annotate readseq.xml @ 4:1a40d002fdc4 draft default tip

planemo upload

<tool id="sniplay_readseq" name="Readseq" version="1.0.3">
    
    <!-- [REQUIRED] Tool description displayed after the tool name -->
    <description> Convert various alignment formats </description>
    
    <!-- [OPTIONAL] 3rd party tools, binaries, modules... required for the tool to work -->
    <requirements>
        <requirement type="binary">perl</requirement>
	<requirement type="package" version="10.03.13">readseq.jar</requirement>
    </requirements>
    
    <!-- [STRONGLY RECOMMANDED] Exit code rules -->
    <stdio>
        <!-- [HELP] If no exit code rule is defined, the tool will stop if anything is written to STDERR -->
        <exit_code range="1:" level="fatal" />
    </stdio>

    <!-- [REQUIRED] The command to execute -->
    <command>
	java -jar \$JAVA_JAR_PATH/readseq.jar $filein -f $format >> $fileout_log 2>&amp;1 &amp;&amp;
#if str( $format ) == "1":
 mv ${filein}.ig $fileout
#elif str( $format ) == "2"  :
 mv ${filein}.gb $fileout
#elif str( $format ) == "3"  :
 mv ${filein}.nbrf $fileout
#elif str( $format ) == "4"  :
 mv ${filein}.embl $fileout
#elif str( $format ) == "5"  :
 mv ${filein}.gcg $fileout
#elif str( $format ) == "6"  :
 mv ${filein}.strider $fileout
#elif str( $format ) == "8"  :
 mv ${filein}.fasta $fileout
#elif str( $format ) == "11"  :
 mv ${filein}.phylip2 $fileout
#elif str( $format ) == "12"  :
 mv ${filein}.phylip $fileout
#elif str( $format ) == "13"  :
 mv ${filein}.seq $fileout
#elif str( $format ) == "14"  :
 mv ${filein}.pir $fileout
#elif str( $format ) == "15"  :
 mv ${filein}.msf $fileout
#elif str( $format ) == "17"  :
 mv ${filein}.nexus $fileout
#elif str( $format ) == "18"  :
 mv ${filein}.pretty $fileout
#elif str( $format ) == "19"  :
 mv ${filein}.xml $fileout
#elif str( $format ) == "22"  :
 mv ${filein}.aln $fileout
#elif str( $format ) == "25"  :
 mv ${filein}.ace $fileout
#end if
    </command>
   
    <!-- [REQUIRED] Input files and tool parameters -->
    <inputs>
	<param name="filein" type="data" format="fasta" optional="false" label="Fasta alignment input" />
	<param name="fileout_label" type="text" value="phylip conversion" label="Output name" help="Output name for files" />
	<param name="format" type="select" label="Output format" >
	    <option value="1">1.IG|Stanford</option>
	    <option value="2">2.GenBank|gb</option>
	    <option value="3">3.NBRF</option>
	    <option value="4">4.EMBL|em</option>
	    <option value="5">5.GCG</option>
	    <option value="6">6.DNAStrider</option>
	    <option value="8">8.Pearson|Fasta|fa</option>
	    <option value="11">11.Phylip3.2</option>
	    <option value="12" selected="true">12.Phylip|Phylip4</option>
	    <option value="13">13.Plain|Raw</option>
	    <option value="14">14.PIR|CODATA</option>
	    <option value="15">15.MSF</option>
	    <option value="17">17.PAUP|NEXUS</option>
	    <option value="18">18.Pretty</option>
	    <option value="19">19.XML</option>
	    <option value="22">22.Clustal</option>
	    <option value="25">25.ACEDB</option>
        </param>
    </inputs> 
    
    <!-- [REQUIRED] Output files -->
    <outputs>
	<data name="fileout_log" type="data" format="txt" label="${fileout_label}.log" />
	<data name="fileout" type="data" format="txt" label="${fileout_label}" >
		<change_format>
			<when input="format" value="1" format="ig" />
			<when input="format" value="2" format="genbank" />
			<when input="format" value="4" format="embl" />
			<when input="format" value="5" format="gcg" />
			<when input="format" value="6" format="strider" />
			<when input="format" value="8" format="fasta" />
			<when input="format" value="11" format="phylip" />
			<when input="format" value="12" format="phylip" />
			<when input="format" value="14" format="pir" />
			<when input="format" value="17" format="nexus" />
			<when input="format" value="18" format="prettyseq" />
			<when input="format" value="19" format="xml" />
			<when input="format" value="22" format="clustal" />
			<when input="format" value="25" format="acedb" />
		</change_format>
	</data>
    </outputs>
    
    <!-- [OPTIONAL] Tests to be run manually by the Galaxy admin -->
    <tests>
        <!-- [HELP] Test files have to be in the ~/test-data directory -->
        <test>
         <param name="filein" value="readseq-alignment.fa" />
	 <param name="format" value="1" />
         <output name="fileout" file="readseq-standford" />
        </test>
        <test>
         <param name="filein" value="readseq-alignment.fa" />
	 <param name="format" value="2" />
         <output name="fileout" file="readseq-GenBank" />
        </test>
        <test>
         <param name="filein" value="readseq-alignment.fa" />
	 <param name="format" value="3" />
         <output name="fileout" file="readseq-NBRF" />
        </test>
        <test>
         <param name="filein" value="readseq-alignment.fa" />
	 <param name="format" value="4" />
         <output name="fileout" file="readseq-EMBL" />
        </test>
        <test>
         <param name="filein" value="readseq-alignment.fa" />
	 <param name="format" value="5" />
	 <assert_command>
	  <has_text text="-f 5" />
	  <has_text text=".gcg" />
	 </assert_command>
        </test>
        <test>
         <param name="filein" value="readseq-alignment.fa" />
	 <param name="format" value="6" />
         <output name="fileout" file="readseq-DNAStrider" />
        </test>
        <test>
         <param name="filein" value="readseq-alignment.fa" />
	 <param name="format" value="8" />
         <output name="fileout" file="readseq-Pearson" />
        </test>
        <test>
         <param name="filein" value="readseq-alignment.fa" />
	 <param name="format" value="11" />
         <output name="fileout" file="readseq-phylip32" />
        </test>
        <test>
         <param name="filein" value="readseq-alignment.fa" />
	 <param name="format" value="12" />
         <output name="fileout" file="readseq-phylip" />
        </test>
        <test>
         <param name="filein" value="readseq-alignment.fa" />
	 <param name="format" value="13" />
         <output name="fileout" file="readseq-raw" />
        </test>
        <test>
         <param name="filein" value="readseq-alignment.fa" />
	 <param name="format" value="14" />
         <output name="fileout" file="readseq-PIR" />
        </test>
        <test>
         <param name="filein" value="readseq-alignment.fa" />
	 <param name="format" value="15" />
         <output name="fileout" file="readseq-MSF.txt" lines_diff="2" />
        </test>
        <test>
         <param name="filein" value="readseq-alignment.fa" />
	 <param name="format" value="17" />
         <output name="fileout" file="readseq-NEXUS" />
        </test>
        <test>
         <param name="filein" value="readseq-alignment.fa" />
	 <param name="format" value="18" />
         <output name="fileout" file="readseq-Pretty" />
        </test>
        <test>
         <param name="filein" value="readseq-alignment.fa" />
	 <param name="format" value="19" />
         <output name="fileout" file="readseq-XML" />
        </test>
        <test>
         <param name="filein" value="readseq-alignment.fa" />
	 <param name="format" value="22" />
         <output name="fileout" file="readseq-Clustal" />
        </test>
        <test>
         <param name="filein" value="readseq-alignment.fa" />
	 <param name="format" value="25" />
         <output name="fileout" file="readseq-ACEDB" />
        </test>

    </tests>
    
    <!-- [OPTIONAL] Help displayed in Galaxy -->
    <help>

.. class:: infomark

**Authors** Don Gilbert [e-mail]

  | **Please cite** If you use this tool, please cite Don Gilbert [e-mail]


.. class:: infomark

**Galaxy integration** Andres Gwendoline, Institut Français de Bioinformatique.

.. class:: infomark

**Support** For any questions about Galaxy integration, please send an e-mail to [e-mail]

---------------------------------------------------


=======
Readseq
=======

-----------
Description
-----------

  Compute a phylip tree from a fasta alignment.


-----------------
Workflow position
-----------------

**Upstream tools**

=========== ========================== =======
Name            output file(s)         format 
=========== ========================== =======
=========== ========================== =======


**Downstream tools**

=========== ========================== =======
Name            output file(s)         format
=========== ========================== =======
fastme      Newick tree                Newick 
Rooting     out tree                   Newick 
=========== ========================== =======


----------
Input file
----------

Fasta file
	The input data file contains sequence alignment(s)
	

----------
Parameters
----------

Output name
        Output base name for the ouput files


------------
Output files
------------

Output_name
	Resulting tree in phylip format

Output_name.log
	Log file

------------
Dependencies
------------
ReadSeq
	readseq.jar at 10.03.13 version

---------------------------------------------------

---------------
Working example
---------------

Input files
===========

Fasta file
-----------

::

	>IRAT112 GAGAACCGTCCTGTAAGTACTCTTGCTTTAAGTAATAAAGTAATACTAATCCATGACGCTTAAGTCGAAGAGAGAATAAGTCAATATTTAATTGGACTCATCGCTTATTATCATTATGAATCAATAAACAACTTGATGTTGTGCTCCATGTACGATATATAAAGACAGATA
	>KARASUKARASURANKASU GAGAACCGTCCTGTAAGTACTCTTGCTTTAAATACGAAAGTAATACTAATCCATGACGCTTAAGTCGAAGAGAGAATAAGTCAATATTTAATTGGACTCATCGCTTATGTTCATCATGAATCTATAGTTAACTTGATGTTGTGCTCCATGTACGATATAAAAAGTTAGATA


Parameters
==========

Output name -> phylip conversion


Output files
============

phylip conversion
-----------------

::

	168 5125
	IRAT112      GAGAACCGTC CTGTAAGTAC TCTTGCTTTA AGTAATAAAG TAATACTAAT
	KARASUKARA   GAGAACCGTC CTGTAAGTAC TCTTGCTTTA AATACGAAAG TAATACTAAT
	
    </help>
    
</tool>