Mercurial > repos > devteam > fastqc
changeset 12:484e86282f4b draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/fastqc commit 4b383d48868d7f3f6d35f242a0ee35953adcb037
| author | iuc |
|---|---|
| date | Mon, 15 May 2017 08:34:57 -0400 |
| parents | db2dc6bc8f05 |
| children | 9337dd1fbc66 |
| files | rgFastQC.xml |
| diffstat | 1 files changed, 4 insertions(+), 3 deletions(-) [+] |
line wrap: on
line diff
--- a/rgFastQC.xml Thu Apr 20 11:06:17 2017 -0400 +++ b/rgFastQC.xml Mon May 15 08:34:57 2017 -0400 @@ -25,7 +25,8 @@ #end if ]]></command> <inputs> - <param format="fastq,fastq.gz,fastq.bz2,bam,sam" name="input_file" type="data" label="Short read data from your current history" /> + <param format="fastq,fastq.gz,fastq.bz2,bam,sam" name="input_file" type="data" + label="Short read data from your current history" /> <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA" /> <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file" @@ -88,7 +89,7 @@ This is a Galaxy wrapper. It merely exposes the external package FastQC_ which is documented at FastQC_ Kindly acknowledge it as well as this tool if you use it. -FastQC incorporates the Picard-tools_ libraries for sam/bam processing. +FastQC incorporates the Picard-tools_ libraries for SAM/BAM processing. The contaminants file parameter was borrowed from the independently developed fastqcwrapper contributed to the Galaxy Community Tool Shed by J. Johnson. @@ -125,7 +126,7 @@ All except Basic Statistics and Overrepresented sequences are plots. .. _FastQC: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ - .. _Picard-tools: http://picard.sourceforge.net/index.shtml + .. _Picard-tools: https://broadinstitute.github.io/picard/ </help> <citations> <citation type="bibtex">