diff rgFastQC.xml @ 10:a00a6402d09a draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/fastqc commit 2bfbb5ae6b801e43355fdc3f964a5111fe3fe3a1

--- a/rgFastQC.xml	Wed Nov 02 16:12:51 2016 -0400
+++ b/rgFastQC.xml	Wed Feb 08 12:43:43 2017 -0500
@@ -10,26 +10,26 @@
         <regex match="Exception:" />
     </stdio>
     <command><![CDATA[
-        python '$__tool_directory__'/rgFastQC.py
-        -i "$input_file"
-        -d "$html_file.files_path"
-        -o "$html_file"
-        -t "$text_file"
-        -f "$input_file.ext"
-        -j "$input_file.name"
-        #if $contaminants.dataset and str($contaminants) > ''
-            -c "$contaminants"
-        #end if
-        #if $limits.dataset and str($limits) > ''
-            -l "$limits"
-        #end if
+        python '${__tool_directory__}/rgFastQC.py'
+            -i '$input_file'
+            -d '${html_file.files_path}'
+            -o '$html_file'
+            -t '$text_file'
+            -f '${input_file.ext}'
+            -j '${input_file.name}'
+            #if $contaminants.dataset and str($contaminants) > ''
+                -c '$contaminants'
+            #end if
+            #if $limits.dataset and str($limits) > ''
+                -l '$limits'
+            #end if
     ]]></command>
     <inputs>
-        <param format="fastqsanger,fastq,bam,sam" name="input_file" type="data" label="Short read data from your current history" />
+        <param format="fastq,fastq.gz,fastq.bz2,bam,sam" name="input_file" type="data" label="Short read data from your current history" />
         <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list"
-            help="tab delimited file with 2 columns: name and sequence.  For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/>
+               help="tab delimited file with 2 columns: name and sequence.  For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA" />
         <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file"
-            help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" />
+               help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" />
     </inputs>
     <outputs>
         <data format="html" name="html_file" label="${tool.name} on ${on_string}: Webpage" />
@@ -49,14 +49,19 @@
             <output name="text_file" file="fastqc_data2.txt" ftype="txt" compare="sim_size"/>
         </test>
         <test>
-            <param name="input_file" value="1000gsample.fastq.gz" />
+            <param name="input_file" value="1000gsample.fastq.gz" ftype="fastq.gz" />
+            <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" />
+            <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/>
+            <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="100"/>
+        </test>
+        <test>
+            <param name="input_file" value="1000gsample.fastq.bz2" ftype="fastq.bz2" />
             <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" />
             <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/>
             <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="100"/>
         </test>
     </tests>
     <help>
-
 .. class:: infomark
 
 **Purpose**
@@ -69,16 +74,14 @@
 
 The main functions of FastQC are:
 
-- Import of data from BAM, SAM or FastQ/FastQ.gz files (any variant), 
+- Import of data from BAM, SAM or FastQ/FastQ.gz files (any variant),
 - Providing a quick overview to tell you in which areas there may be problems
 - Summary graphs and tables to quickly assess your data
 - Export of results to an HTML based permanent report
 - Offline operation to allow automated generation of reports without running the interactive application
 
-
 -----
 
-
 .. class:: infomark
 
 **FastQC**
@@ -123,11 +126,10 @@
 All except Basic Statistics and Overrepresented sequences are plots.
  .. _FastQC: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/
  .. _Picard-tools: http://picard.sourceforge.net/index.shtml
-
     </help>
     <citations>
         <citation type="bibtex">
-        @ARTICLE{andrews_s,
+        @unpublished{andrews_s,
             author = {Andrews, S.},
             keywords = {bioinformatics, ngs, qc},
             priority = {2},