Mercurial > repos > devteam > freebayes
changeset 12:aaf568580946 draft
Uploaded
| author | devteam |
|---|---|
| date | Fri, 20 Jun 2014 17:16:05 -0400 |
| parents | e9ebed0c12f6 |
| children | 2dd40b601766 |
| files | freebayes.xml sam_fa_indices.loc.sample test-data/fake_phiX_reads_1.bam test-data/freebayes-phix174-test1.vcf test-data/freebayes-phix174.bam test-data/freebayes-phix174.fasta test-data/freebayes_out_1.output_trace test-data/freebayes_out_1.vcf.contains test-data/phiX.fasta tool-data/sam_fa_indices.loc.sample tool-data/tool_data_table_conf.xml.sample tool_data_table_conf.xml.sample tool_dependencies.xml |
| diffstat | 13 files changed, 65 insertions(+), 814 deletions(-) [+] |
line wrap: on
line diff
--- a/freebayes.xml Mon Feb 17 10:53:56 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,680 +0,0 @@ -<?xml version="1.0"?> -<tool id="freebayes" name="FreeBayes" version="0.0.3"> - <requirements> - <requirement type="package" version="0.9.6_9608597d12e127c847ae03aa03440ab63992fedf">freebayes</requirement> - <requirement type="package" version="0.1.18">samtools</requirement> - </requirements> - <description> - Bayesian genetic variant detector</description> - <command> - ##set up input files - #set $reference_fasta_filename = "localref.fa" - #if str( $reference_source.reference_source_selector ) == "history": - ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" && - samtools faidx "${reference_fasta_filename}" 2>&1 || echo "Error running samtools faidx for FreeBayes" >&2 && - #else: - #set $reference_fasta_filename = str( $reference_source.ref_file.fields.path ) - #end if - #for $bam_count, $input_bam in enumerate( $reference_source.input_bams ): - ln -s "${input_bam.input_bam}" "localbam_${bam_count}.bam" && - ln -s "${input_bam.input_bam.metadata.bam_index}" "localbam_${bam_count}.bam.bai" && - #end for - ##finished setting up inputs - - ##start FreeBayes commandline - freebayes - #for $bam_count, $input_bam in enumerate( $reference_source.input_bams ): - --bam "localbam_${bam_count}.bam" - #end for - --fasta-reference "${reference_fasta_filename}" - - ##outputs - --vcf "${output_vcf}" - - ##advanced options - #if str( $options_type.options_type_selector ) == "advanced": - ##additional outputs - #if $options_type.output_trace_option: - --trace "${output_trace}" - #end if - #if $options_type.output_failed_alleles_option: - --failed-alleles "${output_failed_alleles_bed}" - #end if - - ##additional inputs - #if str( $options_type.target_limit_type.target_limit_type_selector ) == "limit_by_target_file": - --targets "${options_type.target_limit_type.input_target_bed}" - #elif str( $options_type.target_limit_type.target_limit_type_selector ) == "limit_by_region": - --region "${options_type.target_limit_type.region_chromosome}:${options_type.target_limit_type.region_start}..${options_type.target_limit_type.region_end}" - #end if - #if $options_type.input_sample_file: - --samples "${options_type.input_sample_file}" - #end if - #if $options_type.input_populations_file: - --populations "${options_type.input_populations_file}" - #end if - #if $options_type.input_cnv_map_bed: - --cnv-map "${options_type.input_cnv_map_bed}" - #end if - #if str( $options_type.input_variant_type.input_variant_type_selector ) == "provide_vcf": - --variant-input "${options_type.input_variant_type.input_variant_vcf}" - ${options_type.input_variant_type.only_use_input_alleles} - #end if - #if $options_type.haplotype_basis_alleles: - --haplotype-basis-alleles "${options_type.haplotype_basis_alleles}" - #end if - - - ##reporting - #if str( $options_type.section_reporting_type.section_reporting_type_selector ) == "set": - --pvar "${options_type.section_reporting_type.pvar}" - ${options_type.section_reporting_type.show_reference_repeats} - #end if - - ##population model - #if str( $options_type.section_population_model_type.section_population_model_type_selector ) == "set": - --theta "${options_type.section_population_model_type.theta}" - --ploidy "${options_type.section_population_model_type.ploidy}" - ${options_type.section_population_model_type.pooled} - #end if - - ##reference allele - #if str( $options_type.use_reference_allele_type.use_reference_allele_type_selector ) == "include_reference_allele": - --use-reference-allele - ${options_type.use_reference_allele_type.diploid_reference} - --reference-quality "${options_type.use_reference_allele_type.reference_quality_mq},${options_type.use_reference_allele_type.reference_quality_bq}" - #end if - - ##allele scope - #if str( $options_type.section_allele_scope_type.section_allele_scope_type_selector ) == "set": - ${options_type.section_allele_scope_type.no_snps} - ${options_type.section_allele_scope_type.no_indels} - ${options_type.section_allele_scope_type.no_mnps} - ${options_type.section_allele_scope_type.no_complex} - --use-best-n-alleles "${options_type.section_allele_scope_type.use_best_n_alleles}" - #if $options_type.section_allele_scope_type.max_complex_gap: - --max-complex-gap "${options_type.section_allele_scope_type.max_complex_gap}" - #end if - #end if - - ##indel realignment - ${options_type.left_align_indels} - - ##input filters - #if str( $options_type.section_input_filters_type.section_input_filters_type_selector ) == "set": - ${options_type.section_input_filters_type.use_duplicate_reads} - #if str( $options_type.section_input_filters_type.quality_filter_type.quality_filter_type_selector ) == "apply_filters": - --min-mapping-quality "${options_type.section_input_filters_type.quality_filter_type.min_mapping_quality}" - --min-base-quality "${options_type.section_input_filters_type.quality_filter_type.min_base_quality}" - --min-supporting-quality "${options_type.section_input_filters_type.quality_filter_type.min_supporting_quality_mq},${options_type.section_input_filters_type.quality_filter_type.min_supporting_quality_bq}" - #elif str( $options_type.section_input_filters_type.quality_filter_type.quality_filter_type_selector ) == "standard_filters": - --standard-filters - #end if - --mismatch-base-quality-threshold "${options_type.section_input_filters_type.mismatch_base_quality_threshold}" - #if $options_type.section_input_filters_type.read_mismatch_limit: - --read-mismatch-limit "${options_type.section_input_filters_type.read_mismatch_limit}" - #end if - --read-max-mismatch-fraction "${options_type.section_input_filters_type.read_max_mismatch_fraction}" - #if $options_type.section_input_filters_type.read_snp_limit: - --read-snp-limit "${options_type.section_input_filters_type.read_snp_limit}" - #end if - #if $options_type.section_input_filters_type.read_indel_limit: - --read-indel-limit "${options_type.section_input_filters_type.read_indel_limit}" - #end if - --indel-exclusion-window "${options_type.section_input_filters_type.indel_exclusion_window}" - --min-alternate-fraction "${options_type.section_input_filters_type.min_alternate_fraction}" - --min-alternate-count "${options_type.section_input_filters_type.min_alternate_count}" - --min-alternate-qsum "${options_type.section_input_filters_type.min_alternate_qsum}" - --min-alternate-total "${options_type.section_input_filters_type.min_alternate_total}" - --min-coverage "${options_type.section_input_filters_type.min_coverage}" - #end if - - ##bayesian priors - #if str( $options_type.section_bayesian_priors_type.section_bayesian_priors_type_selector ) == "set": - ${options_type.section_bayesian_priors_type.no_ewens_priors} - ${options_type.section_bayesian_priors_type.no_population_priors} - ${options_type.section_bayesian_priors_type.hwe_priors} - #end if - - ##observation prior expectations - #if str( $options_type.section_observation_prior_expectations_type.section_observation_prior_expectations_type_selector ) == "set": - ${options_type.section_observation_prior_expectations_type.binomial_obs_priors} - ${options_type.section_observation_prior_expectations_type.allele_balance_priors} - #end if - - ##algorithmic features - #if str( $options_type.section_algorithmic_features_type.section_algorithmic_features_type_selector ) == "set": - --site-selection-max-iterations "${options_type.section_algorithmic_features_type.site_selection_max_iterations}" - --genotyping-max-iterations "${options_type.section_algorithmic_features_type.genotyping_max_iterations}" - --genotyping-max-banddepth "${options_type.section_algorithmic_features_type.genotyping_max_banddepth}" - --posterior-integration-limits "${options_type.section_algorithmic_features_type.posterior_integration_limits_n},${options_type.section_algorithmic_features_type.posterior_integration_limits_m}" - ${options_type.section_algorithmic_features_type.no_permute} - ${options_type.section_algorithmic_features_type.exclude_unobserved_genotypes} - #if $options_type.section_algorithmic_features_type.genotype_variant_threshold: - --genotype-variant-threshold "${options_type.section_algorithmic_features_type.genotype_variant_threshold}" - #end if - ${options_type.section_algorithmic_features_type.use_mapping_quality} - --read-dependence-factor "${options_type.section_algorithmic_features_type.read_dependence_factor}" - ${options_type.section_algorithmic_features_type.no_marginals} - #end if - #end if - </command> - <inputs> - <conditional name="reference_source"> - <param name="reference_source_selector" type="select" label="Choose the source for the reference list"> - <option value="cached">Locally cached</option> - <option value="history">History</option> - </param> - <when value="cached"> - <repeat name="input_bams" title="Sample BAM file" min="1"> - <param name="input_bam" type="data" format="bam" label="BAM file"> - <validator type="unspecified_build" /> - <validator type="dataset_metadata_in_data_table" table_name="sam_fa_indexes" metadata_name="dbkey" metadata_column="1" message="Sequences are not currently available for the specified build." /> - </param> - </repeat> - <param name="ref_file" type="select" label="Using reference genome"> - <options from_data_table="sam_fa_indexes"> - <!-- <filter type="sam_fa_indexes" key="dbkey" ref="input_bam" column="value"/> does not yet work in a repeat...--> - </options> - <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> - </param> - </when> - <when value="history"> <!-- FIX ME!!!! --> - <repeat name="input_bams" title="Sample BAM file" min="1"> - <param name="input_bam" type="data" format="bam" label="BAM file" /> - </repeat> - <param name="ref_file" type="data" format="fasta" label="Using reference file" /> - </when> - </conditional> - - <conditional name="options_type"> - <param name="options_type_selector" type="select" label="Basic or Advanced options"> - <option value="basic" selected="True">Basic</option> - <option value="advanced">Advanced</option> - </param> - <when value="basic"> - <!-- Do nothing here --> - </when> - <when value="advanced"> - - <!-- output --> - <param name="output_failed_alleles_option" type="boolean" truevalue="--failed-alleles" falsevalue="" checked="False" label="Write out failed alleles file" /> - <param name="output_trace_option" type="boolean" truevalue="--trace" falsevalue="" checked="False" label="Write out algorithm trace file" /> - - - <!-- input --> - <conditional name="target_limit_type"> - <param name="target_limit_type_selector" type="select" label="Limit analysis to listed targets"> - <option value="do_not_limit" selected="True">Do not limit</option> - <option value="limit_by_target_file">Limit by target file</option> - <option value="limit_by_region">Limit to region</option> - </param> - <when value="do_not_limit"> - <!-- Do nothing here --> - </when> - <when value="limit_by_target_file"> - <param name="input_target_bed" type="data" format="bed" label="Limit analysis to targets listed in the BED-format FILE." /> - </when> - <when value="limit_by_region"> - <param name="region_chromosome" type="text" label="Region Chromosome" value="" /> <!--only once? --> - <param name="region_start" type="integer" label="Region Start" value="" /> - <param name="region_end" type="integer" label="Region End" value="" /> - </when> - </conditional> - <param name="input_sample_file" type="data" format="txt" label="Limit analysis to samples listed (one per line) in the FILE" optional="True" /> - <param name="input_populations_file" type="data" format="txt" label="Populations File" optional="True" /> - <param name="input_cnv_map_bed" type="data" format="bed" label="Read a copy number map from the BED file FILE" optional="True" /> - <conditional name="input_variant_type"> - <param name="input_variant_type_selector" type="select" label="Provide variants file"> - <option value="do_not_provide" selected="True">Do not provide</option> - <option value="provide_vcf">Provide VCF file</option> - </param> - <when value="do_not_provide"> - <!-- Do nothing here --> - </when> - <when value="provide_vcf"> - <param name="input_variant_vcf" type="data" format="vcf" label="Use variants reported in VCF file as input to the algorithm" /> - <param name="only_use_input_alleles" type="boolean" truevalue="--only-use-input-alleles" falsevalue="" checked="False" label="Only provide variant calls and genotype likelihoods for sites in VCF" /> - </when> - </conditional> - <param name="haplotype_basis_alleles" type="data" format="vcf" label="Only use variant alleles provided in this input VCF for the construction of complex or haplotype alleles" optional="True" /> - - <!-- reporting --> - <conditional name="section_reporting_type"> - <param name="section_reporting_type_selector" type="select" label="Set Reporting options"> - <option value="do_not_set" selected="True">Do not set</option> - <option value="set">Set</option> - </param> - <when value="do_not_set"> - <!-- do nothing here --> - </when> - <when value="set"> - <param name="pvar" type="float" label="Report sites if the probability that there is a polymorphism at the site is greater" value="0.0001" /> - <param name="show_reference_repeats" type="boolean" truevalue="--show-reference-repeats" falsevalue="" checked="False" label="Calculate and show information about reference repeats" /> - </when> - </conditional> - - - <!-- population model --> - <conditional name="section_population_model_type"> - <param name="section_population_model_type_selector" type="select" label="Set population model options"> - <option value="do_not_set" selected="True">Do not set</option> - <option value="set">Set</option> - </param> - <when value="do_not_set"> - <!-- do nothing here --> - </when> - <when value="set"> - <param name="theta" type="float" label="expected mutation rate or pairwise nucleotide diversity among the population" value="0.001" help="This serves as the single parameter to the Ewens Sampling Formula prior model"/> - <param name="ploidy" type="integer" label="default ploidy for the analysis" value="2" /> - <param name="pooled" type="boolean" truevalue="--pooled" falsevalue="" checked="False" label="Assume that samples result from pooled sequencing" help="When using this flag, set --ploidy to the number of alleles in each sample." /> - </when> - </conditional> - - <!-- reference allele --> - <conditional name="use_reference_allele_type"> - <param name="use_reference_allele_type_selector" type="select" label="Include the reference allele in the analysis"> - <option value="do_not_include_reference_allele" selected="True">Do not include</option> - <option value="include_reference_allele">Include</option> - </param> - <when value="do_not_include_reference_allele"> - <!-- Do nothing here --> - </when> - <when value="include_reference_allele"> - <param name="diploid_reference" type="boolean" truevalue="--diploid-reference" falsevalue="" checked="False" label="Treat reference as diploid" /> - <param name="reference_quality_mq" type="integer" label="Assign mapping quality" value="100" /> - <param name="reference_quality_bq" type="integer" label="Assign base quality" value="60" /> - </when> - </conditional> - - <!-- allele scope --> - <conditional name="section_allele_scope_type"> - <param name="section_allele_scope_type_selector" type="select" label="Set allele scope options"> - <option value="do_not_set" selected="True">Do not set</option> - <option value="set">Set</option> - </param> - <when value="do_not_set"> - <!-- do nothing here --> - </when> - <when value="set"> - <param name="no_snps" type="boolean" truevalue="--no-snps" falsevalue="" checked="False" label="Ignore SNP alleles" /> - <param name="no_indels" type="boolean" truevalue="--no-indels" falsevalue="" checked="False" label="Ignore insertion and deletion alleles" /> - <param name="no_mnps" type="boolean" truevalue="--no-mnps" falsevalue="" checked="False" label="Ignore multi-nuceotide polymorphisms, MNPs" /> - <param name="no_complex" type="boolean" truevalue="--no-complex" falsevalue="" checked="False" label="Ignore complex events (composites of other classes)" /> - <param name="use_best_n_alleles" type="integer" label="Evaluate only the best N SNP alleles" value="0" min="0" help="Ranked by sum of supporting quality scores; Set to 0 to use all" /> - <param name="max_complex_gap" type="integer" label="Allow complex alleles with contiguous embedded matches of up to this length" value="" optional="True"/> - </when> - </conditional> - - <!-- indel realignment --> - <!-- in FreeBayes < 0.9.9 the default is to not left-align indels and the available option is - -left-align-indels, - in FreeBayes >= 0.9.9 the default is to left-align indels and the available option is - -dont-left-align-indels --> - <param name="left_align_indels" type="boolean" truevalue="--left-align-indels" falsevalue="" checked="False" label="Left align indels" /> - - <!-- input filters --> - <conditional name="section_input_filters_type"> - <param name="section_input_filters_type_selector" type="select" label="Set input filters options"> - <option value="do_not_set" selected="True">Do not set</option> - <option value="set">Set</option> - </param> - <when value="do_not_set"> - <!-- do nothing here --> - </when> - <when value="set"> - <param name="use_duplicate_reads" type="boolean" truevalue="--use-duplicate-reads" falsevalue="" checked="False" label="Include duplicate-marked alignments in the analysis" /> - <conditional name="quality_filter_type"> - <param name="quality_filter_type_selector" type="select" label="Apply Quality filters"> - <option value="standard_filters" selected="True">Apply standard</option> - <option value="apply_filters">Apply specified</option> - </param> - <when value="standard_filters"> - <!-- Do nothing here --> <!-- standard-filters --> - </when> - <when value="apply_filters"> - <param name="min_mapping_quality" type="integer" label="Exclude alignments from analysis if they have a mapping quality less than" value="0" /> - <param name="min_base_quality" type="integer" label="Exclude alleles from analysis if their supporting base quality less than" value="0" /> - <param name="min_supporting_quality_mq" type="integer" label="In order to consider an alternate allele, at least one supporting alignment must have mapping quality" value="0" /> - <param name="min_supporting_quality_bq" type="integer" label="In order to consider an alternate allele, at least one supporting alignment must have base quality" value="0" /> - </when> - </conditional> - <param name="mismatch_base_quality_threshold" type="integer" label="Count mismatches toward read-mismatch-limit if the base quality of the mismatch is >=" value="10" /> - <param name="read_mismatch_limit" type="integer" label="Exclude reads with more than N mismatches where each mismatch has base quality >= mismatch-base-quality-threshold" value="" optional="True" /> - <param name="read_max_mismatch_fraction" type="float" label="Exclude reads with more than N [0,1] fraction of mismatches where each mismatch has base quality >= mismatch-base-quality-threshold" value="1.0" /> - <param name="read_snp_limit" type="integer" label="Exclude reads with more than N base mismatches, ignoring gaps with quality >= mismatch-base-quality-threshold" value="" optional="True" /> - <param name="read_indel_limit" type="integer" label="Exclude reads with more than N separate gaps" value="" optional="True" /> - <param name="indel_exclusion_window" type="integer" label="Ignore portions of alignments this many bases from a putative insertion or deletion allele" value="0" /> - <param name="min_alternate_fraction" type="float" label="Require at least this fraction of observations supporting an alternate allele within a single individual in the in order to evaluate the position" value="0" /> - <param name="min_alternate_count" type="integer" label="Require at least this count of observations supporting an alternate allele within a single individual in order to evaluate the position" value="1" /> - <param name="min_alternate_qsum" type="integer" label="Require at least this sum of quality of observations supporting an alternate allele within a single individual in order to evaluate the position" value="0" /> - <param name="min_alternate_total" type="integer" label="Require at least this count of observations supporting an alternate allele within the total population in order to use the allele in analysis" value="1" /> - <param name="min_coverage" type="integer" label="Require at least this coverage to process a site" value="0" /> - </when> - </conditional> - - - <!-- bayesian priors --> - <conditional name="section_bayesian_priors_type"> - <param name="section_bayesian_priors_type_selector" type="select" label="Set bayesian priors options"> - <option value="do_not_set" selected="True">Do not set</option> - <option value="set">Set</option> - </param> - <when value="do_not_set"> - <!-- do nothing here --> - </when> - <when value="set"> - <param name="no_ewens_priors" type="boolean" truevalue="--no-ewens-priors" falsevalue="" checked="False" label="Turns off the Ewens' Sampling Formula component of the priors" /> - <param name="no_population_priors" type="boolean" truevalue="--no-population-priors" falsevalue="" checked="False" label="No population priors" help="Equivalent to --pooled --no-ewens-priors" /> - <param name="hwe_priors" type="boolean" truevalue="--hwe-priors" falsevalue="" checked="False" label="Use the probability of the combination arising under HWE given the allele frequency as estimated by observation frequency" /> - </when> - </conditional> - - <!-- observation prior expectations --> - <conditional name="section_observation_prior_expectations_type"> - <param name="section_observation_prior_expectations_type_selector" type="select" label="Set observation prior expectations options"> - <option value="do_not_set" selected="True">Do not set</option> - <option value="set">Set</option> - </param> - <when value="do_not_set"> - <!-- do nothing here --> - </when> - <when value="set"> - <param name="binomial_obs_priors" type="boolean" truevalue="--binomial-obs-priors" falsevalue="" checked="False" label="Incorporate expectations about osbervations into the priors, Uses read placement probability, strand balance probability, and read position (5'-3') probability" /> - <param name="allele_balance_priors" type="boolean" truevalue="--allele-balance-priors" falsevalue="" checked="False" label="Use aggregate probability of observation balance between alleles as a component of the priors. Best for observations with minimal inherent reference bias" /> - </when> - </conditional> - - - <!-- algorithmic features --> - <conditional name="section_algorithmic_features_type"> - <param name="section_algorithmic_features_type_selector" type="select" label="Set algorithmic features options"> - <option value="do_not_set" selected="True">Do not set</option> - <option value="set">Set</option> - </param> - <when value="do_not_set"> - <!-- do nothing here --> - </when> - <when value="set"> - <param name="site_selection_max_iterations" type="integer" label="Uses hill-climbing algorithm to search posterior space for N iterations to determine if the site should be evaluated." value="5" help="Set to 0 to prevent use of this algorithm for site selection, and to a low integer for improvide site selection at a slight performance penalty" /> - <param name="genotyping_max_iterations" type="integer" label="Iterate no more than N times during genotyping step" value="25" /> - <param name="genotyping_max_banddepth" type="integer" label="Integrate no deeper than the Nth best genotype by likelihood when genotyping" value="6" /> - <param name="posterior_integration_limits_n" type="integer" label="Posteriror integration limit N" help="Integrate all genotype combinations in our posterior space which include no more than N samples with their Mth best data likelihood." value="1" /> - <param name="posterior_integration_limits_m" type="integer" label="Posteriror integration limit M" help="Integrate all genotype combinations in our posterior space which include no more than N samples with their Mth best data likelihood." value="3" /> - <param name="no_permute" type="boolean" truevalue="--no-permute" falsevalue="" checked="False" label="Do not scale prior probability of genotype combination given allele frequency by the number of permutations of included genotypes" /> - <param name="exclude_unobserved_genotypes" type="boolean" truevalue="--exclude-unobserved-genotypes" falsevalue="" checked="False" label="Skip sample genotypings for which the sample has no supporting reads" /> - <param name="genotype_variant_threshold" type="integer" label="Limit posterior integration to samples where the second-best genotype likelihood is no more than log(N) from the highest genotype likelihood for the sample" value="" optional="True" /> - <param name="use_mapping_quality" type="boolean" truevalue="--use-mapping-quality" falsevalue="" checked="False" label="Use mapping quality of alleles when calculating data likelihoods" /> - <param name="read_dependence_factor" type="float" label="Incorporate non-independence of reads by scaling successive observations by this factor during data likelihood calculations" value="0.9" /> - <param name="no_marginals" type="boolean" truevalue="--no-marginals" falsevalue="" checked="False" label="Do not calculate the marginal probability of genotypes. Saves time and improves scaling performance in large populations" /> - </when> - </conditional> - - - </when> - </conditional> - - </inputs> - <outputs> - <data format="vcf" name="output_vcf" label="${tool.name} on ${on_string} (variants)" /> - <data format="bed" name="output_failed_alleles_bed" label="${tool.name} on ${on_string} (failed alleles)"> - <filter>options_type['options_type_selector'] == "advanced" and options_type['output_failed_alleles_option'] is True</filter> - </data> - <data format="txt" name="output_trace" label="${tool.name} on ${on_string} (trace)"> - <filter>options_type['options_type_selector'] == "advanced" and options_type['output_trace_option'] is True</filter> - </data> - </outputs> - <tests> - <test> - <param name="reference_source_selector" value="history" /> - <param name="ref_file" ftype="fasta" value="phiX.fasta"/> - <param name="input_bam" ftype="bam" value="fake_phiX_reads_1.bam"/> - <param name="options_type_selector" value="basic"/> - <output name="output_vcf" file="freebayes_out_1.vcf.contains" compare="contains"/> - </test> - </tests> - <stdio> - <exit_code range="1:" /> - </stdio> - <help> -**What it does** - -This tool uses FreeBayes to call SNPS given a reference sequence and a BAM alignment file. - -FreeBayes is a high-performance, flexible, and open-source Bayesian genetic variant detector. It operates on BAM alignment files, which are produced by most contemporary short-read aligners. - -In addition to substantial performance improvements over its predecessors (PolyBayes, GigaBayes, and BamBayes), it expands the scope of SNP and small-indel variant calling to populations of individuals with heterogeneous copy number. FreeBayes is currently under active development. - -Go `here <http://bioinformatics.bc.edu/marthlab/FreeBayes>`_ for details on FreeBayes. - ------- - -**Inputs** - -FreeBayes accepts an input aligned BAM file. - - -**Outputs** - -The output is in the VCF format. - -------- - -**Settings**:: - - input and output: - - -b --bam FILE Add FILE to the set of BAM files to be analyzed. - -c --stdin Read BAM input on stdin. - -v --vcf FILE Output VCF-format results to FILE. - -f --fasta-reference FILE - Use FILE as the reference sequence for analysis. - An index file (FILE.fai) will be created if none exists. - If neither --targets nor --region are specified, FreeBayes - will analyze every position in this reference. - -t --targets FILE - Limit analysis to targets listed in the BED-format FILE. - -r --region <chrom>:<start_position>..<end_position> - Limit analysis to the specified region, 0-base coordinates, - end_position not included (same as BED format). - -s --samples FILE - Limit analysis to samples listed (one per line) in the FILE. - By default FreeBayes will analyze all samples in its input - BAM files. - --populations FILE - Each line of FILE should list a sample and a population which - it is part of. The population-based bayesian inference model - will then be partitioned on the basis of the populations. - -A --cnv-map FILE - Read a copy number map from the BED file FILE, which has - the format: - reference sequence, start, end, sample name, copy number - ... for each region in each sample which does not have the - default copy number as set by --ploidy. - -L --trace FILE Output an algorithmic trace to FILE. - --failed-alleles FILE - Write a BED file of the analyzed positions which do not - pass --pvar to FILE. - -@ --variant-input VCF - Use variants reported in VCF file as input to the algorithm. - A report will be generated for every record in the VCF file. - -l --only-use-input-alleles - Only provide variant calls and genotype likelihoods for sites - and alleles which are provided in the VCF input, and provide - output in the VCF for all input alleles, not just those which - have support in the data. - --haplotype-basis-alleles VCF - When specified, only variant alleles provided in this input - VCF will be used for the construction of complex or haplotype - alleles. - - reporting: - - -P --pvar N Report sites if the probability that there is a polymorphism - at the site is greater than N. default: 0.0001 - -_ --show-reference-repeats - Calculate and show information about reference repeats in - the VCF output. - - population model: - - -T --theta N The expected mutation rate or pairwise nucleotide diversity - among the population under analysis. This serves as the - single parameter to the Ewens Sampling Formula prior model - default: 0.001 - -p --ploidy N Sets the default ploidy for the analysis to N. default: 2 - -J --pooled Assume that samples result from pooled sequencing. - When using this flag, set --ploidy to the number of - alleles in each sample. - - reference allele: - - -Z --use-reference-allele - This flag includes the reference allele in the analysis as - if it is another sample from the same population. - -H --diploid-reference - If using the reference sequence as a sample (-Z), - treat it as diploid. default: false (reference is haploid) - --reference-quality MQ,BQ - Assign mapping quality of MQ to the reference allele at each - site and base quality of BQ. default: 100,60 - - allele scope: - - -I --no-snps Ignore SNP alleles. - -i --no-indels Ignore insertion and deletion alleles. - -X --no-mnps Ignore multi-nuceotide polymorphisms, MNPs. - -u --no-complex Ignore complex events (composites of other classes). - -n --use-best-n-alleles N - Evaluate only the best N SNP alleles, ranked by sum of - supporting quality scores. (Set to 0 to use all; default: all) - -E --max-complex-gap N - Allow complex alleles with contiguous embedded matches of up - to this length. - - indel realignment: - - -O --left-align-indels - Left-realign and merge gaps embedded in reads. default: false - - input filters: - - -4 --use-duplicate-reads - Include duplicate-marked alignments in the analysis. - default: exclude duplicates - -m --min-mapping-quality Q - Exclude alignments from analysis if they have a mapping - quality less than Q. default: 30 - -q --min-base-quality Q - Exclude alleles from analysis if their supporting base - quality is less than Q. default: 20 - -R --min-supporting-quality MQ,BQ - In order to consider an alternate allele, at least one supporting - alignment must have mapping quality MQ, and one supporting - allele must have base quality BQ. default: 0,0, unset - -Q --mismatch-base-quality-threshold Q - Count mismatches toward --read-mismatch-limit if the base - quality of the mismatch is >= Q. default: 10 - -U --read-mismatch-limit N - Exclude reads with more than N mismatches where each mismatch - has base quality >= mismatch-base-quality-threshold. - default: ~unbounded - -z --read-max-mismatch-fraction N - Exclude reads with more than N [0,1] fraction of mismatches where - each mismatch has base quality >= mismatch-base-quality-threshold - default: 1.0 - -$ --read-snp-limit N - Exclude reads with more than N base mismatches, ignoring gaps - with quality >= mismatch-base-quality-threshold. - default: ~unbounded - -e --read-indel-limit N - Exclude reads with more than N separate gaps. - default: ~unbounded - -0 --standard-filters Use stringent input base and mapping quality filters - Equivalent to -m 30 -q 20 -R 0 -S 0 - -x --indel-exclusion-window - Ignore portions of alignments this many bases from a - putative insertion or deletion allele. default: 0 - -F --min-alternate-fraction N - Require at least this fraction of observations supporting - an alternate allele within a single individual in the - in order to evaluate the position. default: 0.0 - -C --min-alternate-count N - Require at least this count of observations supporting - an alternate allele within a single individual in order - to evaluate the position. default: 1 - -3 --min-alternate-qsum N - Require at least this sum of quality of observations supporting - an alternate allele within a single individual in order - to evaluate the position. default: 0 - -G --min-alternate-total N - Require at least this count of observations supporting - an alternate allele within the total population in order - to use the allele in analysis. default: 1 - -! --min-coverage N - Require at least this coverage to process a site. default: 0 - - bayesian priors: - - -Y --no-ewens-priors - Turns off the Ewens' Sampling Formula component of the priors. - -k --no-population-priors - Equivalent to --pooled --no-ewens-priors - -w --hwe-priors Use the probability of the combination arising under HWE given - the allele frequency as estimated by observation frequency. - - observation prior expectations: - - -V --binomial-obs-priors - Incorporate expectations about osbervations into the priors, - Uses read placement probability, strand balance probability, - and read position (5'-3') probability. - -a --allele-balance-priors - Use aggregate probability of observation balance between alleles - as a component of the priors. Best for observations with minimal - inherent reference bias. - - algorithmic features: - - -M --site-selection-max-iterations N - Uses hill-climbing algorithm to search posterior space for N - iterations to determine if the site should be evaluated. Set to 0 - to prevent use of this algorithm for site selection, and - to a low integer for improvide site selection at a slight - performance penalty. default: 5. - -B --genotyping-max-iterations N - Iterate no more than N times during genotyping step. default: 25. - --genotyping-max-banddepth N - Integrate no deeper than the Nth best genotype by likelihood when - genotyping. default: 6. - -W --posterior-integration-limits N,M - Integrate all genotype combinations in our posterior space - which include no more than N samples with their Mth best - data likelihood. default: 1,3. - -K --no-permute - Do not scale prior probability of genotype combination given allele - frequency by the number of permutations of included genotypes. - -N --exclude-unobserved-genotypes - Skip sample genotypings for which the sample has no supporting reads. - -S --genotype-variant-threshold N - Limit posterior integration to samples where the second-best - genotype likelihood is no more than log(N) from the highest - genotype likelihood for the sample. default: ~unbounded - -j --use-mapping-quality - Use mapping quality of alleles when calculating data likelihoods. - -D --read-dependence-factor N - Incorporate non-independence of reads by scaling successive - observations by this factor during data likelihood - calculations. default: 0.9 - -= --no-marginals - Do not calculate the marginal probability of genotypes. Saves - time and improves scaling performance in large populations. - - ------- - -**Citation** - -For the underlying tool, please cite `Erik Garrison and Gabor Marth. Haplotype-based variant detection from short-read sequencing <http://arxiv.org/abs/1207.3907>`_. - -If you use this tool in Galaxy, please cite Blankenberg D, et al. *In preparation.* - - </help> -</tool>
--- a/sam_fa_indices.loc.sample Mon Feb 17 10:53:56 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,28 +0,0 @@ -#This is a sample file distributed with Galaxy that enables tools -#to use a directory of Samtools indexed sequences data files. You will need -#to create these data files and then create a sam_fa_indices.loc file -#similar to this one (store it in this directory) that points to -#the directories in which those files are stored. The sam_fa_indices.loc -#file has this format (white space characters are TAB characters): -# -#index <seq> <location> -# -#So, for example, if you had hg18 indexed stored in -#/depot/data2/galaxy/sam/, -#then the sam_fa_indices.loc entry would look like this: -# -#index hg18 /depot/data2/galaxy/sam/hg18.fa -# -#and your /depot/data2/galaxy/sam/ directory -#would contain hg18.fa and hg18.fa.fai files: -# -#-rw-r--r-- 1 james universe 830134 2005-09-13 10:12 hg18.fa -#-rw-r--r-- 1 james universe 527388 2005-09-13 10:12 hg18.fa.fai -# -#Your sam_fa_indices.loc file should include an entry per line for -#each index set you have stored. The file in the path does actually -#exist, but it should never be directly used. Instead, the name serves -#as a prefix for the index file. For example: -# -#index hg18 /depot/data2/galaxy/sam/hg18.fa -#index hg19 /depot/data2/galaxy/sam/hg19.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/freebayes-phix174-test1.vcf Fri Jun 20 17:16:05 2014 -0400 @@ -0,0 +1,27 @@ +#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT unknown +phiX174 311 . A G 6.48411 . AB=0.222222;ABP=9.04217;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=9;DPB=9;DPRA=0;EPP=7.35324;EPPR=5.80219;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=33.5714;NS=1;NUMALT=1;ODDS=1.23853;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=70;QR=478;RO=7;RPP=7.35324;RPPR=3.32051;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=5;SRP=5.80219;SRR=2;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:9:7:478:2:70:-5.49703,0,-10 +phiX174 374 . T G 30.6931 . AB=0.5;ABP=3.0103;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=7.35324;EPPR=7.35324;GTI=0;LEN=1;MEANALT=1;MQM=37;MQMR=25;NS=1;NUMALT=1;ODDS=7.0665;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=75;QR=141;RO=2;RPP=3.0103;RPPR=7.35324;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=0;SRP=7.35324;SRR=2;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:4:2:141:2:75:-6.69903,0,-10 +phiX174 913 . A C 13.1703 . AB=0.4;ABP=3.44459;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=3.0103;EPPR=3.73412;GTI=0;LEN=1;MEANALT=1;MQM=31;MQMR=29;NS=1;NUMALT=1;ODDS=2.98318;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=58;QR=171;RO=3;RPP=3.0103;RPPR=3.73412;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=3;SRP=9.52472;SRR=0;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:5:3:171:2:58:-5.00485,0,-10 +phiX174 1205 . A C 2.30262 . AB=0.2;ABP=10.8276;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=10;DPB=10;DPRA=0;EPP=7.35324;EPPR=7.35324;GTI=0;LEN=1;MEANALT=1;MQM=31;MQMR=34;NS=1;NUMALT=1;ODDS=0.357718;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=67;QR=456;RO=8;RPP=7.35324;RPPR=7.35324;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=2;SRP=7.35324;SRR=6;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:10:8:456:2:67:-5.00791,0,-10 +phiX174 1245 . G T 6.48411 . AB=0.222222;ABP=9.04217;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=9;DPB=9;DPRA=0;EPP=7.35324;EPPR=3.32051;GTI=0;LEN=1;MEANALT=1;MQM=31;MQMR=28.4286;NS=1;NUMALT=1;ODDS=1.23853;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=70;QR=389;RO=7;RPP=7.35324;RPPR=3.32051;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=0;SRP=18.2106;SRR=7;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:9:7:389:2:70:-5.49703,0,-10 +phiX174 1249 . T G 15.3287 . AB=0.222222;ABP=9.04217;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=9;DPB=9;DPRA=0;EPP=3.0103;EPPR=3.32051;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=30.1429;NS=1;NUMALT=1;ODDS=3.4998;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=74;QR=464;RO=7;RPP=3.0103;RPPR=5.80219;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=2;SRP=5.80219;SRR=5;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:9:7:464:2:74:-5.87703,0,-10 +phiX174 1445 . C A 24.4745 . AB=0.285714;ABP=5.80219;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=7;DPB=7;DPRA=0;EPP=7.35324;EPPR=6.91895;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=32.2;NS=1;NUMALT=1;ODDS=5.63189;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=76;QR=273;RO=5;RPP=3.0103;RPPR=6.91895;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=2;SRP=3.44459;SRR=3;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:7:5:273:2:76:-6.43501,0,-10 +phiX174 1577 . A C 4.06305 . AB=0.222222;ABP=9.04217;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=9;DPB=9;DPRA=0;EPP=7.35324;EPPR=3.32051;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=35.2857;NS=1;NUMALT=1;ODDS=0.437365;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=60;QR=460;RO=7;RPP=3.0103;RPPR=10.7656;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=4;SRP=3.32051;SRR=3;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:9:7:460:2:60:-4.54703,0,-10 +phiX174 1631 . T G 2.719 . AB=0.2;ABP=10.8276;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=10;DPB=10;DPRA=0;EPP=7.35324;EPPR=4.09604;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=28;NS=1;NUMALT=1;ODDS=0.138972;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=68;QR=500;RO=8;RPP=7.35324;RPPR=3.0103;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=3;SRP=4.09604;SRR=5;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:10:8:500:2:68:-5.10291,0,-10 +phiX174 1772 . T G 2.16317 . AB=0.2;ABP=10.8276;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=10;DPB=10;DPRA=0;EPP=3.0103;EPPR=3.32051;GTI=0;LEN=1;MEANALT=2;MQM=31;MQMR=31.8571;NS=1;NUMALT=1;ODDS=0.437618;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=59;QR=425;RO=7;RPP=3.0103;RPPR=3.32051;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=1;SRP=10.7656;SRR=6;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:10:7:425:2:59:-4.16703,0,-10 +phiX174 1945 . T G 11.7103 . AB=0.333333;ABP=4.45795;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=6;DPB=6;DPRA=0;EPP=3.0103;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=31;MQMR=37;NS=1;NUMALT=1;ODDS=2.62656;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=59;QR=263;RO=4;RPP=3.0103;RPPR=5.18177;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=2;SRP=3.0103;SRR=2;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:6:4:263:2:59:-4.97491,0,-10 +phiX174 2230 . T G 1.61813 . AB=0.2;ABP=10.8276;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=10;DPB=10;DPRA=0;EPP=7.35324;EPPR=3.0103;GTI=0;LEN=1;MEANALT=1;MQM=31;MQMR=35.5;NS=1;NUMALT=1;ODDS=0.795209;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=65;QR=491;RO=8;RPP=7.35324;RPPR=4.09604;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=3;SRP=4.09604;SRR=5;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:10:8:491:2:65:-4.81791,0,-10 +phiX174 2699 . C A 31.6424 . AB=0.5;ABP=3.0103;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=7.35324;EPPR=3.0103;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=37;NS=1;NUMALT=1;ODDS=7.28525;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=76;QR=109;RO=2;RPP=3.0103;RPPR=3.0103;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=0;SRP=7.35324;SRR=2;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:4:2:109:2:76:-6.79403,0,-9.92903 +phiX174 2722 . T G 21.5364 . AB=0.4;ABP=3.44459;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=7.35324;EPPR=3.73412;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=33;NS=1;NUMALT=1;ODDS=4.95189;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=67;QR=150;RO=3;RPP=3.0103;RPPR=3.73412;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=0;SRP=9.52472;SRR=3;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:5:3:150:2:67:-5.85985,0,-10 +phiX174 2814 . T G 8.81714 . AB=0.4;ABP=3.44459;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=3.0103;EPPR=3.73412;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=33;NS=1;NUMALT=1;ODDS=1.88946;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=53;QR=135;RO=3;RPP=3.0103;RPPR=3.73412;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=0;SRP=9.52472;SRR=3;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:5:3:135:2:53:-4.52985,0,-10 +phiX174 2828 . T G 37.7173 . AB=0.25;ABP=7.35324;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=8;DPB=8;DPRA=0;EPP=7.35324;EPPR=3.0103;GTI=0;LEN=1;MEANALT=1;MQM=31;MQMR=31;NS=1;NUMALT=1;ODDS=8.68456;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=100;QR=348;RO=6;RPP=7.35324;RPPR=4.45795;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=1;SRP=8.80089;SRR=5;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:8:6:348:2:100:-8.53892,0,-10 +phiX174 2983 . T G 12.2712 . AB=0.4;ABP=3.44459;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=3.0103;EPPR=3.73412;GTI=0;LEN=1;MEANALT=1;MQM=31;MQMR=33;NS=1;NUMALT=1;ODDS=2.76444;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=57;QR=150;RO=3;RPP=3.0103;RPPR=3.73412;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=2;SRP=3.73412;SRR=1;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:5:3:150:2:57:-4.90985,0,-10 +phiX174 3110 . T C 34.4848 . AB=0.333333;ABP=5.18177;AC=1;AF=0.5;AN=2;AO=3;CIGAR=1X;DP=9;DPB=9;DPRA=0;EPP=3.73412;EPPR=4.45795;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=35;NS=1;NUMALT=1;ODDS=7.94006;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=94;QR=361;RO=6;RPP=9.52472;RPPR=3.0103;RUN=1;SAF=1;SAP=3.73412;SAR=2;SRF=1;SRP=8.80089;SRR=5;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:9:6:361:3:94:-7.98834,0,-10 +phiX174 3155 . T G 23.5283 . AB=0.285714;ABP=5.80219;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=7;DPB=7;DPRA=0;EPP=3.0103;EPPR=3.44459;GTI=0;LEN=1;MEANALT=1;MQM=37;MQMR=29.8;NS=1;NUMALT=1;ODDS=5.41314;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=75;QR=299;RO=5;RPP=3.0103;RPPR=3.44459;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=4;SRP=6.91895;SRR=1;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:7:5:299:2:75:-6.34001,0,-10 +phiX174 3325 . A C 5.77196 . AB=0.333333;ABP=4.45795;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=6;DPB=6;DPRA=0;EPP=7.35324;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=31;NS=1;NUMALT=1;ODDS=1.02152;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=58;QR=284;RO=4;RPP=7.35324;RPPR=3.0103;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=3;SRP=5.18177;SRR=1;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:6:4:284:2:58:-4.87991,0,-10 +phiX174 3418 . A C 0.61163 . AB=0.2;ABP=10.8276;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=10;DPB=10;DPRA=0;EPP=7.35324;EPPR=3.0103;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=34;NS=1;NUMALT=1;ODDS=1.88894;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=60;QR=526;RO=8;RPP=7.35324;RPPR=4.09604;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=5;SRP=4.09604;SRR=3;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:10:8:526:2:60:-4.34291,0,-10 +phiX174 3729 . C T 8.03017 . AB=0.333333;ABP=4.45795;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=6;DPB=6;DPRA=0;EPP=7.35324;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=31;MQMR=37;NS=1;NUMALT=1;ODDS=1.67776;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=61;QR=232;RO=4;RPP=7.35324;RPPR=5.18177;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=0;SRP=11.6962;SRR=4;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:6:4:232:2:61:-5.16491,0,-10 +phiX174 4031 . T G 23.4861 . AB=0.25;ABP=7.35324;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=8;DPB=8;DPRA=0;EPP=7.35324;EPPR=4.45795;GTI=0;LEN=1;MEANALT=1;MQM=31;MQMR=27;NS=1;NUMALT=1;ODDS=5.40338;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=85;QR=322;RO=6;RPP=7.35324;RPPR=8.80089;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=3;SRP=3.0103;SRR=3;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:8:6:322:2:85:-7.11392,0,-10 +phiX174 4502 . A C 8.30185 . AB=0.333333;ABP=4.45795;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=6;DPB=6;DPRA=0;EPP=3.0103;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=37;NS=1;NUMALT=1;ODDS=1.75158;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=55;QR=284;RO=4;RPP=3.0103;RPPR=11.6962;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=3;SRP=5.18177;SRR=1;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:6:4:284:2:55:-4.59491,0,-10 +phiX174 4558 . C G 6.48999 . AB=0.333333;ABP=4.45795;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=6;DPB=6;DPRA=0;EPP=7.35324;EPPR=3.0103;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=28;NS=1;NUMALT=1;ODDS=1.24027;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=59;QR=204;RO=4;RPP=7.35324;RPPR=11.6962;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=2;SRP=3.0103;SRR=2;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:6:4:204:2:59:-4.97491,0,-10 +phiX174 4655 . T G 21.8853 . AB=0.333333;ABP=4.45795;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=6;DPB=6;DPRA=0;EPP=3.0103;EPPR=3.0103;GTI=0;LEN=1;MEANALT=1;MQM=25;MQMR=37;NS=1;NUMALT=1;ODDS=5.03277;PAIRED=0;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=70;QR=193;RO=4;RPP=3.0103;RPPR=3.0103;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=0;SRP=11.6962;SRR=4;TYPE=snp GT:DP:RO:QR:AO:QA:GL 0/1:6:4:193:2:70:-6.01991,0,-10
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/freebayes-phix174.fasta Fri Jun 20 17:16:05 2014 -0400 @@ -0,0 +1,2 @@ +>phiX174 +GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTTGATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAAATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTGTCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTAGATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATCTGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTTTCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTTCGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCTTGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCGTCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTACGGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTACGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCaGAAGGAGTGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACTAAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGCCCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCATCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGACTCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTACTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAAGGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTTGGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACAACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGCTCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTTTCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGCATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCgTGATGTTATTTCTTCATTTGGAGGTAAAACCTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTTGATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGCCGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGACTAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTGTATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGTTTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGAAGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGATTATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTTATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAACGCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGCTTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGTTCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTATATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTGTCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGCCTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTGAATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGCCGGGCAATAAtGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGTTTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTGCTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAAAGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCTGGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTGGTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGATAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTATCTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGGTTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGAGATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGACCAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTATGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCAAACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGACTTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTTCTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCGTCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTTCTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTATTGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGCATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATGTTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGAATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGGGACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCCCTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATTGCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTaCTATTCAGCGTTTGATGAATGCAATGCGACAGGCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTTATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCGCAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGCCGTCTTCATTTCCATGCGGTGCAtTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTCGTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCATCGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAGCCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATATGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACTTCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTGTCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGCAGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACCTGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA
--- a/test-data/freebayes_out_1.output_trace Mon Feb 17 10:53:56 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,8 +0,0 @@ -phiX174,1411,allele,phiX174,phiX174,A,60,100 -phiX174,1412,allele,phiX174,phiX174,G,60,100 -phiX174,1413,allele,phiX174,phiX174,C,60,100 -phiX174,1414,allele,phiX174,phiX174,G,60,100 -phiX174,1415,allele,phiX174,phiX174,C,60,100 -phiX174,1416,allele,phiX174,phiX174,C,60,100 -phiX174,1417,allele,phiX174,phiX174,G,60,100 -phiX174,1418,allele,phiX174,phiX174,T,60,100
--- a/test-data/freebayes_out_1.vcf.contains Mon Feb 17 10:53:56 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,2 +0,0 @@ -#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT A -
--- a/test-data/phiX.fasta Mon Feb 17 10:53:56 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,79 +0,0 @@ ->phiX174 -GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT -GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA -ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG -TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA -GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC -TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT -TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT -CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT -TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG -TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC -GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA -CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG -TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT -AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC -CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA -TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC -TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA -CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA -GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT -GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA -ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC -TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT -TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC -ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC -CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT -GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC -CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC -TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG -TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT -TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA -AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT -TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT -ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC -GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC -TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT -TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA -TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG -TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC -CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG -AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC -CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT -TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG -CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA -AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT -GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG -GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA -TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT -CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG -TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA -GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC -CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA -TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA -AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC -TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT -CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA -TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG -TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT -CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT -TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC -ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG -TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA -ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG -GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC -CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT -GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG -GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT -ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG -CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC -CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC -GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT -CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG -CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA -TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT -TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG -TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC -AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC -TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA -
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/sam_fa_indices.loc.sample Fri Jun 20 17:16:05 2014 -0400 @@ -0,0 +1,28 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of Samtools indexed sequences data files. You will need +#to create these data files and then create a sam_fa_indices.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The sam_fa_indices.loc +#file has this format (white space characters are TAB characters): +# +#index <seq> <location> +# +#So, for example, if you had hg18 indexed stored in +#/depot/data2/galaxy/sam/, +#then the sam_fa_indices.loc entry would look like this: +# +#index hg18 /depot/data2/galaxy/sam/hg18.fa +# +#and your /depot/data2/galaxy/sam/ directory +#would contain hg18.fa and hg18.fa.fai files: +# +#-rw-r--r-- 1 james universe 830134 2005-09-13 10:12 hg18.fa +#-rw-r--r-- 1 james universe 527388 2005-09-13 10:12 hg18.fa.fai +# +#Your sam_fa_indices.loc file should include an entry per line for +#each index set you have stored. The file in the path does actually +#exist, but it should never be directly used. Instead, the name serves +#as a prefix for the index file. For example: +# +#index hg18 /depot/data2/galaxy/sam/hg18.fa +#index hg19 /depot/data2/galaxy/sam/hg19.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/tool_data_table_conf.xml.sample Fri Jun 20 17:16:05 2014 -0400 @@ -0,0 +1,8 @@ +<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc--> +<tables> + <!-- Location of SAMTools indexes and other files --> + <table name="sam_fa_indexes" comment_char="#"> + <columns>line_type, value, path</columns> + <file path="tool-data/sam_fa_indices.loc" /> + </table> +</tables>
--- a/tool_data_table_conf.xml.sample Mon Feb 17 10:53:56 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,8 +0,0 @@ -<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc--> -<tables> - <!-- Location of SAMTools indexes and other files --> - <table name="sam_fa_indexes" comment_char="#"> - <columns>line_type, value, path</columns> - <file path="tool-data/sam_fa_indices.loc" /> - </table> -</tables>
--- a/tool_dependencies.xml Mon Feb 17 10:53:56 2014 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,9 +0,0 @@ -<?xml version="1.0"?> -<tool_dependency> - <package name="freebayes" version="0.9.6_9608597d12e127c847ae03aa03440ab63992fedf"> - <repository changeset_revision="7615ee9e216d" name="package_freebayes_0_9_6_9608597d" owner="devteam" toolshed="http://toolshed.g2.bx.psu.edu" /> - </package> - <package name="samtools" version="0.1.18"> - <repository changeset_revision="171cd8bc208d" name="package_samtools_0_1_18" owner="devteam" toolshed="http://toolshed.g2.bx.psu.edu" /> - </package> -</tool_dependency>