eeco_h.cut</option>
+      <option value="Eecoli.cut">Eecoli.cut</option>
+      <option value="Ef1.cut">Ef1.cut</option>
+      <option value="Efish.cut">Efish.cut</option>
+      <option value="Efmdvpolyp.cut">Efmdvpolyp.cut</option>
+      <option value="Eham.cut">Eham.cut</option>
+      <option value="Ehha.cut">Ehha.cut</option>
+      <option value="Ehin.cut">Ehin.cut</option>
+      <option value="Ehma.cut">Ehma.cut</option>
+      <option value="Ehuman.cut">Ehuman.cut</option>
+      <option value="Ekla.cut">Ekla.cut</option>
+      <option value="Ekpn.cut">Ekpn.cut</option>
+      <option value="Ella.cut">Ella.cut</option>
+      <option value="Emac.cut">Emac.cut</option>
+      <option value="Emaize.cut">Emaize.cut</option>
+      <option value="Emam_h.cut">Emam_h.cut</option>
+      <option value="Emixlg.cut">Emixlg.cut</option>
+      <option value="Emouse.cut">Emouse.cut</option>
+      <option value="Emsa.cut">Emsa.cut</option>
+      <option value="Emse.cut">Emse.cut</option>
+      <option value="Emta.cut">Emta.cut</option>
+      <option value="Emtu.cut">Emtu.cut</option>
+      <option value="Emus.cut">Emus.cut</option>
+      <option value="Emussp.cut">Emussp.cut</option>
+      <option value="Emva.cut">Emva.cut</option>
+      <option value="Emze.cut">Emze.cut</option>
+      <option value="Emzecp.cut">Emzecp.cut</option>
+      <option value="Encr.cut">Encr.cut</option>
+      <option value="Eneu.cut">Eneu.cut</option>
+      <option value="Engo.cut">Engo.cut</option>
+      <option value="Eoncsp.cut">Eoncsp.cut</option>
+      <option value="Epae.cut">Epae.cut</option>
+      <option value="Epea.cut">Epea.cut</option>
+      <option value="Epet.cut">Epet.cut</option>
+      <option value="Epfa.cut">Epfa.cut</option>
+      <option value="Ephix174.cut">Ephix174.cut</option>
+      <option value="Ephv.cut">Ephv.cut</option>
+      <option value="Ephy.cut">Ephy.cut</option>
+      <option value="Epig.cut">Epig.cut</option>
+      <option value="Epolyomaa2.cut">Epolyomaa2.cut</option>
+      <option value="Epombe.cut">Epombe.cut</option>
+      <option value="Epombecai.cut">Epombecai.cut</option>
+      <option value="Epot.cut">Epot.cut</option>
+      <option value="Eppu.cut">Eppu.cut</option>
+      <option value="Epse.cut">Epse.cut</option>
+      <option value="Epsy.cut">Epsy.cut</option>
+      <option value="Epvu.cut">Epvu.cut</option>
+      <option value="Erab.cut">Erab.cut</option>
+      <option value="Erabbit.cut">Erabbit.cut</option>
+      <option value="Erabsp.cut">Erabsp.cut</option>
+      <option value="Erat.cut">Erat.cut</option>
+      <option value="Eratsp.cut">Eratsp.cut</option>
+      <option value="Erca.cut">Erca.cut</option>
+      <option value="Erhm.cut">Erhm.cut</option>
+      <option value="Eric.cut">Eric.cut</option>
+      <option value="Erle.cut">Erle.cut</option>
+      <option value="Erme.cut">Erme.cut</option>
+      <option value="Ersp.cut">Ersp.cut</option>
+      <option value="Esalsp.cut">Esalsp.cut</option>
+      <option value="Esau.cut">Esau.cut</option>
+      <option value="Esco.cut">Esco.cut</option>
+      <option value="Esgi.cut">Esgi.cut</option>
+      <option value="Eshp.cut">Eshp.cut</option>
+      <option value="Eshpsp.cut">Eshpsp.cut</option>
+      <option value="Esli.cut">Esli.cut</option>
+      <option value="Eslm.cut">Eslm.cut</option>
+      <option value="Esma.cut">Esma.cut</option>
+      <option value="Esmi.cut">Esmi.cut</option>
+      <option value="Esmu.cut">Esmu.cut</option>
+      <option value="Esoy.cut">Esoy.cut</option>
+      <option value="Espi.cut">Espi.cut</option>
+      <option value="Espn.cut">Espn.cut</option>
+      <option value="Espo.cut">Espo.cut</option>
+      <option value="Espo_h.cut">Espo_h.cut</option>
+      <option value="Espu.cut">Espu.cut</option>
+      <option value="Esta.cut">Esta.cut</option>
+      <option value="Esty.cut">Esty.cut</option>
+      <option value="Esus.cut">Esus.cut</option>
+      <option value="Esv40.cut">Esv40.cut</option>
+      <option value="Esyhsp.cut">Esyhsp.cut</option>
+      <option value="Esynsp.cut">Esynsp.cut</option>
+      <option value="Etbr.cut">Etbr.cut</option>
+      <option value="Etcr.cut">Etcr.cut</option>
+      <option value="Eter.cut">Eter.cut</option>
+      <option value="Etetsp.cut">Etetsp.cut</option>
+      <option value="Etob.cut">Etob.cut</option>
+      <option value="Etobcp.cut">Etobcp.cut</option>
+      <option value="Etom.cut">Etom.cut</option>
+      <option value="Etrb.cut">Etrb.cut</option>
+      <option value="Evco.cut">Evco.cut</option>
+      <option value="Ewht.cut">Ewht.cut</option>
+      <option value="Exel.cut">Exel.cut</option>
+      <option value="Exenopus.cut">Exenopus.cut</option>
+      <option value="Eyeast.cut">Eyeast.cut</option>
+      <option value="Eyeastcai.cut">Eyeastcai.cut</option>
+      <option value="Eyen.cut">Eyen.cut</option>
+      <option value="Eysc.cut">Eysc.cut</option>
+      <option value="Eysc_h.cut">Eysc_h.cut</option>
+      <option value="Eyscmt.cut">Eyscmt.cut</option>
+      <option value="Eysp.cut">Eysp.cut</option>
+      <option value="Ezebrafish.cut">Ezebrafish.cut</option>
+      <option value="Ezma.cut">Ezma.cut</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="codcmp" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="cfile1" value="Ehum.cut"/>
+      <param name="cfile2" value="Eacc.cut"/>
+      <output name="out_file1" file="emboss_codcmp_out.codcmp"/>
+    </test>
+  </tests>
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/codcmp.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_coderet.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,81 @@
+<tool id="EMBOSS: coderet13" name="coderet" version="5.0.0">
+  <description>Extract CDS, mRNA and translations from feature tables</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <!--  <command>coderet -seqall $input1 -outfile $out_file1 -osformat2 $out_format1 -cds $cds -mrna $mrna -translation $translation -auto</command>-->
+  <command>coderet -seqall $input1 -outfile $out_file1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>On query</label>
+    </param>
+    <!--
+    <param name="cds" type="boolean" truevalue="yes" falsevalue="no" checked="true">
+      <label>Extract CDS sequences</label>
+    </param>
+    <param name="mrna" type="select">
+      <label>Extract mRNA sequences</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="translation" type="select">
+      <label>Extract translated sequences</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+    -->
+  </inputs>
+  <outputs>
+    <data format="coderet" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <output name="out_file1" file="emboss_coderet_out.coderet"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/coderet.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_compseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,50 @@
+<tool id="EMBOSS: compseq14" name="compseq" version="5.0.0">
+  <description>Count composition of dimer/trimer/etc words in a sequence</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>compseq -sequence $input1 -outfile $out_file1 -word $word -frame $frame -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>On query</label>
+    </param>
+    <param name="word" size="4" type="text" value="2">
+      <label>Size of word (window) to count</label>
+    </param>
+    <param name="frame" type="select">
+      <label>Frame to inspect</label>
+      <option value="0">All Frames</option>
+      <option value="1">Frame 1</option>
+      <option value="2">Frame 2</option>
+      <option value="3">Frame 3</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="compseq" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="word" value="2"/>
+      <param name="frame" value="0"/>
+      <output name="out_file1" file="emboss_compseq_out.compseq"/>
+    </test>
+  </tests>
+  <help>
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/compseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_cpgplot.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,41 @@
+<tool id="EMBOSS: cpgplot15" name="cpgplot" version="5.0.0">
+  <description>Plot CpG rich areas</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command interpreter="perl">emboss_cpgplot_wrapper.pl cpgplot -sequence $input1 -window $window -minlen $minlen -minpc $minpc -outfile $outfile -graph png -goutfile $goutfile -outfeat $outfeat -minoe $minoe -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>On query</label>
+    </param>
+    <param name="window" size="4" type="integer" value="100">
+      <label>Window Size</label>
+    </param>
+    <param name="minlen" size="4" type="integer" value="200">
+      <label>Minimum length</label>
+    </param>
+    <param name="minoe" size="4" type="float" value="0.6">
+      <label>Minimum average observed to expected ratio</label>
+    </param>
+    <param name="minpc" size="4" type="float" value="50.0">
+      <label>Minimum average percentage of G plus C</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="cpgplot" name="outfile" />
+    <data format="png" name="goutfile" />
+    <data format="gff" name="outfeat" />
+  </outputs>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/cpgplot.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_cpgplot_wrapper.pl	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,9 @@
+#! /usr/bin/perl -w
+use strict;
+use File::Copy;
+
+my $cmd_string = join (" ",@ARGV);
+my $results = `$cmd_string`;
+my @files = split("\n",$results);
+my $fileNameOut = $ARGV[14];
+move($fileNameOut.".1.png",$fileNameOut);
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_cpgreport.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,57 @@
+<tool id="EMBOSS: cpgreport16" name="cpgreport" version="5.0.0">
+  <description>Reports all CpG rich regions</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>cpgreport -sequence $input1 -outfile $out_file1 -outfeat $out_file2 -offormat3 $out_format2 -score $score -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>On query</label>
+    </param>
+    <param name="score" size="4" type="text" value="17">
+      <label>Score for each CG sequence found (1-200)</label>
+    </param>
+    <param name="out_format2" type="select">
+      <label>Output Feature File Format</label>
+      <option value="gff">GFF</option>
+      <option value="embl">EMBL</option>
+      <option value="swiss">SwissProt</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="cpgreport" name="out_file1" />
+    <data format="gff" name="out_file2" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="score" value="17"/>
+      <param name="out_format2" value="gff"/>
+      <output name="out_file2" file="emboss_cpgreport_out2.cpgreport"/>
+    </test>
+    <!-- <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="score" value="17"/>
+      <param name="out_format2" value="gff"/>
+      <output name="out_file1" file="emboss_cpgreport_out1.gff"/>
+    </test>  -->
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/cpgreport.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_cusp.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,38 @@
+<tool id="EMBOSS: cusp17" name="cusp" version="5.0.0">
+  <description>Create a codon usage table</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>cusp -sequence $input1 -outfile $out_file1 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>On query</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="cusp" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <output name="out_file1" file="emboss_cusp_out.cusp"/>
+    </test>
+  </tests>
+  <help>
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/cusp.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_cutseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,80 @@
+<tool id="EMBOSS: cutseq18" name="cutseq" version="5.0.0">
+  <description>Removes a specified section from a sequence</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>cutseq -sequence $input1 -outseq $out_file1 -from $from -to $to -osformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>On query</label>
+    </param>
+    <param name="from" size="8" type="text" value="1">
+      <label>Start of region to delete</label>
+    </param>
+    <param name="to" size="8" type="text" value="1">
+      <label>End of region to delete</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="from" value="1"/>
+      <param name="to" value="1"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_cutseq_out.fasta"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/cutseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_dan.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,92 @@
+<tool id="EMBOSS: dan19" name="dan" version="5.0.0">
+  <description>Calculates DNA RNA/DNA melting temperature</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command interpreter="perl">emboss_single_outputfile_wrapper.pl dan -sequence $input1 -windowsize $window -goutfile $out_file1 -graph png -plot $plot1 -shiftincrement $shift -dnaconc $dnaconc
+  -saltconc $saltconc -product $product -formamide $formamide -mismatch $mismatch -prodlen $prodlen -thermo $thermo -temperature $temperature -rna $rna -outfile $out_file1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>On query</label>
+    </param>
+    <param name="window" size="4" type="text" value="20">
+      <label>Window Size</label>
+    </param>
+    <param name="shift" size="4" type="text" value="1">
+      <label>Step size (shift increment)</label>
+    </param>
+    <param name="dnaconc" size="4" type="text" value="50.0">
+      <label>DNA Concentration (nM)</label>
+    </param>
+    <param name="saltconc" size="4" type="text" value="50.0">
+      <label>Salt concentration (mM)</label>
+    </param>
+    <param name="thermo" type="select">
+      <label>Output the DeltaG, DeltaH and DeltaS values</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="temperature" size="4" type="text" value="25 ">
+      <label>Temperature at which to calculate the DeltaG, DeltaH and DeltaS values</label>
+    </param>
+    <param name="rna" type="select">
+      <label>Sequence is RNA</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="product" type="select">
+      <label>Include percent formamide, percent of mismatches allowed and product length</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="formamide" size="4" type="text" value="0 ">
+      <label>Formamide concentration (nM)</label>
+    </param>
+    <param name="mismatch" size="4" type="text" value="0 ">
+      <label>Percent mismatch to be used in calculations</label>
+    </param>
+    <param name="prodlen" size="4" type="text" value="20">
+      <label>Product length to be used in calculations</label>
+    </param>
+    <param name="plot1" type="select">
+      <label>Create a graph</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="dan" name="out_file1" />
+  </outputs>
+  <!--
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="window" value="20"/>
+      <param name="shift" value="1"/>
+      <param name="dnaconc" value="50"/>
+      <param name="saltconc" value="50"/>
+      <param name="thermo" value="yes"/>
+      <param name="temperature" value="25"/>
+      <param name="rna" value="no"/>
+      <param name="product" value="no"/>
+      <param name="formamide" value="0"/>
+      <param name="mismatch" value="0"/>
+      <param name="prodlen" value="20"/>
+      <param name="plot1" value="yes"/>
+      <output name="out_file1" file="emboss_dan_out.png"/>
+    </test>
+  </tests>
+  -->
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/dan.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_degapseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,66 @@
+<tool id="EMBOSS: degapseq20" name="degapseq" version="5.0.0">
+  <description>Removes gap characters from sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>degapseq -sequence $input1 -outseq $out_file1 -osformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>On query</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_degapseq_out.fasta"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/degapseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_descseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,80 @@
+<tool id="EMBOSS: descseq21" name="descseq" version="5.0.0">
+  <description>Alter the name or description of a sequence</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>descseq -sequence $input1 -outseq $out_file1 -name "$seqname" -description "$desc" -append $append -osformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>On query</label>
+    </param>
+    <param name="seqname" size="50" type="text" value="">
+      <label>Name of the sequence</label>
+    </param>
+    <param name="desc" size="50" type="text" value="">
+      <label>Description of the sequence</label>
+    </param>
+    <param name="append" type="select">
+      <label>Append the name or description on to the end of the existing name or description</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="seqname" value="test"/>
+      <param name="desc" value="test"/>
+      <param name="append" value="yes"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_descseq_out.fasta"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/descseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_diffseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,72 @@
+<tool id="EMBOSS: diffseq22" name="diffseq" version="5.0.0">
+  <description>Find differences between nearly identical sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>diffseq -asequence $input1 -bsequence $input2 -outfile $out_file1 -aoutfeat $out_file2 -boutfeat $out_file3 -wordsize $wordsize -globaldifferences $globaldifferences -rformat3
+  $out_format1 -offormat4 $out_format2 -offormat5 $out_format3 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence 1</label>
+    </param>
+    <param format="data" name="input2" type="data">
+      <label>Sequence 2</label>
+    </param>
+    <param name="wordsize" size="4" type="text" value="20">
+      <label>Wordsize</label>
+    </param>
+    <param name="globaldifferences" type="select">
+      <label>Report differences at the ends</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Report File Format</label>
+      <option value="diffseq">Diffseq</option>
+      <option value="embl">EMBL</option>
+      <option value="genbank">GENBANK</option>
+      <option value="gff">GFF</option>
+      <option value="pir">PIR</option>
+      <option value="swiss">SwissProt</option>
+      <option value="dbmotif">DbMotif</option>
+      <option value="excel">Excel (tab delimited)</option>
+      <option value="feattable">FeatTable</option>
+      <option value="motif">Motif</option>
+      <option value="regions">Regions</option>
+      <option value="seqtable">SeqTable</option>
+      <option value="simple">SRS Simple</option>
+      <option value="srs">SRS</option>
+      <option value="table">Table</option>
+      <option value="tagseq">TagSeq</option>
+    </param>
+    <param name="out_format2" type="select">
+      <label>Sequence 1 Output Feature File Format</label>
+      <option value="gff">GFF</option>
+      <option value="embl">EMBL</option>
+      <option value="swiss">SwissProt</option>
+    </param>
+    <param name="out_format3" type="select">
+      <label>Sequence 2 Output Feature File Format</label>
+      <option value="gff">GFF</option>
+      <option value="embl">EMBL</option>
+      <option value="swiss">SwissProt</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="diffseq" name="out_file1" />
+    <data format="gff" name="out_file2" />
+    <data format="gff" name="out_file3" />
+  </outputs>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/diffseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_digest.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,73 @@
+<tool id="EMBOSS: digest23" name="digest" version="5.0.0">
+  <description>Protein proteolytic enzyme or reagent cleavage digest</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>digest -seqall $input1 -outfile $out_file1 -menu $menu -unfavoured $unfavoured -overlap $overlap -allpartials $allpartials -rformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="menu" type="select">
+      <label>Enzyme/Reagent</label>
+      <option value="1">Trypsin</option>
+      <option value="2">Lys-C</option>
+      <option value="3">Arg-C</option>
+      <option value="4">Asp-N</option>
+      <option value="5">V8-bicarb</option>
+      <option value="6">V8-phosph</option>
+      <option value="7">Chymotrypsin</option>
+      <option value="8">CNBr</option>
+    </param>
+    <param name="unfavoured" type="select">
+      <label>Trypsin will not normally cut after a K if it is followed by (e.g.) another K or a P. Specifying this shows those cuts, as well as the favoured ones.</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="overlap" type="select">
+      <label>Used for partial digestion. Shows all cuts from favoured cut sites plus 1..3, 2..4, 3..5 etc but not (e.g.) 2..5. Overlaps are therefore fragments with exactly one potential cut site
+      within it.</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="allpartials" type="select">
+      <label>As for overlap but fragments containing more than one potential cut site are included.</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Report File Format</label>
+      <option value="seqtable">SeqTable</option>
+      <option value="embl">EMBL</option>
+      <option value="genbank">GENBANK</option>
+      <option value="gff">GFF</option>
+      <option value="pir">PIR</option>
+      <option value="swiss">SwissProt</option>
+      <option value="dbmotif">DbMotif</option>
+      <option value="diffseq">Diffseq</option>
+      <option value="excel">Excel (tab delimited)</option>
+      <option value="feattable">FeatTable</option>
+      <option value="motif">Motif</option>
+      <option value="regions">Regions</option>
+      <option value="simple">SRS Simple</option>
+      <option value="srs">SRS</option>
+      <option value="table">Table</option>
+      <option value="tagseq">TagSeq</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="digest" name="out_file1" />
+  </outputs>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/digest.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_dotmatcher.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,37 @@
+<tool id="EMBOSS: dotmatcher24" name="dotmatcher" version="5.0.0">
+  <description>Displays a thresholded dotplot of two sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command interpreter="perl">emboss_single_outputfile_wrapper.pl dotmatcher -asequence $input1 -bsequence $input2 -goutfile $out_file1 -windowsize $windowsize -threshold $threshold -graph png -xygraph png
+  -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence 1</label>
+    </param>
+    <param format="data" name="input2" type="data">
+      <label>Sequence 2</label>
+    </param>
+    <param name="windowsize" size="4" type="text" value="10">
+      <label>Window size</label>
+    </param>
+    <param name="threshold" size="4" type="text" value="23">
+      <label>Threshold</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="png" name="out_file1" />
+  </outputs>
+  <!-- functional tests not possible since image output contains file name information and timestamp -->
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/dotmatcher.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_dotpath.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,44 @@
+<tool id="EMBOSS: dotpath25" name="dotpath" version="5.0.0">
+  <description>Non-overlapping wordmatch dotplot of two sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command interpreter="perl">emboss_single_outputfile_wrapper.pl dotpath -asequence $input1 -bsequence $input2 -goutfile $out_file1 -wordsize $wordsize -overlaps $overlaps -boxit $boxit -graph png
+  -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence 1</label>
+    </param>
+    <param format="data" name="input2" type="data">
+      <label>Sequence 2</label>
+    </param>
+    <param name="wordsize" size="4" type="text" value="4">
+      <label>Word size (Integer 2 or more)</label>
+    </param>
+    <param name="overlaps" type="select">
+      <label>Display the overlapping matches (in red) as well as the minimal set of non-overlapping matches</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="boxit" type="select">
+      <label>Draw a box around dotplot</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="png" name="out_file1" />
+  </outputs>
+  <!-- functional tests not possible since image output contains file name information and timestamp -->
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/dotpath.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_dottup.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,38 @@
+<tool id="EMBOSS: dottup26" name="dottup" version="5.0.0">
+  <description>Displays a wordmatch dotplot of two sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command interpreter="perl">emboss_single_outputfile_wrapper.pl dottup -asequence $input1 -bsequence $input2 -goutfile $out_file1 -wordsize $wordsize -boxit $boxit -graph png  -xygraph png -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence 1</label>
+    </param>
+    <param format="data" name="input2" type="data">
+      <label>Sequence 2</label>
+    </param>
+    <param name="wordsize" size="4" type="text" value="4">
+      <label>Word size</label>
+    </param>
+    <param name="boxit" type="select">
+      <label>Draw a box around dotplot</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="png" name="out_file1" />
+  </outputs>
+  <!-- functional tests not possible since image output contains file name information and timestamp -->
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/dottup.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_dreg.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,30 @@
+<tool id="EMBOSS: dreg27" name="dreg" version="5.0.0">
+  <description>Regular expression search of a nucleotide sequence</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>dreg -sequence $input1 -outfile $out_file1 -pattern "$pattern" -raccshow3 "no" -rusashow3 "no" -rdesshow3 "no" -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence 1</label>
+    </param>
+    <param name="pattern" size="50" type="text" value="(AUG)">
+      <label>Regular expression pattern</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="dreg" name="out_file1" />
+  </outputs>
+  <!-- tests not possible since dreg timestamps output file -->
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/dreg.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_einverted.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,58 @@
+<tool id="EMBOSS: einverted28" name="einverted" version="5.0.0">
+  <description>Finds DNA inverted repeats</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>einverted -sequence $input1 -outfile $out_file1 -gap $gap -threshold $threshold -match $match -mismatch $mismatch -maxrepeat $maxrepeat -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>On query</label>
+    </param>
+    <param name="gap" size="4" type="text" value="12">
+      <label>Gap penalty</label>
+    </param>
+    <param name="threshold" size="4" type="text" value="50">
+      <label>Minimum score threshold</label>
+    </param>
+    <param name="match" size="4" type="text" value="3">
+      <label>Match score</label>
+    </param>
+    <param name="mismatch" size="4" type="text" value="-4">
+      <label>Mismatch score</label>
+    </param>
+    <param name="maxrepeat" size="4" type="text" value="2000">
+      <label>Maximum separation between the start of repeat and the end of the inverted repeat</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="einverted" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="1.fasta"/>
+      <param name="gap" value="12"/>
+      <param name="threshold" value="50"/>
+      <param name="match" value="3"/>
+      <param name="mismatch" value="-4"/>
+      <param name="maxrepeat" value="2000"/>
+      <output name="out_file1" file="emboss_einverted_out.einverted"/>
+    </test>
+  </tests>
+  <help>
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/einverted.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_epestfind.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,73 @@
+<tool id="EMBOSS: epestfind29" name="epestfind" version="5.0.0">
+  <description>Finds PEST motifs as potential proteolytic cleavage sites</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command interpreter="perl">emboss_single_outputfile_wrapper.pl epestfind -sequence $input1 -goutfile $ofile2 -outfile $ofile1 -window $window -order $order -potential $potential -poor $poor
+  -invalid $invalid -map $map -graph png -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="window" size="4" type="text" value="10">
+      <label>Minimal distance between positively charged amino acids</label>
+    </param>
+    <param name="order" type="select">
+      <label>Sort by</label>
+      <option value="3">Score</option>
+      <option value="1">Length</option>
+      <option value="2">Position</option>
+    </param>
+    <param name="threshold" size="4" type="text" value="5.0">
+      <label>Threshold value to discriminate weak from potential PEST motifs.</label>
+    </param>
+    <param name="potential" type="select">
+      <label>Decide whether potential PEST motifs should be printed</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="poor" type="select">
+      <label>Decide whether poor PEST motifs should be printed</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="invalid" type="select">
+      <label>Decide whether invalid PEST motifs should be printed</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="map" type="select">
+      <label>Decide whether PEST motifs should be mapped to sequence</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="png" name="ofile2" />
+    <data format="epestfind" name="ofile1" />
+  </outputs>
+<!--    <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="window" value="10"/>
+      <param name="order" value="3"/>
+      <param name="threshold" value="5.0"/>
+      <param name="potential" value="yes"/>
+      <param name="poor" value="yes"/>
+      <param name="invalid" value="no"/>
+      <param name="map" value="yes"/>
+      <output name="ofile1" file="emboss_epestfind_out.epestfind"/>
+    </test>
+  </tests>  output file contains file location info  -->
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/epestfind.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_equicktandem.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,68 @@
+<tool id="EMBOSS: equicktandem31" name="equicktandem" version="5.0.0">
+  <description>Finds tandem repeats</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>equicktandem -sequence $input1 -outfile $out_file1 -origfile $ofile2 -maxrepeat $maxrepeat -threshold $threshold -rformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="maxrepeat" size="4" type="text" value="600">
+      <label>Maximum repeat size</label>
+    </param>
+    <param name="threshold" size="4" type="text" value="20">
+      <label>Threshold score</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Report File Format</label>
+      <option value="table">Table</option>
+      <option value="embl">EMBL</option>
+      <option value="genbank">GENBANK</option>
+      <option value="gff">GFF</option>
+      <option value="pir">PIR</option>
+      <option value="swiss">SwissProt</option>
+      <option value="dbmotif">DbMotif</option>
+      <option value="diffseq">Diffseq</option>
+      <option value="excel">Excel (tab delimited)</option>
+      <option value="feattable">FeatTable</option>
+      <option value="motif">Motif</option>
+      <option value="regions">Regions</option>
+      <option value="seqtable">SeqTable</option>
+      <option value="simple">SRS Simple</option>
+      <option value="srs">SRS</option>
+      <option value="tagseq">TagSeq</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="table" name="out_file1" />
+    <data format="equicktandem" name="ofile2" />
+  </outputs>
+    <tests>
+    <test>
+      <param name="input1" value="1.fasta"/>
+      <param name="maxrepeat" value="600"/>
+      <param name="threshold" value="20"/>
+      <param name="out_format1" value="table"/>
+      <output name="ofile2" file="emboss_equicktandem_out.equicktandem"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/equicktandem.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_est2genome.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,111 @@
+<tool id="EMBOSS: est2genome32" name="est2genome" version="5.0.0">
+  <description>Align EST and genomic DNA sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>est2genome -estsequence $input1 -genomesequence $input2 -outfile $out_file1 -match $match -mismatch $mismatch -gappenalty $gappenalty -intronpenalty $intronpenalty -splicepenalty
+  $splicepenalty -minscore $minscore -reverse $reverse -splice $splice -mode $mode -best $best -shuffle $shuffle -seed $seed -align $align -width $width -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>EST sequence(s)</label>
+    </param>
+    <param format="data" name="input2" type="data">
+      <label>Genomic sequence</label>
+    </param>
+    <param name="match" size="4" type="text" value="1">
+      <label>Score for matching two bases</label>
+    </param>
+    <param name="mismatch" size="4" type="text" value="1">
+      <label>Cost for mismatching two bases</label>
+    </param>
+    <param name="gappenalty" size="4" type="text" value="2">
+      <label>Cost for deleting a single base in either sequence, excluding introns</label>
+    </param>
+    <param name="intronpenalty" size="4" type="text" value="40">
+      <label>Cost for an intron, independent of length</label>
+    </param>
+    <param name="splicepenalty" size="4" type="text" value="20">
+      <label>Cost for an intron, independent of length and starting/ending on donor-acceptor sites</label>
+    </param>
+    <param name="minscore" size="4" type="text" value="30">
+      <label>Exclude alignments with scores below this threshold score</label>
+    </param>
+    <param name="reverse" type="select">
+      <label>Reverse the orientation of the EST sequence</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="splice" type="select">
+      <label>Use donor and acceptor splice sites</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="mode" type="select">
+      <label>Comparison mode</label>
+      <option value="both">Both strands</option>
+      <option value="forward">Forward strand only</option>
+      <option value="reverse">Reverse strand only</option>
+    </param>
+    <param name="best" type="select">
+      <label>Only best comparisons</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="shuffle" size="4" type="text" value="0">
+      <label>Shuffle</label>
+    </param>
+    <param name="seed" size="4" type="text" value="20825">
+      <label>Random number seed</label>
+    </param>
+    <param name="align" type="select">
+      <label>Show the alignment</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="width" size="4" type="text" value="50">
+      <label>Alignment width</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="est2genome" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="input2" value="1.fasta"/>
+      <param name="match" value="1"/>
+      <param name="mismatch" value="1"/>
+      <param name="match" value="1"/>
+      <param name="gappenalty" value="2"/>
+      <param name="intronpenalty" value="40"/>
+      <param name="splicepenalty" value="20"/>
+      <param name="minscore" value="30"/>
+      <param name="reverse" value="no"/>
+      <param name="splice" value="yes"/>
+      <param name="mode" value="both"/>
+      <param name="best" value="yes"/>
+      <param name="shuffle" value="0"/>
+      <param name="seed" value="20825"/>
+      <param name="align" value="no"/>
+      <param name="width" value="50"/>
+      <output name="out_file1" file="emboss_est2genome_out.est2genome"/>
+    </test>
+  </tests>
+  <help>
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/est2genome.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_etandem.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,86 @@
+<tool id="EMBOSS: etandem33" name="etandem" version="5.0.0">
+  <description>Looks for tandem repeats in a nucleotide sequence</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>etandem -sequence $input1 -outfile $out_file1 -origfile $ofile2 -minrepeat $minrepeat -maxrepeat $maxrepeat -threshold $threshold -mismatch $mismatch -uniform $uniform -rformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="minrepeat" size="4" type="text" value="10">
+      <label>Minimum repeat size</label>
+    </param>
+    <param name="maxrepeat" size="4" type="text" value="10">
+      <label>Maximum repeat size</label>
+    </param>
+    <param name="threshold" size="4" type="text" value="20">
+      <label>Threshold score</label>
+    </param>
+    <param name="mismatch" type="select">
+      <label>Allow N as a mismatch</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="uniform" type="select">
+      <label>Allow uniform consensus</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Report File Format</label>
+      <option value="table">Table</option>
+      <option value="embl">EMBL</option>
+      <option value="genbank">GENBANK</option>
+      <option value="gff">GFF</option>
+      <option value="pir">PIR</option>
+      <option value="swiss">SwissProt</option>
+      <option value="dbmotif">DbMotif</option>
+      <option value="diffseq">Diffseq</option>
+      <option value="excel">Excel (tab delimited)</option>
+      <option value="feattable">FeatTable</option>
+      <option value="motif">Motif</option>
+      <option value="regions">Regions</option>
+      <option value="seqtable">SeqTable</option>
+      <option value="simple">SRS Simple</option>
+      <option value="srs">SRS</option>
+      <option value="tagseq">TagSeq</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="etandem" name="out_file1" />
+    <data format="table" name="ofile2" />
+  </outputs>
+    <tests>
+    <test>
+      <param name="input1" value="1.fasta"/>
+      <param name="minrepeat" value="10"/>
+      <param name="maxrepeat" value="10"/>
+      <param name="threshold" value="20"/>
+      <param name="mismatch" value="no"/>
+       <param name="uniform" value="no"/>
+      <param name="out_format1" value="table"/>
+      <output name="ofile2" file="emboss_etandem_out.table"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/etandem.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
+
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_extractfeat.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,104 @@
+<tool id="EMBOSS: extractfeat34" name="extractfeat" version="5.0.0">
+  <!-- tool tested with documentation, functional test not designed due to empty files resulting from test input sequences -->
+  <description>Extract features from a sequence</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>extractfeat -sequence $input1 -outseq $out_file1 -before $before -after $after -source "$source" -type "$type" -sense $sense -minscore $minscore -maxscore $maxscore -tag "$tag" -value
+  "$value" -join $join -featinname $featinname -describe "$describe" -osformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="before" size="4" type="text" value="0">
+      <label>Number of bases or residues before the feature to include in the extracted sequence</label>
+    </param>
+    <param name="after" size="4" type="text" value="0">
+      <label>Number of bases or residues after the feature to include in the extracted sequence</label>
+    </param>
+    <param name="source" size="4" type="text" value="*">
+      <label>Feature source</label>
+    </param>
+    <param name="type" size="4" type="text" value="*">
+      <label>Feature type</label>
+    </param>
+    <param name="sense" type="select">
+      <label>Feature sense</label>
+      <option value="0">Any sense</option>
+      <option value="1">Forward sense</option>
+      <option value="-1">Reverse sense</option>
+    </param>
+    <param name="minscore" size="4" type="text" value="0.0">
+      <label>Minimum score</label>
+    </param>
+    <param name="maxscore" size="4" type="text" value="0.0">
+      <label>Maximum score</label>
+    </param>
+    <param name="tag" size="4" type="text" value="*">
+      <label>Feature tags</label>
+    </param>
+    <param name="value" size="4" type="text" value="*">
+      <label>Tag values</label>
+    </param>
+    <param name="join" type="select">
+      <label>Join features</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="featinname" type="select">
+      <label>Put feature type in sequence name</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="describe" size="4" type="text" value="">
+      <label>Specify one or more tag names that should be added to the output sequence Description text</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+  </outputs>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/extractfeat.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_extractseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,76 @@
+<tool id="EMBOSS: extractseq35" name="extractseq" version="5.0.0">
+  <description>Extract regions from a sequence</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>extractseq -sequence $input1 -outseq $out_file1 -regions $regions -separate $separate -osformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="regions" size="20" type="text" value="1-9999999">
+      <label>Regions to extract</label>
+    </param>
+    <param name="separate" type="select">
+      <label>Write each specified region as a separate sequence</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="regions" value="1-9999999"/>
+      <param name="separate" value="no"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_extractseq_out.fasta"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/extractseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_format_corrector.py	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,53 @@
+#EMBOSS format corrector
+
+import operator
+#from galaxy import datatypes
+
+#Properly set file formats after job run
+def exec_after_process( app, inp_data, out_data, param_dict,tool, stdout, stderr):
+#Properly set file formats before job run
+#def exec_before_job(trans, inp_data, out_data, param_dict,tool):
+    #why isn't items an ordered list?
+    items = out_data.items()
+    #lets sort it ourselves....
+    items = sorted(items, key=operator.itemgetter(0))
+    #items is now sorted...
+
+    #normal filetype correction
+    data_count=1
+    for name, data in items:
+        outputType = param_dict.get( 'out_format'+str(data_count), None )
+        #print "data_count",data_count, "name", name, "outputType", outputType
+        if outputType !=None:
+            if outputType == 'ncbi':
+                outputType = "fasta"
+            elif outputType == 'excel':
+                outputType = "tabular"
+            elif outputType == 'text':
+                outputType = "txt"
+            data = app.datatypes_registry.change_datatype(data, outputType)
+            app.model.context.add( data )
+            app.model.context.flush()
+        data_count+=1
+
+    #html filetype correction
+    data_count=1
+    for name, data in items:
+        wants_plot = param_dict.get( 'html_out'+str(data_count), None )
+        ext = "html"
+        if wants_plot == "yes":
+            data = app.datatypes_registry.change_datatype(data, ext)
+            app.model.context.add( data )
+            app.model.context.flush()
+        data_count+=1
+
+    #png file correction
+    data_count=1
+    for name, data in items:
+        wants_plot = param_dict.get( 'plot'+str(data_count), None )
+        ext = "png"
+        if wants_plot == "yes":
+            data = app.datatypes_registry.change_datatype(data, ext)
+            app.model.context.add( data )
+            app.model.context.flush()
+        data_count+=1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_freak.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,44 @@
+<tool id="EMBOSS: freak36" name="freak" version="5.0.0">
+  <description>Residue/base frequency table or plot</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>freak -seqall $input1 -outfile $out_file1 -window $window -letters $letters -graph png -step $step -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="letters" size="5" type="text" value="gc">
+      <label>Residue letters</label>
+    </param>
+    <param name="step" size="5" type="text" value="1">
+      <label>Stepping value</label>
+    </param>
+    <param name="window" size="5" type="text" value="30">
+      <label>Averaging window</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="freak" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="letters" value="gc"/>
+      <param name="step" value="1"/>
+      <param name="window" value="30"/>
+      <output name="out_file1" file="emboss_freak_out.freak"/>
+    </test>
+  </tests>
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/freak.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_fuzznuc.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,83 @@
+<tool id="EMBOSS: fuzznuc37" name="fuzznuc" version="5.0.1">
+  <description>Nucleic acid pattern search</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>fuzznuc -sequence $input1 -outfile $out_file1 -pattern '$pattern' -pmismatch $mismatch -complement $complement -rformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="pattern" size="5" type="text" value="">
+      <label>Search pattern</label>
+      <sanitizer>
+        <valid initial="string.printable">
+         <remove value="&apos;"/>
+        </valid>
+        <mapping initial="none">
+          <add source="&apos;" target=""/>
+        </mapping>
+      </sanitizer>
+    </param>
+    <param name="mismatch" size="5" type="text" value="0">
+      <label>Number of mismatches</label>
+    </param>
+    <param name="complement" type="select">
+      <label>Search complementary strand</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Report File Format</label>
+      <option value="seqtable">SeqTable</option>
+      <option value="embl">EMBL</option>
+      <option value="genbank">GENBANK</option>
+      <option value="gff">GFF</option>
+      <option value="pir">PIR</option>
+      <option value="swiss">SwissProt</option>
+      <option value="dbmotif">DbMotif</option>
+      <option value="diffseq">Diffseq</option>
+      <option value="excel">Excel (tab delimited)</option>
+      <option value="feattable">FeatTable</option>
+      <option value="motif">Motif</option>
+      <option value="regions">Regions</option>
+      <option value="simple">SRS Simple</option>
+      <option value="fuzznuc">Fuzznuc Output File</option>
+      <option value="srs">SRS</option>
+      <option value="table">Table</option>
+      <option value="tagseq">TagSeq</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fuzznuc" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="pattern" value="AA"/>
+      <param name="mismatch" value="0"/>
+      <param name="complement" value="no"/>
+      <param name="out_format1" value="excel"/>
+      <output name="out_file1" file="emboss_fuzznuc_out.tabular"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/fuzznuc.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_fuzzpro.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,52 @@
+<tool id="EMBOSS: fuzzpro38" name="fuzzpro" version="5.0.0">
+  <description>Protein pattern search</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>fuzzpro -sequence $input1 -outfile $out_file1 -pattern "$pattern" -pmismatch $mismatch -rformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="pattern" size="30" type="text" value="">
+      <label>Search pattern</label>
+    </param>
+    <param name="mismatch" size="5" type="text" value="0">
+      <label>Number of mismatches</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Report File Format</label>
+      <option value="seqtable">SeqTable</option>
+      <option value="embl">EMBL</option>
+      <option value="genbank">GENBANK</option>
+      <option value="gff">GFF</option>
+      <option value="pir">PIR</option>
+      <option value="swiss">SwissProt</option>
+      <option value="dbmotif">DbMotif</option>
+      <option value="diffseq">Diffseq</option>
+      <option value="excel">Excel (tab delimited)</option>
+      <option value="feattable">FeatTable</option>
+      <option value="motif">Motif</option>
+      <option value="regions">Regions</option>
+      <option value="simple">SRS Simple</option>
+      <option value="srs">SRS</option>
+      <option value="table">Table</option>
+      <option value="tagseq">TagSeq</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fuzzpro" name="out_file1" />
+  </outputs>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/fuzzpro.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_fuzztran.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,103 @@
+<tool id="EMBOSS: fuzztran39" name="fuzztran" version="5.0.0">
+  <description>Protein pattern search after translation</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>fuzztran -sequence $input1 -outfile $out_file1 -pattern "$pattern" -pmismatch $mismatch -frame $frame -table $table -rformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="pattern" size="5" type="text" value="">
+      <label>Search pattern</label>
+    </param>
+    <param name="mismatch" size="5" type="text" value="0">
+      <label>Number of mismatches</label>
+    </param>
+    <param name="frame" type="select">
+      <label>Frame(s) to translate</label>
+      <option value="1">Frame 1</option>
+      <option value="2">Frame 2</option>
+      <option value="3">Frame 3</option>
+      <option value="F">Forward three frames</option>
+      <option value="-1">Frame -1</option>
+      <option value="-2">Frame -2</option>
+      <option value="-3">Frame -3</option>
+      <option value="R">Reverse three frames</option>
+      <option value="6">All six frames</option>
+    </param>
+    <param name="table" type="select">
+      <label>Code to use</label>
+      <option value="0">Standard</option>
+      <option value="1">Standard (with alternative initiation codons)</option>
+      <option value="2">Vertebrate Mitochondrial</option>
+      <option value="3">Yeast Mitochondrial</option>
+      <option value="4">Mold, Protozoan, Coelenterate Mitochondrial and Mycoplasma/Spiroplasma</option>
+      <option value="5">Invertebrate Mitochondrial</option>
+      <option value="6">Ciliate Macronuclear and Dasycladacean</option>
+      <option value="9">Echinoderm Mitochondrial</option>
+      <option value="10">Euplotid Nuclear</option>
+      <option value="11">Bacterial</option>
+      <option value="12">Alternative Yeast Nuclear</option>
+      <option value="13">Ascidian Mitochondrial</option>
+      <option value="14">Flatworm Mitochondrial</option>
+      <option value="15">Blepharisma Macronuclear</option>
+      <option value="16">Chlorophycean Mitochondrial</option>
+      <option value="21">Trematode Mitochondrial</option>
+      <option value="22">Scenedesmus obliquus</option>
+      <option value="23">Thraustochytrium Mitochondrial</option>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Report File Format</label>
+      <option value="table">Table</option>
+      <option value="embl">EMBL</option>
+      <option value="genbank">GENBANK</option>
+      <option value="gff">GFF</option>
+      <option value="pir">PIR</option>
+      <option value="swiss">SwissProt</option>
+      <option value="dbmotif">DbMotif</option>
+      <option value="diffseq">Diffseq</option>
+      <option value="excel">Excel (tab delimited)</option>
+      <option value="feattable">FeatTable</option>
+      <option value="motif">Motif</option>
+      <option value="regions">Regions</option>
+      <option value="seqtable">SeqTable</option>
+      <option value="simple">SRS Simple</option>
+      <option value="srs">SRS</option>
+      <option value="tagseq">TagSeq</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fuzztran" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="1.fasta"/>
+      <param name="pattern" value="AA"/>
+      <param name="mismatch" value="0"/>
+      <param name="frame" value="6"/>
+      <param name="table" value="0"/>
+      <param name="out_format1" value="excel"/>
+      <output name="out_file1" file="emboss_fuzztran_out.tabular"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/fuzztran.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_garnier.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,66 @@
+<tool id="EMBOSS: garnier40" name="garnier" version="5.0.0">
+  <description>Predicts protein secondary structure</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>garnier -sequence $input1 -outfile $out_file1 -idc $idc -rformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="idc" type="select">
+      <label>In their paper, GOR mention that if you know something about the secondary structure content of the protein you are analyzing, you can do better in prediction. 'idc' is an index into a
+      set of arrays, dharr[] and dsarr[], which provide 'decision constants' (dch, dcs), which are offsets that are applied to the weights for the helix and sheet (extend) terms. So, idc=0 says don't
+      use the decision constant offsets, and idc=1 to 6 indicates that various combinations of dch,dcs offsets should be used</label>
+      <option value="0">idc 0</option>
+      <option value="1">idc 1</option>
+      <option value="2">idc 2</option>
+      <option value="3">idc 3</option>
+      <option value="4">idc 4</option>
+      <option value="5">idc 5</option>
+      <option value="6">idc 6</option>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Report File Format</label>
+      <option value="tagseq">TagSeq</option>
+      <option value="embl">EMBL</option>
+      <option value="genbank">GENBANK</option>
+      <option value="gff">GFF</option>
+      <option value="pir">PIR</option>
+      <option value="swiss">SwissProt</option>
+      <option value="dbmotif">DbMotif</option>
+      <option value="diffseq">Diffseq</option>
+      <option value="excel">Excel (tab delimited)</option>
+      <option value="feattable">FeatTable</option>
+      <option value="motif">Motif</option>
+      <option value="regions">Regions</option>
+      <option value="seqtable">SeqTable</option>
+      <option value="simple">SRS Simple</option>
+      <option value="srs">SRS</option>
+      <option value="table">Table</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="garnier" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="idc" value="0"/>
+      <param name="out_format1" value="excel"/>
+      <output name="out_file1" file="emboss_garnier_out.tabular"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/4.0/emboss/apps/garnier.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_geecee.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,32 @@
+<tool id="EMBOSS: geecee41" name="geecee" version="5.0.0">
+  <description>Calculates fractional GC content of nucleic acid sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>geecee -sequence $input1 -outfile $out_file1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="geecee" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <output name="out_file1" file="emboss_geecee_out.geecee"/>
+    </test>
+  </tests>
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/geecee.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_getorf.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,137 @@
+<tool id="EMBOSS: getorf42" name="getorf" version="5.0.0">
+  <description>Finds and extracts open reading frames (ORFs)</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>getorf -sequence $input1 -outseq $out_file1 -table $table -minsize $minsize -maxsize $maxsize -find $find -methionine $methionine -circular $circular -reverse $reverse -flanking $flanking
+  -osformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="table" type="select">
+      <label>Code to use</label>
+      <option value="0">Standard</option>
+      <option value="1">Standard (with alternative initiation codons)</option>
+      <option value="2">Vertebrate Mitochondrial</option>
+      <option value="3">Yeast Mitochondrial</option>
+      <option value="4">Mold, Protozoan, Coelenterate Mitochondrial and Mycoplasma/Spiroplasma</option>
+      <option value="5">Invertebrate Mitochondrial</option>
+      <option value="6">Ciliate Macronuclear and Dasycladacean</option>
+      <option value="9">Echinoderm Mitochondrial</option>
+      <option value="10">Euplotid Nuclear</option>
+      <option value="11">Bacterial</option>
+      <option value="12">Alternative Yeast Nuclear</option>
+      <option value="13">Ascidian Mitochondrial</option>
+      <option value="14">Flatworm Mitochondrial</option>
+      <option value="15">Blepharisma Macronuclear</option>
+      <option value="16">Chlorophycean Mitochondrial</option>
+      <option value="21">Trematode Mitochondrial</option>
+      <option value="22">Scenedesmus obliquus</option>
+      <option value="23">Thraustochytrium Mitochondrial</option>
+    </param>
+    <param name="minsize" size="10" type="text" value="30">
+      <label>Minimum nucleotide size of ORF to report</label>
+    </param>
+    <param name="maxsize" size="10" type="text" value="1000000">
+      <label>Maximum nucleotide size of ORF to report</label>
+    </param>
+    <param name="find" type="select">
+      <label>What to output</label>
+      <option value="0">Translation of regions between STOP codons</option>
+      <option value="1">Translation of regions between START and STOP codons</option>
+      <option value="2">Nucleic sequences between STOP codons</option>
+      <option value="3">Nucleic sequences between START and STOP codons</option>
+      <option value="4">Nucleotides flanking START codons</option>
+      <option value="5">Nucleotides flanking initial STOP codons</option>
+      <option value="6">Nucleotides flanking ending STOP codons</option>
+    </param>
+    <param name="methionine" type="select">
+      <label>All START codons to code for Methionine</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="circular" type="select">
+      <label>Circular sequence</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="reverse" type="select">
+      <label>Find ORFs in the reverse complement</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="flanking" size="10" type="text" value="100">
+      <label>Number of flanking nucleotides to output</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <!-- <option value="gff">GFF (m)</option> -->
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="minsize" value="30"/>
+      <param name="maxsize" value="1000000"/>
+      <param name="find" value="0"/>
+      <param name="methionine" value="yes"/>
+      <param name="circular" value="no"/>
+      <param name="reverse" value="yes"/>
+      <param name="table" value="0"/>
+      <param name="flanking" value="100"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_getorf_out.fasta"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/getorf.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_helixturnhelix.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,71 @@
+<tool id="EMBOSS: helixturnhelix43" name="helixturnhelix" version="5.0.0">
+  <description>Report nucleic acid binding motifs</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>helixturnhelix -sequence $input1 -outfile $out_file1 -mean $mean -sd $sd -minsd $minsd -eightyseven $eightyseven -rformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="mean" size="10" type="text" value="238.71">
+      <label>Mean value</label>
+    </param>
+    <param name="sd" size="10" type="text" value="293.61">
+      <label>Standard Deviation value</label>
+    </param>
+    <param name="minsd" size="10" type="text" value="2.5">
+      <label>Minimum SD</label>
+    </param>
+    <param name="eightyseven" type="select">
+      <label>Use the old (1987) weight data</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Report File Format</label>
+      <option value="motif">Motif</option>
+      <option value="embl">EMBL</option>
+      <option value="genbank">GENBANK</option>
+      <option value="gff">GFF</option>
+      <option value="pir">PIR</option>
+      <option value="swiss">SwissProt</option>
+      <option value="dbmotif">DbMotif</option>
+      <option value="diffseq">Diffseq</option>
+      <option value="excel">Excel (tab delimited)</option>
+      <option value="feattable">FeatTable</option>
+      <option value="regions">Regions</option>
+      <option value="seqtable">SeqTable</option>
+      <option value="simple">SRS Simple</option>
+      <option value="srs">SRS</option>
+      <option value="table">Table</option>
+      <option value="tagseq">TagSeq</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="motif" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="mean" value="238.71"/>
+      <param name="sd" value="293.61"/>
+      <param name="minsd" value="2.5"/>
+      <param name="eightyseven" value="no"/>
+      <param name="out_format1" value="excel"/>
+      <output name="out_file1" file="emboss_helixturnhelix_out.tabular"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/helixturnhelix.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_hmoment.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,40 @@
+<tool id="EMBOSS: hmoment44" name="hmoment" version="5.0.0">
+  <description>Hydrophobic moment calculation</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>hmoment -seqall $input1 -outfile $out_file1 -window $window -aangle $aangle -graph png -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="window" size="5" type="text" value="10">
+      <label>Window</label>
+    </param>
+    <param name="aangle" size="5" type="text" value="100">
+      <label>Alpha helix angle (degrees)</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="hmoment" name="out_file1" />
+  </outputs>
+    <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="window" value="10"/>
+      <param name="aangle" value="100"/>
+      <output name="out_file1" file="emboss_hmoment_out.hmoment"/>
+    </test>
+  </tests>
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/hmoment.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_iep.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,46 @@
+<tool id="EMBOSS: iep45" name="iep" version="5.0.0">
+  <description>Calculates the isoelectric point of a protein</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>iep -sequence $input1 -outfile $out_file1 -step $step -amino $amino -graph png -termini $termini -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="step" size="5" type="text" value=".5">
+      <label>Step value for pH</label>
+    </param>
+    <param name="amino" size="5" type="text" value="1">
+      <label>Number of N-termini</label>
+    </param>
+    <param name="termini" type="select">
+      <label>Include charge at N and C terminus</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="iep" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="step" value="0.5"/>
+      <param name="amino" value="1"/>
+      <param name="termini" value="yes"/>
+      <output name="out_file1" file="emboss_iep_out.iep"/>
+    </test>
+  </tests>
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/iep.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_infoseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,84 @@
+<tool id="EMBOSS: infoseq46" name="infoseq" version="5.0.0">
+  <!-- info contains file information always -->
+  <description>Displays some simple information about sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>infoseq -sequence $input1 -outfile $out_file1 -html $html_out1 -heading $heading -usa $usa -name $disname -accession $accession -gi $gi -version $version -type $type -length $length -pgc
+  $pgc -description $description -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="html_out1" type="select">
+      <label>Format output as an HTML table</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="heading" type="select">
+      <label>Display column headings</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="usa" type="select">
+      <label>Display the USA of the sequence</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="disname" type="select">
+      <label>Display 'name' column</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="accession" type="select">
+      <label>Display 'accession' column</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="gi" type="select">
+      <label>Display 'GI' column</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="version" type="select">
+      <label>Display 'version' column</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="type" type="select">
+      <label>Display 'type' column</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="length" type="select">
+      <label>Display 'length' column</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="pgc" type="select">
+      <label>Display 'percent GC content' column</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="description" type="select">
+      <label>Display 'description' column</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="txt" name="out_file1" />
+  </outputs>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/infoseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_infoseq_wrapper.pl	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,9 @@
+#! /usr/bin/perl -w
+use strict;
+
+my $cmd_string = join (" ",@ARGV);
+my $results = `$cmd_string`;
+if ($ARGV[6]=~/yes/)
+{
+	print "Extension: html\n";
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_isochore.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,90 @@
+<tool id="EMBOSS: isochore47" name="isochore" version="5.0.0">
+  <description>Plots isochores in large DNA sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command interpreter="perl">emboss_single_outputfile_wrapper.pl isochore -sequence $input1 -outfile $ofile2 -goutfile $ofile1 -graph png -window $window -shift $shift -auto</command>
+  <!--  <command interpreter="perl">emboss_single_outputfile_wrapper.pl isochore -sequence $input1 -goutfile $ofile1 -graph png -window $window -shift $shift -auto</command>-->
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="window" size="4" type="text" value="1000">
+      <label>Window size</label>
+    </param>
+    <param name="shift" size="4" type="text" value="100">
+      <label>Shift increment</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="png" name="ofile1" />
+    <data format="isochore" name="ofile2" />
+  </outputs>
+  <!-- <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="window" value="1000"/>
+      <param name="shift" value="100"/>
+      <output name="ofile1" file="emboss_isochore_out.isochore"/>
+      <output name="ofile2" file="emboss_isochore_out.isochore"/>
+    </test>
+         <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="window" value="1000"/>
+      <param name="shift" value="100"/>
+      <output name="ofile2" file="emboss_isochore_out.isochore"/>
+    </test>
+  </tests>-->
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+**Syntax**
+
+This application plots GC content over a sequence. It is intended for large sequences such as complete chromosomes or large genomic contigs, although interesting results can also be obtained from shorter sequences. You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/isochore.html
+
+- Both **Window size** and **Shift increment** are intergers.
+
+-----
+
+**Example**
+
+- Input sequences::
+
+    >hg18_dna range=chrX:151073054-151073376 5'pad=0 3'pad=0 revComp=FALSE strand=? repeatMasking=none
+    TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA
+    GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTGTCTTTATGCCTCAGATT
+    TGGAGTGCTCAGAGCCTCTGCAGCAAAGATTTGGCATGTGTCCTAGGCCT
+    GCTCAGAGCAGCAAATCCCACCCTCTTGGAGAATGAGACTCATAGAGGGA
+    CAGCTCCCTCCTCAGAGGCTTCTCTAATGGGACTCCAAAGAGCAAACACT
+    CAGCCCCATGAGGACTGGCCAGGCCAAGTGGTGTGTGGGAACAGGGAGCA
+    GCGGTTTCCAAGAGGATACAGTA
+
+- Output data file::
+
+    Position	Percent G+C 1 .. 323
+    80	0.422
+    112	0.460
+    144	0.509
+    176	0.534
+    208	0.553
+    240	0.553
+
+- Output graphics file:
+
+.. image:: ./static/emboss_icons/isochore.png
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_lindna.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,107 @@
+<tool id="EMBOSS: lindna48" name="lindna" version="5.0.0">
+  <!-- tool produces memory error in ajmem.c -->
+  <description>Draws linear maps of DNA constructs</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>lindna -infile $input1 -graphout png -goutfile $out_file1 -ruler $ruler -blocktype $blocktype -maxgroups $maxgroups -maxlabels $maxlabels -intersymbol $intersymbol -intercolour $intercolour
+  -interticks $interticks -gapsize $gapsize -ticklines $ticklines -textheight $textheight -textlength $textlength -margin $margin -tickheight $tickheight -blockheight $blockheight -rangeheight
+  $rangeheight -gapgroup $gapgroup -postext $postext -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="ruler" type="select">
+      <label>Draw a ruler</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="blocktype" type="select">
+      <label>Type of blocks</label>
+      <option value="Filled">Filled blocks</option>
+      <option value="Open">Open blocks</option>
+      <option value="Outline">Black border</option>
+    </param>
+    <param name="maxgroups" size="4" type="text" value="20">
+      <label>Maximum number of groups</label>
+    </param>
+    <param name="maxlabels" size="6" type="text" value="10000">
+      <label>Maximum number of labels</label>
+    </param>
+    <param name="intersymbol" type="select">
+      <label>Type of blocks</label>
+      <option value="Straight">Straight</option>
+    </param>
+    <param name="intercolour" type="select">
+      <label>Colour of junctions between blocks</label>
+      <option value="1">Red</option>
+      <option value="0">Black</option>
+      <option value="2">Yellow</option>
+      <option value="3">Green</option>
+      <option value="4">Aquamarine</option>
+      <option value="5">Pink</option>
+      <option value="6">Wheat</option>
+      <option value="7">Grey</option>
+      <option value="8">Brown</option>
+      <option value="9">Blue</option>
+      <option value="10">Blue-violet</option>
+      <option value="11">Cyan</option>
+      <option value="12">Turquoise</option>
+      <option value="13">Magenta</option>
+      <option value="14">Salmon</option>
+      <option value="15">White</option>
+    </param>
+    <param name="interticks" type="select">
+      <label>Horizontal junctions between ticks</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="gapsize" size="6" type="text" value="500">
+      <label>Interval between ticks in the ruler</label>
+    </param>
+    <param name="ticklines" type="select">
+      <label>Vertical lines at the ruler's ticks</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="textheight" size="4" type="text" value="1.0">
+      <label>Height of text. Enter a number &lt;1.0 or &gt;1.0 to decrease or increase the size, respectively</label>
+    </param>
+    <param name="textlength" size="4" type="text" value="1.0">
+      <label>Length of text. Enter a number &lt;1.0 or &gt;1.0 to decrease or increase the size, respectively</label>
+    </param>
+    <param name="margin" size="4" type="text" value="1.0">
+      <label>Width of left margin. This is the region left to the groups where the names of the groups are displayed. Enter a number &lt;1.0 or &gt;1.0 to decrease or increase the size,
+      respectively</label>
+    </param>
+    <param name="tickheight" size="4" type="text" value="1.0">
+      <label>Height of ticks. Enter a number &lt;1.0 or &gt;1.0 to decrease or increase the size, respectively</label>
+    </param>
+    <param name="blockheight" size="4" type="text" value="1.0">
+      <label>Height of blocks. Enter a number &lt;1.0 or &gt;1.0 to decrease or increase the size, respectively</label>
+    </param>
+    <param name="rangeheight" size="4" type="text" value="1.0">
+      <label>Height of range ends. Enter a number &lt;1.0 or &gt;1.0 to decrease or increase the size, respectively</label>
+    </param>
+    <param name="gapgroup" size="4" type="text" value="1.0">
+      <label>Space between groups. Enter a number &lt;1.0 or &gt;1.0 to decrease or increase the size, respectively</label>
+    </param>
+    <param name="postext" size="4" type="text" value="1.0">
+      <label>Space between text and ticks, blocks, and ranges. Enter a number &lt;1.0 or &gt;1.0 to decrease or increase the size, respectively</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="png" name="out_file1" />
+  </outputs>
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/lindna.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_marscan.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,53 @@
+<tool id="EMBOSS: marscan49" name="marscan" version="5.0.0">
+  <description>Finds MAR/SAR sites in nucleic sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>marscan -sequence $input1 -outfile $out_file1 -rformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Report File Format</label>
+      <option value="gff">GFF</option>
+      <option value="embl">EMBL</option>
+      <option value="genbank">GENBANK</option>
+      <option value="pir">PIR</option>
+      <option value="swiss">SwissProt</option>
+      <option value="dbmotif">DbMotif</option>
+      <option value="diffseq">Diffseq</option>
+      <option value="excel">Excel (tab delimited)</option>
+      <option value="feattable">FeatTable</option>
+      <option value="motif">Motif</option>
+      <option value="regions">Regions</option>
+      <option value="seqtable">SeqTable</option>
+      <option value="simple">SRS Simple</option>
+      <option value="srs">SRS</option>
+      <option value="table">Table</option>
+      <option value="tagseq">TagSeq</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="gff" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="1.fasta"/>
+      <param name="out_format1" value="excel"/>
+      <output name="out_file1" file="emboss_marscan_out.tabular"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/marscan.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_maskfeat.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,80 @@
+<tool id="EMBOSS: maskfeat50" name="maskfeat" version="5.0.0">
+  <description>Mask off features of a sequence</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>maskfeat -sequence $input1 -outseq $out_file1 -type "$type" -tolower $tolower -maskchar "$maskchar" -osformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="type" size="50" type="text" value="repeat*">
+      <label>Feature to mask</label>
+    </param>
+    <param name="tolower" type="select">
+      <label>Mask features by converting to lowercase</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="maskchar" size="1" type="text" value="N">
+      <label>Character to mask with</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="type" value="repeat*"/>
+      <param name="tolower" value="no"/>
+      <param name="maskchar" value="N"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_maskfeat_out.fasta"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/maskfeat.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_maskseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,80 @@
+<tool id="EMBOSS: maskseq51" name="maskseq" version="5.0.0">
+  <description>Mask off regions of a sequence</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>maskseq -sequence $input1 -outseq $out_file1 -regions "$regions" -tolower $tolower -maskchar "$maskchar" -osformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="regions" size="50" type="text" value="">
+      <label>Regions to mask (Example 1-99)</label>
+    </param>
+    <param name="tolower" type="select">
+      <label>mask by converting to lowercase</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="maskchar" size="1" type="text" value="N">
+      <label>Character to use when masking</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="regions" value="1-3"/>
+      <param name="tolower" value="no"/>
+      <param name="maskchar" value="N"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_maskseq_out.fasta"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/maskseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_matcher.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,65 @@
+<tool id="EMBOSS: matcher52" name="matcher" version="5.0.0">
+  <description>Finds the best local alignments between two sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>matcher -asequence $input1 -bsequence $input2 -outfile $out_file1 -alternatives $alternatives -gapopen $gapopen -gapextend $gapextend -aformat3 $out_format1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence 1</label>
+    </param>
+    <param format="data" name="input2" type="data">
+      <label>Sequence 2</label>
+    </param>
+    <param name="alternatives" size="4" type="text" value="1">
+      <label>Number of alternative matches</label>
+    </param>
+    <param name="gapopen" size="4" type="text" value="16">
+      <label>Gap penalty</label>
+    </param>
+    <param name="gapextend" size="4" type="text" value="4">
+      <label>Gap length (extension) penalty</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Alignment File Format</label>
+      <option value="markx0">Markx0 (p)</option>
+      <option value="simple">Simple (m)</option>
+      <option value="fasta">FASTA (m)</option>
+      <option value="msf">MSF (m)</option>
+      <option value="srs">SRS (m)</option>
+      <option value="pair">Pair (p)</option>
+      <option value="markx1">Markx1 (p)</option>
+      <option value="markx2">Markx2 (p)</option>
+      <option value="markx3">Markx3 (p)</option>
+      <option value="markx10">Markx10 (p)</option>
+      <option value="srspair">SRS pair (p)</option>
+      <option value="score">Score (p)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="markx0" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="input2" value="1.fasta"/>
+      <param name="alternatives" value="1"/>
+      <param name="gapopen" value="16"/>
+      <param name="gapextend" value="4"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_matcher_out.fasta"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/matcher.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_megamerger.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,71 @@
+<tool id="EMBOSS: megamerger53" name="megamerger" version="5.0.0">
+  <description>Merge two large overlapping nucleic acid sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>megamerger -asequence $input1 -bsequence $input2 -outseq $out_file1 -outfile $out_file2 -wordsize $wordsize -prefer $prefer -osformat3 $out_format1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence 1</label>
+    </param>
+    <param format="data" name="input2" type="data">
+      <label>Sequence 2</label>
+    </param>
+    <param name="wordsize" size="4" type="text" value="20">
+      <label>Word size</label>
+    </param>
+    <param name="prefer" type="select">
+      <label>Prefer first sequence when mismatches occur</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+    <data format="txt" name="out_file2" />
+  </outputs>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/megamerger.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_merger.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,84 @@
+<tool id="EMBOSS: merger54" name="merger" version="5.0.0">
+  <description>Merge two overlapping nucleic acid sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>merger -asequence $input1 -bsequence $input2 -outseq $out_file1 -outfile $out_file2 -gapopen $gapopen -gapextend $gapextend -osformat4 $out_format1 -aformat3 $out_format2 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence 1</label>
+    </param>
+    <param format="data" name="input2" type="data">
+      <label>Sequence 2</label>
+    </param>
+    <param name="gapopen" size="4" type="text" value="50.0">
+      <label>Gap opening penalty</label>
+    </param>
+    <param name="gapextend" size="4" type="text" value="5.0">
+      <label>Gap extension penalty</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+    <param name="out_format2" type="select">
+      <label>Output Alignment File Format</label>
+      <option value="simple">Simple (m)</option>
+      <option value="fasta">FASTA (m)</option>
+      <option value="msf">MSF (m)</option>
+      <option value="srs">SRS (m)</option>
+      <option value="pair">Pair (p)</option>
+      <option value="markx0">Markx0 (p)</option>
+      <option value="markx1">Markx1 (p)</option>
+      <option value="markx2">Markx2 (p)</option>
+      <option value="markx3">Markx3 (p)</option>
+      <option value="markx10">Markx10 (p)</option>
+      <option value="srspair">SRS pair (p)</option>
+      <option value="score">Score (p)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+    <data format="simple" name="out_file2" />
+  </outputs>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/merger.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_msbar.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,125 @@
+<tool id="EMBOSS: msbar55" name="msbar" version="5.0.0">
+  <description>Mutate sequence beyond all recognition</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>msbar -sequence $input1 -outseq $out_file1 -count $count -point $point -block $block -codon $codon -inframe $inframe -minimum $minimum -maximum $maximum -osformat2 $out_format1
+  -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequence 1</label>
+    </param>
+    <param name="count" size="4" type="text" value="1">
+      <label>Number of times to perform the mutation operations</label>
+    </param>
+    <param name="point" type="select">
+      <label>Types of point mutations to perform</label>
+      <option value="0">None</option>
+      <option value="1">Any of the following</option>
+      <option value="2">Insertions</option>
+      <option value="3">Deletions</option>
+      <option value="4">Changes</option>
+      <option value="5">Duplications</option>
+      <option value="6">Moves</option>
+    </param>
+    <param name="block" type="select">
+      <label>Types of block mutations to perform</label>
+      <option value="0">None</option>
+      <option value="1">Any of the following</option>
+      <option value="2">Insertions</option>
+      <option value="3">Deletions</option>
+      <option value="4">Changes</option>
+      <option value="5">Duplications</option>
+      <option value="6">Moves</option>
+    </param>
+    <param name="codon" type="select">
+      <label>Types of codon mutations to perform. These are only done if the sequence is nucleic</label>
+      <option value="0">None</option>
+      <option value="1">Any of the following</option>
+      <option value="2">Insertions</option>
+      <option value="3">Deletions</option>
+      <option value="4">Changes</option>
+      <option value="5">Duplications</option>
+      <option value="6">Moves</option>
+    </param>
+    <param name="inframe" type="select">
+      <label>Do 'codon' and 'block' operations in frame</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="minimum" size="4" type="text" value="1">
+      <label>Minimum size for a block mutation</label>
+    </param>
+    <param name="maximum" size="4" type="text" value="10">
+      <label>Maximum size for a block mutation</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="count" value="1"/>
+      <param name="point" value="0"/>
+      <param name="block" value="0"/>
+      <param name="codon" value="0"/>
+      <param name="inframe" value="no"/>
+      <param name="minimum" value="1"/>
+      <param name="maximum" value="10"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_msbar_out.fasta"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/msbar.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_multiple_outputfile_wrapper.pl	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,19 @@
+#! /usr/bin/perl -w
+use strict;
+
+my $cmd_string = join (" ",@ARGV);
+my $results = `$cmd_string`;
+my @files = split("\n",$results);
+foreach my $thisLine (@files)
+{
+	if ($thisLine =~ /Created /)
+	{
+		$thisLine =~ /[\w|\.]+$/;
+		$thisLine =$&;
+		print "outfile: $thisLine\n";
+	}
+	else
+	{
+		print $thisLine,"\n";
+	}
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_needle.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,134 @@
+<tool id="EMBOSS: needle56" name="needle" version="5.0.0">
+  <description>Needleman-Wunsch global alignment</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>needle -asequence $input1 -bsequence $input2 -outfile $out_file1 -gapopen $gapopen -gapextend $gapextend -brief $brief -aformat3 $out_format1 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequence 1</label>
+    </param>
+    <param format="fasta" name="input2" type="data">
+      <label>Sequence 2</label>
+    </param>
+    <param name="gapopen" size="4" type="text" value="10.0">
+      <label>Gap open penalty</label>
+    </param>
+    <param name="gapextend" size="4" type="text" value="0.5">
+      <label>Gap extension penalty</label>
+    </param>
+    <param name="brief" type="select">
+      <label>Brief identity and similarity</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Alignment File Format</label>
+      <option value="srspair">SRS pair (p)</option>
+      <option value="simple">Simple (m)</option>
+      <option value="fasta">FASTA (m)</option>
+      <option value="msf">MSF (m)</option>
+      <option value="srs">SRS (m)</option>
+      <option value="pair">Pair (p)</option>
+      <option value="markx0">Markx0 (p)</option>
+      <option value="markx1">Markx1 (p)</option>
+      <option value="markx2">Markx2 (p)</option>
+      <option value="markx3">Markx3 (p)</option>
+      <option value="markx10">Markx10 (p)</option>
+      <option value="score">Score (p)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="needle" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="input2" value="1.fasta"/>
+      <param name="gapopen" value="10"/>
+      <param name="gapextend" value="0.5"/>
+      <param name="brief" value="yes"/>
+      <param name="out_format1" value="score"/>
+      <output name="out_file1" file="emboss_needle_out.score"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+
+.. class:: warningmark
+
+needle reads any two sequences of the same type (DNA or protein).
+
+-----
+
+**Syntax**
+
+This tool uses the Needleman-Wunsch global alignment algorithm to find the optimum alignment (including gaps) of two sequences when considering their entire length.
+
+- **Optimal alignment:** Dynamic programming methods ensure the optimal global alignment by exploring all possible alignments and choosing the best.
+
+- **The Needleman-Wunsch algorithm** is a member of the class of algorithms that can calculate the best score and alignment in the order of mn steps, (where 'n' and 'm' are the lengths of the two sequences).
+
+- **Gap open penalty:** [10.0 for any sequence] The gap open penalty is the score taken away when a gap is created. The best value depends on the choice of comparison matrix. The default value assumes you are using the EBLOSUM62 matrix for protein sequences, and the EDNAFULL matrix for nucleotide sequences. (Floating point number from 1.0 to 100.0)
+
+- **Gap extension penalty:** [0.5 for any sequence] The gap extension, penalty is added to the standard gap penalty for each base or residue in the gap. This is how long gaps are penalized. Usually you will expect a few long gaps rather than many short gaps, so the gap extension penalty should be lower than the gap penalty. An exception is where one or both sequences are single reads with possible sequencing errors in which case you would expect many single base gaps. You can get this result by setting the gap open penalty to zero (or very low) and using the gap extension penalty to control gap scoring. (Floating point number from 0.0 to 10.0)
+
+You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/needle.html
+
+-----
+
+**Example**
+
+- Input File::
+
+    >hg18_dna range=chrX:151073054-151073136 5'pad=0 3'pad=0 revComp=FALSE strand=? repeatMasking=none
+    TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA
+    GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG
+
+- If both Sequence1 and Sequence2 take the above file as input, Gap open penalty equals 10.0, Gap extension penalty equals 0.5, Brief identity and similarity is set to Yes, Output Alignment File Format is set to SRS pairs, the output file is::
+
+    ########################################
+    # Program: needle
+    # Rundate: Mon Apr 02 2007 14:23:16
+    # Align_format: srspair
+    # Report_file: ./database/files/dataset_7.dat
+    ########################################
+
+    #=======================================
+    #
+    # Aligned_sequences: 2
+    # 1: hg18_dna
+    # 2: hg18_dna
+    # Matrix: EDNAFULL
+    # Gap_penalty: 10.0
+    # Extend_penalty: 0.5
+    #
+    # Length: 83
+    # Identity:      83/83 (100.0%)
+    # Similarity:    83/83 (100.0%)
+    # Gaps:           0/83 ( 0.0%)
+    # Score: 415.0
+    #
+    #=======================================
+
+    hg18_dna           1 TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA     50
+                       ||||||||||||||||||||||||||||||||||||||||||||||||||
+    hg18_dna           1 TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA     50
+
+    hg18_dna          51 GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG     83
+                       |||||||||||||||||||||||||||||||||
+    hg18_dna          51 GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG     83
+
+    #---------------------------------------
+    #---------------------------------------
+
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_newcpgreport.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,52 @@
+<tool id="EMBOSS: newcpgreport57" name="newcpgreport" version="5.0.0">
+  <description>Report CpG rich areas</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>newcpgreport -sequence $input1 -window $window -shift $shift -minlen $minlen -minpc $minpc -outfile $out_file1 -minoe $minoe -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="window" size="4" type="text" value="100">
+      <label>Window Size</label>
+    </param>
+    <param name="shift" size="4" type="text" value="1">
+      <label>Step size (shift)</label>
+    </param>
+    <param name="minlen" size="4" type="text" value="200">
+      <label>Minimum length</label>
+    </param>
+    <param name="minoe" size="4" type="text" value="0.6">
+      <label>Minimum average observed to expected ratio</label>
+    </param>
+    <param name="minpc" size="4" type="text" value="50.0">
+      <label>Minimum average percentage of G plus C</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="newcpgreport" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="window" value="100"/>
+      <param name="shift" value="1"/>
+      <param name="minlen" value="200"/>
+      <param name="minoe" value="0.6"/>
+      <param name="minpc" value="50.0"/>
+      <output name="out_file1" file="emboss_newcpgreport_out.newcpgreport"/>
+    </test>
+  </tests>
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/newcpgreport.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_newcpgseek.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,43 @@
+<tool id="EMBOSS: newcpgseek58" name="newcpgseek" version="5.0.0">
+  <description>Reports CpG rich region</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>newcpgseek -sequence $input1 -outfile $out_file1 -score $score -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="score" size="4" type="text" value="17">
+      <label>CpG score</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="newcpgseek" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="score" value="17"/>
+      <output name="out_file1" file="emboss_newcpgseek_out.newcpgseek"/>
+    </test>
+  </tests>
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/newcpgseek.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_newseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,80 @@
+<tool id="EMBOSS: newseq59" name="newseq" version="5.0.0">
+  <description>Type in a short new sequence</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>newseq -outseq $out_file1 -name "$seqname" -description "$description" -type $type -sequence "$sequence" -osformat5 $out_format1 -auto</command>
+  <inputs>
+    <param name="seqname" size="10" type="text" value="">
+      <label>Name of of the sequence</label>
+    </param>
+    <param name="description" size="10" type="text" value="">
+      <label>Description of the sequence</label>
+    </param>
+    <param name="type" type="select">
+      <label>Type of sequence</label>
+      <option value="N">Nucleic</option>
+      <option value="P">Protein</option>
+    </param>
+    <param name="sequence" size="50" type="text" value="">
+      <label>The sequence itself</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="seqname" value="cytoc"/>
+      <param name="description" value="fragment of cytochrome c"/>
+      <param name="type" value="N"/>
+      <param name="sequence" value="KKKEERADLIAY"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_newseq_out.fasta"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/newseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_noreturn.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,39 @@
+<tool id="EMBOSS: noreturn60" name="noreturn" version="5.0.0">
+  <description>Removes carriage return from ASCII files</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>noreturn -infile $input1 -outfile $out_file1 -system $system -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>On query</label>
+    </param>
+    <param name="system" type="select">
+      <label>Target operating system for end-of-line format</label>
+      <option value="unix">Unix/Linux systems</option>
+      <option value="pc">Windows/DOS</option>
+      <option value="mac">Apple Macintosh</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="noreturn" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="system" value="unix"/>
+      <output name="out_file1" file="emboss_noreturn_out.noreturn"/>
+    </test>
+  </tests>
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/noreturn.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_notseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,77 @@
+<tool id="EMBOSS: notseq61" name="notseq" version="5.0.0">
+  <description>Exclude a set of sequences and write out the remaining ones</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>notseq -sequence $input1 -outseq $out_file1 -exclude "$exclude" -osformat3 $out_format1 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>On query</label>
+    </param>
+    <param name="exclude" size="50" type="text" value="">
+      <label>Exclude list</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="exclude" value="AA"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_notseq_out.fasta"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/notseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_nthseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,77 @@
+<tool id="EMBOSS: nthseq62" name="nthseq" version="5.0.0">
+  <description>Writes one sequence from a multiple set of sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>nthseq -sequence $input1 -outseq $out_file1 -number $number -osformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="number" size="4" type="text" value="1">
+      <label>Number of the sequence to output</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="number" value="1"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_nthseq_out.fasta"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/nthseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_octanol.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,46 @@
+<tool id="EMBOSS: octanol63" name="octanol" version="5.0.0">
+  <!-- graphics output with filename, no functional tests added -->
+  <description>Displays protein hydropathy</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command interpreter="perl">emboss_single_outputfile_wrapper.pl octanol -sequence $input1 -graph png -goutfile $out_file1 -width $width -octanolplot $octanolplot -interfaceplot $interfaceplot
+  -differenceplot $differenceplot -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="width" size="4" type="text" value="19">
+      <label>Window size</label>
+    </param>
+    <param name="octanolplot" type="select">
+      <label>Display the octanol plot</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="interfaceplot" type="select">
+      <label>Display the interface plot</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="differenceplot" type="select">
+      <label>Display the difference plot</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="png" name="out_file1" />
+  </outputs>
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/octanol.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_oddcomp.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,48 @@
+<tool id="EMBOSS: oddcomp64" name="oddcomp" version="5.0.0">
+  <!-- output contains file location info, commented out functional tests -->
+  <description>Find protein sequence regions with a biased composition</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>oddcomp -sequence $input1 -infile $input2 -outfile $out_file1 -window $window -ignorebz $ignorebz -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param format="data" name="input2" type="data">
+      <label>This is a file in the format of the output produced by 'compseq' that is used to set the minimum frequencies of words in this analysis</label>
+    </param>
+    <param name="window" size="4" type="text" value="30">
+      <label>This is the size of window in which to count. Thus if you want to count frequencies in a 40 aa stretch you should enter 40 here</label>
+    </param>
+    <param name="ignorebz" type="select">
+      <label>The amino acid code B represents Asparagine or Aspartic acid and the code Z represents Glutamine or Glutamic acid. These are not commonly used codes and you may wish not to count words
+      containing them, just noting them in the count of 'Other' words</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="oddcomp" name="out_file1" />
+  </outputs>
+<!--    <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="input2" value="emboss_compseq_out.compseq"/>
+      <param name="window" value="30"/>
+      <param name="ignorebz" value="yes"/>
+      <output name="out_file1" file="emboss_oddcomp_out.oddcomp"/>
+    </test>
+  </tests> -->
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/oddcomp.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_palindrome.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,61 @@
+<tool id="EMBOSS: palindrome65" name="palindrome" version="5.0.0">
+  <description>Looks for inverted repeats in a nucleotide sequence</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>palindrome -sequence $input1 -outfile $out_file1 -minpallen $minpallen -maxpallen $maxpallen -gaplimit $gaplimit -nummismatches $nummismatches -overlap $overlap -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="minpallen" size="4" type="text" value="10">
+      <label>Minimum length of palindrome</label>
+    </param>
+    <param name="maxpallen" size="4" type="text" value="100">
+      <label>Maximum length of palindrome</label>
+    </param>
+    <param name="gaplimit" size="4" type="text" value="100">
+      <label>Maximum gap between repeated regions</label>
+    </param>
+    <param name="nummismatches" size="4" type="text" value="0">
+      <label>Number of mismatches allowed</label>
+    </param>
+    <param name="overlap" type="select">
+      <label>Report overlapping matches</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="palindrome" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="minpallen" value="10"/>
+      <param name="maxpallen" value="100"/>
+      <param name="gaplimit" value="100"/>
+      <param name="nummismatches" value="0"/>
+      <param name="overlap" value="yes"/>
+      <output name="out_file1" file="emboss_palindrome_out.palindrome"/>
+    </test>
+  </tests>
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/palindrome.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_pasteseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,81 @@
+<tool id="EMBOSS: pasteseq66" name="pasteseq" version="5.0.0">
+  <description>Insert one sequence into another</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>pasteseq -asequence $input2 -bsequence $input1 -outseq $out_file1 -pos $pos -osformat3 $out_format1 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Main sequence</label>
+    </param>
+    <param format="fasta" name="input2" type="data">
+      <label>Sequence to insert</label>
+    </param>
+    <param name="pos" size="4" type="text" value="0">
+      <label>Position to insert after</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="1.fasta"/>
+      <param name="input2" value="2.fasta"/>
+      <param name="pos" value="0"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_pasteseq_out.fasta"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+
+.. class:: warningmark
+
+The input datasets need to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/pasteseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_patmatdb.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,57 @@
+<tool id="EMBOSS: patmatdb67" name="patmatdb" version="5.0.0">
+  <description>Search a protein sequence with a motif</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>patmatdb -sequence $input1 -outfile $out_file1 -motif "$motif" -rformat3 $out_format1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Main sequence</label>
+    </param>
+    <param name="motif" size="4" type="text" value="">
+      <label>Motif to search for</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Report File Format</label>
+      <option value="dbmotif">DbMotif</option>
+      <option value="embl">EMBL</option>
+      <option value="genbank">GENBANK</option>
+      <option value="gff">GFF</option>
+      <option value="pir">PIR</option>
+      <option value="swiss">SwissProt</option>
+      <option value="diffseq">Diffseq</option>
+      <option value="excel">Excel (tab delimited)</option>
+      <option value="feattable">FeatTable</option>
+      <option value="motif">Motif</option>
+      <option value="regions">Regions</option>
+      <option value="seqtable">SeqTable</option>
+      <option value="simple">SRS Simple</option>
+      <option value="srs">SRS</option>
+      <option value="table">Table</option>
+      <option value="tagseq">TagSeq</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="dbmotif" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="motif" value="aa"/>
+      <param name="out_format1" value="excel"/>
+      <output name="out_file1" file="emboss_patmatdb_out.tabular"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/patmatdb.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_pepcoil.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,54 @@
+<tool id="EMBOSS: pepcoil68" name="pepcoil" version="5.0.0">
+  <description>Predicts coiled coil regions</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>pepcoil -sequence $input1 -outfile $out_file1 -window $window -coil $coil -frame $frame -other $other -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="window" size="4" type="text" value="28">
+      <label>Window size</label>
+    </param>
+    <param name="coil" type="select">
+      <label>Report coiled coil regions</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="frame" type="select">
+      <label>Show coil frameshifts</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="other" type="select">
+      <label>Report non coiled coil regions</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="pepcoil" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="window" value="28"/>
+      <param name="coil" value="yes"/>
+      <param name="frame" value="yes"/>
+      <param name="other" value="yes"/>
+      <output name="out_file1" file="emboss_pepcoil_out.pepcoil"/>
+    </test>
+  </tests>
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/pepcoil.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_pepinfo.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,36 @@
+<tool id="EMBOSS: pepinfo69" name="pepinfo" version="5.0.0">
+  <!-- puts file info in output files -->
+  <description>Plots simple amino acid properties in parallel</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command interpreter="perl">emboss_single_outputfile_wrapper.pl pepinfo -sequence $input1 -outfile $out_file1 -goutfile $out_file2 -graph png -hwindow $hwindow $plot_type -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="hwindow" size="4" type="text" value="9">
+      <label>Window size for hydropathy averaging</label>
+    </param>
+    <param name="plot_type" type="select">
+      <label>Choose a plot type</label>
+      <option value="-generalplot yes -hydropathyplot no">Histogram of general properties</option>
+      <option value="-generalplot no -hydropathyplot yes">Graphs of hydropathy</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="pepinfo" name="out_file1" />
+    <data format="png" name="out_file2" />
+  </outputs>
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/pepinfo.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_pepnet.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,41 @@
+<tool id="EMBOSS: pepnet70" name="pepnet" version="5.0.0">
+  <!-- graphical output file with path information -->
+  <description>Displays proteins as a helical net</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>pepnet -sequence $input1 -graph png -goutfile $out_file1 -squares $squares -diamonds $diamonds -octags $octags -amphipathic $amphipathic -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="squares" size="10" type="text" value="ILVM">
+      <label>Residues to mark with squares</label>
+    </param>
+    <param name="diamonds" size="10" type="text" value="DENQST">
+      <label>Residues to mark with diamonds</label>
+    </param>
+    <param name="octags" size="10" type="text" value="HKR ">
+      <label>Residues to mark with octagons</label>
+    </param>
+    <param name="amphipathic" type="select">
+      <label>If this is true then the residues ACFGILMVWY are marked as squares and all other residues are unmarked. This overrides any other markup that you may have specified</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="png" name="out_file1" />
+  </outputs>
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/pepnet.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_pepstats.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,38 @@
+<tool id="EMBOSS: pepstats71" name="pepstats" version="5.0.0">
+  <description>Protein statistics</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>pepstats -sequence $input1 -outfile $out_file1 -termini $termini -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="termini" type="select">
+      <label>Include charge at N and C terminus</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="pepstats" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="termini" value="yes"/>
+      <output name="out_file1" file="emboss_pepstats_out.pepstats"/>
+    </test>
+  </tests>
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/pepstats.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_pepwheel.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,53 @@
+<tool id="EMBOSS: pepwheel72" name="pepwheel" version="5.0.0">
+  <!-- produces png file -->
+  <description>Shows protein sequences as helices</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command interpreter="perl">emboss_single_outputfile_wrapper.pl pepwheel -sequence $input1 -graph png -goutfile $out_file1 -squares $squares -diamonds $diamonds -octags $octags -amphipathic
+  $amphipathic -steps $steps -turns $turns -wheel $wheel -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="steps" size="10" type="text" value="18">
+      <label>Steps, the number of residues plotted per turn is this value divided by the 'turns' value</label>
+    </param>
+    <param name="turns" size="10" type="text" value="5">
+      <label>Turns, the number of residues plotted per turn is the 'steps' value divided by this value</label>
+    </param>
+    <param name="squares" size="10" type="text" value="ILVM">
+      <label>Residues to mark with squares</label>
+    </param>
+    <param name="diamonds" size="10" type="text" value="DENQST">
+      <label>Residues to mark with diamonds</label>
+    </param>
+    <param name="octags" size="10" type="text" value="HKR">
+      <label>Residues to mark with octagons</label>
+    </param>
+    <param name="wheel" type="select">
+      <label>Plot the wheel</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="amphipathic" type="select">
+      <label>If this is true then the residues ACFGILMVWY are marked as squares and all other residues are unmarked. This overrides any other markup that you may have specified</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="png" name="out_file1" />
+  </outputs>
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/pepwheel.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_pepwindow.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,30 @@
+<tool id="EMBOSS: pepwindow73" name="pepwindow" version="5.0.0">
+  <!-- produces png file -->
+  <description>Displays protein hydropathy</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command interpreter="perl">emboss_single_outputfile_wrapper.pl pepwindow -sequence $input1 -graph png -goutfile $out_file1 -length $length -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="length" size="10" type="text" value="7">
+      <label>Window size</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="png" name="out_file1" />
+  </outputs>
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/pepwindow.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_pepwindowall.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,30 @@
+<tool id="EMBOSS: pepwindowall74" name="pepwindowall" version="5.0.0">
+  <!-- produces png file -->
+  <description>Displays protein hydropathy of a set of sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command interpreter="perl">emboss_single_outputfile_wrapper.pl pepwindowall -sequence $input1 -graph png -goutfile $out_file1 -length $length -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="length" size="10" type="text" value="7">
+      <label>Window size</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="png" name="out_file1" />
+  </outputs>
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/pepwindowall.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_plotcon.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,30 @@
+<tool id="EMBOSS: plotcon75" name="plotcon" version="5.0.0">
+  <!-- produces png file -->
+  <description>Plot quality of conservation of a sequence alignment</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command interpreter="perl">emboss_single_outputfile_wrapper.pl plotcon -sequences $input1 -graph png -goutfile $out_file1 -winsize $winsize -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="winsize" size="10" type="text" value="4">
+      <label>Number of columns to average alignment quality over</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="png" name="out_file1" />
+  </outputs>
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/plotcon.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_plotorf.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,48 @@
+<tool id="EMBOSS: plotorf76" name="plotorf" version="5.0.0">
+  <!-- produces png file output -->
+  <description>Plot potential open reading frames</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command interpreter="perl">emboss_single_outputfile_wrapper.pl plotorf -sequence $input1 -graph png -goutfile $out_file1 -start $start -stop $stop -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="start" size="15" type="text" value="ATG">
+      <label>Start codons</label>
+    </param>
+    <param name="stop" size="15" type="text" value="TAA">
+      <label>Stop codons</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="png" name="out_file1" />
+  </outputs>
+  <!--  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="start" value="ATG"/>
+      <param name="stop" value="TAA"/>
+      <output name="out_file1" file="emboss_plotorf_out.png"/>
+    </test>
+  </tests> -->
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/plotorf.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_polydot.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,56 @@
+<tool id="EMBOSS: polydot77" name="polydot" version="5.0.0">
+  <!-- produces png file, not added functional tests -->
+  <description>Displays all-against-all dotplots of a set of sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command interpreter="perl">emboss_single_outputfile_wrapper.pl polydot -sequence $input1 -graph png -goutfile $output2 -outfeat $output1 -wordsize $wordsize -boxit $boxit -dumpfeat yes -gap
+  $gap -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="wordsize" size="10" type="text" value="6">
+      <label>Word size</label>
+    </param>
+    <param name="boxit" type="select">
+      <label>Draw a box around each dotplot</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="gap" size="10" type="text" value="10">
+      <label>Size of gap</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="polydot" name="output1" />
+    <data format="png" name="output2" />
+  </outputs>
+<!--    <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="wordsize" value="6"/>
+      <param name="boxit" value="yes"/>
+      <param name="gap" value="10"/>
+      <output name="output1" file="emboss_polydot_out.png"/>
+    </test>
+  </tests>-->
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/polydot.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_preg.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,29 @@
+<tool id="EMBOSS: preg78" name="preg" version="5.0.0">
+  <description>Regular expression search of a protein sequence</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>preg -sequence $input1 -outfile $out_file1 -pattern "$pattern" -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence 1</label>
+    </param>
+    <param name="pattern" size="50" type="text" value="(ACD)">
+      <label>Regular expression pattern</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="preg" name="out_file1" />
+  </outputs>
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/preg.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_prettyplot.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,121 @@
+<tool id="EMBOSS: prettyplot79" name="prettyplot" version="5.0.0">
+  <!-- produces png output with file name -->
+  <description>Displays aligned sequences, with colouring and boxing</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>prettyplot -sequences $input1 -graph png -goutfile $out_file1 -residuesperline $residuesperline -resbreak $resbreak -ccolours $ccolours -cidentity $cidentity -csimilarity $csimilarity
+  -cother $cother -docolour $docolour -gtitle $title -pair $pair -identity $identity -box $box -boxcol $boxcol -boxcolval $boxcolval -name $name -maxnamelen $maxnamelen -number $number -listoptions
+  $listoptions -consensus $consensus -collision $collision -alternative $alternative -showscore $showscore -portrait $portrait -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="residuesperline" size="10" type="text" value="50">
+      <label>The number of residues to be displayed on each line</label>
+    </param>
+    <param name="resbreak" size="10" type="text" value="50">
+      <label>Residues before a space</label>
+    </param>
+    <param name="ccolours" type="select">
+      <label>Colour residues by their consensus value</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="cidentity" size="10" type="text" value="RED">
+      <label>Colour to display identical residues</label>
+    </param>
+    <param name="csimilarity" size="10" type="text" value="GREEN">
+      <label>Colour to display similar residues</label>
+    </param>
+    <param name="cother" size="10" type="text" value="BLACK">
+      <label>Colour to display other residues</label>
+    </param>
+    <param name="docolour" type="select">
+      <label>Colour residues by table oily, amide etc.</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="title" type="select">
+      <label>Display the title</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="pair" size="10" type="text" value="1.5,1.0,0.5">
+      <label>Values to represent identical similar related</label>
+    </param>
+    <param name="identity" size="10" type="text" value="0">
+      <label>Only match those which are identical in all sequences</label>
+    </param>
+    <param name="box" type="select">
+      <label>Display prettyboxes</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="boxcol" type="select">
+      <label>Colour the background in the boxes</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="boxcolval" size="10" type="text" value="GREY">
+      <label>Colour to be used for background</label>
+    </param>
+    <param name="name" type="select">
+      <label>Display the sequence names</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="maxnamelen" size="10" type="text" value="10">
+      <label>Margin size for the sequence name</label>
+    </param>
+    <param name="number" type="select">
+      <label>Display the residue number</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="listoptions" type="select">
+      <label>Display the date and options used</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="consensus" type="select">
+      <label>Display the consensus</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="collision" type="select">
+      <label>Allow collisions in calculating consensus</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="alternative" type="select">
+      <label>Use alternative collisions routine</label>
+      <option value="0">Normal collision check</option>
+      <option value="1">Checks identical scores with the max score found. So if any other residue matches the identical score then a collision has occurred</option>
+      <option value="2">If another residue has a greater than or equal to matching score and these do not match then a collision has occurred</option>
+      <option value="3">Checks all those not in the current consensus.If any of these give a top score for matching or identical scores then a collision has occured</option>
+    </param>
+    <param name="showscore" size="10" type="text" value="-1">
+      <label>Print residue scores</label>
+    </param>
+    <param name="portrait" type="select">
+      <label>Set page to Portrait</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="png" name="out_file1" />
+  </outputs>
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/prettyplot.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_prettyseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,61 @@
+<tool id="EMBOSS: prettyseq80" name="prettyseq" version="5.0.0">
+  <description>Output sequence with translated ranges</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>prettyseq -sequence $input1 -outfile $out_file1 -ruler $ruler -plabel $plabel -nlabel $nlabel -width $width -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="ruler" type="select">
+      <label>Add a ruler</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="plabel" type="select">
+      <label>Number translations</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="nlabel" type="select">
+      <label>Number DNA sequence</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="width" size="4" type="text" value="60">
+      <label>Width of screen</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="prettyseq" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="ruler" value="yes"/>
+      <param name="plabel" value="yes"/>
+      <param name="nlabel" value="yes"/>
+      <param name="width" value="60"/>
+      <output name="out_file1" file="emboss_prettyseq_out.prettyseq"/>
+    </test>
+  </tests>
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/prettyseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_primersearch.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,41 @@
+<tool id="EMBOSS: primersearch81" name="primersearch" version="5.0.0">
+  <description>Searches DNA sequences for matches with primer pairs</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>primersearch -seqall $input1 -infile $input2 -outfile $out_file1 -mismatchpercent $mismatchpercent -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Main sequences</label>
+    </param>
+    <param format="data" name="input2" type="data">
+      <label>Primer file</label>
+    </param>
+    <param name="mismatchpercent" size="4" type="text" value="0">
+      <label>Allowed percent mismatch</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="primersearch" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="input2" value="emboss_primersearch.fasta"/>
+      <param name="mismatchpercent" value="0"/>
+      <output name="out_file1" file="emboss_primersearch_out.primersearch"/>
+    </test>
+  </tests>
+  <help>
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/primersearch.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_revseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,85 @@
+<tool id="EMBOSS: revseq82" name="revseq" version="5.0.0">
+  <description>Reverse and complement a sequence</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>revseq -sequence $input1 -outseq $out_file1 -reverse $reverse -complement $complement -osformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="reverse" type="select">
+      <label>Reverse the sequence</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="complement" type="select">
+      <label>Complement the sequence</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="reverse" value="yes"/>
+      <param name="complement" value="yes"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_revseq_out.fasta"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/revseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_seqmatchall.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,62 @@
+<tool id="EMBOSS: seqmatchall83" name="seqmatchall" version="5.0.0">
+  <description>All-against-all comparison of a set of sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>seqmatchall -sequence $input1 -outfile $out_file1 -wordsize $wordsize -aformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="wordsize" size="4" type="text" value="4">
+      <label>Word size</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Alignment File Format</label>
+      <option value="match">Match (m)</option>
+      <option value="simple">Simple (m)</option>
+      <option value="fasta">FASTA (m)</option>
+      <option value="msf">MSF (m)</option>
+      <option value="srs">SRS (m)</option>
+      <option value="pair">Pair (p)</option>
+      <option value="markx0">Markx0 (p)</option>
+      <option value="markx1">Markx1 (p)</option>
+      <option value="markx2">Markx2 (p)</option>
+      <option value="markx3">Markx3 (p)</option>
+      <option value="markx10">Markx10 (p)</option>
+      <option value="srspair">SRS pair (p)</option>
+      <option value="score">Score (p)</option>
+      <option value="seqmatchall">Seqmatchall Output File</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="seqmatchall" name="out_file1" />.
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="wordsize" value="2"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_seqmatchall_out.fasta"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/seqmatchall.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_seqret.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,78 @@
+<tool id="EMBOSS: seqret84" name="seqret" version="5.0.0">
+  <description>Reads and writes sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>seqret -sequence $input1 -outseq $out_file1 -feature $feature -firstonly $firstonly -osformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="feature" type="select">
+      <label>Use feature information</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="firstonly" type="select">
+      <label>Read one sequence and stop</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="feature" value="no"/>
+      <param name="firstonly" value="no"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_seqret_out.fasta"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/seqret.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_showfeat.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,131 @@
+<tool id="EMBOSS: showfeat85" name="showfeat" version="5.0.0">
+  <!-- tool gives memory errors -->
+  <description>Show features of a sequence</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>showfeat -sequence $input1 -outfile $out_file1 -matchsource "$matchsource" -matchtype "$matchtype" -matchtag "$matchtag" -matchvalue "$matchvalue" -sort $sort -annotation "$annotation" -id
+  $id -description "$description" -scale "$scale" -width "$width" -collapse $collapse -forward $forward -reverse $reverse -unknown $unknown -strand $strand -source $source -position $position -type
+  $type -tags $tags -values $values -stricttags $stricttags -html $html_out1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="html_out1" type="select">
+      <label>Format output as an HTML table</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="matchsource" size="50" type="text" value="*">
+      <label>Feature source to match</label>
+    </param>
+    <param name="matchtype" size="50" type="text" value="*">
+      <label>Feature type to match</label>
+    </param>
+    <param name="matchtag" size="50" type="text" value="*">
+      <label>Feature tags to match</label>
+    </param>
+    <param name="matchvalue" size="50" type="text" value="*">
+      <label>Tag values to match</label>
+    </param>
+    <param name="sort" type="select">
+      <label>Sort by</label>
+      <option value="start">Start position</option>
+      <option value="source">Source</option>
+      <option value="type">Type</option>
+      <option value="nosort">No sorting done</option>
+      <option value="join">Join coding regions together</option>
+    </param>
+    <param name="annotation" size="50" type="text" value="">
+      <label>Regions to annotate by marking</label>
+    </param>
+    <param name="id" type="select">
+      <label>Display the ID name of the sequence</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="description" type="select">
+      <label>Display the description of the sequence</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="scale" type="select">
+      <label>Display the scale line</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="width" size="50" type="text" value="60">
+      <label>Screen width</label>
+    </param>
+    <param name="collapse" type="select">
+      <label>Collapse features</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="forward" type="select">
+      <label>Display forward sense features</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="reverse" type="select">
+      <label>Display reverse sense features</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="unknown" type="select">
+      <label>Display unknown sense features</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="strand" type="select">
+      <label>Display the strand of the features</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="source" type="select">
+      <label>Display the source of the features</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="position" type="select">
+      <label>SDisplay the start and end position of the features</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="type" type="select">
+      <label>Display the type of the features</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="tags" type="select">
+      <label>Display the tags and values of the features</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="values" type="select">
+      <label>Display the tag values of the features</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="stricttags" type="select">
+      <label>Display only those tag/value pairs in a feature that match the specified tag and value</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="showfeat" name="out_file1" />
+  </outputs>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/showfeat.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_shuffleseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,70 @@
+<tool id="EMBOSS: shuffleseq87" name="shuffleseq" version="5.0.0">
+  <!-- produces random outputs each time -->
+  <description>Shuffles a set of sequences maintaining composition</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>shuffleseq -sequence $input1 -outseq $out_file1 -shuffle "$shuffle" -osformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="shuffle" size="4" type="text" value="1">
+      <label>Number of shuffles</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+  </outputs>
+  <code file="emboss_format_corrector.py" />
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/shuffleseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_sigcleave.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,63 @@
+<tool id="EMBOSS: sigcleave88" name="sigcleave" version="5.0.0">
+  <description>Reports protein signal cleavage sites</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>sigcleave -sequence $input1 -outfile $out_file1 -minweight "$minweight" -prokaryote $prokaryote -rformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="minweight" size="4" type="text" value="3.5">
+      <label>Minimum scoring weight value for the predicted cleavage site</label>
+    </param>
+    <param name="prokaryote" type="select">
+      <label>Specifies the sequence is prokaryotic and changes the default scoring data file</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Report File Format</label>
+      <option value="motif">Motif</option>
+      <option value="embl">EMBL</option>
+      <option value="genbank">GENBANK</option>
+      <option value="gff">GFF</option>
+      <option value="pir">PIR</option>
+      <option value="swiss">SwissProt</option>
+      <option value="dbmotif">DbMotif</option>
+      <option value="diffseq">Diffseq</option>
+      <option value="excel">Excel (tab delimited)</option>
+      <option value="feattable">FeatTable</option>
+      <option value="regions">Regions</option>
+      <option value="seqtable">SeqTable</option>
+      <option value="simple">SRS Simple</option>
+      <option value="srs">SRS</option>
+      <option value="table">Table</option>
+      <option value="tagseq">TagSeq</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="motif" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="minweight" value="3.5"/>
+      <param name="prokaryote" value="no"/>
+      <param name="out_format1" value="excel"/>
+      <output name="out_file1" file="emboss_sigcleave_out.tabular"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/sigcleave.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_single_outputfile_wrapper.pl	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,27 @@
+#! /usr/bin/perl -w
+use strict;
+use File::Copy;
+
+my $cmd_string = join (" ",@ARGV);
+my $results = `$cmd_string`;
+my @files = split("\n",$results);
+my $fileNameOut = $ARGV[6];
+my ($drive, $outputDir, $file) = File::Spec->splitpath( $fileNameOut );
+my $destination = $fileNameOut;
+
+foreach my $thisLine (@files)
+{
+	if ($thisLine =~ /Created /)
+	{
+		$thisLine =~ /[\w|\.]+$/;
+		$thisLine =$&;
+		#print "outfile: $thisLine\n";
+		#there is only one file to move, so we can quit after finding it
+		move($drive.$outputDir.$thisLine,$fileNameOut);
+		exit(1);
+	}
+	else
+	{
+		print $thisLine,"\n";
+	}
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_sirna.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,126 @@
+<tool id="EMBOSS: sirna89" name="sirna" version="5.0.0">
+  <description>Finds siRNA duplexes in mRNA</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>sirna -sequence $input1 -outfile $ofile1 -outseq $ofile2 -poliii $poliii -aa $aa -tt $tt -polybase $polybase -context $context -rformat2 $out_format1 -osformat3 $out_format2
+  -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="poliii" type="select">
+      <label>Select only the 21 base probes that start with a purine (Pol III expression vectors)</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="aa" type="select">
+      <label>Select only those 23 base regions that start with AA</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="tt" type="select">
+      <label>Select only those 23 base regions that end with TT</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="polybase" type="select">
+      <label>Report more than those 23 base regions that have no repeat of 4 or more of any bases in a row</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="context" type="select">
+      <label>Displays the whole 23 bases of the region with the first two bases in brackets</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Report File Format</label>
+      <option value="table">Table</option>
+      <option value="embl">EMBL</option>
+      <option value="genbank">GENBANK</option>
+      <option value="gff">GFF</option>
+      <option value="pir">PIR</option>
+      <option value="swiss">SwissProt</option>
+      <option value="dbmotif">DbMotif</option>
+      <option value="diffseq">Diffseq</option>
+      <option value="excel">Excel (tab delimited)</option>
+      <option value="feattable">FeatTable</option>
+      <option value="motif">Motif</option>
+      <option value="regions">Regions</option>
+      <option value="seqtable">SeqTable</option>
+      <option value="simple">SRS Simple</option>
+      <option value="srs">SRS</option>
+      <option value="tagseq">TagSeq</option>
+    </param>
+    <param name="out_format2" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="table" name="ofile1" />
+    <data format="fasta" name="ofile2" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="poliii" value="no"/>
+      <param name="aa" value="no"/>
+      <param name="tt" value="no"/>
+      <param name="polybase" value="yes"/>
+      <param name="context" value="no"/>
+      <param name="mismatchpercent" value="0"/>
+      <param name="out_format1" value="gff"/>
+      <param name="out_format2" value="fasta"/>
+      <output name="ofile2" file="emboss_sirna_out.fasta"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/sirna.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_sixpack.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,170 @@
+<tool id="EMBOSS: sixpack90" name="sixpack" version="5.0.0">
+  <!-- tool adds file description and timestamp to output data -->
+  <description>Display a DNA sequence with 6-frame translation and ORFs</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>sixpack -sequence $input1 -outfile $ofile1 -outseq $ofile2 -table $table -firstorf $firstorf -lastorf $lastorf -mstart $mstart -reverse $reverse -orfminsize $orfminsize -uppercase
+  "$uppercase" -number $number -width "$width" -length "$length" -margin "$margin" -name $disp_name -description $description -offset "$offset" -html $html_out1 -osformat $out_format2 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="table" type="select">
+      <label>Code to use</label>
+      <option value="0">Standard</option>
+      <option value="1">Standard (with alternative initiation codons)</option>
+      <option value="2">Vertebrate Mitochondrial</option>
+      <option value="3">Yeast Mitochondrial</option>
+      <option value="4">Mold, Protozoan, Coelenterate Mitochondrial and Mycoplasma/Spiroplasma</option>
+      <option value="5">Invertebrate Mitochondrial</option>
+      <option value="6">Ciliate Macronuclear and Dasycladacean</option>
+      <option value="9">Echinoderm Mitochondrial</option>
+      <option value="10">Euplotid Nuclear</option>
+      <option value="11">Bacterial</option>
+      <option value="12">Alternative Yeast Nuclear</option>
+      <option value="13">Ascidian Mitochondrial</option>
+      <option value="14">Flatworm Mitochondrial</option>
+      <option value="15">Blepharisma Macronuclear</option>
+      <option value="16">Chlorophycean Mitochondrial</option>
+      <option value="21">Trematode Mitochondrial</option>
+      <option value="22">Scenedesmus obliquus</option>
+      <option value="23">Thraustochytrium Mitochondrial</option>
+    </param>
+    <param name="firstorf" type="select">
+      <label>Count the beginning of a sequence as a possible ORF</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="lastorf" type="select">
+      <label>Count the end of a sequence as a possible ORF</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="mstart" type="select">
+      <label>Displays only ORFs starting with an M</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="reverse" type="select">
+      <label>Display the translation of the DNA sequence in the 3 reverse frames</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="orfminsize" size="4" type="text" value="1">
+      <label>Minimum size of Open Reading Frames (ORFs) to display in the translations</label>
+    </param>
+    <param name="uppercase" size="50" type="text" value="">
+      <label>Regions to put in uppercase</label>
+    </param>
+    <param name="number" type="select">
+      <label>Number the sequence at the beginning and the end of each line</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="width" size="4" type="text" value="60">
+      <label>Number of nucleotides displayed on each line</label>
+    </param>
+    <param name="length" size="4" type="text" value="0">
+      <label>Line length of page</label>
+    </param>
+    <param name="margin" size="4" type="text" value="10">
+      <label>Margin around sequence for numbering</label>
+    </param>
+    <param name="disp_name" type="select">
+      <label>Display the ID name of the sequence</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="description" type="select">
+      <label>Display the description of the sequence</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="offset" size="4" type="text" value="1">
+      <label>Number from which you want the DNA sequence to be numbered</label>
+    </param>
+    <param name="html_out1" type="select">
+      <label>Format output as an HTML table</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="out_format2" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="sixpack" name="ofile1" />
+    <data format="fasta" name="ofile2" />
+  </outputs>
+<!--    <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="table" value="0"/>
+      <param name="firstorf" value="no"/>
+      <param name="lastorf" value="no"/>
+      <param name="mstart" value="no"/>
+      <param name="reverse" value="no"/>
+      <param name="orfminsize" value="1"/>
+      <param name="uppercase" value=""/>
+      <param name="number" value="no"/>
+      <param name="width" value="60"/>
+      <param name="length" value="0"/>
+      <param name="margin" value="10"/>
+      <param name="disp_name" value="no"/>
+      <param name="description" value="no"/>
+      <param name="offset" value="1"/>
+      <param name="html_out1" value="no"/>
+      <param name="out_format2" value="fasta"/>
+      <output name="ofile2" file="emboss_sixpack_out.fasta"/>
+    </test>
+  </tests> -->
+  <code file="emboss_format_corrector.py" />
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/sixpack.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_skipseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,67 @@
+<tool id="EMBOSS: skipseq91" name="skipseq" version="5.0.0">
+  <description>Reads and writes sequences, skipping first few</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>skipseq -sequence $input1 -outseq $out_file1 -skip "$skip" -feature $feature -osformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="skip" size="4" type="text" value="0">
+      <label>Number of sequences to skip at start</label>
+    </param>
+    <param name="feature" type="select">
+      <label>Use feature information</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+  </outputs>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/skipseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_splitter.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,87 @@
+<tool id="EMBOSS: splitter92" name="splitter" version="5.0.0">
+  <description>Split a sequence into (overlapping) smaller sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>splitter -sequence $input1 -outseq $out_file1 -size "$size" -overlap "$overlap" -addoverlap $addoverlap -osformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="size" size="10" type="text" value="10000">
+      <label>Size to split at</label>
+    </param>
+    <param name="overlap" size="4" type="text" value="0">
+      <label>Overlap between split sequences</label>
+    </param>
+    <param name="addoverlap" type="select">
+      <label>Add overlap to size</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="size" value="10000"/>
+      <param name="overlap" value="0"/>
+      <param name="addoverlap" value="no"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_splitter_out.fasta"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/splitter.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_supermatcher.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,72 @@
+<tool id="EMBOSS: supermatcher95" name="supermatcher" version="5.0.0">
+  <!-- puts file information in output report -->
+  <description>Match large sequences against one or more other sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>supermatcher -asequence $input1 -bsequence $input2 -gapopen "$gapopen" -gapextend "$gapextend" -width "$width" -wordlen "$wordlen" -outfile $ofile1 -errorfile $ofile2 -aformat3
+  $out_format1 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Large sequences</label>
+    </param>
+    <param format="data" name="input2" type="data">
+      <label>Sequences to match</label>
+    </param>
+    <param name="gapopen" size="4" type="text" value="10.0">
+      <label>Gap opening penalty</label>
+    </param>
+    <param name="gapextend" size="4" type="text" value="0.5">
+      <label>Gap extension penalty</label>
+    </param>
+    <param name="width" size="4" type="text" value="16">
+      <label>Alignment width</label>
+    </param>
+    <param name="wordlen" size="4" type="text" value="6">
+      <label>Word length for initial matching</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Alignment File Format</label>
+      <option value="simple">Simple (m)</option>
+      <option value="fasta">FASTA (m)</option>
+      <option value="msf">MSF (m)</option>
+      <option value="srs">SRS (m)</option>
+      <option value="pair">Pair (p)</option>
+      <option value="markx0">Markx0 (p)</option>
+      <option value="markx1">Markx1 (p)</option>
+      <option value="markx2">Markx2 (p)</option>
+      <option value="markx3">Markx3 (p)</option>
+      <option value="markx10">Markx10 (p)</option>
+      <option value="srspair">SRS pair (p)</option>
+      <option value="score">Score (p)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="simple" name="ofile1" />
+    <data format="supermatcher" name="ofile2" />
+  </outputs>
+<!--    <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="input2" value="1.fasta"/>
+      <param name="gapopen" value="10.0"/>
+      <param name="gapextend" value="0.5"/>
+      <param name="width" value="16"/>
+      <param name="wordlen" value="6"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="ofile1" file="emboss_supermatcher_out.fasta"/>
+    </test>
+  </tests> -->
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/supermatcher.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_syco.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,205 @@
+<tool id="EMBOSS: syco96" name="syco" version="5.0.0">
+  <!-- graphics output -->
+  <description>Synonymous codon usage Gribskov statistic plot</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command interpreter="perl">emboss_single_outputfile_wrapper.pl syco -sequence $input1 -graph png -goutfile $ofile1 -outfile $ofile2 -cfile $cfile -window "$window" -uncommon $uncommon -minimum "$minimum"
+  -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="cfile" type="select">
+      <label>Codon Usage File</label>
+      <option value="Ehum.cut">Ehum.cut</option>
+      <option value="Eyeastcai.cut">Eyeastcai.cut</option>
+      <option value="Eacc.cut">Eacc.cut</option>
+      <option value="Eadenovirus5.cut">Eadenovirus5.cut</option>
+      <option value="Eadenovirus7.cut">Eadenovirus7.cut</option>
+      <option value="Eaidlav.cut">Eaidlav.cut</option>
+      <option value="Eanasp.cut">Eanasp.cut</option>
+      <option value="Eani.cut">Eani.cut</option>
+      <option value="Eani_h.cut">Eani_h.cut</option>
+      <option value="Eanidmit.cut">Eanidmit.cut</option>
+      <option value="Easn.cut">Easn.cut</option>
+      <option value="Eath.cut">Eath.cut</option>
+      <option value="Eatu.cut">Eatu.cut</option>
+      <option value="Eavi.cut">Eavi.cut</option>
+      <option value="Ebja.cut">Ebja.cut</option>
+      <option value="Ebly.cut">Ebly.cut</option>
+      <option value="Ebme.cut">Ebme.cut</option>
+      <option value="Ebmo.cut">Ebmo.cut</option>
+      <option value="Ebna.cut">Ebna.cut</option>
+      <option value="Ebov.cut">Ebov.cut</option>
+      <option value="Ebovsp.cut">Ebovsp.cut</option>
+      <option value="Ebst.cut">Ebst.cut</option>
+      <option value="Ebsu.cut">Ebsu.cut</option>
+      <option value="Ebsu_h.cut">Ebsu_h.cut</option>
+      <option value="Ecac.cut">Ecac.cut</option>
+      <option value="Ecal.cut">Ecal.cut</option>
+      <option value="Eccr.cut">Eccr.cut</option>
+      <option value="Ecel.cut">Ecel.cut</option>
+      <option value="Echi.cut">Echi.cut</option>
+      <option value="Echicken.cut">Echicken.cut</option>
+      <option value="Echisp.cut">Echisp.cut</option>
+      <option value="Echk.cut">Echk.cut</option>
+      <option value="Echmp.cut">Echmp.cut</option>
+      <option value="Echnt.cut">Echnt.cut</option>
+      <option value="Echos.cut">Echos.cut</option>
+      <option value="Echzm.cut">Echzm.cut</option>
+      <option value="Echzmrubp.cut">Echzmrubp.cut</option>
+      <option value="Ecpx.cut">Ecpx.cut</option>
+      <option value="Ecre.cut">Ecre.cut</option>
+      <option value="Ecrisp.cut">Ecrisp.cut</option>
+      <option value="Ectr.cut">Ectr.cut</option>
+      <option value="Edayhoff.cut">Edayhoff.cut</option>
+      <option value="Eddi.cut">Eddi.cut</option>
+      <option value="Eddi_h.cut">Eddi_h.cut</option>
+      <option value="Edog.cut">Edog.cut</option>
+      <option value="Edro.cut">Edro.cut</option>
+      <option value="Edro_h.cut">Edro_h.cut</option>
+      <option value="Edrosophila.cut">Edrosophila.cut</option>
+      <option value="Eeca.cut">Eeca.cut</option>
+      <option value="Eeco.cut">Eeco.cut</option>
+      <option value="Eeco_h.cut">Eeco_h.cut</option>
+      <option value="Eecoli.cut">Eecoli.cut</option>
+      <option value="Ef1.cut">Ef1.cut</option>
+      <option value="Efish.cut">Efish.cut</option>
+      <option value="Efmdvpolyp.cut">Efmdvpolyp.cut</option>
+      <option value="Eham.cut">Eham.cut</option>
+      <option value="Ehha.cut">Ehha.cut</option>
+      <option value="Ehin.cut">Ehin.cut</option>
+      <option value="Ehma.cut">Ehma.cut</option>
+      <option value="Ehuman.cut">Ehuman.cut</option>
+      <option value="Ekla.cut">Ekla.cut</option>
+      <option value="Ekpn.cut">Ekpn.cut</option>
+      <option value="Ella.cut">Ella.cut</option>
+      <option value="Emac.cut">Emac.cut</option>
+      <option value="Emaize.cut">Emaize.cut</option>
+      <option value="Emam_h.cut">Emam_h.cut</option>
+      <option value="Emixlg.cut">Emixlg.cut</option>
+      <option value="Emouse.cut">Emouse.cut</option>
+      <option value="Emsa.cut">Emsa.cut</option>
+      <option value="Emse.cut">Emse.cut</option>
+      <option value="Emta.cut">Emta.cut</option>
+      <option value="Emtu.cut">Emtu.cut</option>
+      <option value="Emus.cut">Emus.cut</option>
+      <option value="Emussp.cut">Emussp.cut</option>
+      <option value="Emva.cut">Emva.cut</option>
+      <option value="Emze.cut">Emze.cut</option>
+      <option value="Emzecp.cut">Emzecp.cut</option>
+      <option value="Encr.cut">Encr.cut</option>
+      <option value="Eneu.cut">Eneu.cut</option>
+      <option value="Engo.cut">Engo.cut</option>
+      <option value="Eoncsp.cut">Eoncsp.cut</option>
+      <option value="Epae.cut">Epae.cut</option>
+      <option value="Epea.cut">Epea.cut</option>
+      <option value="Epet.cut">Epet.cut</option>
+      <option value="Epfa.cut">Epfa.cut</option>
+      <option value="Ephix174.cut">Ephix174.cut</option>
+      <option value="Ephv.cut">Ephv.cut</option>
+      <option value="Ephy.cut">Ephy.cut</option>
+      <option value="Epig.cut">Epig.cut</option>
+      <option value="Epolyomaa2.cut">Epolyomaa2.cut</option>
+      <option value="Epombe.cut">Epombe.cut</option>
+      <option value="Epombecai.cut">Epombecai.cut</option>
+      <option value="Epot.cut">Epot.cut</option>
+      <option value="Eppu.cut">Eppu.cut</option>
+      <option value="Epse.cut">Epse.cut</option>
+      <option value="Epsy.cut">Epsy.cut</option>
+      <option value="Epvu.cut">Epvu.cut</option>
+      <option value="Erab.cut">Erab.cut</option>
+      <option value="Erabbit.cut">Erabbit.cut</option>
+      <option value="Erabsp.cut">Erabsp.cut</option>
+      <option value="Erat.cut">Erat.cut</option>
+      <option value="Eratsp.cut">Eratsp.cut</option>
+      <option value="Erca.cut">Erca.cut</option>
+      <option value="Erhm.cut">Erhm.cut</option>
+      <option value="Eric.cut">Eric.cut</option>
+      <option value="Erle.cut">Erle.cut</option>
+      <option value="Erme.cut">Erme.cut</option>
+      <option value="Ersp.cut">Ersp.cut</option>
+      <option value="Esalsp.cut">Esalsp.cut</option>
+      <option value="Esau.cut">Esau.cut</option>
+      <option value="Esco.cut">Esco.cut</option>
+      <option value="Esgi.cut">Esgi.cut</option>
+      <option value="Eshp.cut">Eshp.cut</option>
+      <option value="Eshpsp.cut">Eshpsp.cut</option>
+      <option value="Esli.cut">Esli.cut</option>
+      <option value="Eslm.cut">Eslm.cut</option>
+      <option value="Esma.cut">Esma.cut</option>
+      <option value="Esmi.cut">Esmi.cut</option>
+      <option value="Esmu.cut">Esmu.cut</option>
+      <option value="Esoy.cut">Esoy.cut</option>
+      <option value="Espi.cut">Espi.cut</option>
+      <option value="Espn.cut">Espn.cut</option>
+      <option value="Espo.cut">Espo.cut</option>
+      <option value="Espo_h.cut">Espo_h.cut</option>
+      <option value="Espu.cut">Espu.cut</option>
+      <option value="Esta.cut">Esta.cut</option>
+      <option value="Esty.cut">Esty.cut</option>
+      <option value="Esus.cut">Esus.cut</option>
+      <option value="Esv40.cut">Esv40.cut</option>
+      <option value="Esyhsp.cut">Esyhsp.cut</option>
+      <option value="Esynsp.cut">Esynsp.cut</option>
+      <option value="Etbr.cut">Etbr.cut</option>
+      <option value="Etcr.cut">Etcr.cut</option>
+      <option value="Eter.cut">Eter.cut</option>
+      <option value="Etetsp.cut">Etetsp.cut</option>
+      <option value="Etob.cut">Etob.cut</option>
+      <option value="Etobcp.cut">Etobcp.cut</option>
+      <option value="Etom.cut">Etom.cut</option>
+      <option value="Etrb.cut">Etrb.cut</option>
+      <option value="Evco.cut">Evco.cut</option>
+      <option value="Ewht.cut">Ewht.cut</option>
+      <option value="Exel.cut">Exel.cut</option>
+      <option value="Exenopus.cut">Exenopus.cut</option>
+      <option value="Eyeast.cut">Eyeast.cut</option>
+      <option value="Eyen.cut">Eyen.cut</option>
+      <option value="Eysc.cut">Eysc.cut</option>
+      <option value="Eysc_h.cut">Eysc_h.cut</option>
+      <option value="Eyscmt.cut">Eyscmt.cut</option>
+      <option value="Eysp.cut">Eysp.cut</option>
+      <option value="Ezebrafish.cut">Ezebrafish.cut</option>
+      <option value="Ezma.cut">Ezma.cut</option>
+    </param>
+    <param name="window" size="4" type="text" value="30">
+      <label>Averaging window</label>
+    </param>
+    <param name="uncommon" type="select">
+      <label>Show common codon usage</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="minimum" size="4" type="text" value="0.15">
+      <label>Minimum value for a common codon</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="png" name="ofile1" />
+    <data format="syco" name="ofile2" />
+  </outputs>
+ <!--   <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="cfile" value="Ehum.cut"/>
+      <param name="window" value="30"/>
+      <param name="uncommon" value="no"/>
+      <param name="minimum" value="0.15"/>
+      <output name="ofile2" file="emboss_syco_out.syco"/>
+    </test>
+  </tests> -->
+  <help>
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/syco.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_tcode.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,52 @@
+<tool id="EMBOSS: tcode97" name="tcode" version="5.0.0">
+  <description>Fickett TESTCODE statistic to identify protein-coding DNA</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>tcode -sequence $input1 -outfile $out_file1 -window "$window" -step "$step" -rformat $out_format1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="window" size="5" type="text" value="200">
+      <label>Window size</label>
+    </param>
+    <param name="step" size="5" type="text" value="3">
+      <label>Step size</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Report File Format</label>
+      <option value="table">Table</option>
+      <option value="embl">EMBL</option>
+      <option value="genbank">GENBANK</option>
+      <option value="gff">GFF</option>
+      <option value="pir">PIR</option>
+      <option value="swiss">SwissProt</option>
+      <option value="dbmotif">DbMotif</option>
+      <option value="diffseq">Diffseq</option>
+      <option value="excel">Excel (tab delimited)</option>
+      <option value="feattable">FeatTable</option>
+      <option value="motif">Motif</option>
+      <option value="regions">Regions</option>
+      <option value="seqtable">SeqTable</option>
+      <option value="simple">SRS Simple</option>
+      <option value="srs">SRS</option>
+      <option value="tagseq">TagSeq</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="table" name="out_file1" />
+  </outputs>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/tcode.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_textsearch.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,66 @@
+<tool id="EMBOSS: textsearch98" name="textsearch" version="5.0.0">
+  <description>Search sequence documentation. Slow, use SRS and Entrez!</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>textsearch -sequence $input1 -outfile $out_file1 -pattern "$pattern" -casesensitive -heading $heading -usa $usa -accession $accession -name $search_name -description $description -html
+  $html_out1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="pattern" size="50" type="text" value="">
+      <label>Pattern to search for</label>
+    </param>
+    <param name="casesensitive" type="select">
+      <label>Do a case-sensitive search</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="heading" type="select">
+      <label>Display column headings</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="usa" type="select">
+      <label>Display the USA of the sequence</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="accession" type="select">
+      <label>Display accession column</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="search_name" type="select">
+      <label>Display name column</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="description" type="select">
+      <label>Display description column</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="html_out1" type="select">
+      <label>Format output as an HTML table</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="textsearch" name="out_file1" />
+  </outputs>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/textsearch.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_tmap.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,47 @@
+<tool id="EMBOSS: tmap99" name="tmap" version="5.0.0">
+  <description>Displays membrane spanning regions</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command interpreter="perl">emboss_single_outputfile_wrapper.pl tmap -sequences $input1 -outfile $out_file1 -goutfile $out_file2 -graph png -rformat $out_format1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Report File Format</label>
+      <option value="seqtable ">SeqTable</option>
+      <option value="embl">EMBL</option>
+      <option value="genbank">GENBANK</option>
+      <option value="gff">GFF</option>
+      <option value="pir">PIR</option>
+      <option value="swiss">SwissProt</option>
+      <option value="dbmotif">DbMotif</option>
+      <option value="diffseq">Diffseq</option>
+      <option value="excel">Excel (tab delimited)</option>
+      <option value="feattable">FeatTable</option>
+      <option value="motif">Motif</option>
+      <option value="regions">Regions</option>
+      <option value="simple">SRS Simple</option>
+      <option value="srs">SRS</option>
+      <option value="table">Table</option>
+      <option value="tagseq">TagSeq</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="seqtable" name="out_file1" />
+    <data format="png" name="out_file2" />
+  </outputs>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/tmap.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_tranalign.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,92 @@
+<tool id="EMBOSS: tranalign100" name="tranalign" version="5.0.0">
+  <description>Align nucleic coding regions given the aligned proteins</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>tranalign -asequence $input1 -bsequence $input2 -outseq $out_file1 -table $table -osformat3 $out_format1 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Nucleic Sequences</label>
+    </param>
+    <param format="data" name="input2" type="data">
+      <label>Protein Sequences</label>
+    </param>
+    <param name="table" type="select">
+      <label>Code to use</label>
+      <option value="0">Standard</option>
+      <option value="1">Standard (with alternative initiation codons)</option>
+      <option value="2">Vertebrate Mitochondrial</option>
+      <option value="3">Yeast Mitochondrial</option>
+      <option value="4">Mold, Protozoan, Coelenterate Mitochondrial and Mycoplasma/Spiroplasma</option>
+      <option value="5">Invertebrate Mitochondrial</option>
+      <option value="6">Ciliate Macronuclear and Dasycladacean</option>
+      <option value="9">Echinoderm Mitochondrial</option>
+      <option value="10">Euplotid Nuclear</option>
+      <option value="11">Bacterial</option>
+      <option value="12">Alternative Yeast Nuclear</option>
+      <option value="13">Ascidian Mitochondrial</option>
+      <option value="14">Flatworm Mitochondrial</option>
+      <option value="15">Blepharisma Macronuclear</option>
+      <option value="16">Chlorophycean Mitochondrial</option>
+      <option value="21">Trematode Mitochondrial</option>
+      <option value="22">Scenedesmus obliquus</option>
+      <option value="23">Thraustochytrium Mitochondrial</option>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="3.fasta"/>
+      <param name="input2" value="2.pep"/>
+      <param name="table" value="0"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_tranalign_out.fasta"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/tranalign.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_transeq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,130 @@
+<tool id="EMBOSS: transeq101" name="transeq" version="5.0.0">
+  <description>Translate nucleic acid sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>transeq -sequence $input1 -outseq $out_file1 -frame $frame -table $table -regions "$regions" -trim $trim -clean $clean -alternative $alternative -osformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="frame" type="select">
+      <label>Frame(s) to translate</label>
+      <option value="1">Frame 1</option>
+      <option value="2">Frame 2</option>
+      <option value="3">Frame 3</option>
+      <option value="F">Forward three frames</option>
+      <option value="-1">Frame -1</option>
+      <option value="-2">Frame -2</option>
+      <option value="-3">Frame -3</option>
+      <option value="R">Reverse three frames</option>
+      <option value="6">All six frames</option>
+    </param>
+    <param name="table" type="select">
+      <label>Code to use</label>
+      <option value="0">Standard</option>
+      <option value="1">Standard (with alternative initiation codons)</option>
+      <option value="2">Vertebrate Mitochondrial</option>
+      <option value="3">Yeast Mitochondrial</option>
+      <option value="4">Mold, Protozoan, Coelenterate Mitochondrial and Mycoplasma/Spiroplasma</option>
+      <option value="5">Invertebrate Mitochondrial</option>
+      <option value="6">Ciliate Macronuclear and Dasycladacean</option>
+      <option value="9">Echinoderm Mitochondrial</option>
+      <option value="10">Euplotid Nuclear</option>
+      <option value="11">Bacterial</option>
+      <option value="12">Alternative Yeast Nuclear</option>
+      <option value="13">Ascidian Mitochondrial</option>
+      <option value="14">Flatworm Mitochondrial</option>
+      <option value="15">Blepharisma Macronuclear</option>
+      <option value="16">Chlorophycean Mitochondrial</option>
+      <option value="21">Trematode Mitochondrial</option>
+      <option value="22">Scenedesmus obliquus</option>
+      <option value="23">Thraustochytrium Mitochondrial</option>
+    </param>
+    <param name="regions" size="10" type="text" value="">
+      <label>Regions to translate</label>
+    </param>
+    <param name="trim" type="select">
+      <label>Remove all 'X' and '*' characters from the right end of the translation</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="clean" type="select">
+      <label>Change all STOP codon positions from the '*' character to 'X'</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="alternative" type="select">
+      <label>Define frame '-1' as using the set of codons starting with the last codon of the sequence</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="frame" value="1"/>
+      <param name="table" value="0"/>
+      <param name="regions" value=""/>
+      <param name="trim" value="no"/>
+      <param name="clean" value="no"/>
+      <param name="alternative" value="no"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_transeq_out.fasta"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/transeq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_trimest.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,100 @@
+<tool id="EMBOSS: trimest102" name="trimest" version="5.0.0">
+  <description>Trim poly-A tails off EST sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>trimest -sequence $input1 -outseq $out_file1 -minlength "$minlength" -mismatches "$mismatches" -reverse $reverse -tolower $tolower -fiveprime $fiveprime -osformat2 $out_format1
+  -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="minlength" size="4" type="text" value="4">
+      <label>Minimum length that a poly-A (or poly-T) tail must have before it is removed</label>
+    </param>
+    <param name="mismatches" size="4" type="text" value="1">
+      <label>Number of fewer mismatched non-A bases in a poly-A tail</label>
+    </param>
+    <param name="reverse" type="select">
+      <label>Change the sequence to the forward sense when it is written out</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="tolower" type="select">
+      <label>Mask poly-A by converting to lowercase</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="fiveprime" type="select">
+      <label>Inspect 5' end of the sequence for poly-T tails</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="minlength" value="4"/>
+      <param name="mismatches" value="1"/>
+      <param name="reverse" value="yes"/>
+      <param name="tolower" value="no"/>
+      <param name="fiveprime" value="yes"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_trimest_out.fasta"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/trimest.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_trimseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,105 @@
+<tool id="EMBOSS: trimseq103" name="trimseq" version="5.0.0">
+  <description>Trim ambiguous bits off the ends of sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>trimseq -sequence $input1 -outseq $out_file1 -window "$window" -percent "$percent" -strict $strict -star $star -left $left -right $right -osformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="window" size="4" type="text" value="1">
+      <label>Window size</label>
+    </param>
+    <param name="percent" size="5" type="text" value="100.0">
+      <label>Threshold of the percentage ambiguity</label>
+    </param>
+    <param name="strict" type="select">
+      <label>Trim all ambiguity codes</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="star" type="select">
+      <label>In protein sequences, trim off not only X's, but also the *'s</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="left" type="select">
+      <label>Trim at the start</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="right" type="select">
+      <label>Trim at the end</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="window" value="1"/>
+      <param name="percent" value="100.0"/>
+      <param name="strict" value="no"/>
+      <param name="star" value="no"/>
+      <param name="left" value="yes"/>
+      <param name="right" value="yes"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_trimseq_out.fasta"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/trimseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_twofeat.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,138 @@
+<tool id="EMBOSS: twofeat104" name="twofeat" version="5.0.0">
+  <description>Finds neighbouring pairs of features in sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>twofeat -sequence $input1 -outfile $out_file1 -atype "$atype" -btype "$btype" -minrange "$minrange" -maxrange "$maxrange" -asource "$asource" -asense $asense -aminscore "$aminscore"
+  -amaxscore "$amaxscore" -atag "$atag" -avalue "$avalue" -bsource "$bsource" -bsense "$bsense" -bminscore "$bminscore" -bmaxscore "$bmaxscore" -btag "$btag" -bvalue "$bvalue" -overlap $overlap
+  -rangetype $rangetype -sense $sense -order $order -twoout $twoout -typeout "$typeout" -rformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="data" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="atype" size="50" type="text" value="*">
+      <label>Feature type you wish to allow. Feature 1</label>
+    </param>
+    <param name="btype" size="50" type="text" value="*">
+      <label>Feature type you wish to allow. Feature 2</label>
+    </param>
+    <param name="minrange" size="5" type="text" value="0">
+      <label>Minimun range</label>
+    </param>
+    <param name="maxrange" size="5" type="text" value="0">
+      <label>Maximum range</label>
+    </param>
+    <param name="asource" size="50" type="text" value="*">
+      <label>Feature source 1</label>
+    </param>
+    <param name="asense" type="select">
+      <label>Feature sense 1</label>
+      <option value="0">Any sense</option>
+      <option value="+">Forward sense</option>
+      <option value="-">Reverse sense</option>
+    </param>
+    <param name="aminscore" size="5" type="text" value="0.0">
+      <label>Feature 1 minimum score</label>
+    </param>
+    <param name="amaxscore" size="5" type="text" value="0.0">
+      <label>Feature1 maxiumum score</label>
+    </param>
+    <param name="atag" size="50" type="text" value="*">
+      <label>Feature 1 tag</label>
+    </param>
+    <param name="avalue" size="50" type="text" value="*">
+      <label>Tag 1 value</label>
+    </param>
+    <param name="bsource" size="50" type="text" value="*">
+      <label>Feature 2 source</label>
+    </param>
+    <param name="bsense" type="select">
+      <label>Feature 2 sense</label>
+      <option value="0">Any sense</option>
+      <option value="+">Forward sense</option>
+      <option value="-">Reverse sense</option>
+    </param>
+    <param name="bminscore" size="5" type="text" value="0.0">
+      <label>Feature 2 miniumum score</label>
+    </param>
+    <param name="bmaxscore" size="5" type="text" value="0.0">
+      <label>Feature 2 maximum score</label>
+    </param>
+    <param name="btag" size="50" type="text" value="*">
+      <label>Feature 2 tag</label>
+    </param>
+    <param name="bvalue" size="50" type="text" value="*">
+      <label>Feature 2 tag value</label>
+    </param>
+    <param name="overlap" type="select">
+      <label>opverlaps allowed</label>
+      <option value="A">Any</option>
+      <option value="O">Overlap required but not within</option>
+      <option value="NO">No overlaps are allowed</option>
+      <option value="NW:">Overlap required but not within</option>
+      <option value="AW">A must be all within B</option>
+      <option value="BW">B must be all within A</option>
+    </param>
+    <param name="rangetype" type="select">
+      <label>How to determine range</label>
+      <option value="N">From nearest ends</option>
+      <option value="L">From left ends</option>
+      <option value="R">From right ends</option>
+      <option value="F">From furthest ends</option>
+    </param>
+    <param name="sense" type="select">
+      <label>Required sense</label>
+      <option value="A">Any sense</option>
+      <option value="S">Same sense</option>
+      <option value="O">Opposite sense</option>
+    </param>
+    <param name="order" type="select">
+      <label>Required order of the two features</label>
+      <option value="A">Any</option>
+      <option value="AB">Feature A then feature B</option>
+      <option value="BA">Feature B then feature A</option>
+    </param>
+    <param name="twoout" type="select">
+      <label>Write out the two features themselves</label>
+      <option value="no">No</option>
+      <option value="yes">Yes</option>
+    </param>
+    <param name="typeout" size="50" type="text" value="misc_feature">
+      <label>New feature type</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Report File Format</label>
+      <option value="table">Table</option>
+      <option value="embl">EMBL</option>
+      <option value="genbank">GENBANK</option>
+      <option value="gff">GFF</option>
+      <option value="pir">PIR</option>
+      <option value="swiss">SwissProt</option>
+      <option value="dbmotif">DbMotif</option>
+      <option value="diffseq">Diffseq</option>
+      <option value="excel">Excel (tab delimited)</option>
+      <option value="feattable">FeatTable</option>
+      <option value="motif">Motif</option>
+      <option value="regions">Regions</option>
+      <option value="seqtable">SeqTable</option>
+      <option value="simple">SRS Simple</option>
+      <option value="srs">SRS</option>
+      <option value="tagseq">TagSeq</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="table" name="out_file1" />
+  </outputs>
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/twofeat.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_union.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,73 @@
+<tool id="EMBOSS: union105" name="union" version="5.0.0">
+  <description>Reads sequence fragments and builds one sequence</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>union -sequence $input1 -outseq $out_file1 -osformat2 $out_format1 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="out_format1" value="fasta"/>
+      <output name="out_file1" file="emboss_union_out.fasta"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/union.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_vectorstrip.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,90 @@
+<tool id="EMBOSS: vectorstrip106" name="vectorstrip" version="5.0.0">
+  <description>Strips out DNA between a pair of vector sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>vectorstrip -sequence $input1 -vectorsfile $input2 -outseq $ofile1 -outfile $ofile2 -vectorfile yes -mismatch "$mismatch" -besthits $besthits -linkera "$linkera" -linkerb
+  "$linkerb" -osformat4 $out_format1 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequences</label>
+    </param>
+    <param format="data" name="input2" type="data">
+      <label>Vector file</label>
+    </param>
+    <param name="mismatch" size="4" type="text" value="10">
+      <label>Max allowed percent mismatch</label>
+    </param>
+    <param name="besthits" type="select">
+      <label>Show only the best hits (minimize mismatches)</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="linkera" size="50" type="text" value="">
+      <label>The 5' sequence</label>
+    </param>
+    <param name="linkerb" size="50" type="text" value="">
+      <label>The 3' sequence</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Sequence File Format</label>
+      <option value="fasta">FASTA (m)</option>
+      <option value="acedb">ACeDB (m)</option>
+      <option value="asn1">ASN.1 (m)</option>
+      <option value="clustal">Clustal (m)</option>
+      <option value="codata">CODATA (m)</option>
+      <option value="embl">EMBL (m)</option>
+      <option value="fitch">Fitch (m)</option>
+      <option value="gcg">Wisconsin Package GCG 9.x and 10.x (s)</option>
+      <option value="genbank">GENBANK (m)</option>
+      <option value="gff">GFF (m)</option>
+      <option value="hennig86">Hennig86 (m)</option>
+      <option value="ig">Intelligenetics (m)</option>
+      <option value="jackknifer">Jackknifer (m)</option>
+      <option value="jackknifernon">Jackknifernon (m)</option>
+      <option value="mega">Mega (m)</option>
+      <option value="meganon">Meganon (m)</option>
+      <option value="msf">Wisconsin Package GCG's MSF (m)</option>
+      <option value="pir">NBRF (PIR) (m)</option>
+      <option value="ncbi">NCBI style FASTA (m)</option>
+      <option value="nexus">Nexus/PAUP (m)</option>
+      <option value="nexusnon">Nexusnon/PAUPnon (m)</option>
+      <option value="phylip">PHYLIP interleaved (m)</option>
+      <option value="phylipnon">PHYLIP non-interleaved (m)</option>
+      <option value="selex">SELEX (m)</option>
+      <option value="staden">Staden (s)</option>
+      <option value="strider">DNA strider (m)</option>
+      <option value="swiss">SwisProt entry (m)</option>
+      <option value="text">Plain sequence (s)</option>
+      <option value="treecon">Treecon (m)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="fasta" name="ofile1" />
+    <data format="vectorstrip" name="ofile2" />
+  </outputs>
+  <!--  <tests>
+    <test>
+      <param name="input1" value="1.fasta"/>
+      <param name="input2" value="2.fasta"/>
+      <param name="mismatch" value="10"/>
+      <param name="besthits" value="yes"/>
+      <param name="linkera" value=""/>
+      <param name="linkerb" value=""/>
+      <param name="out_format1" value="fasta"/>
+      <output name="ofile1" file="emboss_vectorstrip_out.fasta"/>
+    </test>
+  </tests> -->
+  <code file="emboss_format_corrector.py" />
+  <help>
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/vectorstrip.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_water.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,74 @@
+<tool id="EMBOSS: water107" name="water" version="5.0.0">
+  <description>Smith-Waterman local alignment</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>water -asequence $input1 -bsequence $input2 -outfile $out_file1 -gapopen "$gapopen" -gapextend "$gapextend" -brief $brief -aformat3 $out_format1 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequence 1</label>
+    </param>
+    <param format="fasta" name="input2" type="data">
+      <label>Sequence 2</label>
+    </param>
+    <param name="gapopen" size="6" type="text" value="10.0">
+      <label>Gap open penalty</label>
+    </param>
+    <param name="gapextend" size="6" type="text" value="0.5">
+      <label>Gap extension penalty</label>
+    </param>
+    <param name="brief" type="select">
+      <label>Brief identity and similarity</label>
+      <option value="yes">Yes</option>
+      <option value="no">No</option>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Alignment File Format</label>
+      <option value="srs">SRS (m)</option>
+      <option value="simple">Simple (m)</option>
+      <option value="fasta">FASTA (m)</option>
+      <option value="msf">MSF (m)</option>
+      <option value="pair">Pair (p)</option>
+      <option value="markx0">Markx0 (p)</option>
+      <option value="markx1">Markx1 (p)</option>
+      <option value="markx2">Markx2 (p)</option>
+      <option value="markx3">Markx3 (p)</option>
+      <option value="markx10">Markx10 (p)</option>
+      <option value="srspair">SRS pair (p)</option>
+      <option value="score">Score (p)</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="srs" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="input2" value="1.fasta"/>
+      <param name="gapopen" value="10.0"/>
+      <param name="gapextend" value="0.5"/>
+      <param name="brief" value="no"/>
+      <param name="out_format1" value="score"/>
+      <output name="out_file1" file="emboss_water_out.score"/>
+    </test>
+  </tests>
+  <code file="emboss_format_corrector.py" />
+  <help>
+
+.. class:: warningmark
+
+The input datasets need to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/water.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_wobble.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,48 @@
+<tool id="EMBOSS: wobble108" name="wobble" version="5.0.0">
+  <description>Wobble base plot</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command interpreter="perl">emboss_single_outputfile_wrapper.pl wobble -sequence $input1 -graph png -goutfile $ofile1 -outfile $ofile2 -window "$window" -bases "$bases" -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="window" size="5" type="text" value="30">
+      <label>Window size, in codons</label>
+    </param>
+    <param name="bases" size="6" type="text" value="GC">
+      <label>Bases used</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="png" name="ofile1" />
+    <data format="wobble" name="ofile2" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="window" value="30"/>
+      <param name="bases" value="GC"/>
+      <output name="ofile2" file="emboss_wobble_out.wobble"/>
+    </test>
+  </tests>
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/wobble.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_wordcount.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,43 @@
+<tool id="EMBOSS: wordcount109" name="wordcount" version="5.0.0">
+  <description>Counts words of a specified size in a DNA sequence</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>wordcount -sequence $input1 -outfile $out_file1 -wordsize "$wordsize" -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequence</label>
+    </param>
+    <param name="wordsize" size="5" type="text" value="4">
+      <label>Word size</label>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="wordcount" name="out_file1" />
+  </outputs>
+  <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="wordsize" value="4"/>
+      <output name="out_file1" file="emboss_wordcount_out.wordcount"/>
+    </test>
+  </tests>
+  <help>
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/wordcount.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_wordmatch.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,82 @@
+<tool id="EMBOSS: wordmatch110" name="wordmatch" version="5.0.0">
+  <description>Finds all exact matches of a given size between 2 sequences</description>
+  <requirements><requirement type="package" version="5.0.0">emboss</requirement></requirements>
+  <command>wordmatch -asequence $input1 -bsequence $input2 -outfile $out_file1 -aoutfeat $out_file2 -boutfeat $out_file3 -wordsize "$wordsize" -aformat3 $out_format1 -offormat4 $out_format2
+  -offormat5 $out_format3 -auto</command>
+  <inputs>
+    <param format="fasta" name="input1" type="data">
+      <label>Sequence 1</label>
+    </param>
+    <param format="fasta" name="input2" type="data">
+      <label>Sequence 2</label>
+    </param>
+    <param name="wordsize" size="5" type="text" value="4">
+      <label>Word size</label>
+    </param>
+    <param name="out_format1" type="select">
+      <label>Output Alignment File Format</label>
+      <option value="match">Match (m)</option>
+      <option value="simple">Simple (m)</option>
+      <option value="fasta">FASTA (m)</option>
+      <option value="msf">MSF (m)</option>
+      <option value="srs">SRS (m)</option>
+      <option value="pair">Pair (p)</option>
+      <option value="markx0">Markx0 (p)</option>
+      <option value="markx1">Markx1 (p)</option>
+      <option value="markx2">Markx2 (p)</option>
+      <option value="markx3">Markx3 (p)</option>
+      <option value="markx10">Markx10 (p)</option>
+      <option value="srspair">SRS pair (p)</option>
+      <option value="score">Score (p)</option>
+    </param>
+    <param name="out_format2" type="select">
+      <label>Output Feature 1 File Format</label>
+      <option value="gff">GFF</option>
+      <option value="embl">EMBL</option>
+      <option value="swiss">SwissProt</option>
+    </param>
+    <param name="out_format3" type="select">
+      <label>Output Feature 2 File Format</label>
+      <option value="gff">GFF</option>
+      <option value="embl">EMBL</option>
+      <option value="swiss">SwissProt</option>
+    </param>
+  </inputs>
+  <outputs>
+    <data format="match" name="out_file1" />
+    <data format="gff" name="out_file2" />
+    <data format="gff" name="out_file3" />
+  </outputs>
+  <!--   <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="input2" value="1.fasta"/>
+      <param name="wordsize" value="4"/>
+      <param name="out_format1" value="fasta"/>
+      <param name="out_format2" value="gff"/>
+      <param name="out_format3" value="gff"/>
+      <output name="ofile2" file="emboss_wordmatch_out.embl"/>
+    </test>
+  </tests> test takes a long time to run-->
+  <code file="emboss_format_corrector.py" />
+  <help>
+
+.. class:: warningmark
+
+The input datasets need to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/wordmatch.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. &lt;http://www.ncbi.nlm.nih.gov/pubmed/10827456&gt;`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. &lt;http://www.ncbi.nlm.nih.gov/pubmed/17568012&gt;`_
+  </help>
+</tool>