Mercurial > repos > devteam > fastx_clipper

comparison fastx_clipper.xml @ 2:bdf1ce174e39 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_clipper commit a1517c9d22029095120643bbe2c8fa53754dd2b7
author devteam
date Wed, 11 Nov 2015 12:38:51 -0500
parents 8192b4014977
children 85263dc18cec
comparison
equal deleted inserted replaced
1:8192b4014977 2:bdf1ce174e39
1 <tool id="cshl_fastx_clipper" name="Clip" version="1.0.1" > 1 <tool id="cshl_fastx_clipper" name="Clip" version="1.0.1">
2 <description>adapter sequences</description> 2 <description>adapter sequences</description>
3 <requirements> 3 <requirements>
4 <requirement type="package" version="0.0.13">fastx_toolkit</requirement> 4 <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
5 </requirements> 5 </requirements>
6 <command> 6 <command>
7 zcat -f $input | fastx_clipper -l $minlength -a $clip_source.clip_sequence -d $keepdelta -o $output -v $KEEP_N $DISCARD_OPTIONS 7 <![CDATA[
8 zcat -f < '$input' | fastx_clipper -l $minlength -a '$clip_source.clip_sequence' -d $keepdelta -o '$output' -v $KEEP_N $DISCARD_OPTIONS
8 #if $input.ext == "fastqsanger": 9 #if $input.ext == "fastqsanger":
9 -Q 33 10 -Q 33
10 #end if 11 #end if
11 </command> 12 ]]>
12 13 </command>
13 <inputs>
14 <param format="fasta,fastqsanger,fastqsolexa,fastqillumina" name="input" type="data" label="Library to clip" />
15
16 <param name="minlength" size="4" type="integer" value="15">
17 <label>Minimum sequence length (after clipping, sequences shorter than this length will be discarded)</label>
18 </param>
19 14
20 <conditional name="clip_source"> 15 <inputs>
21 <param name="clip_source_list" type="select" label="Source"> 16 <param format="fasta,fastqsanger,fastqsolexa,fastqillumina" name="input" type="data" label="Library to clip" />
22 <option value="prebuilt" selected="true">Standard (select from the list below)</option>
23 <option value="user">Enter custom sequence</option>
24 </param>
25 17
26 <when value="user"> 18 <param name="minlength" type="integer" value="15">
27 <param name="clip_sequence" size="30" label="Enter custom clipping sequence" type="text" value="AATTGGCC" /> 19 <label>Minimum sequence length (after clipping, sequences shorter than this length will be discarded)</label>
28 </when> 20 </param>
29 21
30 <when value="prebuilt"> 22 <conditional name="clip_source">
31 <param name="clip_sequence" type="select" label="Choose Adapter"> 23 <param name="clip_source_list" type="select" label="Source">
32 <options from_file="fastx_clipper_sequences.txt"> 24 <option value="prebuilt" selected="true">Standard (select from the list below)</option>
33 <column name="name" index="1"/> 25 <option value="user">Enter custom sequence</option>
34 <column name="value" index="0"/> 26 </param>
35 </options>
36 </param>
37 </when>
38 </conditional>
39 27
40 <param name="keepdelta" size="2" type="integer" value="0"> 28 <when value="user">
41 <label>enter non-zero value to keep the adapter sequence and x bases that follow it</label> 29 <param name="clip_sequence" label="Enter custom clipping sequence" type="text" value="AATTGGCC" />
42 <help>use this for hairpin barcoding. keep at 0 unless you know what you're doing.</help> 30 </when>
43 </param>
44 31
45 <param name="KEEP_N" type="select" label="Discard sequences with unknown (N) bases"> 32 <when value="prebuilt">
46 <option value="">Yes</option> 33 <param name="clip_sequence" type="select" label="Choose Adapter">
47 <option value="-n">No</option> 34 <options from_file="fastx_clipper_sequences.txt">
48 </param> 35 <column name="name" index="1"/>
36 <column name="value" index="0"/>
37 </options>
38 </param>
39 </when>
40 </conditional>
49 41
50 <param name="DISCARD_OPTIONS" type="select" label="Output options"> 42 <param name="keepdelta" type="integer" value="0">
51 <option value="-c">Output only clipped sequences (i.e. sequences which contained the adapter)</option> 43 <label>enter non-zero value to keep the adapter sequence and x bases that follow it</label>
52 <option value="-C">Output only non-clipped sequences (i.e. sequences which did not contained the adapter)</option> 44 <help>use this for hairpin barcoding. keep at 0 unless you know what you're doing.</help>
53 <option value="">Output both clipped and non-clipped sequences</option> 45 </param>
54 </param>
55 46
56 </inputs> 47 <param name="KEEP_N" type="select" label="Discard sequences with unknown (N) bases">
57 <!-- 48 <option value="">Yes</option>
58 #functional test with param value starting with - fails. 49 <option value="-n">No</option>
59 --> 50 </param>
60 <tests> 51
61 <test> 52 <param name="DISCARD_OPTIONS" type="select" label="Output options">
62 <param name="input" value="fastx_clipper1.fastq" ftype="fastqsolexa"/> 53 <option value="-c">Output only clipped sequences (i.e. sequences which contained the adapter)</option>
63 <param name="maxmismatches" value="2" /> 54 <option value="-C">Output only non-clipped sequences (i.e. sequences which did not contained the adapter)</option>
64 <param name="minlength" value="15" /> 55 <option value="">Output both clipped and non-clipped sequences</option>
65 <param name="clip_source_list" value="user" /> 56 </param>
66 <param name="clip_sequence" value="CAATTGGTTAATCCCCCTATATA" /> 57 </inputs>
67 <param name="keepdelta" value="0" /> 58 <outputs>
68 <param name="KEEP_N" value="+-n" /> 59 <data format_source="input" name="output" metadata_source="input" />
69 <param name="DISCARD_OPTIONS" value="+-c" /> 60 </outputs>
70 <output name="output" file="fastx_clipper1a.out" /> 61 <tests>
71 </test> 62 <test>
72 </tests> 63 <param name="input" value="fastx_clipper1.fastq" ftype="fastqsolexa"/>
73 <outputs> 64 <param name="maxmismatches" value="2" />
74 <data format="input" name="output" metadata_source="input" /> 65 <param name="minlength" value="15" />
75 </outputs> 66 <param name="clip_source_list" value="user" />
76 67 <param name="clip_sequence" value="CAATTGGTTAATCCCCCTATATA" />
77 <help> 68 <param name="keepdelta" value="0" />
69 <param name="KEEP_N" value="-n" />
70 <param name="DISCARD_OPTIONS" value="-c" />
71 <output name="output" ftype="fastqsolexa" file="fastx_clipper1a.out" />
72 </test>
73 </tests>
74 <help>
78 **What it does** 75 **What it does**
79 76
80 This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file. 77 This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file.
81 78
82 -------- 79 --------
83 80
84 81
85 **Clipping Illustration:** 82 **Clipping Illustration:**
86 83
87 .. image:: fastx_clipper_illustration.png 84 .. image:: fastx_clipper_illustration.png
88
89
90
91
92
93
94
95 85
96 **Clipping Example:** 86 **Clipping Example:**
97 87
98 .. image:: fastx_clipper_example.png 88 .. image:: fastx_clipper_example.png
99 89
100
101
102 **In the above example:** 90 **In the above example:**
103 91
104 * Sequence no. 1 was discarded since it wasn't clipped (i.e. didn't contain the adapter sequence). (**Output** parameter). 92 * Sequence no. 1 was discarded since it wasn't clipped (i.e. didn't contain the adapter sequence). (**Output** parameter).
105 * Sequence no. 5 was discarded --- it's length (after clipping) was shorter than 15 nt (**Minimum Sequence Length** parameter). 93 * Sequence no. 5 was discarded --- it's length (after clipping) was shorter than 15 nt (**Minimum Sequence Length** parameter).
106
107
108
109 94
110 ------ 95 ------
111 96
112 This tool is based on `FASTX-toolkit`__ by Assaf Gordon. 97 This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
113 98
114 .. __: http://hannonlab.cshl.edu/fastx_toolkit/ 99 .. __: http://hannonlab.cshl.edu/fastx_toolkit/
115 100 </help>
116 </help>
117 </tool> 101 </tool>