diff rgFastQC.xml @ 1:8fae48caaf06 draft

Uploaded form GH

--- a/rgFastQC.xml	Mon Jan 27 09:29:14 2014 -0500
+++ b/rgFastQC.xml	Tue Nov 11 12:46:27 2014 -0500
@@ -1,13 +1,16 @@
-<tool name="FastQC:Read QC" id="fastqc" version="0.52">
+<tool name="FastQC:Read QC" id="fastqc" version="0.62">
   <description>reports using FastQC</description>
   <command interpreter="python">
-    rgFastQC.py -i "$input_file" -d "$html_file.files_path" -o "$html_file" -n "$out_prefix" -f "$input_file.ext" -j "$input_file.name" -e "\$JAVA_JAR_PATH/fastqc"
+    rgFastQC.py -i "$input_file" -d "$html_file.files_path" -o "$html_file" -t "$text_file" -n "$out_prefix" -f "$input_file.ext" -j "$input_file.name" -e "\$FASTQC_JAR_PATH/fastqc"
 #if $contaminants.dataset and str($contaminants) > ''
 -c "$contaminants"
 #end if
+#if $limits.dataset and str($limits) > ''
+-l "$limits"
+#end if
   </command>
   <requirements>
-    <requirement type="package" version="0.10.1">FastQC</requirement>
+    <requirement type="package" version="0.11.2">FastQC</requirement>
   </requirements>
   <inputs>
     <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" />
@@ -18,10 +21,13 @@
     </sanitizer>
     </param>
     <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" 
-           help="tab delimited file with 2 columns: name and sequence.  For example: Illumina Small RNA RT Primer	CAAGCAGAAGACGGCATACGA"/>
+           help="tab delimited file with 2 columns: name and sequence.  For example: Illumina Small RNA RT Primer   CAAGCAGAAGACGGCATACGA"/>
+    <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file"
+	   help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" />
   </inputs>
   <outputs>
-    <data format="html" name="html_file"  label="${out_prefix}_${input_file.name}.html" />
+    <data format="html" name="html_file"  label="${out_prefix}_${input_file.name}_Webpage.html" />
+    <data format="txt" name="text_file"  label="${out_prefix}_${input_file.name}_RawData.txt" />
   </outputs>
   <tests>
     <test>
@@ -29,6 +35,14 @@
       <param name="out_prefix" value="fastqc_out" />
       <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" />
       <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/>
+      <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="100"/>
+    </test>
+    <test>
+      <param name="input_file" value="1000gsample.fastq" />
+      <param name="out_prefix" value="fastqc_out" />
+      <param name="limits" value="fastqc_customlimits.txt" ftype="txt" />
+      <output name="html_file" file="fastqc_report2.html" ftype="html" lines_diff="100"/>
+      <output name="text_file" file="fastqc_data2.txt" ftype="txt" lines_diff="100"/>
     </test>
   </tests>
   <help>
@@ -65,6 +79,7 @@
 
 The contaminants file parameter was borrowed from the independently developed
 fastqcwrapper contributed to the Galaxy Community Tool Shed by J. Johnson.
+Adaption to version 0.11.2 by T. McGowan.
 
 -----
 
@@ -77,9 +92,11 @@
 
 This wrapper will accept a Galaxy fastq, sam or bam as the input read file to check.
 It will also take an optional file containing a list of contaminants information, in the form of
-a tab-delimited file with 2 columns, name and sequence.
+a tab-delimited file with 2 columns, name and sequence. As another option the tool takes a custom
+limits.txt file that allows setting the warning thresholds for the different modules and also specifies
+which modules to include in the output.
 
-The tool produces a single HTML output file that contains all of the results, including the following:
+The tool produces a basic text and a HTML output file that contain all of the results, including the following:
 
 - Basic Statistics
 - Per base sequence quality