diff fastx_trimmer.xml @ 3:bbb007a39ac2 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1

--- a/fastx_trimmer.xml	Wed Nov 11 12:40:14 2015 -0500
+++ b/fastx_trimmer.xml	Tue May 08 13:28:34 2018 -0400
@@ -1,30 +1,23 @@
-<tool id="cshl_fastx_trimmer" version="1.0.0" name="Trim sequences">
+<tool id="cshl_fastx_trimmer" version="1.0.1" name="Trim sequences">
     <description></description>
-    <requirements>
-        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
-    </requirements>
-    <command>
-<![CDATA[
-zcat -f < '$input' | fastx_trimmer -v -f $first -l $last -o '$output'
-#if $input.ext == "fastqsanger":
-    -Q 33
-#end if
-]]>
-    </command>
-
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements" />
+    <command detect_errors="exit_code"><![CDATA[
+@CATS@ fastx_trimmer -v
+-f $first
+-l $last
+-o '$output'
+@FQQUAL@
+    ]]></command>
     <inputs>
-        <param format="fasta,fastqsolexa,fastqsanger" name="input" type="data" label="Library to clip" />
-
-        <param name="first" type="integer" value="1">
-            <label>First base to keep</label>
-        </param>
-
-        <param name="last" type="integer" value="21">
-            <label>Last base to keep</label>
-        </param>
+        <expand macro="fastx_input" />
+        <param name="first" type="integer" value="1" label="First base to keep" />
+        <param name="last" type="integer" value="21" label="Last base to keep" />
     </inputs>
     <outputs>
-        <data format_source="input" name="output" metadata_source="input" />
+        <data name="output" format_source="input" metadata_source="input" />
     </outputs>
     <tests>
         <test>
@@ -42,7 +35,7 @@
             <output name="output" ftype="fastqsolexa" file="fastx_trimmer2.out" />
         </test>
     </tests>
-    <help>
+    <help><![CDATA[
 **What it does**
 
 This tool trims (cut bases from) sequences in a FASTA/Q file.
@@ -58,7 +51,6 @@
     >2-1
     CAGCGAGGCTTTAATGCCATTTGGCTGTAGGCACCA
 
-
 Trimming with First=1 and Last=21, we get a FASTA file with 21 bases in each sequences (starting from the first base)::
 
     >1-1
@@ -78,6 +70,7 @@
 This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
 
  .. __: http://hannonlab.cshl.edu/fastx_toolkit/
-    </help>
+    ]]></help>
+    <expand macro="citations" />
 <!-- FASTX-Trimmer is part of the FASTX-toolkit, by A.Gordon ([e-mail]) -->
 </tool>