annotate fastx_renamer.xml @ 4:b29d37ca9e41 draft default tip

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit 4c002e52261da2e7609735883d91fa1610ce6ce7"
author iuc
date Thu, 30 Jan 2020 13:30:44 -0500
parents 3599f5451ee2
children
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
4
b29d37ca9e41 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit 4c002e52261da2e7609735883d91fa1610ce6ce7"
iuc
parents: 3
diff changeset
1 <tool id="cshl_fastx_renamer" name="Rename sequences" version="@VERSION@+galaxy1" >
1
02f8a17a4ebd planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 0
diff changeset
2 <description></description>
2
d8a3d31554d7 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 1
diff changeset
3 <macros>
d8a3d31554d7 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 1
diff changeset
4 <import>macros.xml</import>
d8a3d31554d7 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 1
diff changeset
5 </macros>
4
b29d37ca9e41 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit 4c002e52261da2e7609735883d91fa1610ce6ce7"
iuc
parents: 3
diff changeset
6 <expand macro="requirements">
b29d37ca9e41 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit 4c002e52261da2e7609735883d91fa1610ce6ce7"
iuc
parents: 3
diff changeset
7 <requirement type="package" version="1.0.8">bzip2</requirement>
b29d37ca9e41 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit 4c002e52261da2e7609735883d91fa1610ce6ce7"
iuc
parents: 3
diff changeset
8 </expand>
2
d8a3d31554d7 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 1
diff changeset
9 <command detect_errors="exit_code"><![CDATA[
d8a3d31554d7 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 1
diff changeset
10 @CATS@ fastx_renamer
d8a3d31554d7 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 1
diff changeset
11 -n $TYPE
d8a3d31554d7 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 1
diff changeset
12 -v
d8a3d31554d7 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 1
diff changeset
13 @FQQUAL@
4
b29d37ca9e41 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit 4c002e52261da2e7609735883d91fa1610ce6ce7"
iuc
parents: 3
diff changeset
14 @GZIP@ > '$output'
2
d8a3d31554d7 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 1
diff changeset
15 ]]></command>
0
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
16
1
02f8a17a4ebd planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 0
diff changeset
17 <inputs>
2
d8a3d31554d7 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 1
diff changeset
18 <expand macro="fastx_input" />
0
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
19
1
02f8a17a4ebd planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 0
diff changeset
20 <param name="TYPE" type="select" label="Rename sequence identifiers to">
02f8a17a4ebd planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 0
diff changeset
21 <option value="SEQ">Nucleotides sequence</option>
02f8a17a4ebd planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 0
diff changeset
22 <option value="COUNT">Numeric Counter</option>
02f8a17a4ebd planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 0
diff changeset
23 </param>
02f8a17a4ebd planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 0
diff changeset
24 </inputs>
0
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
25
1
02f8a17a4ebd planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 0
diff changeset
26 <outputs>
2
d8a3d31554d7 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 1
diff changeset
27 <data name="output" format_source="input" metadata_source="input" />
1
02f8a17a4ebd planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 0
diff changeset
28 </outputs>
02f8a17a4ebd planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 0
diff changeset
29 <tests>
2
d8a3d31554d7 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 1
diff changeset
30 <test>
d8a3d31554d7 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 1
diff changeset
31 <param name="input" value="fastx_renamer-in1.fastq" />
d8a3d31554d7 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 1
diff changeset
32 <param name="TYPE" value="SEQ" />
d8a3d31554d7 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 1
diff changeset
33 <output name="output" file="fastx_renamer-out1.fastq" />
d8a3d31554d7 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 1
diff changeset
34 </test>
1
02f8a17a4ebd planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 0
diff changeset
35 </tests>
2
d8a3d31554d7 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 1
diff changeset
36 <help><![CDATA[
0
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
37 **What it does**
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
38
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
39 This tool renames the sequence identifiers in a FASTQ/A file.
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
40
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
41 .. class:: infomark
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
42
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
43 Use this tool at the beginning of your workflow, as a way to keep the original sequence (before trimming, clipping, barcode-removal, etc).
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
44
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
45 --------
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
46
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
47 **Example**
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
48
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
49 The following Solexa-FASTQ file::
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
50
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
51 @CSHL_4_FC042GAMMII_2_1_517_596
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
52 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
53 +CSHL_4_FC042GAMMII_2_1_517_596
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
54 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
1
02f8a17a4ebd planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 0
diff changeset
55
0
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
56 Renamed to **nucleotides sequence**::
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
57
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
58 @GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
59 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
60 +GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
61 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
62
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
63 Renamed to **numeric counter**::
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
64
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
65 @1
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
66 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
67 +1
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
68 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
69
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
70 ------
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
71
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
72 This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
73
1
02f8a17a4ebd planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 0
diff changeset
74 .. __: http://hannonlab.cshl.edu/fastx_toolkit/
2
d8a3d31554d7 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 1
diff changeset
75 ]]></help>
d8a3d31554d7 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 1
diff changeset
76 <expand macro="citations" />
0
d7bce63e6e09 Uploaded tool tarball.
devteam
parents:
diff changeset
77 </tool>