comparison rgFastQC.xml @ 12:484e86282f4b draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/fastqc commit 4b383d48868d7f3f6d35f242a0ee35953adcb037

11:db2dc6bc8f05

            #if $limits.dataset and str($limits) > ''
                -l '$limits'
            #end if
    ]]></command>
    <inputs>
        <param format="fastq,fastq.gz,fastq.bz2,bam,sam" name="input_file" type="data" label="Short read data from your current history" />
        <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list"
               help="tab delimited file with 2 columns: name and sequence.  For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA" />
        <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file"
               help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" />
    </inputs>

**FastQC**

This is a Galaxy wrapper. It merely exposes the external package FastQC_ which is documented at FastQC_
Kindly acknowledge it as well as this tool if you use it.
FastQC incorporates the Picard-tools_ libraries for sam/bam processing.

The contaminants file parameter was borrowed from the independently developed
fastqcwrapper contributed to the Galaxy Community Tool Shed by J. Johnson.
Adaption to version 0.11.2 by T. McGowan.

- Overrepresented sequences
- Kmer Content

All except Basic Statistics and Overrepresented sequences are plots.
 .. _FastQC: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/
 .. _Picard-tools: http://picard.sourceforge.net/index.shtml
    </help>
    <citations>
        <citation type="bibtex">
        @unpublished{andrews_s,
            author = {Andrews, S.},

12:484e86282f4b

            #if $limits.dataset and str($limits) > ''
                -l '$limits'
            #end if
    ]]></command>
    <inputs>
        <param format="fastq,fastq.gz,fastq.bz2,bam,sam" name="input_file" type="data"
               label="Short read data from your current history" />
        <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list"
               help="tab delimited file with 2 columns: name and sequence.  For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA" />
        <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file"
               help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" />
    </inputs>

**FastQC**

This is a Galaxy wrapper. It merely exposes the external package FastQC_ which is documented at FastQC_
Kindly acknowledge it as well as this tool if you use it.
FastQC incorporates the Picard-tools_ libraries for SAM/BAM processing.

The contaminants file parameter was borrowed from the independently developed
fastqcwrapper contributed to the Galaxy Community Tool Shed by J. Johnson.
Adaption to version 0.11.2 by T. McGowan.

- Overrepresented sequences
- Kmer Content

All except Basic Statistics and Overrepresented sequences are plots.
 .. _FastQC: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/
 .. _Picard-tools: https://broadinstitute.github.io/picard/
    </help>
    <citations>
        <citation type="bibtex">
        @unpublished{andrews_s,
            author = {Andrews, S.},