Mercurial > repos > drosofff > metavisitor_workflows
diff Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-3.ga @ 0:4a47903bb4df draft
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows commit f6fa4bd2f176e3f4ae4b9c887113557d3c4ff209
author | drosofff |
---|---|
date | Tue, 05 Apr 2016 06:42:47 -0400 |
parents | |
children | 48b020a0d2f7 |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-3.ga Tue Apr 05 06:42:47 2016 -0400 @@ -0,0 +1,819 @@ +{ + "a_galaxy_workflow": "true", + "annotation": "", + "format-version": "0.1", + "name": "Metavisitor: Workflow for Use Case 1-3", + "steps": { + "0": { + "annotation": "", + "content_id": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Input Dataset Collection" + } + ], + "label": null, + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 211.9271240234375, + "top": 200 + }, + "tool_errors": null, + "tool_id": null, + "tool_state": "{\"collection_type\": \"list\", \"name\": \"Input Dataset Collection\"}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "e60ca12e-15cc-4a01-a912-945af21a5e8e", + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "af22e150-8299-44ee-be79-a749377663ce" + } + ] + }, + "1": { + "annotation": "", + "content_id": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "viral nucleotide BLAST database (NCBI 19-10-2015)" + } + ], + "label": null, + "name": "Input dataset", + "outputs": [], + "position": { + "left": 1024.9827423095703, + "top": 963.9930725097656 + }, + "tool_errors": null, + "tool_id": null, + "tool_state": "{\"name\": \"viral nucleotide BLAST database (NCBI 19-10-2015)\"}", + "tool_version": null, + "type": "data_input", + "uuid": "462eb78f-9844-42d6-8087-19f2e1e801ca", + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "71520953-6fe2-410d-a217-556ea72142e7" + } + ] + }, + "2": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4", + "id": 2, + "input_connections": {}, + "inputs": [], + "label": null, + "name": "Retrieve FASTA from NCBI", + "outputs": [ + { + "name": "outfilename", + "type": "fasta" + }, + { + "name": "logfile", + "type": "txt" + } + ], + "position": { + "left": 1587.5001220703125, + "top": 994.4965515136719 + }, + "post_job_actions": { + "HideDatasetActionlogfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "logfile" + }, + "RenameDatasetActionoutfilename": { + "action_arguments": { + "newname": "${ncbi_guide_ID}" + }, + "action_type": "RenameDatasetAction", + "output_name": "outfilename" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4", + "tool_state": "{\"__page__\": 0, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"${ncbi_guide_ID}\\\"\", \"dbname\": \"\\\"nuccore\\\"\"}", + "tool_version": "0.9.4", + "type": "tool", + "uuid": "7858036a-2e5d-4dc3-8ce4-819c746c742c", + "workflow_outputs": [ + { + "label": null, + "output_name": "outfilename", + "uuid": "db6977fd-e017-4f30-8be3-e20d500e45de" + } + ] + }, + "3": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", + "id": 3, + "input_connections": { + "input": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Clip adapter", + "outputs": [ + { + "name": "output", + "type": "fasta" + } + ], + "position": { + "left": 420.43408203125, + "top": 292.50001525878906 + }, + "post_job_actions": {}, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", + "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"459d9188801e11e5ae6af01fafdfc061\\\"\", \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"Nmode\": \"\\\"reject\\\"\"}", + "tool_version": "1.3.6", + "type": "tool", + "uuid": "69611c78-3f25-4471-abf7-426ec35fd2db", + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "f539c29e-feed-4631-9c25-83aac8ba6209" + } + ] + }, + "4": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.06", + "id": 4, + "input_connections": { + "input_file": { + "id": 2, + "output_name": "outfilename" + } + }, + "inputs": [], + "label": null, + "name": "NCBI BLAST+ makeblastdb", + "outputs": [ + { + "name": "outfile", + "type": "data" + } + ], + "position": { + "left": 1866.4931640625, + "top": 1084.4965515136719 + }, + "post_job_actions": { + "HideDatasetActionoutfile": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "outfile" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.06", + "tool_state": "{\"__page__\": 0, \"mask_data_file\": \"null\", \"input_file\": \"null\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"True\\\"\", \"tax\": \"{\\\"taxselect\\\": \\\"\\\", \\\"__current_case__\\\": 0}\", \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"title\": \"\\\"Blastn candidate database\\\"\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"parse_seqids\": \"\\\"False\\\"\"}", + "tool_version": "0.1.06", + "type": "tool", + "uuid": "ce29cdbe-653a-4d0e-b225-0d0762c28d4d", + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", + "id": 5, + "input_connections": { + "input": { + "id": 3, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Concatenate multiple datasets", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 382.3785400390625, + "top": 522.5000228881836 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "fasta" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", + "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", + "tool_version": "0.2", + "type": "tool", + "uuid": "6be696ec-ca89-4e64-ad39-7d0e7fb4401a", + "workflow_outputs": [ + { + "label": null, + "output_name": "out_file1", + "uuid": "9e2e996f-02a1-4b58-b88b-050caac31037" + } + ] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/khmer_normalize_by_median/khmer_normalize_by_median/2.0.0", + "id": 6, + "input_connections": { + "inputs": { + "id": 5, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Normalize By Median", + "outputs": [ + { + "name": "sequences", + "type": "input" + }, + { + "name": "countgraph", + "type": "oxlicg" + }, + { + "name": "report", + "type": "txt" + } + ], + "position": { + "left": 522.9688110351562, + "top": 658.9930877685547 + }, + "post_job_actions": { + "ChangeDatatypeActionsequences": { + "action_arguments": { + "newtype": "fasta" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "sequences" + }, + "HideDatasetActioncountgraph": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "countgraph" + }, + "HideDatasetActionreport": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "report" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/khmer_normalize_by_median/khmer_normalize_by_median/2.0.0", + "tool_state": "{\"force_single_switch\": \"\\\"True\\\"\", \"cutoff\": \"\\\"20\\\"\", \"save_countgraph\": \"\\\"False\\\"\", \"parameters\": \"{\\\"type\\\": \\\"simple\\\", \\\"tablesize\\\": \\\"2e9\\\", \\\"__current_case__\\\": 0}\", \"inputs\": \"null\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"paired_switch\": \"\\\"False\\\"\", \"countgraph_to_load\": \"null\", \"unpaired_reads_filename\": \"null\"}", + "tool_version": "2.0.0", + "type": "tool", + "uuid": "834cfd60-e0df-40e3-9d01-ecfa4296960b", + "workflow_outputs": [ + { + "label": null, + "output_name": "sequences", + "uuid": "b5b133ed-e16a-43f6-bb08-796748547b5f" + } + ] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", + "id": 7, + "input_connections": { + "input": { + "id": 6, + "output_name": "sequences" + } + }, + "inputs": [], + "label": null, + "name": "Concatenate multiple datasets", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 753.9931640625, + "top": 511.9965515136719 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "fasta" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "HideDatasetActionout_file1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "out_file1" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", + "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", + "tool_version": "0.2", + "type": "tool", + "uuid": "8480cd00-f3b5-4ddb-a140-370a0b6e8c99", + "workflow_outputs": [] + }, + "8": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", + "id": 8, + "input_connections": { + "input": { + "id": 7, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "sRbowtie", + "outputs": [ + { + "name": "output", + "type": "tabular" + }, + { + "name": "aligned", + "type": "fasta" + }, + { + "name": "unaligned", + "type": "fasta" + } + ], + "position": { + "left": 830.4341125488281, + "top": 288.4895935058594 + }, + "post_job_actions": { + "HideDatasetActionaligned": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "aligned" + }, + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + }, + "RenameDatasetActionunaligned": { + "action_arguments": { + "newname": "Non D. melanogaster sequences" + }, + "action_type": "RenameDatasetAction", + "output_name": "unaligned" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", + "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"dm6\\\", \\\"__current_case__\\\": 0}\", \"method\": \"\\\"k_option\\\"\"}", + "tool_version": "1.1.2", + "type": "tool", + "uuid": "e22c6843-8125-49d6-9dcd-546155536f78", + "workflow_outputs": [ + { + "label": null, + "output_name": "unaligned", + "uuid": "1186f277-578c-4b5c-8a62-ee2e01be8d0d" + } + ] + }, + "9": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4", + "id": 9, + "input_connections": { + "inputs_0|input": { + "id": 8, + "output_name": "unaligned" + } + }, + "inputs": [], + "label": null, + "name": "Oases_optimiser", + "outputs": [ + { + "name": "transcripts", + "type": "fasta" + } + ], + "position": { + "left": 1099.461898803711, + "top": 509.4965515136719 + }, + "post_job_actions": { + "RenameDatasetActiontranscripts": { + "action_arguments": { + "newname": "Oases Contigs" + }, + "action_type": "RenameDatasetAction", + "output_name": "transcripts" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4", + "tool_state": "{\"__page__\": 0, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": null}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}", + "tool_version": "1.1.4", + "type": "tool", + "uuid": "4290f9b9-2ea7-4634-a639-bc008f1eb90c", + "workflow_outputs": [ + { + "label": null, + "output_name": "transcripts", + "uuid": "36a26500-824f-4a91-97c1-e24a2cbdfbb5" + } + ] + }, + "10": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", + "id": 10, + "input_connections": { + "db_opts|histdb": { + "id": 1, + "output_name": "output" + }, + "query": { + "id": 9, + "output_name": "transcripts" + } + }, + "inputs": [], + "label": null, + "name": "NCBI BLAST+ blastn", + "outputs": [ + { + "name": "output1", + "type": "tabular" + } + ], + "position": { + "left": 1273.4896919727325, + "top": 800.4861450195312 + }, + "post_job_actions": { + "HideDatasetActionoutput1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output1" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", + "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_optional_id_files_opts\\\": {\\\"adv_optional_id_files_opts_selector\\\": \\\"none\\\", \\\"__current_case__\\\": 0}, \\\"identity_cutoff\\\": \\\"0.0\\\", \\\"adv_opts_selector\\\": \\\"advanced\\\", \\\"ungapped\\\": \\\"False\\\", \\\"filter_query\\\": \\\"True\\\", \\\"word_size\\\": \\\"0\\\", \\\"__current_case__\\\": 1, \\\"parse_deflines\\\": \\\"False\\\", \\\"qcov_hsp_perc\\\": \\\"0.0\\\", \\\"strand\\\": \\\"-strand both\\\", \\\"max_hits\\\": \\\"5\\\"}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"4dd2fde8802311e5bcddf01fafdfc061\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}", + "tool_version": "0.1.06", + "type": "tool", + "uuid": "bf30a0ad-4ef9-49f0-b4c7-4aae52017748", + "workflow_outputs": [] + }, + "11": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", + "id": 11, + "input_connections": { + "blast": { + "id": 10, + "output_name": "output1" + }, + "sequences": { + "id": 9, + "output_name": "transcripts" + } + }, + "inputs": [], + "label": null, + "name": "Parse blast output and compile hits", + "outputs": [ + { + "name": "tabularOutput", + "type": "tabular" + }, + { + "name": "fastaOutput", + "type": "fasta" + }, + { + "name": "al_sequences", + "type": "fasta" + }, + { + "name": "un_sequences", + "type": "fasta" + } + ], + "position": { + "left": 1563.9931640625, + "top": 513.4896087646484 + }, + "post_job_actions": { + "HideDatasetActional_sequences": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "al_sequences" + }, + "HideDatasetActionun_sequences": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "un_sequences" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3", + "tool_state": "{\"__page__\": 0, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"filter_term_out\\\": \\\"JX220408.1\\\", \\\"filter_relativeCov\\\": \\\"0.0\\\", \\\"filter_meanScore\\\": \\\"0.0\\\", \\\"use_filters\\\": \\\"yes\\\", \\\"__current_case__\\\": 1, \\\"filter_term_in\\\": \\\"Nora_virus\\\", \\\"filter_maxScore\\\": \\\"0.0\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"null\", \"blast\": \"null\"}", + "tool_version": "2.4.3", + "type": "tool", + "uuid": "84989771-81db-4d86-bff6-cfda892b1959", + "workflow_outputs": [ + { + "label": null, + "output_name": "tabularOutput", + "uuid": "3a780445-58ca-491d-8634-b9c700e26218" + }, + { + "label": null, + "output_name": "fastaOutput", + "uuid": "975aa4eb-7087-4751-8d01-723f5017ec2c" + } + ] + }, + "12": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_cap3/cap3/1.2.0", + "id": 12, + "input_connections": { + "inputSequences": { + "id": 11, + "output_name": "fastaOutput" + } + }, + "inputs": [], + "label": null, + "name": "cap3", + "outputs": [ + { + "name": "contigsandsinglets", + "type": "fasta" + }, + { + "name": "cap3stdout", + "type": "txt" + }, + { + "name": "contigs", + "type": "fasta" + }, + { + "name": "contigsqual", + "type": "txt" + }, + { + "name": "contigslink", + "type": "txt" + }, + { + "name": "ace", + "type": "txt" + }, + { + "name": "info", + "type": "txt" + }, + { + "name": "singlets", + "type": "txt" + } + ], + "position": { + "left": 1902.5001220703125, + "top": 655.4861450195312 + }, + "post_job_actions": { + "HideDatasetActionace": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "ace" + }, + "HideDatasetActioncap3stdout": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "cap3stdout" + }, + "HideDatasetActioncontigs": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "contigs" + }, + "HideDatasetActioncontigslink": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "contigslink" + }, + "HideDatasetActioncontigsqual": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "contigsqual" + }, + "HideDatasetActioninfo": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "info" + }, + "HideDatasetActionsinglets": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "singlets" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_cap3/cap3/1.2.0", + "tool_state": "{\"__page__\": 0, \"inputSequences\": \"null\", \"overlaplength\": \"\\\"40\\\"\", \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"overlapidentity\": \"\\\"90\\\"\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}", + "tool_version": "1.2.0", + "type": "tool", + "uuid": "1d6dcdba-8f89-453b-ae30-6bb8aee06360", + "workflow_outputs": [ + { + "label": null, + "output_name": "contigsandsinglets", + "uuid": "de30b0c5-c501-433e-a4d4-e1b4441d2bb1" + } + ] + }, + "13": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", + "id": 13, + "input_connections": { + "db_opts|histdb": { + "id": 4, + "output_name": "outfile" + }, + "query": { + "id": 12, + "output_name": "contigsandsinglets" + } + }, + "inputs": [], + "label": null, + "name": "NCBI BLAST+ blastn", + "outputs": [ + { + "name": "output1", + "type": "tabular" + } + ], + "position": { + "left": 2234.4967041015625, + "top": 956.4930725097656 + }, + "post_job_actions": { + "HideDatasetActionoutput1": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output1" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06", + "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_opts_selector\\\": \\\"basic\\\", \\\"__current_case__\\\": 0}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}", + "tool_version": "0.1.06", + "type": "tool", + "uuid": "c9f9c58a-f21d-46d2-a952-9e7b7d5bf939", + "workflow_outputs": [] + }, + "14": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", + "id": 14, + "input_connections": { + "blast_tab": { + "id": 13, + "output_name": "output1" + }, + "guideSequence": { + "id": 2, + "output_name": "outfilename" + }, + "sequences": { + "id": 12, + "output_name": "contigsandsinglets" + } + }, + "inputs": [], + "label": null, + "name": "blast_to_scaffold", + "outputs": [ + { + "name": "output", + "type": "fasta" + } + ], + "position": { + "left": 2553.0731201171875, + "top": 876.5625305175781 + }, + "post_job_actions": { + "HideDatasetActionoutput": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "output" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0", + "tool_state": "{\"__page__\": 0, \"guideSequence\": \"null\", \"blast_tab\": \"null\", \"__rerun_remap_job_id__\": null, \"sequences\": \"null\"}", + "tool_version": "0.9.0", + "type": "tool", + "uuid": "031fbacb-303d-421d-84ee-24c9474c26d2", + "workflow_outputs": [] + }, + "15": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", + "id": 15, + "input_connections": { + "input": { + "id": 14, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Regex Find And Replace", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 2726.9967041015625, + "top": 1140.0000305175781 + }, + "post_job_actions": { + "ChangeDatatypeActionout_file1": { + "action_arguments": { + "newtype": "fasta" + }, + "action_type": "ChangeDatatypeAction", + "output_name": "out_file1" + }, + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "Nora_Median-Norm-reads_${ncbi_guide_ID}_guided" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", + "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"replacement\\\": \\\">Nora_Median-Norm-reads\\\", \\\"pattern\\\": \\\">.+\\\"}]\", \"__page__\": 0}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "d804abd4-ad4e-4382-a81d-b592bec797cf", + "workflow_outputs": [ + { + "label": null, + "output_name": "out_file1", + "uuid": "dc8227de-395d-4410-98ec-b176432b5ee8" + } + ] + } + }, + "uuid": "dab2601e-a95f-4f94-accc-28d265c7001e" +} \ No newline at end of file