Mercurial > repos > devteam > fastqc
comparison rgFastQC.xml @ 10:a00a6402d09a draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/fastqc commit 2bfbb5ae6b801e43355fdc3f964a5111fe3fe3a1
author | iuc |
---|---|
date | Wed, 08 Feb 2017 12:43:43 -0500 |
parents | 3a458e268066 |
children | db2dc6bc8f05 |
comparison
equal
deleted
inserted
replaced
9:3a458e268066 | 10:a00a6402d09a |
---|---|
8 <exit_code range=":-1" /> | 8 <exit_code range=":-1" /> |
9 <regex match="Error:" /> | 9 <regex match="Error:" /> |
10 <regex match="Exception:" /> | 10 <regex match="Exception:" /> |
11 </stdio> | 11 </stdio> |
12 <command><![CDATA[ | 12 <command><![CDATA[ |
13 python '$__tool_directory__'/rgFastQC.py | 13 python '${__tool_directory__}/rgFastQC.py' |
14 -i "$input_file" | 14 -i '$input_file' |
15 -d "$html_file.files_path" | 15 -d '${html_file.files_path}' |
16 -o "$html_file" | 16 -o '$html_file' |
17 -t "$text_file" | 17 -t '$text_file' |
18 -f "$input_file.ext" | 18 -f '${input_file.ext}' |
19 -j "$input_file.name" | 19 -j '${input_file.name}' |
20 #if $contaminants.dataset and str($contaminants) > '' | 20 #if $contaminants.dataset and str($contaminants) > '' |
21 -c "$contaminants" | 21 -c '$contaminants' |
22 #end if | 22 #end if |
23 #if $limits.dataset and str($limits) > '' | 23 #if $limits.dataset and str($limits) > '' |
24 -l "$limits" | 24 -l '$limits' |
25 #end if | 25 #end if |
26 ]]></command> | 26 ]]></command> |
27 <inputs> | 27 <inputs> |
28 <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" /> | 28 <param format="fastq,fastq.gz,fastq.bz2,bam,sam" name="input_file" type="data" label="Short read data from your current history" /> |
29 <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" | 29 <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" |
30 help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/> | 30 help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA" /> |
31 <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file" | 31 <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file" |
32 help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" /> | 32 help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" /> |
33 </inputs> | 33 </inputs> |
34 <outputs> | 34 <outputs> |
35 <data format="html" name="html_file" label="${tool.name} on ${on_string}: Webpage" /> | 35 <data format="html" name="html_file" label="${tool.name} on ${on_string}: Webpage" /> |
36 <data format="txt" name="text_file" label="${tool.name} on ${on_string}: RawData" /> | 36 <data format="txt" name="text_file" label="${tool.name} on ${on_string}: RawData" /> |
37 </outputs> | 37 </outputs> |
47 <param name="limits" value="fastqc_customlimits.txt" ftype="txt" /> | 47 <param name="limits" value="fastqc_customlimits.txt" ftype="txt" /> |
48 <output name="html_file" file="fastqc_report2.html" ftype="html" compare="sim_size" delta="4096"/> | 48 <output name="html_file" file="fastqc_report2.html" ftype="html" compare="sim_size" delta="4096"/> |
49 <output name="text_file" file="fastqc_data2.txt" ftype="txt" compare="sim_size"/> | 49 <output name="text_file" file="fastqc_data2.txt" ftype="txt" compare="sim_size"/> |
50 </test> | 50 </test> |
51 <test> | 51 <test> |
52 <param name="input_file" value="1000gsample.fastq.gz" /> | 52 <param name="input_file" value="1000gsample.fastq.gz" ftype="fastq.gz" /> |
53 <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" /> | |
54 <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/> | |
55 <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="100"/> | |
56 </test> | |
57 <test> | |
58 <param name="input_file" value="1000gsample.fastq.bz2" ftype="fastq.bz2" /> | |
53 <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" /> | 59 <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" /> |
54 <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/> | 60 <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/> |
55 <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="100"/> | 61 <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="100"/> |
56 </test> | 62 </test> |
57 </tests> | 63 </tests> |
58 <help> | 64 <help> |
59 | |
60 .. class:: infomark | 65 .. class:: infomark |
61 | 66 |
62 **Purpose** | 67 **Purpose** |
63 | 68 |
64 FastQC aims to provide a simple way to do some quality control checks on raw | 69 FastQC aims to provide a simple way to do some quality control checks on raw |
67 impression of whether your data has any problems of | 72 impression of whether your data has any problems of |
68 which you should be aware before doing any further analysis. | 73 which you should be aware before doing any further analysis. |
69 | 74 |
70 The main functions of FastQC are: | 75 The main functions of FastQC are: |
71 | 76 |
72 - Import of data from BAM, SAM or FastQ/FastQ.gz files (any variant), | 77 - Import of data from BAM, SAM or FastQ/FastQ.gz files (any variant), |
73 - Providing a quick overview to tell you in which areas there may be problems | 78 - Providing a quick overview to tell you in which areas there may be problems |
74 - Summary graphs and tables to quickly assess your data | 79 - Summary graphs and tables to quickly assess your data |
75 - Export of results to an HTML based permanent report | 80 - Export of results to an HTML based permanent report |
76 - Offline operation to allow automated generation of reports without running the interactive application | 81 - Offline operation to allow automated generation of reports without running the interactive application |
77 | 82 |
78 | |
79 ----- | 83 ----- |
80 | |
81 | 84 |
82 .. class:: infomark | 85 .. class:: infomark |
83 | 86 |
84 **FastQC** | 87 **FastQC** |
85 | 88 |
121 - Kmer Content | 124 - Kmer Content |
122 | 125 |
123 All except Basic Statistics and Overrepresented sequences are plots. | 126 All except Basic Statistics and Overrepresented sequences are plots. |
124 .. _FastQC: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/ | 127 .. _FastQC: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/ |
125 .. _Picard-tools: http://picard.sourceforge.net/index.shtml | 128 .. _Picard-tools: http://picard.sourceforge.net/index.shtml |
126 | |
127 </help> | 129 </help> |
128 <citations> | 130 <citations> |
129 <citation type="bibtex"> | 131 <citation type="bibtex"> |
130 @ARTICLE{andrews_s, | 132 @unpublished{andrews_s, |
131 author = {Andrews, S.}, | 133 author = {Andrews, S.}, |
132 keywords = {bioinformatics, ngs, qc}, | 134 keywords = {bioinformatics, ngs, qc}, |
133 priority = {2}, | 135 priority = {2}, |
134 title = {{FastQC A Quality Control tool for High Throughput Sequence Data}}, | 136 title = {{FastQC A Quality Control tool for High Throughput Sequence Data}}, |
135 url = {http://www.bioinformatics.babraham.ac.uk/projects/fastqc/} | 137 url = {http://www.bioinformatics.babraham.ac.uk/projects/fastqc/} |