Mercurial > repos > drosofff > msp_sr_bowtie
changeset 0:e8bdae1a2bdc draft
Uploaded
| author | drosofff |
|---|---|
| date | Tue, 26 May 2015 18:36:09 -0400 |
| parents | |
| children | 71b072cf5dde |
| files | sRbowtie.py sRbowtie.xml test-data/297_reference.fa test-data/input.fa test-data/input.fastq test-data/output.bam test-data/output2.bam tool-data/bowtie_indices.loc.sample tool_data_table_conf.xml.sample tool_dependencies.xml |
| diffstat | 10 files changed, 607 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/sRbowtie.py Tue May 26 18:36:09 2015 -0400 @@ -0,0 +1,189 @@ +#!/usr/bin/env python +# small RNA oriented bowtie wrapper +# version 1.5 17-7-2014: arg parser implementation +# Usage sRbowtie.py <1 input_fasta_file> <2 alignment method> <3 -v mismatches> <4 out_type> <5 buildIndexIfHistory> <6 fasta/bowtie index> <7 bowtie output> <8 ali_fasta> <9 unali_fasta> <10 --num-threads \${GALAXY_SLOTS:-4}> +# current rev: for bowtie __norc, move from --supress 2,6,7,8 to --supress 6,7,8. Future Parser must be updated to take into account this standardisation +# Christophe Antoniewski <drosofff@gmail.com> + +import sys +import os +import subprocess +import tempfile +import shutil +import argparse + + +def Parser(): + the_parser = argparse.ArgumentParser( + description="bowtie wrapper for small fasta reads") + the_parser.add_argument( + '--input', action="store", type=str, help="input file") + the_parser.add_argument( + '--input-format', dest="input_format", action="store", type=str, help="fasta or fastq") + the_parser.add_argument('--method', action="store", type=str, + help="RNA, unique, multiple, k_option, n_option, a_option") + the_parser.add_argument('--v-mismatches', dest="v_mismatches", action="store", + type=str, help="number of mismatches allowed for the alignments") + the_parser.add_argument( + '--output-format', dest="output_format", action="store", type=str, help="tabular, sam, bam") + the_parser.add_argument( + '--output', action="store", type=str, help="output file path") + the_parser.add_argument( + '--index-from', dest="index_from", action="store", type=str, help="indexed or history") + the_parser.add_argument('--index-source', dest="index_source", + action="store", type=str, help="file path to the index source") + the_parser.add_argument( + '--aligned', action="store", type=str, help="aligned read file path, maybe None") + the_parser.add_argument('--unaligned', action="store", + type=str, help="unaligned read file path, maybe None") + the_parser.add_argument('--num-threads', dest="num_threads", + action="store", type=str, help="number of bowtie threads") + args = the_parser.parse_args() + return args + + +def stop_err(msg): + sys.stderr.write('%s\n' % msg) + sys.exit() + + +def bowtieCommandLiner(alignment_method="RNA", v_mis="1", out_type="tabular", + aligned="None", unaligned="None", input_format="fasta", input="path", + index="path", output="path", pslots="4"): + if input_format == "fasta": + input_format = "-f" + elif (input_format == "fastq") or (input_format == "fastqsanger"): + input_format = "-q" + else: + raise Exception('input format must be one of fasta or fastq') + if alignment_method == "RNA": + x = "-v %s -M 1 --best --strata -p %s --norc --suppress 6,7,8" % ( + v_mis, pslots) + elif alignment_method == "unique": + x = "-v %s -m 1 -p %s --suppress 6,7,8" % (v_mis, pslots) + elif alignment_method == "multiple": + x = "-v %s -M 1 --best --strata -p %s --suppress 6,7,8" % ( + v_mis, pslots) + elif alignment_method == "k_option": + x = "-v %s -k 1 --best -p %s --suppress 6,7,8" % (v_mis, pslots) + elif alignment_method == "n_option": + x = "-n %s -M 1 --best -p %s --suppress 6,7,8" % (v_mis, pslots) + elif alignment_method == "a_option": + x = "-v %s -a --best -p %s --suppress 6,7,8" % (v_mis, pslots) + if aligned == "None" and unaligned == "None": + fasta_command = "" + elif aligned != "None" and unaligned == "None": + fasta_command = " --al %s" % aligned + elif aligned == "None" and unaligned != "None": + fasta_command = " --un %s" % unaligned + else: + fasta_command = " --al %s --un %s" % (aligned, unaligned) + x = x + fasta_command + if out_type == "tabular": + return "bowtie %s %s %s %s > %s" % (x, index, input_format, input, output) + elif out_type == "sam": + return "bowtie %s -S %s %s %s > %s" % (x, index, input_format, input, output) + elif out_type == "bam": + return "bowtie %s -S %s %s %s |samtools view -bS - > %s" % ( + x, index, input_format, input, output) + + +def bowtie_squash(fasta): + # make temp directory for bowtie indexes + tmp_index_dir = tempfile.mkdtemp() + ref_file = tempfile.NamedTemporaryFile(dir=tmp_index_dir) + ref_file_name = ref_file.name + # by default, delete the temporary file, but ref_file.name is now stored + # in ref_file_name + ref_file.close() + # symlink between the fasta source file and the deleted ref_file name + os.symlink(fasta, ref_file_name) + # bowtie command line, which will work after changing dir + # (cwd=tmp_index_dir) + cmd1 = 'bowtie-build -f %s %s' % (ref_file_name, ref_file_name) + try: + FNULL = open(os.devnull, 'w') + # a path string for a temp file in tmp_index_dir. Just a string + tmp = tempfile.NamedTemporaryFile(dir=tmp_index_dir).name + # creates and open a file handler pointing to the temp file + tmp_stderr = open(tmp, 'wb') + # both stderr and stdout of bowtie-build are redirected in dev/null + proc = subprocess.Popen( + args=cmd1, shell=True, cwd=tmp_index_dir, stderr=FNULL, stdout=FNULL) + returncode = proc.wait() + tmp_stderr.close() + FNULL.close() + sys.stdout.write(cmd1 + "\n") + except Exception as e: + # clean up temp dir + if os.path.exists(tmp_index_dir): + shutil.rmtree(tmp_index_dir) + stop_err('Error indexing reference sequence\n' + str(e)) + # no Cleaning if no Exception, tmp_index_dir has to be cleaned after + # bowtie_alignment() + # bowtie fashion path without extention + index_full_path = os.path.join(tmp_index_dir, ref_file_name) + return tmp_index_dir, index_full_path + + +def bowtie_alignment(command_line, flyPreIndexed=''): + # make temp directory just for stderr + tmp_index_dir = tempfile.mkdtemp() + tmp = tempfile.NamedTemporaryFile(dir=tmp_index_dir).name + tmp_stderr = open(tmp, 'wb') + # conditional statement for sorted bam generation viewable in Trackster + if "samtools" in command_line: + # recover the final output file name + target_file = command_line.split()[-1] + path_to_unsortedBam = os.path.join(tmp_index_dir, "unsorted.bam") + path_to_sortedBam = os.path.join(tmp_index_dir, "unsorted.bam.sorted") + first_command_line = " ".join( + command_line.split()[:-3]) + " -o " + path_to_unsortedBam + " - " + # example: bowtie -v 0 -M 1 --best --strata -p 12 --suppress 6,7,8 -S + # /home/galaxy/galaxy-dist/bowtie/Dmel/dmel-all-chromosome-r5.49 -f + # /home/galaxy/galaxy-dist/database/files/003/dataset_3460.dat + # |samtools view -bS -o /tmp/tmp_PgMT0/unsorted.bam - + # generates an "unsorted.bam.sorted.bam file", NOT an + # "unsorted.bam.sorted" file + second_command_line = "samtools sort %s %s" % ( + path_to_unsortedBam, path_to_sortedBam) + # fileno() method return the file descriptor number of tmp_stderr + p = subprocess.Popen( + args=first_command_line, cwd=tmp_index_dir, shell=True, stderr=tmp_stderr.fileno()) + returncode = p.wait() + sys.stdout.write("%s\n" % first_command_line + str(returncode)) + p = subprocess.Popen( + args=second_command_line, cwd=tmp_index_dir, shell=True, stderr=tmp_stderr.fileno()) + returncode = p.wait() + sys.stdout.write("\n%s\n" % second_command_line + str(returncode)) + if os.path.isfile(path_to_sortedBam + ".bam"): + shutil.copy2(path_to_sortedBam + ".bam", target_file) + else: + p = subprocess.Popen( + args=command_line, shell=True, stderr=tmp_stderr.fileno()) + returncode = p.wait() + sys.stdout.write(command_line + "\n") + tmp_stderr.close() + # cleaning if the index was created in the fly + if os.path.exists(flyPreIndexed): + shutil.rmtree(flyPreIndexed) + # cleaning tmp files and directories + if os.path.exists(tmp_index_dir): + shutil.rmtree(tmp_index_dir) + return + + +def __main__(): + args = Parser() + F = open(args.output, "w") + if args.index_from == "history": + tmp_dir, index_path = bowtie_squash(args.index_source) + else: + tmp_dir, index_path = "dummy/dymmy", args.index_source + command_line = bowtieCommandLiner(args.method, args.v_mismatches, args.output_format, + args.aligned, args.unaligned, args.input_format, args.input, + index_path, args.output, args.num_threads) + bowtie_alignment(command_line, flyPreIndexed=tmp_dir) + F.close() +if __name__ == "__main__": + __main__()
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/sRbowtie.xml Tue May 26 18:36:09 2015 -0400 @@ -0,0 +1,216 @@ +<tool id="bowtieForSmallRNA" name="sRbowtie" version="1.1.0"> + <description>for FASTA small reads</description> + <requirements> + <requirement type="package" version="0.12.7">bowtie</requirement> + <requirement type="package" version="0.1.18">samtools</requirement> + </requirements> + <command interpreter="python"> sRbowtie.py --input $input + --input-format $input.extension + --method $method + --v-mismatches $v_mismatches + --output-format $output_format + --output $output + --index-from $refGenomeSource.genomeSource + ## the very source of the index (indexed or fasta file) + --index-source + #if $refGenomeSource.genomeSource == "history": + $refGenomeSource.ownFile + #else: + $refGenomeSource.index.fields.path + #end if + --aligned $aligned + --unaligned $unaligned + --num-threads \${GALAXY_SLOTS:-4} ## number of processors to be handled by bowtie + </command> + <inputs> + <param format="fasta, fastq" help="Only with clipped, raw fasta files" label="Input fasta file: reads clipped from their adapter" name="input" type="data" /> + <param help="bowtie parameters adjusted to the type of matching. RNA option match to only one strand" label="What kind of matching do you want to do?" name="method" type="select"> + <option value="RNA">Match on sense strand RNA reference index, multiple mappers randomly matched at a single position</option> + <option value="unique">Match unique mappers on DNA reference index</option> + <option selected="true" value="multiple">Match on DNA, multiple mappers randomly matched at a single position</option> + <option value="k_option">Match on DNA as fast as possible, without taking care of mapping issues (for raw annotation of reads)</option> + <option value="n_option">Match on DNA - RNAseq mode (-n bowtie option)</option> + <option value="a_option">Match and report all valid alignments</option> + </param> + <param help="specify the -v bowtie option" label="Number of mismatches allowed" name="v_mismatches" type="select"> + <option value="0">0</option> + <option selected="true" value="1">1</option> + <option value="2">2</option> + <option value="3">3</option> + </param> + <conditional name="refGenomeSource"> + <param help="Built-ins were indexed using default options" label="Will you select a reference genome from your history or use a built-in index?" name="genomeSource" type="select"> + <option value="indexed">Use a built-in index</option> + <option value="history">Use one from the history</option> + </param> + <when value="indexed"> + <param help="if your genome of interest is not listed - contact instance administrator" label="Select a DNA reference index" name="index" type="select"> + <options from_data_table="bowtie_indexes"> + + </options> + </param> + </when> + <when value="history"> + <param format="fasta" label="Select a fasta file, to serve as index reference" name="ownFile" type="data" /> + </when> + </conditional> + <param help="Note that the BAM will be viewable in trackster only if you choose a full genome referenced for Trackster usage. see the doc below" label="Select output format" name="output_format" type="select"> + <option select="true" value="tabular">tabular</option> + <option value="sam">sam</option> + <option value="bam">bam</option> + </param> + <param help="to get aligned and unaligned reads in fasta format" label="additional fasta output" name="additional_fasta" type="select"> + <option select="true" value="No">No</option> + <option value="al">aligned</option> + <option value="unal">unaligned</option> + <option value="al_and_unal">both aligned and unaligned</option> + </param> + </inputs> + <outputs> + <data format="tabular" label="Bowtie Output" name="output"> + <change_format> + <when format="sam" input="output_format" value="sam" /> + <when format="bam" input="output_format" value="bam" /> + </change_format> + <actions> + <conditional name="refGenomeSource.genomeSource"> + <when value="indexed"> + <action name="dbkey" type="metadata"> + <option column="1" name="bowtie_indexes" offset="0" type="from_data_table"> + <filter column="0" compare="startswith" keep="False" type="param_value" value="#" /> + <filter column="0" ref="refGenomeSource.index" type="param_value" /> + </option> + </action> + </when> + <when value="history"> + <action name="dbkey" type="metadata"> + <option name="refGenomeSource.ownFile" param_attribute="dbkey" type="from_param" /> + </action> + </when> + </conditional> + </actions> + </data> + <data format="fasta" label="Matched reads" name="aligned"> + <filter>additional_fasta == "al" or additional_fasta == "al_and_unal"</filter> + </data> + <data format="fasta" label="Unmatched reads" name="unaligned"> + <filter>additional_fasta == "unal" or additional_fasta == "al_and_unal"</filter> + </data> + </outputs> + <tests> + <test> + <param name="genomeSource" value="history" /> + <param ftype="fasta" name="ownFile" value="297_reference.fa" /> + <param name="method" value="unique" /> + <param ftype="fasta" name="input" value="input.fa" /> + <param name="v_mismatches" value="1" /> + <param name="output_format" value="bam" /> + <output file="output.bam" ftype="bam" lines_diff="4" name="output" /> + </test> + <test> + <param name="genomeSource" value="history" /> + <param ftype="fasta" name="ownFile" value="297_reference.fa" /> + <param name="method" value="unique" /> + <param ftype="fastq" name="input" value="input.fastq" /> + <param name="v_mismatches" value="1" /> + <param name="output_format" value="bam" /> + <output file="output2.bam" ftype="bam" lines_diff="4" name="output" /> + </test> + </tests> + <help> + +**What it does** + +Bowtie_ is a short read aligner designed to be ultrafast and memory-efficient. It is developed by Ben Langmead and Cole Trapnell. Please cite: Langmead B, Trapnell C, Pop M, Salzberg SL. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biology 10:R25. + +.. _Bowtie: http://bowtie-bio.sourceforge.net/index.shtml + +A generic "Map with Bowtie for Illumina" Galaxy tool is available in the main Galaxy distribution. + +However, this Bowtie wrapper tool only takes FASTQ files as inputs. + +The sRbowtie wrapper specifically works with short reads FASTA inputs (-v bowtie mode) + +------ + +**OPTIONS** + +.. class:: infomark + +This script uses Bowtie to match reads on a reference index. + +Depending on the type of matching, different bowtie options are used: + +**Match on sense strand RNA reference index, multiple mappers randomly matched at a single position** + +Match on RNA reference, SENSE strand, randomly attributing multiple mapper to target with least mismatches, the polarity column is suppressed in the bowtie tabular report: + +*-v [0,1,2,3] -M 1 --best --strata -p 12 --norc --suppress 2,6,7,8* + +**Match unique mappers on DNA reference index** + +Match ONLY unique mappers on DNA reference index + +*-v [0,1,2,3] -m 1 -p 12 --suppress 6,7,8* + +Note that using this option with -v values other than 0 is questionnable... + +**Match on DNA, multiple mappers randomly matched at a single position** + +Match multiple mappers, randomly attributing multiple mapper to target with least mismatches, number of mismatch allowed specified by -v option: + +*-v [0,1,2,3] -M 1 --best --strata -p 12 --suppress 6,7,8* + +**Match on DNA as fast as possible, without taking care of mapping issues (for raw annotation of reads)** + +Match with highest speed, not guaranteeing best hit for speed gain: + +*-v [0,1,2,3] -k 1 --best -p 12 --suppress 6,7,8* + + +----- + +**Input formats** + +.. class:: warningmark + +*The only accepted format for the script is a raw fasta list of reads, clipped from their adapter* + +----- + +**OUTPUTS** + +If you choose tabular as the output format, you will obtain the matched reads in standard bowtie output format, having the following columns:: + + Column Description + -------- -------------------------------------------------------- + 1 FastaID fasta identifier + 2 polarity + or - depending whether the match was reported on the forward or reverse strand + 3 target name of the matched target + 4 Offset O-based coordinate of the miR on the miRBase pre-miR sequence + 5 Seq sequence of the matched Read + +If you choose SAM, you will get the output in unordered SAM format. + +.. class:: warningmark + +if you choose BAM, the output will be in sorted BAM format. +To be viewable in Trackster, several condition must be fulfilled: + +.. class:: infomark + +Reads must have been matched to a genome whose chromosome names are compatible with Trackster genome indexes + +.. class:: infomark + +the database/Build (dbkey) which is indicated for the dataset (Pencil - Database/Build field) must match a Trackster genome index. + +Please contact the Galaxy instance administrator if your genome is not referenced + +**Matched and unmatched fasta reads can be retrieved, for further analyses** + + </help> + <citations> + <citation type="doi">10.1186/gb-2009-10-3-r25</citation> + </citations> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/297_reference.fa Tue May 26 18:36:09 2015 -0400 @@ -0,0 +1,118 @@ +>FBgn0000005_297 +AGTGACGTATTTGGGTGGTCCAAACCAGCCACTTCCATTATTTCAAAGAAATCAGTAATG +CACTCTAGTAATTTTCCATAACTGTATCCCAGCTGCGCAGACTCGTTTATCTTTTGCAGC +GCAGCGTTCTTTGTAAACATCCTAAAGACCTGCCTAAGCAGATTTGACTGCCCTCTTTCA +ACGCTACCTAATCTTAAGAACCCAAGAGCGAGGCTCTCCCGAAATACAAATATTGTTCAA +ATACTGAGGCTTCTCCTCAATCCAATTTGCATTTGATTTTTAGTCTTAAGCTGAGATCCA +AAGAATAAAGTCGTGAAACTATTTCTCCTAAAAACTATTTTTTATTTCTTGGCGTTGTCC +TTAGTCAACTGACGGGACATTAGTTCGACTCATAAATAAAACAACAATTTTACTGGCGCA +GTCGGTAGGATACAAAAGTATCCGAAAAAAAAGAACCTTCGAATGGAAAATAAGTTAAAT +TTTATAGTCCTGTGCTCGAAACATCTCCCAAAATAAATTCGTGAAAACTCTTCAACTTCA +ATTATAATTCCAATTCGGTTATCCAATAATAAGTGGAAGTGAAATACGAAACAAAAATAT +TAAGTCCAAAGGCAACTAAGTTTTAAAACCAACATATAAAAATAAAAAATTAAAACAATA +TAGAATTTTAATAATACAACACAAAAATTTACAAAACAAAAAAACAAACAAGTGAAACTA +GAAAGCTTAAAAATAATAATAACATTGAATCCGAAACAAAACAAAAAAATAAAACACAAA +AGTTAAAAATTTTACAATAAAAATGTCACAACCAATTATTGCGCTGAGCGACATAAACCT +TGCCGAAGCCCGTCGGCAGCTTAAAGACATTATGCCATTCAAGGGTGATCCAGAAACCCT +TCACACCTTTATCAGCAGAGTGGATTACGTAATTTCGCTCTACCAAACAAATGATGTCCG +ACAACAGAGGATTCTACTGGGAGCCATCGAAAGGAACTTGGACGGACAAATTACACGATC +TTTGGGACTTCCGAACGTCGAAGATTGGCCTACCCTTAAAGCAAGACTCATCGCGGAATT +TAAAATTCAAACACCAAACTACAAACTTCTGGAGAACTTCAGGGAGACACCATACAGAGG +AAGCCTAAGAGCATTCTGCGAAGAAGCGGAGAGACGACGTCAATTACTAATTTCGAAACT +ACACCTGGAAGGTAACCAATCGGATTTTCTTATTTATATTCAGGGTATTAAAGAATCTAT +TAAGATACTGATAAGGAAACTACCAATACAATTATTCACTATTTTAGCCCATCACGATAT +TACAGACTTAAGATCCTTAATTACCATTGCACAAAATGAGGGAATTTATGAAGAACACAT +TAATTTTGAATTTTATGAAAAACCAGAATATCGTAATAAAAATTCAAATTCTAACCAGAA +TTCGAAAACACAAAAATTCAATACAAATGTTCAAACTCAAAATCGACCAAGTTACTCACA +ATATTCCCAACCCTTCCAACCTAATTTTAATCAATACATTCAACCATTTAGACCTAGCTA +TACACAGCAGATAACTAACAACCCACCCATGTGGCACGCACCTAATTATTTCAGACCCAA +CCAATACATAAACCCACAACCCATTATTCAAAAAAATCATTTCCAACAATATCCCAACAA +AGCCCAATTTCCCCAAACAACGCATTTTAGAGGAAATACATACCCTCGACTACAACAACC +CTCTACATATAAAAATACTAACTTCCCGATTACTAAACGACTAAGACCATCGGACAGTGA +ACAAACTAAAATGTCTATTGACGAAATTAGATTCCAAGACGCGCATGAATTCGAACAAGT +CCAACCTAATTATTACGAGCAACAGTATTTTAACCAAAATCAATACAATCCGTATCAAAA +TCATAGCTTCATTAATGAAGGGCAACAACAAGTTCAATTTGTACAAATTAATAACAAACA +AAACCAAAATAATTCTGAACTAAACGAAAATTTTCGGTTAACAGTTCCGGAAAATACGAA +TACATAAAAATAGTATACAAAGGGCGTTCATACAAATGCCTTCTAGACACAGGATCAACA +ATTAATATGATCAATGAAAATATATTTTGTCTTCCCATTCAAAATAGTAGATGTGAAGTT +TTAACATCAAATGGCCCTATTACCTTGAACGACTTGATTATGTTACCCAGAAATAGTATT +TTCAAAAAAACCGAACCATTTTATGTGCACAGATTTTCTAATAATTACGATATGCTAATT +GGCAGAAAATTGTTGAAAAATGCTCAATCAGTTATTAATTACAAAAATGATACAGTTACC +CTTTTTGATCAAACATACAAATTAATTACTTCAGAATCCGAAAGAAACCAAAATTTGTAT +ATCCAAAGGACACCAGAATCAATTGCAAGCTCAGATCAGGAATCAATAAAAAAATTAGAT +TTTTCACAGTTTCGATTAGATCACCTAAATCAGGAGGAAACTTTTAAGTTAAAAGGCTTG +TTAAATAAATTTAGAAATCTTGAATATAAGGAGGGAGAGAAATTAACATTTACAAATACA +ATTAAACACGTACTAAATACAACACATAACTCCCCAATTTATTCGAAACAATACCCACTT +GCGCAAACACACGAAATCGAAGTAGAAAACCAAGTACAGGAAATGCTGAATCAGGGATTA +ATTAGGGAAAGTAATTCTCCATACAATAGTCCTACTTGGGTCGTACCAAAGAAACCGGAT +GCTTCTGGTGCAAATAAGTACAGGGTAGTAATTGATTATAGAAAGCTAAATGAAATAACC +ATACCTGACAGATATCCAATTCCAAATATGGACGAAATTCTTGGCAAACTGGGTAAATGC +CAATATTTTACAACGATCGATCTGGCAAAGGGATTTCATCAAATAGAAATGGACGAAGAA +TCAATTTCTAAAACTGCATTCTCCACAAAAAGCGGTCATTACGAATACCTTCGAATGCCA +TTTGGCCTTAGGAATGCACCCGCTACTTTTCAAAGGTGCATGAATAATATCCTTCGACCG +TTGCTTAACAAACACTGTTTGGTGTATCTGGATGATATTATAATTTTTTCAACATCCCTT +ACAGAACATTTAAATTCAATACAATTAGTTTTTACAAAGCTTGCAGATGCAAATTTAAAA +TTGCAACTAGACAAATGTGAGTTCTTAAAAAAGGAAGCTAACTTTCTTGGTCACATAGTT +ACCCCTGATGGTATTAAACCAAATCCTATTAAAGTTAAAGCCATAGTTTCATACCCAATT +CCGACAAAAGATAAAGAGATAAGAGCTTTCCTTGGATTAACAGGTTATTATCGCAAATTT +ATTCCAAATTACGCAGACATAGCAAAACCCATGACCAGCTGCTTAAAAAAAAGGACAAAG +ATAGATACACAAAAACTTGAGTACATAGAGGCATTCGAAAAACTTAAGGCTTTGATAATT +CGTGACCCAATTTTACAATTACCTGATTTTGAAAAGAAATTTGTTTTAACCACAGATGCA +AGTAACTTGGCCCTCGGGGCTGTCCTTTCTCAAAACGGTCATCCTATATCTTTTATTAGT +AGAACACTTAACGATCACGAATTAAATTACAGTGCTATCGAAAAAGAATTACTTGCCATA +GTTTGGGCCACAAAAACTTTTCGACATTATTTACTAGGACGACAATTTCTCATTGCCAGT +GACCATCAACCTCTTAGATGGCTTCATAACTTAAAGGAACCAGGTGCTAAGTTAGAAAGA +TGGAGAGTTAGATTAAGCGAATACCAATTTAAAATAGATTATATTAAAGGGAAAGAAAAT +TCAGTTGCCGATGCATTATCAAGAATTAAAATTGAAGAAAATCATCATAGTGAAGCTACT +CAACATAGTGCAGAAGAGGACAATAGCAACCTTATTCATTTAACAGAAAAACCAATAAAT +TATTTCAAAAAACAAATAATCTTTATTAAATCCGATAAAAATAAAGTAGAGCATTCAAAA +ATATTCGGTAACTCCATTACCACAATTCAATATGACGTAATGACACTTGAAAAGGCCAAA +CAAATTTTACTCGATCACTTTATCCATAGAAACATTACCATTTATATTGAGAGCGATGTA +GATTTTGAAATCGTTCAAAGAGCACACATAGAAATTGTTAATACCACCTACACAAAAGTA +ATTCGCAGTCTTTTCCTATTAAAGAACGTTGGTTCATACGCCGAATTCAAAGAAATCATA +CTTCAATCACATGAAAAACTTTTACACCCTGGTATACAGAAAATGACAAAATTATTTAAA +GAAAATCACTTCTTTCCAAATAGCCAACTATTAATTCAGAATATAATAAACGAATGCAAC +ATATGCAATTTGGCCAAAACAGAACATAGAAACACCAAAATGCCTTTAAAAATCACACCC +AACCCGGAACATTGCCGAGAAAAATTTGTAGTAGATATTTATTCATCTGAGGGAAAACAT +TACATCAGTTGCATTGATATTTATTCTAAATTCGCTACACTTGAGCAAATTAAAACTAAG +GATTGGATAGAATGCAGAAACGCATTAATGCGCATTTTTAATCAACTAGGAAAACCCAAA +TTATTAAAGGCAGACAGAGACGGAGCTTTCTCCAGTTTAGCTTTAAAGCGATGGCTTGAA +GAAGAAGAAGTCGAATTACAGCTCAATACAGCAAAAAACGGAGTAGCAGACGTCGAAAGA +TTACACAAAACAATAAATGAAAAAATTCGTATAATCAATTCATCTGATGATGAAGAAGTA +AAATTAAGCAAGATAGAAACAATCCTCTACACATACAACCAAAAAATTAAACATGACACT +ACTGGACAGAGACCTGCTCAAATTTTCTTATACGCTGGGCATCCCATATTAGACACTCAA +AAAATTAAAGAGAAGAAAATAGAGAAAATAAATGAAGACAGACGGGAATTTAATATTGAC +ACTAATTACAGAAAAGGTCCACTACAGAAAGGCAAATTAGAAAACCCATTTAAACCAACC +AAAAATGTAGAACAGACAGACCCTGACCATTACAAAATCACTAATAGAAATAGAGTTACG +CACTACTACAAAACACAATTCAAAAAACAAAAGAAAAATAATAAACTCTCAATTTCACAG +GCACCTGGTACCCGATAACACTATTGTTTATACTGATCACAGCTGTTCATGGACAACAAA +TTCAAATTAATAATATTGACACCAACCACGGATATCTCCTTTTTTCTGATAAGCCAGTAC +AGATACCATCCTCCTTTGAACATCACTCCTTAAAAATCAATTTAACTGAAATAGACATCG +TGGTTGACTATTTTGAGCAAAGACTACGAACCGATTACCATGCACCCCAGATCAATTTTT +TATACAATAAAATAAAAAGAGAACTAGCCAGAATAACCCTGAAACATAGAAACAAACGGG +GTTTTATTAACATTGTGGGTTCAGGTTTTAAATACCTATTTGGAACACTAGATGAAAATG +ATCGAGTCGAAATACAGAAAAAACTTGAAATCAACGTCCATAACTCAGTAAAATTACATG +AACTCAACGACGCCATACGATTGATAAATGACGGAATGCAAAAAATACAGAATTATGAAA +ATAACCACACCATCATTGACAGTCTTTTGTTCGAACTAATGCAGTTTACGGAATACATAG +AAGATTTGGAAATGGCTATGCAGCTTTCCAGACTTGGACTGTTTAACCCCAAATTACTAA +ACTACGACAAACTTGAAAATGTGAACAGCCAAAACATTTTGAACATTAAAACATCCACTT +GGATTAACTACAATGATAACCAAGTATTAATCATATCCCACATACCCATTTACCTTTCAC +TAATAAGCACAATTAAAATAATTCCTTACCCAGACTCCAACGGCTATCAGCTAGATTACA +CAGACACACAATCATATTTTGAAAAAGAAAATAAAGTTTATAATACCGAAAATAAAGAAG +TAAAAAATGAATGTGTCACCAATATTATTAAACACTTAAATCCAATTTGTAATTTTAAGC +CAGTACACACGAACGAAATAATAAAATACATAGAACCAAACACAATTGTAACTTGGAACT +TAACCCAAACAATTCTTAACCAAAATTGCCAAAATTCAATTAATAAAATAAAAATAGAAG +GAAACAAAATGATAAGAGTAACGCAATGCAAAATAGAAATCAATAATATAAATTTTAGTG +AAACTCTGTTAGAACCAGAAATAGATTTGACACCACTATACACACCACTTAATATAACAA +AAATAAAAATTGTAAAACACAACGACATTATTGAGATGATTTCAGAGAACAATATTACAC +TTTACATACAAATGATCATTGTAATAATCGCACTAATTTTGTTGTACTCATATTTAAGAT +ATGTATCATTTAAACCATTTATGATGTTGTATGCAAAACTTAAAATAAGAAAAAATCAAA +ATCAAAACACACCACAACAAACAGAAATAGAAGAAATTCCATTTCCCACACTATATCCAT +CAATCCCAGCCCAAGTATAGGCTTCTCTTTAAGGGAAGGGGAGTGACGTATTTGGGTGGT +CCAAACCAGCCACTTCCATTATTTCAAAGAAATCAGTAATGCACTCTAGTAATTTTCCAT +AACTGTATCCCAGCTGCGCAGACTCGTTTATCTTTTGCAGCGCAGCGTTCTTTGTAAACA +TCCTAAAGACCTGCCTAAGCAGATTTGACTGCCCTCTTTCAACGCTACCTAATCTTAAGA +ACCCAAGAGCGAGGCTCTCCCGAAATACAAATATTGTTCAAATACTGAGGCTTCTCCTCA +ATCCAATTTGCATTTGATTTTTAGTCTTAAGCTGAGATCCAAAGAATAAAGTCGTGAAAC +TATTTCTCCTAAAAACTATTTTTTATTTCTTGGCGTTGTCCTTAGTCAACTGACGGGACA +TTAGTTCGACTCATAAATAAAACAACAATTTTACT
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/input.fa Tue May 26 18:36:09 2015 -0400 @@ -0,0 +1,10 @@ +>1 +CATTCTGCGAAGAAGC +>2 +GGAGAGACGACGTCAATTACT +>3 +AATTTCGAAACTACACCTGGAAGGTAACCA +>4 +ATCGGATTTTCTTATTTATATTCAGGGTATTAAAGAATCTAT +>5 +TAAGATACTGATAAGGAAACTACCAATA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/input.fastq Tue May 26 18:36:09 2015 -0400 @@ -0,0 +1,20 @@ +@HTW-1 +CATTCTGCGAAGAAGC ++ +HHHHHHHHHHHHHHHH +@HTW-2 +GGAGAGACGACGTCAATTACT ++ +HHHHHHHHHHHHHHHHHHHHH +@HTW-3 +AATTTCGAAACTACACCTGGAAGGTAACCA ++ +HHHHHHHHHHHHHHHHHHHHHHHHHHHHHH +@HTW-4 +ATCGGATTTTCTTATTTATATTCAGGGTATTAAAGAATCTAT ++ +HHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHHH +@HTW-5 +TAAGATACTGATAAGGAAACTACCAATA ++ +HHHHHHHHHHHHHHHHHHHHHHHHHHHH
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/bowtie_indices.loc.sample Tue May 26 18:36:09 2015 -0400 @@ -0,0 +1,37 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of Bowtie indexed sequences data files. You will +#need to create these data files and then create a bowtie_indices.loc +#file similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The bowtie_indices.loc +#file has this format (longer white space characters are TAB characters): +# +#<unique_build_id> <dbkey> <display_name> <file_base_path> +# +#So, for example, if you had hg18 indexed stored in +#/depot/data2/galaxy/bowtie/hg18/, +#then the bowtie_indices.loc entry would look like this: +# +#hg18 hg18 hg18 /depot/data2/galaxy/bowtie/hg18/hg18 +# +#and your /depot/data2/galaxy/bowtie/hg18/ directory +#would contain hg18.*.ebwt files: +# +#-rw-r--r-- 1 james universe 830134 2005-09-13 10:12 hg18.1.ebwt +#-rw-r--r-- 1 james universe 527388 2005-09-13 10:12 hg18.2.ebwt +#-rw-r--r-- 1 james universe 269808 2005-09-13 10:12 hg18.3.ebwt +#...etc... +# +#Your bowtie_indices.loc file should include an entry per line for each +#index set you have stored. The "file" in the path does not actually +#exist, but it is the prefix for the actual index files. For example: +# +#hg18canon hg18 hg18 Canonical /depot/data2/galaxy/bowtie/hg18/hg18canon +#hg18full hg18 hg18 Full /depot/data2/galaxy/bowtie/hg18/hg18full +#/orig/path/hg19 hg19 hg19 /depot/data2/galaxy/bowtie/hg19/hg19 +#...etc... +# +#Note that for backwards compatibility with workflows, the unique ID of +#an entry must be the path that was in the original loc file, because that +#is the value stored in the workflow for that parameter. That is why the +#hg19 entry above looks odd. New genomes can be better-looking. +#
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.sample Tue May 26 18:36:09 2015 -0400 @@ -0,0 +1,8 @@ +<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc--> +<tables> + <!-- Locations of indexes in the Bowtie mapper format --> + <table name="bowtie_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="tool-data/bowtie_indices.loc" /> + </table> +</tables>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_dependencies.xml Tue May 26 18:36:09 2015 -0400 @@ -0,0 +1,9 @@ +<?xml version="1.0"?> +<tool_dependency> + <package name="bowtie" version="0.12.7"> + <repository changeset_revision="9f9f38617a98" name="package_bowtie_0_12_7" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" /> + </package> + <package name="samtools" version="0.1.18"> + <repository changeset_revision="171cd8bc208d" name="package_samtools_0_1_18" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" /> + </package> +</tool_dependency>