Mercurial > repos > fabio > sbtas_se
changeset 20:7944301895cb draft
Uploaded 20180223
| author | fabio |
|---|---|
| date | Fri, 23 Feb 2018 15:45:14 -0500 |
| parents | 604e373b3b45 |
| children | feab8fd2f0a7 |
| files | ._.shed.yml ._example.tsv ._query.py ._query.xml query.xml |
| diffstat | 5 files changed, 1 insertions(+), 1 deletions(-) [+] |
line wrap: on
line diff
--- a/query.xml Fri Feb 23 13:21:20 2018 -0500 +++ b/query.xml Fri Feb 23 15:45:14 2018 -0500 @@ -64,7 +64,7 @@ idn CAATTAATGATAAATATTTTATAAGGTGCGGAAATAAAGTGAGGAATATCTTTTAAATTCAAGTTCAATTCTGAAAGC The ID can contain alphanumeric characters in addition to spaces, dots, dashes, and round and square brackets. -Any additional characters will be trimmed out. +Any additional character will be trimmed out. The output of the tool is a collection that contains a file for each ID with a list of accession numbers representing the samples that express one particular transcript.
