comparison rgFastQC.xml @ 1:8fae48caaf06 draft

Uploaded form GH

0:e28c965eeed4

<tool name="FastQC:Read QC" id="fastqc" version="0.52">
  <description>reports using FastQC</description>
  <command interpreter="python">
    rgFastQC.py -i "$input_file" -d "$html_file.files_path" -o "$html_file" -n "$out_prefix" -f "$input_file.ext" -j "$input_file.name" -e "\$JAVA_JAR_PATH/fastqc"
#if $contaminants.dataset and str($contaminants) > ''
-c "$contaminants"
#end if
  </command>
  <requirements>
    <requirement type="package" version="0.10.1">FastQC</requirement>
  </requirements>
  <inputs>
    <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" />
    <param name="out_prefix" value="FastQC" type="text" label="Title for the output file - to remind you what the job was for" size="80"
      help="Letters and numbers only please - other characters will be removed">
    <sanitizer invalid_char="">
        <valid initial="string.letters,string.digits"/>
    </sanitizer>
    </param>
    <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" 
           help="tab delimited file with 2 columns: name and sequence.  For example: Illumina Small RNA RT Primer	CAAGCAGAAGACGGCATACGA"/>
  </inputs>
  <outputs>
    <data format="html" name="html_file"  label="${out_prefix}_${input_file.name}.html" />
  </outputs>
  <tests>
    <test>
      <param name="input_file" value="1000gsample.fastq" />
      <param name="out_prefix" value="fastqc_out" />
      <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" />
      <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/>
    </test>
  </tests>
  <help>

.. class:: infomark

Kindly acknowledge it as well as this tool if you use it.
FastQC incorporates the Picard-tools_ libraries for sam/bam processing.

The contaminants file parameter was borrowed from the independently developed
fastqcwrapper contributed to the Galaxy Community Tool Shed by J. Johnson.

-----

.. class:: infomark

FastQC_ is the best place to look for documentation - it's very good. 
A summary follows below for those in a tearing hurry.

This wrapper will accept a Galaxy fastq, sam or bam as the input read file to check.
It will also take an optional file containing a list of contaminants information, in the form of
a tab-delimited file with 2 columns, name and sequence.

The tool produces a single HTML output file that contains all of the results, including the following:

- Basic Statistics
- Per base sequence quality
- Per sequence quality scores
- Per base sequence content

1:8fae48caaf06

<tool name="FastQC:Read QC" id="fastqc" version="0.62">
  <description>reports using FastQC</description>
  <command interpreter="python">
    rgFastQC.py -i "$input_file" -d "$html_file.files_path" -o "$html_file" -t "$text_file" -n "$out_prefix" -f "$input_file.ext" -j "$input_file.name" -e "\$FASTQC_JAR_PATH/fastqc"
#if $contaminants.dataset and str($contaminants) > ''
-c "$contaminants"
#end if
#if $limits.dataset and str($limits) > ''
-l "$limits"
#end if
  </command>
  <requirements>
    <requirement type="package" version="0.11.2">FastQC</requirement>
  </requirements>
  <inputs>
    <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" />
    <param name="out_prefix" value="FastQC" type="text" label="Title for the output file - to remind you what the job was for" size="80"
      help="Letters and numbers only please - other characters will be removed">
    <sanitizer invalid_char="">
        <valid initial="string.letters,string.digits"/>
    </sanitizer>
    </param>
    <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" 
           help="tab delimited file with 2 columns: name and sequence.  For example: Illumina Small RNA RT Primer   CAAGCAGAAGACGGCATACGA"/>
    <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file"
	   help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" />
  </inputs>
  <outputs>
    <data format="html" name="html_file"  label="${out_prefix}_${input_file.name}_Webpage.html" />
    <data format="txt" name="text_file"  label="${out_prefix}_${input_file.name}_RawData.txt" />
  </outputs>
  <tests>
    <test>
      <param name="input_file" value="1000gsample.fastq" />
      <param name="out_prefix" value="fastqc_out" />
      <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" />
      <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/>
      <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="100"/>
    </test>
    <test>
      <param name="input_file" value="1000gsample.fastq" />
      <param name="out_prefix" value="fastqc_out" />
      <param name="limits" value="fastqc_customlimits.txt" ftype="txt" />
      <output name="html_file" file="fastqc_report2.html" ftype="html" lines_diff="100"/>
      <output name="text_file" file="fastqc_data2.txt" ftype="txt" lines_diff="100"/>
    </test>
  </tests>
  <help>

.. class:: infomark

Kindly acknowledge it as well as this tool if you use it.
FastQC incorporates the Picard-tools_ libraries for sam/bam processing.

The contaminants file parameter was borrowed from the independently developed
fastqcwrapper contributed to the Galaxy Community Tool Shed by J. Johnson.
Adaption to version 0.11.2 by T. McGowan.

-----

.. class:: infomark

FastQC_ is the best place to look for documentation - it's very good. 
A summary follows below for those in a tearing hurry.

This wrapper will accept a Galaxy fastq, sam or bam as the input read file to check.
It will also take an optional file containing a list of contaminants information, in the form of
a tab-delimited file with 2 columns, name and sequence. As another option the tool takes a custom
limits.txt file that allows setting the warning thresholds for the different modules and also specifies
which modules to include in the output.

The tool produces a basic text and a HTML output file that contain all of the results, including the following:

- Basic Statistics
- Per base sequence quality
- Per sequence quality scores
- Per base sequence content