Mercurial > repos > drosofff > metavisitor_workflows

comparison Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-4.ga @ 0:4a47903bb4df draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows commit f6fa4bd2f176e3f4ae4b9c887113557d3c4ff209
author drosofff
date Tue, 05 Apr 2016 06:42:47 -0400
parents
children 48b020a0d2f7
comparison
equal deleted inserted replaced
-1:000000000000 0:4a47903bb4df
1 {
2 "a_galaxy_workflow": "true",
3 "annotation": "",
4 "format-version": "0.1",
5 "name": "Metavisitor: Workflow for Use Case 1-4",
6 "steps": {
7 "0": {
8 "annotation": "",
9 "content_id": null,
10 "id": 0,
11 "input_connections": {},
12 "inputs": [
13 {
14 "description": "",
15 "name": "Input Dataset Collection"
16 }
17 ],
18 "label": null,
19 "name": "Input dataset collection",
20 "outputs": [],
21 "position": {
22 "left": 211.94445514678955,
23 "top": 200.00001525878906
24 },
25 "tool_errors": null,
26 "tool_id": null,
27 "tool_state": "{\"collection_type\": \"list\", \"name\": \"Input Dataset Collection\"}",
28 "tool_version": null,
29 "type": "data_collection_input",
30 "uuid": "e60ca12e-15cc-4a01-a912-945af21a5e8e",
31 "workflow_outputs": [
32 {
33 "label": null,
34 "output_name": "output",
35 "uuid": "f9af6731-280d-4606-b7c3-ff6e5bc0870e"
36 }
37 ]
38 },
39 "1": {
40 "annotation": "",
41 "content_id": null,
42 "id": 1,
43 "input_connections": {},
44 "inputs": [
45 {
46 "description": "",
47 "name": "viral nucleotide BLAST database (NCBI 19-10-2015)"
48 }
49 ],
50 "label": null,
51 "name": "Input dataset",
52 "outputs": [],
53 "position": {
54 "left": 1024.9826965332031,
55 "top": 963.9931259155273
56 },
57 "tool_errors": null,
58 "tool_id": null,
59 "tool_state": "{\"name\": \"viral nucleotide BLAST database (NCBI 19-10-2015)\"}",
60 "tool_version": null,
61 "type": "data_input",
62 "uuid": "462eb78f-9844-42d6-8087-19f2e1e801ca",
63 "workflow_outputs": [
64 {
65 "label": null,
66 "output_name": "output",
67 "uuid": "89f3e51c-db84-4ff4-85f3-d3030a160685"
68 }
69 ]
70 },
71 "2": {
72 "annotation": "",
73 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6",
74 "id": 2,
75 "input_connections": {
76 "input": {
77 "id": 0,
78 "output_name": "output"
79 }
80 },
81 "inputs": [],
82 "label": null,
83 "name": "Clip adapter",
84 "outputs": [
85 {
86 "name": "output",
87 "type": "fasta"
88 }
89 ],
90 "position": {
91 "left": 420.4861297607422,
92 "top": 292.5000228881836
93 },
94 "post_job_actions": {},
95 "tool_errors": null,
96 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6",
97 "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"459d9188801e11e5ae6af01fafdfc061\\\"\", \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"Nmode\": \"\\\"reject\\\"\"}",
98 "tool_version": "1.3.6",
99 "type": "tool",
100 "uuid": "69611c78-3f25-4471-abf7-426ec35fd2db",
101 "workflow_outputs": [
102 {
103 "label": null,
104 "output_name": "output",
105 "uuid": "5d28fac9-5b17-48b1-927d-5ae3fbcd2790"
106 }
107 ]
108 },
109 "3": {
110 "annotation": "",
111 "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2",
112 "id": 3,
113 "input_connections": {
114 "input": {
115 "id": 2,
116 "output_name": "output"
117 }
118 },
119 "inputs": [],
120 "label": null,
121 "name": "Concatenate multiple datasets",
122 "outputs": [
123 {
124 "name": "out_file1",
125 "type": "input"
126 }
127 ],
128 "position": {
129 "left": 452.50001525878906,
130 "top": 463.48961639404297
131 },
132 "post_job_actions": {
133 "ChangeDatatypeActionout_file1": {
134 "action_arguments": {
135 "newtype": "fasta"
136 },
137 "action_type": "ChangeDatatypeAction",
138 "output_name": "out_file1"
139 },
140 "HideDatasetActionout_file1": {
141 "action_arguments": {},
142 "action_type": "HideDatasetAction",
143 "output_name": "out_file1"
144 }
145 },
146 "tool_errors": null,
147 "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2",
148 "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}",
149 "tool_version": "0.2",
150 "type": "tool",
151 "uuid": "6be696ec-ca89-4e64-ad39-7d0e7fb4401a",
152 "workflow_outputs": []
153 },
154 "4": {
155 "annotation": "",
156 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0",
157 "id": 4,
158 "input_connections": {
159 "switch|input": {
160 "id": 3,
161 "output_name": "out_file1"
162 }
163 },
164 "inputs": [],
165 "label": null,
166 "name": "fasta - tabular",
167 "outputs": [
168 {
169 "name": "output",
170 "type": "fasta"
171 }
172 ],
173 "position": {
174 "left": 631.5972595214844,
175 "top": 605.5903244018555
176 },
177 "post_job_actions": {
178 "HideDatasetActionoutput": {
179 "action_arguments": {},
180 "action_type": "HideDatasetAction",
181 "output_name": "output"
182 }
183 },
184 "tool_errors": null,
185 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0",
186 "tool_state": "{\"__page__\": 0, \"switch\": \"{\\\"input\\\": null, \\\"conversionType\\\": \\\"fasta2tabular\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null}",
187 "tool_version": "1.1.0",
188 "type": "tool",
189 "uuid": "c700f2a8-231e-4792-a0cc-0e542d36b414",
190 "workflow_outputs": []
191 },
192 "5": {
193 "annotation": "",
194 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0",
195 "id": 5,
196 "input_connections": {
197 "switch|input": {
198 "id": 4,
199 "output_name": "output"
200 }
201 },
202 "inputs": [],
203 "label": null,
204 "name": "fasta - tabular",
205 "outputs": [
206 {
207 "name": "output",
208 "type": "fasta"
209 }
210 ],
211 "position": {
212 "left": 740.5729675292969,
213 "top": 786.5799179077148
214 },
215 "post_job_actions": {
216 "RenameDatasetActionoutput": {
217 "action_arguments": {
218 "newname": "Initial Clipped sequences"
219 },
220 "action_type": "RenameDatasetAction",
221 "output_name": "output"
222 }
223 },
224 "tool_errors": null,
225 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0",
226 "tool_state": "{\"__page__\": 0, \"switch\": \"{\\\"input\\\": null, \\\"conversionType\\\": \\\"tabular2fastaweight\\\", \\\"__current_case__\\\": 2}\", \"__rerun_remap_job_id__\": null}",
227 "tool_version": "1.1.0",
228 "type": "tool",
229 "uuid": "a51f4a8a-2bea-4fc8-97a5-97af74cd4144",
230 "workflow_outputs": [
231 {
232 "label": null,
233 "output_name": "output",
234 "uuid": "28b7e800-5b85-4a42-9af3-7399c7306071"
235 }
236 ]
237 },
238 "6": {
239 "annotation": "",
240 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2",
241 "id": 6,
242 "input_connections": {
243 "input": {
244 "id": 5,
245 "output_name": "output"
246 }
247 },
248 "inputs": [],
249 "label": null,
250 "name": "sRbowtie",
251 "outputs": [
252 {
253 "name": "output",
254 "type": "tabular"
255 },
256 {
257 "name": "aligned",
258 "type": "fasta"
259 },
260 {
261 "name": "unaligned",
262 "type": "fasta"
263 }
264 ],
265 "position": {
266 "left": 830.4861755371094,
267 "top": 288.4896011352539
268 },
269 "post_job_actions": {
270 "HideDatasetActionaligned": {
271 "action_arguments": {},
272 "action_type": "HideDatasetAction",
273 "output_name": "aligned"
274 },
275 "HideDatasetActionoutput": {
276 "action_arguments": {},
277 "action_type": "HideDatasetAction",
278 "output_name": "output"
279 },
280 "RenameDatasetActionunaligned": {
281 "action_arguments": {
282 "newname": "Non D. melanogaster sequences"
283 },
284 "action_type": "RenameDatasetAction",
285 "output_name": "unaligned"
286 }
287 },
288 "tool_errors": null,
289 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2",
290 "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"dm6\\\", \\\"__current_case__\\\": 0}\", \"method\": \"\\\"k_option\\\"\"}",
291 "tool_version": "1.1.2",
292 "type": "tool",
293 "uuid": "e22c6843-8125-49d6-9dcd-546155536f78",
294 "workflow_outputs": [
295 {
296 "label": null,
297 "output_name": "unaligned",
298 "uuid": "ffe3bdf3-dea8-420a-8e04-498463c26691"
299 }
300 ]
301 },
302 "7": {
303 "annotation": "",
304 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4",
305 "id": 7,
306 "input_connections": {
307 "inputs_0|input": {
308 "id": 6,
309 "output_name": "unaligned"
310 }
311 },
312 "inputs": [],
313 "label": null,
314 "name": "Oases_optimiser",
315 "outputs": [
316 {
317 "name": "transcripts",
318 "type": "fasta"
319 }
320 ],
321 "position": {
322 "left": 1099.4965515136719,
323 "top": 509.49654388427734
324 },
325 "post_job_actions": {
326 "RenameDatasetActiontranscripts": {
327 "action_arguments": {
328 "newname": "Oases Contigs"
329 },
330 "action_type": "RenameDatasetAction",
331 "output_name": "transcripts"
332 }
333 },
334 "tool_errors": null,
335 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4",
336 "tool_state": "{\"__page__\": 0, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": null}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}",
337 "tool_version": "1.1.4",
338 "type": "tool",
339 "uuid": "4290f9b9-2ea7-4634-a639-bc008f1eb90c",
340 "workflow_outputs": [
341 {
342 "label": null,
343 "output_name": "transcripts",
344 "uuid": "f5bf1efc-241a-4b48-8fda-5d83ca3eb956"
345 }
346 ]
347 },
348 "8": {
349 "annotation": "",
350 "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06",
351 "id": 8,
352 "input_connections": {
353 "db_opts|histdb": {
354 "id": 1,
355 "output_name": "output"
356 },
357 "query": {
358 "id": 7,
359 "output_name": "transcripts"
360 }
361 },
362 "inputs": [],
363 "label": null,
364 "name": "NCBI BLAST+ blastn",
365 "outputs": [
366 {
367 "name": "output1",
368 "type": "tabular"
369 }
370 ],
371 "position": {
372 "left": 1273.4895935058594,
373 "top": 800.4861679077148
374 },
375 "post_job_actions": {},
376 "tool_errors": null,
377 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06",
378 "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_optional_id_files_opts\\\": {\\\"adv_optional_id_files_opts_selector\\\": \\\"none\\\", \\\"__current_case__\\\": 0}, \\\"identity_cutoff\\\": \\\"0.0\\\", \\\"adv_opts_selector\\\": \\\"advanced\\\", \\\"ungapped\\\": \\\"False\\\", \\\"filter_query\\\": \\\"True\\\", \\\"word_size\\\": \\\"0\\\", \\\"__current_case__\\\": 1, \\\"parse_deflines\\\": \\\"False\\\", \\\"qcov_hsp_perc\\\": \\\"0.0\\\", \\\"strand\\\": \\\"-strand both\\\", \\\"max_hits\\\": \\\"5\\\"}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"4dd2fde8802311e5bcddf01fafdfc061\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}",
379 "tool_version": "0.1.06",
380 "type": "tool",
381 "uuid": "bf30a0ad-4ef9-49f0-b4c7-4aae52017748",
382 "workflow_outputs": [
383 {
384 "label": null,
385 "output_name": "output1",
386 "uuid": "c53ba510-461f-4f0d-a075-d8c97924beab"
387 }
388 ]
389 },
390 "9": {
391 "annotation": "",
392 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3",
393 "id": 9,
394 "input_connections": {
395 "blast": {
396 "id": 8,
397 "output_name": "output1"
398 },
399 "sequences": {
400 "id": 7,
401 "output_name": "transcripts"
402 }
403 },
404 "inputs": [],
405 "label": null,
406 "name": "Parse blast output and compile hits",
407 "outputs": [
408 {
409 "name": "tabularOutput",
410 "type": "tabular"
411 },
412 {
413 "name": "fastaOutput",
414 "type": "fasta"
415 },
416 {
417 "name": "al_sequences",
418 "type": "fasta"
419 },
420 {
421 "name": "un_sequences",
422 "type": "fasta"
423 }
424 ],
425 "position": {
426 "left": 1564.9827575683594,
427 "top": 513.489616394043
428 },
429 "post_job_actions": {
430 "HideDatasetActional_sequences": {
431 "action_arguments": {},
432 "action_type": "HideDatasetAction",
433 "output_name": "al_sequences"
434 },
435 "HideDatasetActionfastaOutput": {
436 "action_arguments": {},
437 "action_type": "HideDatasetAction",
438 "output_name": "fastaOutput"
439 },
440 "HideDatasetActionun_sequences": {
441 "action_arguments": {},
442 "action_type": "HideDatasetAction",
443 "output_name": "un_sequences"
444 }
445 },
446 "tool_errors": null,
447 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3",
448 "tool_state": "{\"__page__\": 0, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"use_filters\\\": \\\"no\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"null\", \"blast\": \"null\"}",
449 "tool_version": "2.4.3",
450 "type": "tool",
451 "uuid": "84989771-81db-4d86-bff6-cfda892b1959",
452 "workflow_outputs": [
453 {
454 "label": null,
455 "output_name": "tabularOutput",
456 "uuid": "8b327d4e-27c9-4ec3-a4f7-be8f8ea27452"
457 }
458 ]
459 }
460 },
461 "uuid": "50e69b15-e7a2-4e1d-8fc4-47f35223efd4"
462 }