Mercurial > repos > genouest > logol
changeset 0:f11370aba286 draft
planemo upload for repository https://github.com/genouest/galaxy-tools/tree/master/tools/logol commit 9ab3e793622c860adb69b1272927620abd106e73
| author | genouest |
|---|---|
| date | Wed, 06 Jun 2018 10:35:32 -0400 |
| parents | |
| children | 08a6fd2620b3 |
| files | logol.xml test-data/logol_results.zip test-data/logol_results_multi_format.zip test-data/primer.fasta test-data/primer.lgd test-data/primer.logol |
| diffstat | 6 files changed, 262 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/logol.xml Wed Jun 06 10:35:32 2018 -0400 @@ -0,0 +1,143 @@ +<?xml version="1.0"?> +<tool id="logol_wrapper" name="Logol" version="1.7.8"> + <description>Biological patterns matching</description> + <requirements> + <requirement type="package" version="1.7.8=1">logol</requirement> + <requirement type="package" version="6.0">unzip</requirement> + </requirements> + <command detect_errors="exit_code"><![CDATA[ + + ## generate properties file + echo -e "minSplitSize=2000000\nmaxResultSize=0\nmaxMatchSize=0\nworkingDir=.\ndir.result=.\nmaxSpacerLength=0\nmaxLength=0\nminLength=2\nparentStrategy=1\nnbProcessor=1\nnbJobs=1\nmaxSolutions=100\nminTreeIndex=2\nsuffix.tool = 2" > logol.properties + + && + + LogolMultiExec.sh + #if str( $options_input.options_input_selector ) == "model": + -m ${options_input.m} + #else + -g ${options_input.g} + #end if + + -${type} + -s ${s} + -max ${max} + + ${fasta} + ${gff} + ${all} + + -maxmatchsize ${maxmatchsize} + -maxspacer ${maxspacer} + -lmax ${lmax} + -lmin ${lmin} + + ${forcesplit} + + -conf logol.properties + + -out 'logol_results.zip' + + > ${log_file} + + && + + unzip logol_results.zip + + ]]></command> + + <inputs> + <conditional name="options_input"> + <param name="options_input_selector" type="select" label="Logol pattern type"> + <option value="model" selected="True">Logol pattern model</option> + <option value="grammar">Logol pattern grammar</option> + </param> + <when value="model"> + <param argument="-m" type="data" format="txt" label="Logol pattern model" help="Pattern model designed by LogolDesigner" /> + </when> + <when value="grammar"> + <param argument="-g" type="data" format="txt" label="Logol pattern grammar" help="Logol Grammar file" /> + </when> + </conditional> + + <param name="type" type="select" format="text"> + <label>Type of personal data file</label> + <option value="dna">DNA</option> + <option value="rna">RNA</option> + <option value="protein">PROTEIN</option> + </param> + + <param argument="-s" type="data" format="fasta" label="Read from file" help="Fasta sequence to analyse" /> + + <param argument="-max" type="integer" value="100" label="Maximum number of result matches"/> + <param argument="-fasta" type="boolean" truevalue="-fasta" falsevalue="" label="Add fasta conversion to result archive" checked="False" value="False"/> + <param argument="-gff" type="boolean" truevalue="-gff" falsevalue="" label="Add gff conversion to result archive" checked="False" value="False"/> + <param argument="-all" type="boolean" truevalue="-all" falsevalue="" label="Search sequence in both directions" checked="False" value="False"/> + <param argument="-maxmatchsize" type="integer" value="0" label="Maximum size of a match (0 is no limit)"/> + <param argument="-maxspacer" type="integer" value="0" label="Maximum size of a spacer (0 is no limit)"/> + <param argument="-lmax" type="integer" value="0" label="Maximum size of a word (0 is no limit)"/> + <param argument="-lmin" type="integer" value="2" label="Minimum size of a word"/> + <param argument="-forcesplit" truevalue="-forcesplit" falsevalue="" type="boolean" label="Allow sequence cut (if several models are defined in rule, all models will look for pattern in same sequence range" checked="False" value="False"/> + <param name="zip" type="boolean" label="Generate zip archive with all files" checked="False" value="False" help="Zip file contains all xml and fasta/gff files if conversion is activated"/> + + </inputs> + <outputs> + <data format="txt" name="log_file" label="Log : ${tool.name} on ${on_string}" /> + <data format="zip" name="logol_results_archive" from_work_dir="logol_results.zip" label="Compressed files : ${tool.name} on ${on_string}"> + <filter>zip</filter> + </data> + <collection name="logol_results" type="list" label="XML files: ${tool.name} on ${on_string}"> + <discover_datasets pattern="(?P<designation>.+)\.xml$" ext="xml" visible="false" /> + </collection> + <collection name="logol_results_gff" type="list" label="GFF files: ${tool.name} on ${on_string}"> + <discover_datasets pattern="(?P<designation>.+)\.xml\.gff" ext="gff" visible="false" /> + <filter>gff</filter> + </collection> + <collection name="logol_results_fasta" type="list" label="Fasta files: ${tool.name} on ${on_string}"> + <discover_datasets pattern="(?P<designation>.+)\.xml\.fasta" ext="fasta" visible="false" /> + <filter>fasta</filter> + </collection> + </outputs> + <tests> + <test> + <param name="s" value="primer.fasta" /> + <conditional name="options_input"> + <param name="options_input_selector" value="grammar"/> + <param name="g" value="primer.logol" /> + </conditional> + <param name="zip" value="True" /> + <output name="logol_results_archive" compare="sim_size" file="logol_results.zip" /> + </test> + <test> + <param name="s" value="primer.fasta" /> + <conditional name="options_input"> + <param name="options_input_selector" value="grammar"/> + <param name="g" value="primer.logol" /> + </conditional> + <param name="gff" value="True" /> + <param name="fasta" value="True" /> + <param name="forcesplit" value="True" /> + <param name="all" value="True" /> + <param name="zip" value="True" /> + <output name="logol_results_archive" compare="sim_size" file="logol_results_multi_format.zip" /> + </test> + </tests> + + <help><![CDATA[ + +Logol is a pattern matching grammar language and a set of tools to search a pattern in a sequence (nucleic or proteic). + +It includes a Linux command line tool and a graphical designer. + +http://logol.genouest.org/web/app.php/logol + +------------------------------------------------------------------------- + +Software is free and open source, under CeCILL license + + + ]]></help> + <citations> + <citation type="doi">10.1007/978-3-319-09192-1_4</citation> + </citations> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/primer.fasta Wed Jun 06 10:35:32 2018 -0400 @@ -0,0 +1,2 @@ +>sample sequence +ccaaaacgtacgtttttttccccccccaaaacgtacgtttttttcccccc
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/primer.lgd Wed Jun 06 10:35:32 2018 -0400 @@ -0,0 +1,113 @@ +<mxGraphModel> + <root> + <Workflow label="MyWorkflow" description="" href="" id="0"> + <mxCell/> + </Workflow> + <Layer label="Default Layer" id="1"> + <mxCell parent="0"/> + </Layer> + <Start label="model1" description="" name="model1" parameters="" id="7"> + <mxCell style="actor" parent="1" vertex="1"> + <mxGeometry x="130" y="160" width="32" height="32" as="geometry"/> + </mxCell> + </Start> + <Variable label="acgt" description="find acgt" overlap="" morphism="" data="" neg_begin="" stg_begin="" neg_end="" stg_end="" neg_size="" stg_optimalsize="" stg_size="" stg_content=""acgt"" stg_save="" neg_cost="" stc_cost="" neg_dist="" stc_dist="" id="8"> + <mxCell style="rounded" parent="1" vertex="1"> + <mxGeometry x="260" y="170" width="72" height="32" as="geometry"/> + </mxCell> + </Variable> + <End label="Terminate" description="" href="" id="9"> + <mxCell style="symbol;image=images/symbols/terminate.png" parent="1" vertex="1"> + <mxGeometry x="750" y="170" width="32" height="32" as="geometry"/> + </mxCell> + </End> + <Edge label="" description="" id="10"> + <mxCell parent="1" source="7" target="8" edge="1"> + <mxGeometry relative="1" as="geometry"/> + </mxCell> + </Edge> + <Rule label="rule" description="" id="13"> + <mxCell style="ellipse" parent="1" vertex="1"> + <mxGeometry x="150" y="70" width="32" height="32" as="geometry"/> + </mxCell> + </Rule> + <Model label="model" description="" parameters="" overlap="" name="model1" id="14"> + <mxCell style="ellipse" parent="1" vertex="1"> + <mxGeometry x="270" y="70" width="72" height="32" as="geometry"/> + </mxCell> + </Model> + <End label="Terminate" description="" href="" id="15"> + <mxCell style="symbol;image=images/symbols/terminate.png" parent="1" vertex="1"> + <mxGeometry x="470" y="70" width="32" height="32" as="geometry"/> + </mxCell> + </End> + <Edge label="" description="" id="16"> + <mxCell parent="1" source="13" target="14" edge="1"> + <mxGeometry relative="1" as="geometry"/> + </mxCell> + </Edge> + <Edge label="" description="" id="17"> + <mxCell parent="1" source="14" target="15" edge="1"> + <mxGeometry relative="1" as="geometry"/> + </mxCell> + </Edge> + <Variable label="acgtwitherror" description="acgt with errors" overlap="" negdata="" morphism="" data="" neg_begin="" stg_begin="" neg_end="" stg_end="" neg_size="" stg_optimalsize="" stg_size="" stg_content=""acgt"" stg_save="" neg_cost="" stc_cost="1" neg_dist="" stc_dist="" stc_alphabet="" stc_alphabetpercent="" id="18"> + <mxCell style="rounded" vertex="1" parent="1"> + <mxGeometry x="470" y="170" width="72" height="32" as="geometry"/> + </mxCell> + </Variable> + <Spacer label="Spacer-max10" description="" stg_begin="" stg_end="" stg_size="1,10" id="19"> + <mxCell style="rhombus" vertex="1" parent="1"> + <mxGeometry x="380" y="170" width="32" height="32" as="geometry"/> + </mxCell> + </Spacer> + <Task label="repeat" description="" nb_repeat="3" overlap="" spacer="" id="20"> + <mxCell style="symbol;image=images/symbols/fork.png" vertex="1" parent="1"> + <mxGeometry x="620" y="270" width="32" height="32" as="geometry"/> + </mxCell> + </Task> + <Variable label="acgtloop" description="" overlap="" negdata="" morphism="" data="" neg_begin="" stg_begin="" neg_end="" stg_end="" neg_size="" stg_optimalsize="" stg_size="" stg_content=""acgt"" stg_save="" neg_cost="" stc_cost="1" neg_dist="" stc_dist="" stc_alphabet="" stc_alphabetpercent="" id="21"> + <mxCell style="rounded" vertex="1" parent="1"> + <mxGeometry x="610" y="170" width="72" height="32" as="geometry"/> + </mxCell> + </Variable> + <Edge label="" description="" id="22"> + <mxCell edge="1" parent="1" source="8" target="19"> + <mxGeometry relative="1" as="geometry"/> + </mxCell> + </Edge> + <Edge label="" description="" id="23"> + <mxCell edge="1" parent="1" source="19" target="18"> + <mxGeometry relative="1" as="geometry"/> + </mxCell> + </Edge> + <Edge label="" description="" id="24"> + <mxCell edge="1" parent="1" source="18" target="21"> + <mxGeometry relative="1" as="geometry"/> + </mxCell> + </Edge> + <Edge label="" description="" id="25"> + <mxCell edge="1" parent="1" source="21" target="9"> + <mxGeometry relative="1" as="geometry"/> + </mxCell> + </Edge> + <Edge label="" description="" id="26"> + <mxCell edge="1" parent="1" source="21" target="20"> + <mxGeometry relative="1" as="geometry"> + <Array as="points"> + <mxPoint x="700" y="240"/> + </Array> + </mxGeometry> + </mxCell> + </Edge> + <Edge label="" description="" id="27"> + <mxCell edge="1" parent="1" source="20" target="21"> + <mxGeometry relative="1" as="geometry"> + <Array as="points"> + <mxPoint x="580" y="250"/> + </Array> + </mxGeometry> + </mxCell> + </Edge> + </root> +</mxGraphModel>