Mercurial > repos > drosofff > metavisitor_workflows

comparison Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-3.ga @ 0:4a47903bb4df draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows commit f6fa4bd2f176e3f4ae4b9c887113557d3c4ff209
author drosofff
date Tue, 05 Apr 2016 06:42:47 -0400
parents
children 48b020a0d2f7
comparison
equal deleted inserted replaced
-1:000000000000 0:4a47903bb4df
1 {
2 "a_galaxy_workflow": "true",
3 "annotation": "",
4 "format-version": "0.1",
5 "name": "Metavisitor: Workflow for Use Case 1-3",
6 "steps": {
7 "0": {
8 "annotation": "",
9 "content_id": null,
10 "id": 0,
11 "input_connections": {},
12 "inputs": [
13 {
14 "description": "",
15 "name": "Input Dataset Collection"
16 }
17 ],
18 "label": null,
19 "name": "Input dataset collection",
20 "outputs": [],
21 "position": {
22 "left": 211.9271240234375,
23 "top": 200
24 },
25 "tool_errors": null,
26 "tool_id": null,
27 "tool_state": "{\"collection_type\": \"list\", \"name\": \"Input Dataset Collection\"}",
28 "tool_version": null,
29 "type": "data_collection_input",
30 "uuid": "e60ca12e-15cc-4a01-a912-945af21a5e8e",
31 "workflow_outputs": [
32 {
33 "label": null,
34 "output_name": "output",
35 "uuid": "af22e150-8299-44ee-be79-a749377663ce"
36 }
37 ]
38 },
39 "1": {
40 "annotation": "",
41 "content_id": null,
42 "id": 1,
43 "input_connections": {},
44 "inputs": [
45 {
46 "description": "",
47 "name": "viral nucleotide BLAST database (NCBI 19-10-2015)"
48 }
49 ],
50 "label": null,
51 "name": "Input dataset",
52 "outputs": [],
53 "position": {
54 "left": 1024.9827423095703,
55 "top": 963.9930725097656
56 },
57 "tool_errors": null,
58 "tool_id": null,
59 "tool_state": "{\"name\": \"viral nucleotide BLAST database (NCBI 19-10-2015)\"}",
60 "tool_version": null,
61 "type": "data_input",
62 "uuid": "462eb78f-9844-42d6-8087-19f2e1e801ca",
63 "workflow_outputs": [
64 {
65 "label": null,
66 "output_name": "output",
67 "uuid": "71520953-6fe2-410d-a217-556ea72142e7"
68 }
69 ]
70 },
71 "2": {
72 "annotation": "",
73 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4",
74 "id": 2,
75 "input_connections": {},
76 "inputs": [],
77 "label": null,
78 "name": "Retrieve FASTA from NCBI",
79 "outputs": [
80 {
81 "name": "outfilename",
82 "type": "fasta"
83 },
84 {
85 "name": "logfile",
86 "type": "txt"
87 }
88 ],
89 "position": {
90 "left": 1587.5001220703125,
91 "top": 994.4965515136719
92 },
93 "post_job_actions": {
94 "HideDatasetActionlogfile": {
95 "action_arguments": {},
96 "action_type": "HideDatasetAction",
97 "output_name": "logfile"
98 },
99 "RenameDatasetActionoutfilename": {
100 "action_arguments": {
101 "newname": "${ncbi_guide_ID}"
102 },
103 "action_type": "RenameDatasetAction",
104 "output_name": "outfilename"
105 }
106 },
107 "tool_errors": null,
108 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4",
109 "tool_state": "{\"__page__\": 0, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"${ncbi_guide_ID}\\\"\", \"dbname\": \"\\\"nuccore\\\"\"}",
110 "tool_version": "0.9.4",
111 "type": "tool",
112 "uuid": "7858036a-2e5d-4dc3-8ce4-819c746c742c",
113 "workflow_outputs": [
114 {
115 "label": null,
116 "output_name": "outfilename",
117 "uuid": "db6977fd-e017-4f30-8be3-e20d500e45de"
118 }
119 ]
120 },
121 "3": {
122 "annotation": "",
123 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6",
124 "id": 3,
125 "input_connections": {
126 "input": {
127 "id": 0,
128 "output_name": "output"
129 }
130 },
131 "inputs": [],
132 "label": null,
133 "name": "Clip adapter",
134 "outputs": [
135 {
136 "name": "output",
137 "type": "fasta"
138 }
139 ],
140 "position": {
141 "left": 420.43408203125,
142 "top": 292.50001525878906
143 },
144 "post_job_actions": {},
145 "tool_errors": null,
146 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6",
147 "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"459d9188801e11e5ae6af01fafdfc061\\\"\", \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"Nmode\": \"\\\"reject\\\"\"}",
148 "tool_version": "1.3.6",
149 "type": "tool",
150 "uuid": "69611c78-3f25-4471-abf7-426ec35fd2db",
151 "workflow_outputs": [
152 {
153 "label": null,
154 "output_name": "output",
155 "uuid": "f539c29e-feed-4631-9c25-83aac8ba6209"
156 }
157 ]
158 },
159 "4": {
160 "annotation": "",
161 "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.06",
162 "id": 4,
163 "input_connections": {
164 "input_file": {
165 "id": 2,
166 "output_name": "outfilename"
167 }
168 },
169 "inputs": [],
170 "label": null,
171 "name": "NCBI BLAST+ makeblastdb",
172 "outputs": [
173 {
174 "name": "outfile",
175 "type": "data"
176 }
177 ],
178 "position": {
179 "left": 1866.4931640625,
180 "top": 1084.4965515136719
181 },
182 "post_job_actions": {
183 "HideDatasetActionoutfile": {
184 "action_arguments": {},
185 "action_type": "HideDatasetAction",
186 "output_name": "outfile"
187 }
188 },
189 "tool_errors": null,
190 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.06",
191 "tool_state": "{\"__page__\": 0, \"mask_data_file\": \"null\", \"input_file\": \"null\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"True\\\"\", \"tax\": \"{\\\"taxselect\\\": \\\"\\\", \\\"__current_case__\\\": 0}\", \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"title\": \"\\\"Blastn candidate database\\\"\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"parse_seqids\": \"\\\"False\\\"\"}",
192 "tool_version": "0.1.06",
193 "type": "tool",
194 "uuid": "ce29cdbe-653a-4d0e-b225-0d0762c28d4d",
195 "workflow_outputs": []
196 },
197 "5": {
198 "annotation": "",
199 "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2",
200 "id": 5,
201 "input_connections": {
202 "input": {
203 "id": 3,
204 "output_name": "output"
205 }
206 },
207 "inputs": [],
208 "label": null,
209 "name": "Concatenate multiple datasets",
210 "outputs": [
211 {
212 "name": "out_file1",
213 "type": "input"
214 }
215 ],
216 "position": {
217 "left": 382.3785400390625,
218 "top": 522.5000228881836
219 },
220 "post_job_actions": {
221 "ChangeDatatypeActionout_file1": {
222 "action_arguments": {
223 "newtype": "fasta"
224 },
225 "action_type": "ChangeDatatypeAction",
226 "output_name": "out_file1"
227 }
228 },
229 "tool_errors": null,
230 "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2",
231 "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}",
232 "tool_version": "0.2",
233 "type": "tool",
234 "uuid": "6be696ec-ca89-4e64-ad39-7d0e7fb4401a",
235 "workflow_outputs": [
236 {
237 "label": null,
238 "output_name": "out_file1",
239 "uuid": "9e2e996f-02a1-4b58-b88b-050caac31037"
240 }
241 ]
242 },
243 "6": {
244 "annotation": "",
245 "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/khmer_normalize_by_median/khmer_normalize_by_median/2.0.0",
246 "id": 6,
247 "input_connections": {
248 "inputs": {
249 "id": 5,
250 "output_name": "out_file1"
251 }
252 },
253 "inputs": [],
254 "label": null,
255 "name": "Normalize By Median",
256 "outputs": [
257 {
258 "name": "sequences",
259 "type": "input"
260 },
261 {
262 "name": "countgraph",
263 "type": "oxlicg"
264 },
265 {
266 "name": "report",
267 "type": "txt"
268 }
269 ],
270 "position": {
271 "left": 522.9688110351562,
272 "top": 658.9930877685547
273 },
274 "post_job_actions": {
275 "ChangeDatatypeActionsequences": {
276 "action_arguments": {
277 "newtype": "fasta"
278 },
279 "action_type": "ChangeDatatypeAction",
280 "output_name": "sequences"
281 },
282 "HideDatasetActioncountgraph": {
283 "action_arguments": {},
284 "action_type": "HideDatasetAction",
285 "output_name": "countgraph"
286 },
287 "HideDatasetActionreport": {
288 "action_arguments": {},
289 "action_type": "HideDatasetAction",
290 "output_name": "report"
291 }
292 },
293 "tool_errors": null,
294 "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/khmer_normalize_by_median/khmer_normalize_by_median/2.0.0",
295 "tool_state": "{\"force_single_switch\": \"\\\"True\\\"\", \"cutoff\": \"\\\"20\\\"\", \"save_countgraph\": \"\\\"False\\\"\", \"parameters\": \"{\\\"type\\\": \\\"simple\\\", \\\"tablesize\\\": \\\"2e9\\\", \\\"__current_case__\\\": 0}\", \"inputs\": \"null\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"paired_switch\": \"\\\"False\\\"\", \"countgraph_to_load\": \"null\", \"unpaired_reads_filename\": \"null\"}",
296 "tool_version": "2.0.0",
297 "type": "tool",
298 "uuid": "834cfd60-e0df-40e3-9d01-ecfa4296960b",
299 "workflow_outputs": [
300 {
301 "label": null,
302 "output_name": "sequences",
303 "uuid": "b5b133ed-e16a-43f6-bb08-796748547b5f"
304 }
305 ]
306 },
307 "7": {
308 "annotation": "",
309 "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2",
310 "id": 7,
311 "input_connections": {
312 "input": {
313 "id": 6,
314 "output_name": "sequences"
315 }
316 },
317 "inputs": [],
318 "label": null,
319 "name": "Concatenate multiple datasets",
320 "outputs": [
321 {
322 "name": "out_file1",
323 "type": "input"
324 }
325 ],
326 "position": {
327 "left": 753.9931640625,
328 "top": 511.9965515136719
329 },
330 "post_job_actions": {
331 "ChangeDatatypeActionout_file1": {
332 "action_arguments": {
333 "newtype": "fasta"
334 },
335 "action_type": "ChangeDatatypeAction",
336 "output_name": "out_file1"
337 },
338 "HideDatasetActionout_file1": {
339 "action_arguments": {},
340 "action_type": "HideDatasetAction",
341 "output_name": "out_file1"
342 }
343 },
344 "tool_errors": null,
345 "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2",
346 "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}",
347 "tool_version": "0.2",
348 "type": "tool",
349 "uuid": "8480cd00-f3b5-4ddb-a140-370a0b6e8c99",
350 "workflow_outputs": []
351 },
352 "8": {
353 "annotation": "",
354 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2",
355 "id": 8,
356 "input_connections": {
357 "input": {
358 "id": 7,
359 "output_name": "out_file1"
360 }
361 },
362 "inputs": [],
363 "label": null,
364 "name": "sRbowtie",
365 "outputs": [
366 {
367 "name": "output",
368 "type": "tabular"
369 },
370 {
371 "name": "aligned",
372 "type": "fasta"
373 },
374 {
375 "name": "unaligned",
376 "type": "fasta"
377 }
378 ],
379 "position": {
380 "left": 830.4341125488281,
381 "top": 288.4895935058594
382 },
383 "post_job_actions": {
384 "HideDatasetActionaligned": {
385 "action_arguments": {},
386 "action_type": "HideDatasetAction",
387 "output_name": "aligned"
388 },
389 "HideDatasetActionoutput": {
390 "action_arguments": {},
391 "action_type": "HideDatasetAction",
392 "output_name": "output"
393 },
394 "RenameDatasetActionunaligned": {
395 "action_arguments": {
396 "newname": "Non D. melanogaster sequences"
397 },
398 "action_type": "RenameDatasetAction",
399 "output_name": "unaligned"
400 }
401 },
402 "tool_errors": null,
403 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2",
404 "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"dm6\\\", \\\"__current_case__\\\": 0}\", \"method\": \"\\\"k_option\\\"\"}",
405 "tool_version": "1.1.2",
406 "type": "tool",
407 "uuid": "e22c6843-8125-49d6-9dcd-546155536f78",
408 "workflow_outputs": [
409 {
410 "label": null,
411 "output_name": "unaligned",
412 "uuid": "1186f277-578c-4b5c-8a62-ee2e01be8d0d"
413 }
414 ]
415 },
416 "9": {
417 "annotation": "",
418 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4",
419 "id": 9,
420 "input_connections": {
421 "inputs_0|input": {
422 "id": 8,
423 "output_name": "unaligned"
424 }
425 },
426 "inputs": [],
427 "label": null,
428 "name": "Oases_optimiser",
429 "outputs": [
430 {
431 "name": "transcripts",
432 "type": "fasta"
433 }
434 ],
435 "position": {
436 "left": 1099.461898803711,
437 "top": 509.4965515136719
438 },
439 "post_job_actions": {
440 "RenameDatasetActiontranscripts": {
441 "action_arguments": {
442 "newname": "Oases Contigs"
443 },
444 "action_type": "RenameDatasetAction",
445 "output_name": "transcripts"
446 }
447 },
448 "tool_errors": null,
449 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4",
450 "tool_state": "{\"__page__\": 0, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": null}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}",
451 "tool_version": "1.1.4",
452 "type": "tool",
453 "uuid": "4290f9b9-2ea7-4634-a639-bc008f1eb90c",
454 "workflow_outputs": [
455 {
456 "label": null,
457 "output_name": "transcripts",
458 "uuid": "36a26500-824f-4a91-97c1-e24a2cbdfbb5"
459 }
460 ]
461 },
462 "10": {
463 "annotation": "",
464 "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06",
465 "id": 10,
466 "input_connections": {
467 "db_opts|histdb": {
468 "id": 1,
469 "output_name": "output"
470 },
471 "query": {
472 "id": 9,
473 "output_name": "transcripts"
474 }
475 },
476 "inputs": [],
477 "label": null,
478 "name": "NCBI BLAST+ blastn",
479 "outputs": [
480 {
481 "name": "output1",
482 "type": "tabular"
483 }
484 ],
485 "position": {
486 "left": 1273.4896919727325,
487 "top": 800.4861450195312
488 },
489 "post_job_actions": {
490 "HideDatasetActionoutput1": {
491 "action_arguments": {},
492 "action_type": "HideDatasetAction",
493 "output_name": "output1"
494 }
495 },
496 "tool_errors": null,
497 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06",
498 "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_optional_id_files_opts\\\": {\\\"adv_optional_id_files_opts_selector\\\": \\\"none\\\", \\\"__current_case__\\\": 0}, \\\"identity_cutoff\\\": \\\"0.0\\\", \\\"adv_opts_selector\\\": \\\"advanced\\\", \\\"ungapped\\\": \\\"False\\\", \\\"filter_query\\\": \\\"True\\\", \\\"word_size\\\": \\\"0\\\", \\\"__current_case__\\\": 1, \\\"parse_deflines\\\": \\\"False\\\", \\\"qcov_hsp_perc\\\": \\\"0.0\\\", \\\"strand\\\": \\\"-strand both\\\", \\\"max_hits\\\": \\\"5\\\"}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"4dd2fde8802311e5bcddf01fafdfc061\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}",
499 "tool_version": "0.1.06",
500 "type": "tool",
501 "uuid": "bf30a0ad-4ef9-49f0-b4c7-4aae52017748",
502 "workflow_outputs": []
503 },
504 "11": {
505 "annotation": "",
506 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3",
507 "id": 11,
508 "input_connections": {
509 "blast": {
510 "id": 10,
511 "output_name": "output1"
512 },
513 "sequences": {
514 "id": 9,
515 "output_name": "transcripts"
516 }
517 },
518 "inputs": [],
519 "label": null,
520 "name": "Parse blast output and compile hits",
521 "outputs": [
522 {
523 "name": "tabularOutput",
524 "type": "tabular"
525 },
526 {
527 "name": "fastaOutput",
528 "type": "fasta"
529 },
530 {
531 "name": "al_sequences",
532 "type": "fasta"
533 },
534 {
535 "name": "un_sequences",
536 "type": "fasta"
537 }
538 ],
539 "position": {
540 "left": 1563.9931640625,
541 "top": 513.4896087646484
542 },
543 "post_job_actions": {
544 "HideDatasetActional_sequences": {
545 "action_arguments": {},
546 "action_type": "HideDatasetAction",
547 "output_name": "al_sequences"
548 },
549 "HideDatasetActionun_sequences": {
550 "action_arguments": {},
551 "action_type": "HideDatasetAction",
552 "output_name": "un_sequences"
553 }
554 },
555 "tool_errors": null,
556 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3",
557 "tool_state": "{\"__page__\": 0, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"filter_term_out\\\": \\\"JX220408.1\\\", \\\"filter_relativeCov\\\": \\\"0.0\\\", \\\"filter_meanScore\\\": \\\"0.0\\\", \\\"use_filters\\\": \\\"yes\\\", \\\"__current_case__\\\": 1, \\\"filter_term_in\\\": \\\"Nora_virus\\\", \\\"filter_maxScore\\\": \\\"0.0\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"null\", \"blast\": \"null\"}",
558 "tool_version": "2.4.3",
559 "type": "tool",
560 "uuid": "84989771-81db-4d86-bff6-cfda892b1959",
561 "workflow_outputs": [
562 {
563 "label": null,
564 "output_name": "tabularOutput",
565 "uuid": "3a780445-58ca-491d-8634-b9c700e26218"
566 },
567 {
568 "label": null,
569 "output_name": "fastaOutput",
570 "uuid": "975aa4eb-7087-4751-8d01-723f5017ec2c"
571 }
572 ]
573 },
574 "12": {
575 "annotation": "",
576 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_cap3/cap3/1.2.0",
577 "id": 12,
578 "input_connections": {
579 "inputSequences": {
580 "id": 11,
581 "output_name": "fastaOutput"
582 }
583 },
584 "inputs": [],
585 "label": null,
586 "name": "cap3",
587 "outputs": [
588 {
589 "name": "contigsandsinglets",
590 "type": "fasta"
591 },
592 {
593 "name": "cap3stdout",
594 "type": "txt"
595 },
596 {
597 "name": "contigs",
598 "type": "fasta"
599 },
600 {
601 "name": "contigsqual",
602 "type": "txt"
603 },
604 {
605 "name": "contigslink",
606 "type": "txt"
607 },
608 {
609 "name": "ace",
610 "type": "txt"
611 },
612 {
613 "name": "info",
614 "type": "txt"
615 },
616 {
617 "name": "singlets",
618 "type": "txt"
619 }
620 ],
621 "position": {
622 "left": 1902.5001220703125,
623 "top": 655.4861450195312
624 },
625 "post_job_actions": {
626 "HideDatasetActionace": {
627 "action_arguments": {},
628 "action_type": "HideDatasetAction",
629 "output_name": "ace"
630 },
631 "HideDatasetActioncap3stdout": {
632 "action_arguments": {},
633 "action_type": "HideDatasetAction",
634 "output_name": "cap3stdout"
635 },
636 "HideDatasetActioncontigs": {
637 "action_arguments": {},
638 "action_type": "HideDatasetAction",
639 "output_name": "contigs"
640 },
641 "HideDatasetActioncontigslink": {
642 "action_arguments": {},
643 "action_type": "HideDatasetAction",
644 "output_name": "contigslink"
645 },
646 "HideDatasetActioncontigsqual": {
647 "action_arguments": {},
648 "action_type": "HideDatasetAction",
649 "output_name": "contigsqual"
650 },
651 "HideDatasetActioninfo": {
652 "action_arguments": {},
653 "action_type": "HideDatasetAction",
654 "output_name": "info"
655 },
656 "HideDatasetActionsinglets": {
657 "action_arguments": {},
658 "action_type": "HideDatasetAction",
659 "output_name": "singlets"
660 }
661 },
662 "tool_errors": null,
663 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_cap3/cap3/1.2.0",
664 "tool_state": "{\"__page__\": 0, \"inputSequences\": \"null\", \"overlaplength\": \"\\\"40\\\"\", \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"overlapidentity\": \"\\\"90\\\"\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}",
665 "tool_version": "1.2.0",
666 "type": "tool",
667 "uuid": "1d6dcdba-8f89-453b-ae30-6bb8aee06360",
668 "workflow_outputs": [
669 {
670 "label": null,
671 "output_name": "contigsandsinglets",
672 "uuid": "de30b0c5-c501-433e-a4d4-e1b4441d2bb1"
673 }
674 ]
675 },
676 "13": {
677 "annotation": "",
678 "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06",
679 "id": 13,
680 "input_connections": {
681 "db_opts|histdb": {
682 "id": 4,
683 "output_name": "outfile"
684 },
685 "query": {
686 "id": 12,
687 "output_name": "contigsandsinglets"
688 }
689 },
690 "inputs": [],
691 "label": null,
692 "name": "NCBI BLAST+ blastn",
693 "outputs": [
694 {
695 "name": "output1",
696 "type": "tabular"
697 }
698 ],
699 "position": {
700 "left": 2234.4967041015625,
701 "top": 956.4930725097656
702 },
703 "post_job_actions": {
704 "HideDatasetActionoutput1": {
705 "action_arguments": {},
706 "action_type": "HideDatasetAction",
707 "output_name": "output1"
708 }
709 },
710 "tool_errors": null,
711 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06",
712 "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_opts_selector\\\": \\\"basic\\\", \\\"__current_case__\\\": 0}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}",
713 "tool_version": "0.1.06",
714 "type": "tool",
715 "uuid": "c9f9c58a-f21d-46d2-a952-9e7b7d5bf939",
716 "workflow_outputs": []
717 },
718 "14": {
719 "annotation": "",
720 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0",
721 "id": 14,
722 "input_connections": {
723 "blast_tab": {
724 "id": 13,
725 "output_name": "output1"
726 },
727 "guideSequence": {
728 "id": 2,
729 "output_name": "outfilename"
730 },
731 "sequences": {
732 "id": 12,
733 "output_name": "contigsandsinglets"
734 }
735 },
736 "inputs": [],
737 "label": null,
738 "name": "blast_to_scaffold",
739 "outputs": [
740 {
741 "name": "output",
742 "type": "fasta"
743 }
744 ],
745 "position": {
746 "left": 2553.0731201171875,
747 "top": 876.5625305175781
748 },
749 "post_job_actions": {
750 "HideDatasetActionoutput": {
751 "action_arguments": {},
752 "action_type": "HideDatasetAction",
753 "output_name": "output"
754 }
755 },
756 "tool_errors": null,
757 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0",
758 "tool_state": "{\"__page__\": 0, \"guideSequence\": \"null\", \"blast_tab\": \"null\", \"__rerun_remap_job_id__\": null, \"sequences\": \"null\"}",
759 "tool_version": "0.9.0",
760 "type": "tool",
761 "uuid": "031fbacb-303d-421d-84ee-24c9474c26d2",
762 "workflow_outputs": []
763 },
764 "15": {
765 "annotation": "",
766 "content_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0",
767 "id": 15,
768 "input_connections": {
769 "input": {
770 "id": 14,
771 "output_name": "output"
772 }
773 },
774 "inputs": [],
775 "label": null,
776 "name": "Regex Find And Replace",
777 "outputs": [
778 {
779 "name": "out_file1",
780 "type": "input"
781 }
782 ],
783 "position": {
784 "left": 2726.9967041015625,
785 "top": 1140.0000305175781
786 },
787 "post_job_actions": {
788 "ChangeDatatypeActionout_file1": {
789 "action_arguments": {
790 "newtype": "fasta"
791 },
792 "action_type": "ChangeDatatypeAction",
793 "output_name": "out_file1"
794 },
795 "RenameDatasetActionout_file1": {
796 "action_arguments": {
797 "newname": "Nora_Median-Norm-reads_${ncbi_guide_ID}_guided"
798 },
799 "action_type": "RenameDatasetAction",
800 "output_name": "out_file1"
801 }
802 },
803 "tool_errors": null,
804 "tool_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0",
805 "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"replacement\\\": \\\">Nora_Median-Norm-reads\\\", \\\"pattern\\\": \\\">.+\\\"}]\", \"__page__\": 0}",
806 "tool_version": "0.1.0",
807 "type": "tool",
808 "uuid": "d804abd4-ad4e-4382-a81d-b592bec797cf",
809 "workflow_outputs": [
810 {
811 "label": null,
812 "output_name": "out_file1",
813 "uuid": "dc8227de-395d-4410-98ec-b176432b5ee8"
814 }
815 ]
816 }
817 },
818 "uuid": "dab2601e-a95f-4f94-accc-28d265c7001e"
819 }