Mercurial > repos > drosofff > fetch_fasta_from_ncbi
changeset 3:a9d8f69d59fb draft
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/tools/fetch_fasta_from_ncbi commit b6de14061c479f0418cd89e26d6f5ac26e565a07
| author | drosofff |
|---|---|
| date | Wed, 09 Nov 2016 11:27:31 -0500 |
| parents | befdb392fece |
| children | 64f45c5e94a0 |
| files | retrieve_fasta_from_NCBI.py retrieve_fasta_from_NCBI.xml test-data/output.fa |
| diffstat | 3 files changed, 12 insertions(+), 4 deletions(-) [+] |
line wrap: on
line diff
--- a/retrieve_fasta_from_NCBI.py Tue Jan 05 10:06:42 2016 -0500 +++ b/retrieve_fasta_from_NCBI.py Wed Nov 09 11:27:31 2016 -0500 @@ -32,11 +32,13 @@ import urllib2 import httplib import re + + class Eutils: def __init__(self, options, logger): self.logger = logger - self.base = "http://eutils.ncbi.nlm.nih.gov/entrez/eutils/" + self.base = "https://eutils.ncbi.nlm.nih.gov/entrez/eutils/" self.query_string = options.query_string self.dbname = options.dbname if options.outname:
--- a/retrieve_fasta_from_NCBI.xml Tue Jan 05 10:06:42 2016 -0500 +++ b/retrieve_fasta_from_NCBI.xml Wed Nov 09 11:27:31 2016 -0500 @@ -1,6 +1,12 @@ <tool id="retrieve_fasta_from_NCBI" name="Retrieve FASTA from NCBI" version="0.9.4"> <description></description> - <command interpreter="python">retrieve_fasta_from_NCBI.py -i "$queryString" -d $dbname -o $outfilename -l $logfile </command> + <command><![CDATA[ + python '$__tool_directory__'/retrieve_fasta_from_NCBI.py + -i "$queryString" + -d $dbname + -o '$outfilename' + -l '$logfile' + ]]></command> <inputs> <param name="queryString" type="text" size="5x80" area="True" value="txid10239[orgn] NOT txid131567[orgn] AND complete[all] NOT partial[title] NOT phage[title]" label="Query to NCBI in entrez format" help="exemple:'Drosophila melanogaster[Organism] AND Gcn5[Title]"> @@ -51,7 +57,7 @@ It is Copyright © 2014-2015 `CNRS and University Pierre et Marie Curie`_ and is released under the `MIT license`_. -.. _Entrez help: http://www.ncbi.nlm.nih.gov/books/NBK3837/#EntrezHelp.Entrez_Searching_Options +.. _Entrez help: https://www.ncbi.nlm.nih.gov/books/NBK3837/#EntrezHelp.Entrez_Searching_Options .. _get_fasta_from_taxon: https://toolshed.g2.bx.psu.edu/view/crs4/get_fasta_from_taxon .. _CNRS and University Pierre et Marie Curie: http://www.ibps.upmc.fr/en .. _MIT license: http://opensource.org/licenses/MIT
--- a/test-data/output.fa Tue Jan 05 10:06:42 2016 -0500 +++ b/test-data/output.fa Wed Nov 09 11:27:31 2016 -0500 @@ -1,4 +1,4 @@ ->gi|9629650|ref|NC_001834.1|_Drosophila_C_virus,_complete_genome +>NC_001834.1_Drosophila_C_virus,_complete_genome TTTATATCGTGTGTACATATAAATATGTACACACGGCTTTTAGGTAGAATATTGTTTTCAATGTTGATTT TAAAGGTAACTTTGGTTATTATGCTTTACGGTTTTCATTGTTGATGGTATTTGTGGCCTGCGGTCCCTAA TTGTTGAATTATTTATTCTGATACGTTGTTTTCATTGTTGATGGTAAGGATTCTTATTTTGAAGTGGTTT