Mercurial > repos > drosofff > metavisitor_workflows
view Galaxy-Workflow-Metavisitor__Workflow_for_small_RNA_profiling_of_contigs.ga @ 5:26e2d79e4c17 draft default tip
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows commit aa9e87614903f27fa5359ce8c437eb6961d68c62
author | drosofff |
---|---|
date | Mon, 17 Apr 2017 07:57:13 -0400 |
parents | ba15c770fd40 |
children |
line wrap: on
line source
{ "a_galaxy_workflow": "true", "annotation": "", "format-version": "0.1", "name": "Metavisitor: Workflow for small RNA profiling of contigs", "steps": { "0": { "annotation": "", "content_id": null, "id": 0, "input_connections": {}, "inputs": [ { "description": "", "name": "Input Dataset Collection of fastq reads" } ], "label": null, "name": "Input dataset collection", "outputs": [], "position": { "left": 136, "top": 213 }, "tool_errors": null, "tool_id": null, "tool_state": "{\"collection_type\": \"list\", \"name\": \"Input Dataset Collection of fastq reads\"}", "tool_version": null, "type": "data_collection_input", "uuid": "95c42be8-325b-48dc-b325-c8e8f9bf8720", "workflow_outputs": [ { "label": null, "output_name": "output", "uuid": "b0b38a3f-6467-4a79-8e6c-616befcfae74" } ] }, "1": { "annotation": "", "content_id": null, "id": 1, "input_connections": {}, "inputs": [ { "description": "", "name": "de novo assembled Oases contigs" } ], "label": null, "name": "Input dataset", "outputs": [], "position": { "left": 134.5, "top": 401 }, "tool_errors": null, "tool_id": null, "tool_state": "{\"name\": \"de novo assembled Oases contigs\"}", "tool_version": null, "type": "data_input", "uuid": "654820a8-188a-4b01-8e7f-4483c8df585f", "workflow_outputs": [ { "label": null, "output_name": "output", "uuid": "4918a4f9-037a-41c8-9881-3f91784b7666" } ] }, "2": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", "id": 2, "input_connections": { "input": { "id": 0, "output_name": "output" } }, "inputs": [ { "description": "runtime parameter for tool Clip adapter", "name": "input" } ], "label": null, "name": "Clip adapter", "outputs": [ { "name": "output", "type": "fasta" } ], "position": { "left": 407.5, "top": 239 }, "post_job_actions": { "RenameDatasetActionoutput": { "action_arguments": { "newname": "Clipped reads" }, "action_type": "RenameDatasetAction", "output_name": "output" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", "tool_shed_repository": { "changeset_revision": "a18edcf9c7ed", "name": "yac_clipper", "owner": "drosofff", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"TGGAATTCTCGGGTGCCAAG\\\", \\\"__current_case__\\\": 0}\", \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"Nmode\": \"\\\"reject\\\"\"}", "tool_version": "1.3.6", "type": "tool", "uuid": "98bb84f7-1199-4755-80e8-47e4cd8d7229", "workflow_outputs": [ { "label": null, "output_name": "output", "uuid": "69ef3522-aeb9-4145-a95b-74154c090d35" } ] }, "3": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1", "id": 3, "input_connections": { "input": { "id": 1, "output_name": "output" } }, "inputs": [ { "description": "runtime parameter for tool Filter sequences by length", "name": "input" } ], "label": null, "name": "Filter sequences by length", "outputs": [ { "name": "output", "type": "fasta" } ], "position": { "left": 364, "top": 387 }, "post_job_actions": { "RenameDatasetActionoutput": { "action_arguments": { "newname": "Contig (>300 nt)" }, "action_type": "RenameDatasetAction", "output_name": "output" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1", "tool_shed_repository": { "changeset_revision": "c8cd0a03db49", "name": "fasta_filter_by_length", "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"__page__\": 0, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"max_length\": \"\\\"0\\\"\", \"min_length\": \"\\\"300\\\"\"}", "tool_version": "1.1", "type": "tool", "uuid": "a66d2ce5-bb0a-433c-b8ea-ea612128ee09", "workflow_outputs": [ { "label": null, "output_name": "output", "uuid": "cfc01174-02dc-457e-a178-493cef1813ea" } ] }, "4": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", "id": 4, "input_connections": { "input": { "id": 2, "output_name": "output" } }, "inputs": [ { "description": "runtime parameter for tool Concatenate multiple datasets", "name": "input" } ], "label": null, "name": "Concatenate multiple datasets", "outputs": [ { "name": "out_file1", "type": "input" } ], "position": { "left": 627, "top": 247 }, "post_job_actions": { "RenameDatasetActionout_file1": { "action_arguments": { "newname": "Merged Clipped Reads" }, "action_type": "RenameDatasetAction", "output_name": "out_file1" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", "tool_shed_repository": { "changeset_revision": "201c568972c3", "name": "concatenate_multiple_datasets", "owner": "mvdbeek", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", "tool_version": "0.2", "type": "tool", "uuid": "c54ed9da-2b31-413b-94fc-3ebf21295d50", "workflow_outputs": [ { "label": null, "output_name": "out_file1", "uuid": "308b80b9-5d82-4d46-865b-233498602a8a" } ] }, "5": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", "id": 5, "input_connections": { "input": { "id": 3, "output_name": "output" } }, "inputs": [ { "description": "runtime parameter for tool Regex Find And Replace", "name": "input" } ], "label": null, "name": "Regex Find And Replace", "outputs": [ { "name": "out_file1", "type": "input" } ], "position": { "left": 649, "top": 381 }, "post_job_actions": { "RenameDatasetActionout_file1": { "action_arguments": { "newname": "contig (>300t, simplified names)" }, "action_type": "RenameDatasetAction", "output_name": "out_file1" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", "tool_shed_repository": { "changeset_revision": "9ea374bb0350", "name": "regex_find_replace", "owner": "jjohnson", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"replacement\\\": \\\"\\\", \\\"pattern\\\": \\\"_Confidence_.+\\\"}]\", \"__page__\": 0}", "tool_version": "0.1.0", "type": "tool", "uuid": "4fd98d0b-2ffc-4636-b0dc-c52882a0bb70", "workflow_outputs": [ { "label": null, "output_name": "out_file1", "uuid": "1d62f8d5-96b9-437b-96ef-51c809eeec5c" } ] }, "6": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2.1", "id": 6, "input_connections": { "input": { "id": 4, "output_name": "out_file1" }, "refGenomeSource|ownFile": { "id": 5, "output_name": "out_file1" } }, "inputs": [ { "description": "runtime parameter for tool sRbowtie", "name": "input" }, { "description": "runtime parameter for tool sRbowtie", "name": "refGenomeSource" } ], "label": null, "name": "sRbowtie", "outputs": [ { "name": "output", "type": "tabular" }, { "name": "aligned", "type": "fasta" }, { "name": "unaligned", "type": "fasta" } ], "position": { "left": 942.5, "top": 287 }, "post_job_actions": { "HideDatasetActionaligned": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "aligned" }, "HideDatasetActionunaligned": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "unaligned" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2.1", "tool_shed_repository": { "changeset_revision": "615d2550977f", "name": "msp_sr_bowtie", "owner": "drosofff", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"__current_case__\\\": 1}\", \"method\": \"\\\"a_option\\\"\"}", "tool_version": "1.1.2.1", "type": "tool", "uuid": "b4d59da2-94c7-4607-8c51-6287b9dd6e6c", "workflow_outputs": [ { "label": null, "output_name": "output", "uuid": "400d7592-b9b5-4c70-ba7f-058c656bd305" } ] }, "7": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.2.0", "id": 7, "input_connections": { "refGenomeSource|ownFile": { "id": 5, "output_name": "out_file1" }, "refGenomeSource|series_0|input": { "id": 6, "output_name": "output" } }, "inputs": [ { "description": "runtime parameter for tool Generate readmap and histograms from alignment files", "name": "gff" }, { "description": "runtime parameter for tool Generate readmap and histograms from alignment files", "name": "refGenomeSource" } ], "label": null, "name": "Generate readmap and histograms from alignment files", "outputs": [ { "name": "readmap_dataframe", "type": "tabular" }, { "name": "size_distribution_dataframe", "type": "tabular" }, { "name": "readmap_PDF", "type": "pdf" }, { "name": "size_PDF", "type": "pdf" }, { "name": "combi_PDF", "type": "pdf" } ], "position": { "left": 1243.5, "top": 273 }, "post_job_actions": { "HideDatasetActionreadmap_dataframe": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "readmap_dataframe" }, "HideDatasetActionsize_distribution_dataframe": { "action_arguments": {}, "action_type": "HideDatasetAction", "output_name": "size_distribution_dataframe" } }, "tool_errors": null, "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.2.0", "tool_shed_repository": { "changeset_revision": "92898cc3ea19", "name": "msp_sr_readmap_and_size_histograms", "owner": "drosofff", "tool_shed": "toolshed.g2.bx.psu.edu" }, "tool_state": "{\"minquery\": \"\\\"18\\\"\", \"__page__\": 0, \"rows_per_page\": \"\\\"8\\\"\", \"yrange\": \"\\\"0\\\"\", \"title\": \"\\\"Readmaps and size distributions\\\"\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"series\\\": [{\\\"__index__\\\": 0, \\\"norm\\\": \\\"1.0\\\", \\\"input\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}], \\\"ownFile\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"maxquery\": \"\\\"30\\\"\", \"xlabel\": \"\\\"Coordinates/read size\\\"\", \"ylabel\": \"\\\"Number of reads\\\"\", \"gff\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", "tool_version": "1.2.0", "type": "tool", "uuid": "87f9f9b5-5c71-465b-9422-c0696a3048a5", "workflow_outputs": [ { "label": null, "output_name": "size_PDF", "uuid": "91fa9c78-72dd-41e8-9937-c4b44682f79b" }, { "label": null, "output_name": "combi_PDF", "uuid": "68f021f3-087b-4f77-813f-74fa61877a0e" }, { "label": null, "output_name": "readmap_PDF", "uuid": "70966192-62e8-4dff-99b1-3f5dc8de8c28" } ] } }, "uuid": "c3853e65-8d66-47fc-aad9-6a40f5517622" }