annotate btman-1.0.0/query.xml @ 18:be864d79c9c7 draft

Uploaded 20190304

<?xml version="1.0"?>
<tool name="BloomTree Manager - Query" id="btman_query" version="1.0.0">
    <description>a Sequence Bloom Tree</description>
    <macros>
        <import>macros.xml</import>
    </macros>
    <expand macro="requirements" />
    <command detect_errors="exit_code">
<![CDATA[
    python '$__tool_directory__/query.py'
    
    #set coll_paths = ','.join( [ str( $f ) for $f in $treecollection ] )
    #if $coll_paths is not 'None':
        --treep '${coll_paths}'
        #set coll_names = ','.join( [ str( $f.name ) for $f in $treecollection ] )
            --treen '${coll_names}'
    #end if

    #set file_paths = ','.join( [ str( $f ) for $f in $txtfiles ] )
    #if $file_paths is not 'None':
        --files '${file_paths}'
        #set file_names = ','.join( [ str( $f.name ) for $f in $txtfiles ] )
            --names '${file_names}'
    #end if

    --threshold ${threshold}
    --sort ${sort}

    --outputdir 'answer_collection'
    --outfile '${resulttxt}'
]]>
    </command>
    <inputs>
        <param name="treecollection" type="data_collection" collection_type="list" label="Select a Sequence Bloom Tree" help="Select a collection generated by the Create tool of the BloomTree Manager suite." />
        <param format="tabular" name="txtfiles" type="data" label="Select query files" multiple="true" optional="false" help="Select one or more tabular files containing (ID, TRANSCRIPT) couples for each line. The content of these files will be merged and the result will represent a query to the Sequence Bloom Tree that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." />
        <param name="threshold" size="1" type="float" value="0.7" min="0.0" max="1.0" label="Search threshold" help="Fraction of query kmers that must be present in a leaf to be considered a match." />
        <param name="sort" type="boolean" checked="true" truevalue="1" falsevalue="0" label="Sort matched leaves by the number of query kmers present, and report the number of kmers present (if not selected we just report the matched leaves without regard to which matches are better)." />
    </inputs>
    <outputs>
        <collection name="output_collect" type="list:list" label="BloomTree Manager - Query result collection">
            <discover_datasets pattern="(?P&lt;identifier_0&gt;[^_]+)_(?P&lt;identifier_1&gt;[^_]+)_(?P&lt;ext&gt;[^_]+)" directory="answer_collection" ext="auto" />
        </collection>
        <data format="txt" name="resulttxt" label="${tool.name} SBT: Result" from_work_dir="query.txt" />
    </outputs>

    <help><![CDATA[
This tool is part of the BloomTree Manager Framework that allow to rapidly identify all 
sequenced samples which express a transcript of interest.

----

The input for this tool is a list of (ID, TRANSCRIPT) couples, one for each line,
in a tab delimited format::
    
    id0  CCAACCAAAGGGAAAACTTTTTTCCGACTTTGGCCTAAAGGGTTTAACGGCCAAGTCAGAAGGGAAAAAGTTGCGCCA
    id1  TTAATGACAGGGCCACATGATGTGAAAAAAAATCAGAAACCGAGTCAACGTGAGAAGATAGTACGTACTACCGCAAAT
    ...
    idn  CAATTAATGATAAATATTTTATAAGGTGCGGAAATAAAGTGAGGAATATCTTTTAAATTCAAGTTCAATTCTGAAAGC

The ID can contain alphanumeric characters in addition to spaces, dots, dashes, and round and square brackets.
Any additional character will be trimmed out.

The Sequence Bloom Tree identifier must be also specified. It is a string that identify an existing Sequence
Bloom Tree, which should be built with the Create tool of the BloomTree Manager Suite.

The output of the tool is a list of collections in which every collection contains a file for each ID with a list of
accession numbers representing the samples that express one particular transcript.

----

.. class:: infomark

**Notes**

This Galaxy tool has been developed by Fabio Cumbo.

Please visit this GithHub_repository_ for more information about the BloomTree Manager

.. _GithHub_repository: https://github.com/fabio-cumbo/bloomtree-manager
    ]]></help>

    <expand macro="citations" />
</tool>