Mercurial > repos > devteam > fastqc
changeset 2:d2cf2c0c8a11 draft
Uploaded from GH
| author | devteam |
|---|---|
| date | Wed, 12 Nov 2014 14:38:48 -0500 |
| parents | 8fae48caaf06 |
| children | 0b201de108b9 |
| files | rgFastQC.xml shed_upload.tar.gz |
| diffstat | 2 files changed, 28 insertions(+), 9 deletions(-) [+] |
line wrap: on
line diff
--- a/rgFastQC.xml Tue Nov 11 12:46:27 2014 -0500 +++ b/rgFastQC.xml Wed Nov 12 14:38:48 2014 -0500 @@ -1,13 +1,21 @@ <tool name="FastQC:Read QC" id="fastqc" version="0.62"> <description>reports using FastQC</description> <command interpreter="python"> - rgFastQC.py -i "$input_file" -d "$html_file.files_path" -o "$html_file" -t "$text_file" -n "$out_prefix" -f "$input_file.ext" -j "$input_file.name" -e "\$FASTQC_JAR_PATH/fastqc" -#if $contaminants.dataset and str($contaminants) > '' --c "$contaminants" -#end if -#if $limits.dataset and str($limits) > '' --l "$limits" -#end if + rgFastQC.py + -i "$input_file" + -d "$html_file.files_path" + -o "$html_file" + -t "$text_file" + -n "$out_prefix" + -f "$input_file.ext" + -j "$input_file.name" + -e "\$FASTQC_JAR_PATH/fastqc" + #if $contaminants.dataset and str($contaminants) > '' + -c "$contaminants" + #end if + #if $limits.dataset and str($limits) > '' + -l "$limits" + #end if </command> <requirements> <requirement type="package" version="0.11.2">FastQC</requirement> @@ -23,7 +31,7 @@ <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list" help="tab delimited file with 2 columns: name and sequence. For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA"/> <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file" - help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" /> + help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" /> </inputs> <outputs> <data format="html" name="html_file" label="${out_prefix}_${input_file.name}_Webpage.html" /> @@ -114,5 +122,16 @@ .. _FastQC: http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/ .. _Picard-tools: http://picard.sourceforge.net/index.shtml -</help> + </help> + <citations> + <citation type="bibtex"> + @ARTICLE{andrews_s, + author = {Andrews, S.}, + keywords = {bioinformatics, ngs, qc}, + priority = {2}, + title = {{FastQC A Quality Control tool for High Throughput Sequence Data}}, + url = {http://www.bioinformatics.babraham.ac.uk/projects/fastqc/} + } + </citation> + </citations> </tool>