Mercurial > repos > fabio > btman

changeset 2:a4abcc1e7459 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded 20180404
author fabio
date Tue, 03 Apr 2018 20:39:28 -0400
parents 9a00e3b8c3c0
children 557d09d81807
files ._.shed.yml ._query.py ._query.xml example.tsv query.xml
diffstat 5 files changed, 6 insertions(+), 3 deletions(-) [+]
line wrap: on
line diff
Binary file ._.shed.yml has changed
Binary file ._query.py has changed
Binary file ._query.xml has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/example.tsv	Tue Apr 03 20:39:28 2018 -0400
@@ -0,0 +1,3 @@
+0	CCAACCAAAGGGAAAACTTTTTTCCGACTTTGGCCTAAAGGGTTTAACGGCCAAGTCAGAAGGGAAAAAGTTGCGCCAAAAATGGCGTTAAAATGTGTAATCAGAGAAGCGACACGAAAAGGGGATCAGCTCTTGGCTGGCAATTGGTAGGTCAGAGGTGGATTGGGAAAAGGCAAGTCAGCAACTGTCGATGACGGCGACTGACTGTTAATGAAAATTGTTTTGGCTGTGTGGAAAAAAATACGCGGGAATCCGTGAATTTTCCGAGGAGCTGGTGGAGCGAAGAAAACGGGGTGCTGCTGTTGTAAATGATTGGTGAAAGTCACACGCCCGCAGCCTTGCCAAACTAATTAACGCCAAATGGAGCTAAGGCCTTTGAATGATGGCTGCAGGCTAGCTTATGAAAAGGGGTTGAAGAGAAGTGGAAAAATTGGTAGAAAGGGATTTGCTCAAGATGCC
+1	TTAATGACAGGGCCACATGATGTGAAAAAAAATCAGAAACCGAGTCAACGTGAGAAGATAGTACGTACTACCGCAAATGAATGGCCATTTCATTTGCATGTTGGGAGCAACAGAAATGAGAGAGCATCCGAAGCTAACCACAAAAATGGACTTTGCTTCATTATGCACAAACACGCCAATAAATGTAACGAGAAAGATAGTAGGAGCGAAAGACGAGACGAGACAAACAGGAAGAAGACGAGTGGACGAGTGTTTTTTGTAACGAAACTCTTAATCGCTCCTTTGCAGGCTTAAGCTGATAGTTGCTACGTTTATGCCATGAATTTCAAGATCTCTCAAATGCGTGAAAATCCAGTTTATGCGACAGACAAATTCATGTATTTGAAAAATCTTAGCTGATAGAAATCAAAGGTGATT
+2	CAATTAATGATAAATATTTTATAAGGTGCGGAAATAAAGTGAGGAATATCTTTTAAATTCAAGTTCAATTCTGAAAGC
\ No newline at end of file
--- a/query.xml	Tue Apr 03 20:27:52 2018 -0400
+++ b/query.xml	Tue Apr 03 20:39:28 2018 -0400
@@ -35,16 +35,16 @@
                 <option value="1">By manually inserted text</option>
             </param>
             <when value="0">
-                <param format="tabular" name="txtfiles" type="data" label="Select files" multiple="true" optional="false" help="Select one or more tabular files containing (ID, TRANSCRIPT) couples for each line. The content of these files will be merged and the result will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." />
+                <param format="tabular" name="txtfiles" type="data" label="Select files" multiple="true" optional="false" help="Select one or more tabular files containing (ID, TRANSCRIPT) couples for each line. The content of these files will be merged and the result will represent a query to the Sequence Bloom Tree that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." />
             </when>
             <when value="1">
-                <param name="sequences" type="text" area="True" size="5x25" label="Manually insert sequences" optional="false" help="Insert a list of (ID, TRANSCRIPT) couples in a tab delimited format, one for each line. The content of this text box will represent a query to the AllSome Sequence Bloom Tree Search Engine that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." />
+                <param name="sequences" type="text" area="True" size="5x25" label="Manually insert sequences" optional="false" help="Insert a list of (ID, TRANSCRIPT) couples in a tab delimited format, one for each line. The content of this text box will represent a query to the Sequence Bloom Tree that will return a collection containing a file for each ID. The content of these files as result of the tool will be a list of accession numbers." />
             </when>
         </conditional>            
         <param name="sthreshold" size="3" type="float" value="0.7" min="0.0" max="1.0" label="Search threshold" help="This threshold controls the specificity. Lower values will produce more hits to the query. Higher values are more stringent and will produce fewer hits." />
     </inputs>
     <outputs>
-        <collection name="output_collect" type="list" label="AllSome Sequence Bloom Tree Search Collection">
+        <collection name="output_collect" type="list" label="BloomTree Manager - Query result collection">
             <discover_datasets pattern="(?P&lt;identifier_0&gt;[^_]+)_(?P&lt;ext&gt;[^_]+)" directory="collection_content" ext="auto" />
         </collection>
     </outputs>