Mercurial > repos > fabio > sbtas_se

diff query.xml @ 20:7944301895cb draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Uploaded 20180223
author fabio
date Fri, 23 Feb 2018 15:45:14 -0500
parents dd3c4fd64402
children
line wrap: on
line diff
--- a/query.xml	Fri Feb 23 13:21:20 2018 -0500
+++ b/query.xml	Fri Feb 23 15:45:14 2018 -0500
@@ -64,7 +64,7 @@
     idn  CAATTAATGATAAATATTTTATAAGGTGCGGAAATAAAGTGAGGAATATCTTTTAAATTCAAGTTCAATTCTGAAAGC
 
 The ID can contain alphanumeric characters in addition to spaces, dots, dashes, and round and square brackets.
-Any additional characters will be trimmed out.
+Any additional character will be trimmed out.
 
 The output of the tool is a collection that contains a file for each ID with a list of
 accession numbers representing the samples that express one particular transcript.