Mercurial > repos > devteam > lastz

changeset 7:10aca14c2332 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/lastz commit 13e9724b44888b0de9535ac7b561ad9686038413
author iuc
date Thu, 17 May 2018 04:29:13 -0400
parents b6d7308c3728
children e7f19d6a9af8
files lastz.xml lastz_d.xml lastz_macros.xml test-data/chrM_human.fa.gz test-data/chrM_mouse.fa.gz test-data/chrM_mouse.fq test-data/chrM_mouse.fq.bz2 test-data/chrM_mouse.fq.gz test-data/test4.out test-data/test5.out
diffstat 10 files changed, 68 insertions(+), 8 deletions(-) [+]
line wrap: on
line diff
--- a/lastz.xml	Fri Mar 02 12:07:00 2018 -0500
+++ b/lastz.xml	Thu May 17 04:29:13 2018 -0400
@@ -1,4 +1,4 @@
-<tool id="lastz_wrapper_2" name="LASTZ" version="1.3">
+<tool id="lastz_wrapper_2" name="LASTZ" version="1.3.1">
     <description>: align long sequences</description>
     <macros>
         <import>lastz_macros.xml</import>
@@ -7,6 +7,7 @@
         <requirement type="package" version="@LASTZ_CONDA_VERSION@">lastz</requirement>
         <requirement type="package" version="1.7">samtools</requirement>
         <requirement type="package" version="3.4.2">r-base</requirement>
+        <requirement type="package" version="1.0.6">bzip2</requirement>
     </requirements>
     <command detect_errors="exit_code"><![CDATA[
         lastz
@@ -18,7 +19,7 @@
                 '${where_to_look.nomirror}'
             #end if
         #else:
-            '${query}'
+            @query_input@
         #end if
 
 ## WHERE TO LOOK --------------------------------
@@ -279,7 +280,7 @@
     </configfiles>
     <inputs>
         <expand macro="target_input"/>
-        <param name="query" format="fasta,fastq" type="data" label="Select QUERY sequence(s)" help="These are the sequences that you are aligning against TARGET"/>
+        <param name="query" format="fasta,fastq,fasta.gz,fastq.gz,fastq.bz2" type="data" label="Select QUERY sequence(s)" help="These are the sequences that you are aligning against TARGET"/>
 
         <section name="where_to_look" expanded="False" title="Where to look">
             <param name="strand" type="select" display="radio" label="which strand to search" argument="--strand" help="Search both strands or choose plus or minus">
@@ -596,6 +597,38 @@
             <param name="format" value="general_def" />
             <output name="output" value="test3.out" />
         </test>
+        <test>
+            <param name="ref_source" value="history" />
+            <param name="target" value="chrM_mouse.fa.gz" />
+            <param name="query" value="chrM_human.fa.gz" />
+            <param name="strand" value="--strand=both" />
+            <param name="format" value="blastn" />
+            <output name="output" value="test4.out" />
+        </test>
+        <test>
+            <param name="ref_source" value="history" />
+            <param name="target" ftype="fasta.gz" value="chrM_human.fa.gz" />
+            <param name="query" ftype="fastq.bz2" value="chrM_mouse.fq.bz2" />
+            <param name="strand" value="--strand=both" />
+            <param name="format" value="blastn" />
+            <output name="output" value="test5.out" />
+        </test>
+        <test>
+            <param name="ref_source" value="history" />
+            <param name="target" ftype="fasta.gz" value="chrM_human.fa.gz" />
+            <param name="query" ftype="fastq.gz" value="chrM_mouse.fq.gz" />
+            <param name="strand" value="--strand=both" />
+            <param name="format" value="blastn" />
+            <output name="output" value="test5.out" />
+        </test>
+        <test>
+            <param name="ref_source" value="history" />
+            <param name="target" ftype="fasta.gz" value="chrM_human.fa.gz" />
+            <param name="query" ftype="fastq" value="chrM_mouse.fq" />
+            <param name="strand" value="--strand=both" />
+            <param name="format" value="blastn" />
+            <output name="output" value="test5.out" />
+        </test>
     </tests>
 
     <help><![CDATA[
--- a/lastz_d.xml	Fri Mar 02 12:07:00 2018 -0500
+++ b/lastz_d.xml	Thu May 17 04:29:13 2018 -0400
@@ -1,15 +1,16 @@
-<tool id="lastz_d_wrapper" name="LASTZ_D" version="1.3">
+<tool id="lastz_d_wrapper" name="LASTZ_D" version="1.3.1">
     <description>: estimate substitution scores matrix</description>
     <macros>
     	<import>lastz_macros.xml</import>
     </macros>
     <requirements>
         <requirement type="package" version="@LASTZ_CONDA_VERSION@">lastz</requirement>
+        <requirement type="package" version="1.0.6">bzip2</requirement>
     </requirements>
     <command detect_errors="exit_code"><![CDATA[
         lastz_D
         @TARGET_INPUT_COMMAND_LINE@
-        '${query}'
+        @query_input@
         #if $score_file:
             '--inferonly=${score_file}'
         #else:
--- a/lastz_macros.xml	Fri Mar 02 12:07:00 2018 -0500
+++ b/lastz_macros.xml	Thu May 17 04:29:13 2018 -0400
@@ -1,11 +1,26 @@
 <macros>
     <token name="@LASTZ_CONDA_VERSION@">1.0.4</token>
-    <token name="@TARGET_INPUT_COMMAND_LINE@">
+    <token name="@TARGET_INPUT_COMMAND_LINE@"><![CDATA[
         #if $source.ref_source=="history":
-            '${source.target}'
+            #if $source.target.is_of_type('fasta.gz'):
+                <(gunzip -c '${source.target}')
+            #else:
+                '${source.target}'
+            #end if
         #else:
             '${source.target_2bit.fields.path}'
         #end if
+        ]]>
+    </token>
+    <token name="@query_input@"><![CDATA[
+        #if $query.is_of_type('fasta.gz','fastq.gz'):
+            <(gunzip -c '${query}')
+        #elif $query.is_of_type('fastq.bz2'):
+            <(bunzip2 -c '${query}')
+        #else:
+            '${query}'
+        #end if
+        ]]>
     </token>
     <xml name="target_input">
         <conditional name="source">
@@ -19,7 +34,7 @@
                 </param>
             </when>
             <when value="history">
-                <param name="target" type="data" format="fasta" label="Select a reference dataset" />
+                <param name="target" type="data" format="fasta,fasta.gz" label="Select a reference dataset" />
             </when>
         </conditional>
     </xml>
Binary file test-data/chrM_human.fa.gz has changed
Binary file test-data/chrM_mouse.fa.gz has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/chrM_mouse.fq	Thu May 17 04:29:13 2018 -0400
@@ -0,0 +1,8 @@
+@read1
+GTTAATGTAGCTTAATAACAAAGCAAAGCACTGAAAATGCTTAGATGGATAATTGTATCCCATAAACACAAAGGTTTGGTCCTGGCCTTATAATTAATTAGAGGTAAAATTACACATGCAAACCTCCATAGACCGGTGTAAAATCCCTTAAACATTTACTTAAAATTTAAGGAGAGGGTATCAAGCACATTAAAATAGCTTAAGACACCTTGCCTAGCCACACCCCCACGGGACTCAGCAGTGATAAATA
++
+HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH
+@read2
+TTAAGCAATAAACGAAAGTTTGACTAAGTTATACCTCTTAGGGTTGGTAAATTTCGTGCCAGCCACCGCGGTCATACGATTAACCCAAACTAATTATCTTCGGCGTAAAACGTGTCAACTATAAATAAATAAATAGAATTAAAATCCAACTTATATGTGAAAATTCATTGTTAGGACCTAAACTCAATAACGAAAGTAATTCTAGTCATTTATAATACACGACAGCTAAGACCCAAACTGGGATTAGATA
++
+HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH
Binary file test-data/chrM_mouse.fq.bz2 has changed
Binary file test-data/chrM_mouse.fq.gz has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test4.out	Thu May 17 04:29:13 2018 -0400
@@ -0,0 +1,1 @@
+chrM	chrM	70.79	16186	4208	152	577	16569	1	15860	0	14129.5
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/test5.out	Thu May 17 04:29:13 2018 -0400
@@ -0,0 +1,2 @@
+read1	chrM	68.50	254	71	5	1	248	577	827	5.2e-47	185.2
+read2	chrM	69.50	259	64	4	1	250	830	1082	1.7e-56	216.7