changeset 0:981086ab0e3d draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/bcftools commit ef90c4602bdb83ea7455946c9d175ea27284e643
author iuc
date Wed, 06 Jul 2016 07:06:43 -0400
parents
children b8906a7966b5
files README.md bcftools_plugin_impute_info.xml macros.xml test-data/23andme.fa test-data/annotate.hdr test-data/annotate.tab test-data/annotate.vcf test-data/annotate2.tab test-data/annotate2.vcf test-data/annotate3.vcf test-data/annotate4.vcf test-data/annots.vcf test-data/annots2.vcf test-data/annots4.tab test-data/annots4.vcf test-data/check.vcf test-data/concat.1.a.vcf test-data/concat.1.b.vcf test-data/concat.2.a.vcf test-data/concat.2.b.vcf test-data/concat.3.0.vcf test-data/concat.3.a.vcf test-data/concat.3.b.vcf test-data/concat.3.c.vcf test-data/concat.3.d.vcf test-data/concat.3.e.vcf test-data/concat.3.f.vcf test-data/consensus.1.chain test-data/consensus.1.out test-data/consensus.fa test-data/consensus.tab test-data/consensus.vcf test-data/convert.23andme test-data/convert.gs.gt.gen test-data/convert.gs.gt.samples test-data/convert.gvcf.vcf test-data/convert.hls.gt.hap test-data/convert.hls.gt.legend test-data/convert.hls.gt.samples test-data/convert.hs.gt.hap test-data/convert.hs.gt.samples test-data/convert.vcf test-data/filter.1.vcf test-data/filter.2.vcf test-data/filter.3.vcf test-data/filter.4.vcf test-data/fixploidy.ploidy test-data/fixploidy.samples test-data/fixploidy.vcf test-data/gvcf.fa test-data/isec.a.vcf test-data/isec.b.vcf test-data/merge.2.a.vcf test-data/merge.2.b.vcf test-data/merge.3.a.vcf test-data/merge.3.b.vcf test-data/merge.4.a.vcf test-data/merge.4.b.vcf test-data/merge.a.vcf test-data/merge.b.vcf test-data/merge.c.vcf test-data/mpileup.X.vcf test-data/mpileup.c.X.vcf test-data/mpileup.c.vcf test-data/mpileup.ploidy test-data/mpileup.samples test-data/mpileup.tab test-data/mpileup.vcf test-data/norm.fa test-data/norm.merge.vcf test-data/norm.setref.vcf test-data/norm.split.vcf test-data/norm.vcf test-data/plugin1.vcf test-data/query.filter.vcf test-data/query.out test-data/query.vcf test-data/reheader.hdr test-data/reheader.samples test-data/reheader.samples2 test-data/reheader.vcf test-data/stats.a.vcf test-data/stats.b.vcf test-data/vcf2sex.vcf test-data/view.GL.vcf test-data/view.bcf test-data/view.bcf.csi test-data/view.filter.vcf test-data/view.vcf tool_dependencies.xml
diffstat 90 files changed, 19525 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/README.md	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,68 @@
+# bcftools (v1.3)
+
+Copied from branch bcftools1.2:
+
+This aims to be a "faithful" rendering of the bcftool suite. I.e. options are
+presented essentially as closely to the command line version as is useful. 
+
+This may not appeal to all, if you'd like to see smaller and more dedicated
+tools (e.g. "intersect", "union" and "complement" being separate tools instead
+of all of them included in the "isec" tool,) please feel free to file an issue.
+
+Updated for bcftools v1.3
+
+This was extended from the bcftools1.2 branch then greatly hand edited to 
+group params and manage param innteractions.
+
+In the macros.xml there are macros and tokens to handle file input and output.  
+These use the datatypes currently available in galaxy: Vcf and Bcf
+The macros take care of bgzip and indexing of inputs.  
+
+The convert command was split into 2 tools, "convert to vcf" and "convert from vcf"
+
+## TODO:
+
+- stats needs a matplotlib tool dependency  and pdflatex for generating a pdf of plots
+- cnv needs a matplotlib tool dependency for generating images, then a means to consolidate those.
+- cnv needs an input.vcf for testing, runs with bcftools cnv -s "HG00101" -o 'HG00101/' -p 5 mpileup.vcf
+- roh needs a more useful input.vcf for testing
+- plugin color chrs
+- plugin frameshifts 
+
+## Status
+
+The wrappers were automatically generated in bulk. That doesn't get them 100%
+of the way there (e.g. meaningful test cases), so the rest of the process is a
+bit slower.
+
+- [x] annotate
+- [x] call
+- [ ] cnv (needs real test data, needs plotting)
+- [x] concat
+- [x] consensus
+- [x] convert from vcf
+- [x] convert to vcf
+- [x] filter
+- [x] gtcheck
+- [x] isec
+- [x] merge
+- [x] norm
+- [x] query
+- [x] query list samples
+- [x] reheader
+- [x] roh
+- [x] stats (needs plotting)
+- [x] view
+- [ ] +color chrs
+- [x] +counts
+- [x] +dosage
+- [x] +fill an ac
+- [x] +fill tags
+- [x] +fixploidy
+- [ ] +frameshifts
+- [x] +impute info
+- [x] +mendelian
+- [x] +missing2ref
+- [x] +setgt
+- [x] +tag2tag
+- [x] +vcf2sex
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/bcftools_plugin_impute_info.xml	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,70 @@
+<?xml version='1.0' encoding='utf-8'?>
+<tool name="bcftools @EXECUTABLE@" id="bcftools_plugin_@PLUGIN_ID@" version="@VERSION@.0">
+    <description>plugin Add imputation information metrics to the INFO field</description>
+    <macros>
+        <token name="@EXECUTABLE@">impute-info</token>
+        <token name="@PLUGIN_ID@">impute_info</token>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements" />
+    <expand macro="version_command" />
+    <command detect_errors="aggressive"><![CDATA[
+@PREPARE_ENV@
+@PREPARE_INPUT_FILE@
+#set $section = $sec_restrict
+@PREPARE_TARGETS_FILE@
+
+bcftools plugin @EXECUTABLE@
+
+## VCF input section
+#set $section = $sec_restrict
+@INCLUDE@
+@EXCLUDE@
+@REGIONS@
+@TARGETS@
+
+@OUTPUT_TYPE@
+@THREADS@
+
+## Primary Input/Outputs
+@INPUT_FILE@
+> "$output_file"
+]]>
+    </command>
+    <inputs>
+        <expand macro="macro_input" />
+        <section name="sec_restrict" expanded="false" title="Restrict to">
+            <expand macro="macro_regions" />
+            <expand macro="macro_targets" />
+            <expand macro="macro_include" />
+            <expand macro="macro_exclude" />
+        </section>
+        <expand macro="macro_select_output_type" />
+    </inputs>
+    <outputs>
+        <expand macro="macro_vcf_output" />
+    </outputs>
+    <tests>
+        <test>
+            <param name="input_file" ftype="vcf" value="convert.vcf" />
+            <param name="output_type" value="v" />
+            <output name="output_file">
+                <assert_contents>
+                    <has_text text="IMPUTE2" />
+                    <has_text text="INFO=1" />
+                </assert_contents>
+            </output>
+        </test>
+    </tests>
+    <help><![CDATA[
+=====================================
+ bcftools @EXECUTABLE@ plugin
+=====================================
+
+@REGIONS_HELP@
+@TARGETS_HELP@
+@EXPRESSIONS_HELP@
+
+    ]]></help>
+    <expand macro="citations" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,674 @@
+
+<macros>
+  <token name="@VERSION@">1.3</token>
+  <xml name="stdio">
+    <stdio>
+      <exit_code range="1:" />
+      <exit_code range=":-1" />
+      <regex match="Error:" />
+      <regex match="Exception:" />
+    </stdio>
+  </xml>
+  <xml name="requirements">
+    <requirements>
+      <requirement type="package" version="1.3">bcftools</requirement>
+      <!-- conda dependency -->
+      <requirement type="package" version="1.3">htslib</requirement>
+      <requirement type="package" version="0.2.6">tabix</requirement>
+      <requirement type="package" version="1.2">samtools</requirement>
+    </requirements>
+  </xml>
+  <xml name="version_command">
+    <version_command>bcftools 2&gt;&amp;1 | grep 'Version:'</version_command>
+  </xml>
+  
+  <xml name="citations">
+    <citations>
+      <citation type="doi">10.1093/bioinformatics/btp352</citation>
+      <yield />
+    </citations>
+  </xml>
+  <token name="@BCFTOOLS_WIKI@">https://github.com/samtools/bcftools/wiki</token>
+  <token name="@BCFTOOLS_MANPAGE@">http://samtools.github.io/bcftools/bcftools.html</token>
+  <token name="@THREADS@">
+  --threads \${GALAXY_SLOTS:-4}
+  </token>
+  <token name="@PREPARE_ENV@">
+<![CDATA[
+export BCFTOOLS_PLUGINS=`which bcftools | sed 's,bin/bcftools,libexec/bcftools,'`;
+]]>
+  </token>
+  <xml name="macro_input">
+    <param name="input_file" type="data" format="vcf,vcf_bgzip,bcf,bcf_bgzip" label="VCF/BCF Data" />
+  </xml>
+  <token name="@PREPARE_INPUT_FILE@">
+<![CDATA[
+## May need to symlink input if there is an associated
+#set $input_vcf = 'input.vcf.gz'
+#if $input_file.datatype.file_ext == 'vcf'
+  bgzip -c "$input_file" > $input_vcf &&
+  bcftools index $input_vcf &&
+#elif $input_file.datatype.file_ext == 'vcf_bgzip'
+  ln -s "$input_file" $input_vcf
+#elif $input_file.datatype.file_ext == 'bcf'
+  #set $input_vcf = 'input.bcf'
+  ln -s "$input_file" $input_vcf && 
+  #if $input_file.metadata.bcf_index:
+    ln -s $input_file.metadata.bcf_index ${input_vcf}.csi &&
+  #else 
+    bcftools index $input_vcf &&
+  #end if
+#elif $input_file.datatype.file_ext == 'bcf_bgzip'
+  ln -s "$input_file" $input_vcf
+#end if
+]]>
+  </token>
+  <token name="@INPUT_FILE@">
+$input_vcf
+  </token>
+
+  <xml name="macro_inputs">
+    <param name="input_files" type="data" format="vcf,bcf" label="Other VCF/BCF Datasets" multiple="True" />
+  </xml>
+  <token name="@PREPARE_INPUT_FILES@">
+<![CDATA[
+## May need to symlink input if there is an associated
+#set $input_vcfs = []
+#set $vcfs_list_file = 'vcfs_list'
+#for (i,input_file) in enumerate($input_files):
+  #set $input_vcf = 'input' + str($i) + '.vcf.gz'
+  echo '$input_vcf' >> $vcfs_list_file &&
+  #if $input_file.datatype.file_ext == 'vcf'
+    bgzip -c "$input_file" > $input_vcf &&
+    bcftools index $input_vcf &&
+  #elif $input_file.datatype.file_ext == 'vcf_bgz'
+    ln -s "$input_file" $input_vcf
+  #elif $input_file.datatype.file_ext == 'bcf'
+    #set $input_vcf = 'input' + str($i) + '.bcf.gz'
+    ## bgzip -c "$input_file" > $input_vcf &&
+    ln -s "$input_file" $input_vcf &&
+    #if $input_file.metadata.bcf_index:
+      ln -s $input_file.metadata.bcf_index ${input_vcf}.csi &&
+    #else 
+      bcftools index $input_vcf &&
+    #end if
+  #elif $input_file.datatype.file_ext == 'bcfvcf_bgz'
+    ln -s "$input_file" $input_vcf &&
+  #end if
+  $input_vcfs.append($input_vcf)
+#end for
+]]>
+  </token>
+  <token name="@INPUT_FILES@">
+#echo ' '.join($input_vcfs)#
+  </token>
+  <token name="@INPUT_LIST_FILE@">
+$vcfs_list_file
+  </token>
+
+  <xml name="macro_fasta_ref">
+    <param name="fasta_ref" type="data" format="data" label="Fasta Ref" optional="True" help="reference sequence in fasta format" />
+  </xml>
+  <token name="@PREPARE_FASTA_REF@">
+<![CDATA[
+#set $input_fa_ref = None
+#if 'fasta_ref' in $section and $section.fasta_ref:
+  #set $input_fa_ref = 'ref.fa'
+  ln -s $section.fasta_ref $input_fa_ref &&
+  samtools faidx $input_fa_ref &&
+#end if
+]]>
+  </token>
+  <token name="@FASTA_REF@">
+#if $input_fa_ref is not None:
+  --fasta-ref  "$input_fa_ref"
+#elif 'fasta_ref' in $section and $section.fasta_ref:
+  --fasta-ref "${section.fasta_ref}"
+#end if
+  </token>
+
+  <xml name="macro_ref_fasta">
+    <conditional name="reference_source">
+       <param name="reference_source_selector" type="select" label="Choose the source for the reference genome">
+         <option value="cached">Locally cached</option>
+         <option value="history">History</option>
+       </param>
+       <when value="cached">
+         <param name="ref_file" type="select" label="Select reference genome">
+           <options from_data_table="fasta_indexes">
+             <!--<filter type="data_meta" key="dbkey" ref="input_bam" column="value"/>-->
+           </options>
+           <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
+         </param>
+       </when>
+       <when value="history"> <!-- FIX ME!!!! -->
+         <param name="ref_file" type="data" format="fasta" label="Using reference file" />
+       </when>
+     </conditional>
+  </xml>
+
+
+  <xml name="macro_AF_file">
+    <param name="AF_file" type="data" format="data" label="Af File" optional="True" help="read allele frequencies from file (CHR\tPOS\tREF,ALT\tAF)" />
+  </xml>
+  <!-- This may need to bgzip and tabix the file -->
+  <token name="@PREPARE_AF_FILE@">
+<![CDATA[
+#if 'AF_file' in $section and $section.AF_file:
+#pass
+#end if
+]]>
+  </token>
+  <token name="@AF_FILE@">
+#if 'AF_file' in $section and $section.AF_file:
+  --AF-file "${section.AF_file}"
+#end if
+  </token>
+
+  <xml name="macro_estimate_AF">
+      <param name="estimate_AF" type="data" format="data" label="Estimate Af" optional="True" help="calculate AC,AN counts on the fly, using either all samples (&quot;-&quot;) or samples listed in &lt;file&gt;" />
+  </xml>
+  <token name="@ESTIMATE_AF@">
+#if 'estimate_AF' in $section and $section.estimate_AF:
+  --estimate-AF "${section.estimate_AF}"
+#end if
+  </token>
+
+  <xml name="macro_exons_file">
+    <param name="exons_file" type="data" format="tabular" label="exons file" optional="True" help="tab-delimited file with exons for indel frameshifts (chr,from,to; 1-based, inclusive, bgzip compressed)" />
+  </xml>
+  <token name="@PREPARE_EXONS_FILE@">
+<![CDATA[
+#set $exons_path = None
+#if 'exons_file' in $section and $section.exons_file:
+    #set $exons_path = 'exons_file.tab.gz'
+    bgzip -c "$section.exons_file" > $exons_path &&
+    tabix -s 1 -b 2 -e 3 $exons_path &&
+#end if
+]]>
+  </token>
+  <token name="@EXONS_FILE@">
+#if 'exons_file' in $section and $section.exons_file:
+  --exons $exons_path
+#end if
+  </token>
+
+  <xml name="macro_ploidy_file">
+    <param name="ploidy_file" type="data" format="tabular" label="Ploidy file" optional="True" help="tab-delimited list of CHROM,FROM,TO,SEX,PLOIDY" />
+  </xml>
+  <token name="@PLOIDY_FILE@">
+#if 'ploidy_file' in $section and $section.ploidy_file:
+  --ploidy "${section.ploidy_file}"
+#end if
+  </token>
+
+  <xml name="macro_collapse_opt_none">
+      <option value="none">none - require the exact same set of alleles in all files</option>
+  </xml>
+  <xml name="macro_collapse_opt_id">
+      <option value="id">id - only records with identical ID column are compatible. </option>
+  </xml>
+  <xml name="macro_collapse">
+    <param name="collapse" type="select" label="Collapse" optional="True" help="Controls how to treat records with duplicate positions and defines compatible records across multiple input files">
+      <option value="snps">snps - allow different alleles, as long as they all are SNPs</option>
+      <option value="indels">indels - allow different alleles, as long as they all are indels</option>
+      <option value="both">both - indels and snps </option>
+      <option value="some">some - at least some of the ALTs must match</option>
+      <option value="any">any - any combination of alleles</option>
+      <yield/>
+    </param>
+  </xml>
+  <token name="@COLLAPSE@">
+#if $section.collapse:
+  --collapse "${section.collapse}"
+#end if
+  </token>
+
+  <xml name="macro_apply_filters">
+    <param name="apply_filters" type="text" value="" label="Apply Filters" optional="true" 
+           help="(-f --apply-filters) Skip sites where FILTER column does not contain any of the strings listed (e.g. &quot;PASS,.&quot;)">
+      <validator type="regex" message="FILTER terms separated by commas">^([^ \t\n\r\f\v,]+(,[^ \t\n\r\f\v,]+)*)?$</validator>
+    </param>
+  </xml>
+  <token name="@APPLY_FILTERS@">
+#if $section.apply_filters:
+  --apply-filters "${section.apply_filters}"
+#end if
+  </token>
+
+  <xml name="macro_select_output_type">
+    <param name="output_type" type="select">
+      <option value="b">compressed BCF</option>
+      <!-- no galaxy datatypes for these
+      <option value="u">uncompressed BCF</option>
+      <option value="z">compressed VCF</option>
+      -->
+      <option value="v">uncompressed VCF</option>
+    </param>
+  </xml>
+  <token name="@OUTPUT_TYPE@">
+#if str($output_type) != "__none__":
+  --output-type "${output_type}"
+#end if
+  </token>
+
+  <xml name="macro_vcf_output">
+      <data name="output_file" format="vcf">
+        <change_format>
+          <when input="output_type" value="b" format="bcf" />
+          <when input="output_type" value="u" format="bcf" />
+          <when input="output_type" value="z" format="vcf_bgzip" />
+          <when input="output_type" value="v" format="vcf" />
+        </change_format>
+      </data>
+  </xml>
+
+  <xml name="macro_regions">
+    <conditional name="regions">
+        <param name="regions_src" type="select" label="Regions">
+            <option value="__none__">None</option>
+            <option value="regions">regions</option>
+            <option value="regions_file">regions-file</option>
+        </param>
+        <when value="__none__"/>
+        <when value="regions">
+            <param name="regions" type="text" value="" label="restrict to comma-separated list of regions" optional="true" 
+                   help="Each region is specifed as: chr or chr:pos or chr:from-to">
+                 <validator type="regex" message="">^(\w+(:\d+(-\d+)?)?(,\w+(:\d+(-\d+)?)?)*)?$</validator>
+            </param>
+        </when>
+        <when value="regions_file">
+            <param name="regions_file" type="data" format="vcf,bed,tabular" label="Regions File" optional="True" help="restrict to regions listed in a file" />
+        </when>
+    </conditional>
+  </xml>
+  <token name="@REGIONS@">
+#if $section.regions.regions_src == 'regions' and $section.regions.regions != '':
+  --regions "$section.regions.regions"
+#elif $section.regions.regions_src == 'regions_file' and $section.regions.regions_file:
+  --regions-file "$section.regions.regions_file"
+#end if
+  </token>
+
+  <xml name="macro_targets_file">
+            <param name="targets_file" type="data" format="tabular" label="Targets File" help="restrict to targets listed in a file" >
+              <yield/>
+            </param>
+            <param name="invert_targets_file" type="boolean" truevalue="^" falsevalue="" label="Invert Targets" help="inverts the query/filtering applied by the target file selection" />
+  </xml>
+  <token name="@PREPARE_TARGETS_FILE@">
+<![CDATA[
+#set $targets_path = None
+#if 'targets' in $section 
+  #if $section.targets.targets_src == 'targets_file':
+    #set $targets_path = 'targets_file.tab.gz'
+    bgzip -c "$section.targets.targets_file" > $targets_path &&
+    tabix -s 1 -b 2 -e 2 $targets_path &&
+  #end if
+#elif $tgts_sec.targets_file:
+  #set $targets_path = 'targets_file.tab.gz'
+  bgzip -c "$section.targets_file" > $targets_path &&
+  tabix -s 1 -b 2 -e 2 $targets_path &&
+#end if
+]]>
+  </token>
+  <token name="@TARGETS_FILE@">
+<![CDATA[
+#if $targets_path is not None:
+  --targets-file "${section.invert_targets_file}${targets_path}"
+#elif $section.targets_file:
+  --targets-file "${section.invert_targets_file}${section.targets_file}"
+#end if
+]]>
+  </token>
+
+  <xml name="macro_targets">
+    <conditional name="targets">
+        <param name="targets_src" type="select" label="Targets">
+            <option value="__none__">None</option>
+            <option value="targets">targets</option>
+            <option value="targets_file">targets-file</option>
+        </param>
+        <when value="__none__"/>
+        <when value="targets">
+            <param name="targets" type="text" value="" label="Restrict to comma-separated list of targets" optional="true" 
+                   help="Each target is specifed as: chr or chr:pos or chr:from-to">
+                 <validator type="regex" message="">^(\w+(:\d+(-\d+)?)?(,\w+(:\d+(-\d+)?)?)*)?$</validator>
+            </param>
+            <param name="invert_targets_file" type="boolean" truevalue="^" falsevalue="" label="Invert Targets" help="inverts the query/filtering applied by the targets" />
+        </when>
+        <when value="targets_file">
+            <expand macro="macro_targets_file">
+               <optional>true</optional>
+            </expand>
+        </when>
+    </conditional>
+  </xml>
+  <token name="@TARGETS@">
+<![CDATA[
+#if $targets_path:
+  --targets-file "${section.targets.invert_targets_file}${targets_path}"
+#else:
+  #if $section.targets.targets_src == 'targets' and $section.targets.targets != '':
+    --targets "${section.targets.invert_targets_file}${section.targets.targets}"
+  #elif $section.targets.targets_src == 'targets_file' and $section.targets.targets_file:
+    --targets-file "${section.targets.invert_targets_file}${section.targets.targets_file}"
+  #end if
+#end if
+]]>
+  </token>
+
+  <xml name="macro_samples">
+      <param name="samples" type="text" value="" label="Samples" optional="true" 
+             help="(-s) comma separated list of samples to annotate (or exclude with &quot;^&quot; prefix)">
+          <validator type="regex" message="">^(\w+(,\w+)*)?$</validator>
+      </param>
+      <param name="invert_samples" type="boolean" truevalue="^" falsevalue="" checked="false" label="Invert Samples" 
+             help="inverts the query/filtering applied by Samples" />
+      <param name="samples_file" type="data" format="tabular" label="Samples File" optional="True" 
+             help="(-S) file of samples to include" />
+      <param name="invert_samples_file" type="boolean" truevalue="^" falsevalue="" checked="false" label="Invert Samples File" 
+             help="inverts the query/filtering applied by Samples File" />
+  </xml>
+  <token name="@SAMPLES@">
+#set $samples_defined = False
+#if str($section.samples) != '':
+  #set $samples_defined = True
+  --samples "${section.invert_samples}${section.samples}"
+#end if
+#if $section.samples_file:
+  #set $samples_defined = True
+  --samples-file "${section.invert_samples_file}${section.samples_file}"
+#end if
+  </token>
+
+  <xml name="macro_sample">
+      <param name="sample" type="text" label="Sample" optional="True" help="apply variants of the given sample" />
+  </xml>
+  <token name="@SAMPLE@">
+#if $section.sample:
+  --sample "${section.sample}"
+#end if
+  </token>
+
+
+  <xml name="macro_include">
+    <param name="include" type="text" label="Include" optional="True" help="(-i) select sites for which the expression is true">
+        <validator type="regex" message="Single quote not allowed">^[^']*$</validator>
+        <sanitizer sanitize="False"/>
+    </param>
+  </xml>
+  <token name="@INCLUDE@">
+#if $section.include:
+  --include '${section.include}'
+#end if
+  </token>
+
+  <xml name="macro_exclude">
+    <param name="exclude" type="text" label="Exclude" optional="True" help="(-e) exclude sites for which the expression is true">
+        <validator type="regex" message="Single quote not allowed">^[^']*$</validator>
+        <sanitizer sanitize="False"/>
+    </param>
+  </xml>
+  <token name="@EXCLUDE@">
+#if $section.exclude:
+  --exclude '${section.exclude}'
+#end if
+  </token>
+
+  <xml name="macro_columns">
+    <param name="columns" type="text" value="" label="Columns" optional="true" 
+            help="list of columns in the annotation file, e.g. CHROM,POS,REF,ALT,-,INFO/TAG. See man page for details">
+        <validator type="regex" message="COLUMN names  separated by commas">^([^,]+(,[^,]+)*)?$</validator>
+    </param>
+  </xml>
+  <token name="@COLUMNS@">
+#if $section.columns != '':
+  --columns "${section.columns}"
+#end if
+  </token>
+
+  <xml name="macro_haploid2diploid">
+    <param name="haploid2diploid" type="boolean" truevalue="--haploid2diploid" falsevalue="" label="Haploid2Diploid" help="convert haploid genotypes to diploid homozygotes" />
+  </xml>
+
+  <xml name="macro_vcf_ids">
+    <param name="vcf_ids" type="boolean" truevalue="--vcf-ids" falsevalue="" label="Vcf Ids" help="output VCF IDs instead of CHROM:POS_REF_ALT" />
+  </xml>
+  <token name="@VCF_IDS@">
+${section.vcf_ids}
+  </token>
+
+  <token name="@OUTPUT_HELP@">
+      <![CDATA[
+Output Type
+-----------
+
+Output compressed BCF (b), or uncompressed VCF (v). 
+Use the BCF option when piping between bcftools subcommands to speed up
+performance by removing unecessary compression/decompression
+and VCF<->BCF conversion.
+
+This Galaxy tool recommends using the compressed BCF format
+as piping is not implemented, and uncompressed data would
+use unnecessary amounts of space.
+
+]]></token>
+  <token name="@REGIONS_HELP@">
+      <![CDATA[
+Region Selections
+-----------------
+
+Regions can be specified in a VCF,
+BED, or tab-delimited file (the default). The columns of the
+tab-delimited file are: CHROM, POS, and, optionally, POS_TO,
+where positions are 1-based and inclusive. Uncompressed
+files are stored in memory, while bgzip-compressed and
+tabix-indexed region files are streamed. Note that sequence
+names must match exactly, "chr20" is not the same as "20".
+Also note that chromosome ordering in FILE will be
+respected, the VCF will be processed in the order in which
+chromosomes first appear in FILE. However, within
+chromosomes, the VCF will always be processed in ascending
+genomic coordinate order no matter what order they appear in
+FILE. Note that overlapping regions in FILE can result in
+duplicated out of order positions in the output. This option
+requires indexed VCF/BCF files.
+
+]]></token>
+  <token name="@TARGETS_HELP@"><![CDATA[
+Targets
+-------
+
+Similar to regions, but the next position is accessed by streaming the whole
+VCF/BCF rather than using the tbi/csi index. Both regions and targets options can be
+applied simultaneously: regions uses the index to jump to a region and targets discards
+positions which are not in the targets. Unlike regions, targets can be prefixed with
+"^" to request logical complement. For example, "^X,Y,MT" indicates that
+sequences X, Y and MT should be skipped. Yet another difference between the two
+is that regions checks both start and end positions of indels, whereas targets checks
+start positions only.
+
+For the bcftools call command, with the option -C alleles, third column of the
+targets file must be comma-separated list of alleles, starting with the
+reference allele. Note that the file must be compressed and index. Such a file
+can be easily created from a VCF using::
+
+    bcftools query -f'%CHROM\t%POS\t%REF,%ALT\n' file.vcf | bgzip -c > als.tsv.gz && tabix -s1 -b2 -e2 als.tsv.gz
+      ]]>
+      <!-- TODO: galaxy-ify -->
+  </token>
+
+
+  <token name="@COLLAPSE_HELP@">
+Collapse
+--------
+
+Controls how to treat records with duplicate positions and defines compatible
+records across multiple input files. Here by "compatible" we mean records which
+should be considered as identical by the tools. For example, when performing
+line intersections, the desire may be to consider as identical all sites with
+matching positions (bcftools isec -c all), or only sites with matching variant
+type (bcftools isec -c snps  -c indels), or only sites with all alleles
+identical (bcftools isec -c none).
+
+
++------------+----------------------------------------------------------------+
+| Flag value | Result                                                         |
++============+================================================================+
+| none       | only records with identical REF and ALT alleles are compatible |
++------------+----------------------------------------------------------------+
+| some       | only records where some subset of ALT alleles match are        |
+|            | compatible                                                     |
++------------+----------------------------------------------------------------+
+| all        | all records are compatible, regardless of whether the ALT      |
+|            | alleles match or not. In the case of records with the same     |
+|            | position, only the first wil lbe considered and appear on      |
+|            | output.                                                        |
++------------+----------------------------------------------------------------+
+| snps       | any SNP records are compatible, regardless of whether the ALT  |
+|            | alleles match or not. For duplicate positions, only the first  |
+|            | SNP record will be considered and appear on output.            |
++------------+----------------------------------------------------------------+
+| indels     | all indel records are compatible, regardless of whether the    |
+|            | REF and ALT alleles match or not. For duplicate positions,     |
+|            | only the first indel record will be considered and appear on   |
+|            | output.                                                        |
++------------+----------------------------------------------------------------+
+| both       | abbreviation of "-c indels  -c snps"                           |
++------------+----------------------------------------------------------------+
+| id         | only records with identical ID column are compatible.          |
+|            | Supportedby bcftools merge only.                               |
++------------+----------------------------------------------------------------+
+
+  </token>
+
+  <token name="@EXPRESSIONS_HELP@">
+      <![CDATA[
+Expressions
+-----------
+
+Valid expressions may contain:
+
+-  numerical constants, string constants
+
+   ::
+
+      1, 1.0, 1e-4
+      "String"
+
+-  arithmetic operators
+
+   ::
+
+      +,*,-,/
+
+-  comparison operators
+
+   ::
+
+      == (same as =), >, >=, <=, <, !=
+
+-  regex operators "~" and its negation "!~"
+
+   ::
+
+      INFO/HAYSTACK ~ "needle"
+
+-  parentheses
+
+   ::
+
+      (, )
+
+-  logical operators
+
+   ::
+
+      && (same as &), ||,  |
+
+-  INFO tags, FORMAT tags, column names
+
+   ::
+
+      INFO/DP or DP
+      FORMAT/DV, FMT/DV, or DV
+      FILTER, QUAL, ID, REF, ALT[0]
+
+-  1 (or 0) to test the presence (or absence) of a flag
+
+   ::
+
+      FlagA=1 && FlagB=0
+
+-  "." to test missing values
+
+   ::
+
+      DP=".", DP!=".", ALT="."
+
+-  missing genotypes can be matched regardless of phase and ploidy (".|.", "./.", ".") using this expression
+
+   ::
+
+      GT="."
+
+-  TYPE for variant type in REF,ALT columns (indel,snp,mnp,ref,other)
+
+   ::
+
+      TYPE="indel" | TYPE="snp"
+
+-  array subscripts, "*" for any field
+
+   ::
+
+      (DP4[0]+DP4[1])/(DP4[2]+DP4[3]) > 0.3
+      DP4[*] == 0
+      CSQ[*] ~ "missense_variant.*deleterious"
+
+-  function on FORMAT tags (over samples) and INFO tags (over vector fields)
+
+   ::
+
+      MAX, MIN, AVG, SUM, STRLEN, ABS
+
+-  variables calculated on the fly if not present: number of alternate alleles; number of samples; count of alternate alleles; minor allele count (similar to AC but is always smaller than 0.5); frequency of alternate alleles (AF=AC/AN); frequency of minor alleles (MAF=MAC/AN); number of alleles in called genotypes
+
+   ::
+
+      N_ALT, N_SAMPLES, AC, MAC, AF, MAF, AN
+
+**Notes:**
+
+-  String comparisons and regular expressions are case-insensitive
+-  If the subscript "*" is used in regular expression search, the whole field
+   is treated as one string. For example, the regex ``STR[*]~"B,C"`` will be
+   true for the string vector INFO/STR=AB,CD.
+-  Variables and function names are case-insensitive, but not tag names. For
+   example, "qual" can be used instead of "QUAL", "strlen()" instead of
+   "STRLEN()" , but not "dp" instead of "DP".
+
+**Examples:**
+
+   ::
+
+      MIN(DV)>5
+      MIN(DV/DP)>0.3
+      MIN(DP)>10 & MIN(DV)>3
+      FMT/DP>10  & FMT/GQ>10 .. both conditions must be satisfied within one sample
+      FMT/DP>10 && FMT/GQ>10 .. the conditions can be satisfied in different samples
+      QUAL>10 |  FMT/GQ>10   .. selects only GQ>10 samples
+      QUAL>10 || FMT/GQ>10   .. selects all samples at QUAL>10 sites
+      TYPE="snp" && QUAL>=10 && (DP4[2]+DP4[3] > 2)
+      MIN(DP)>35 && AVG(GQ)>50
+      ID=@file       .. selects lines with ID present in the file
+      ID!=@~/file    .. skip lines with ID present in the ~/file
+      MAF[0]<0.05    .. select rare variants at 5% cutoff
+
+]]></token>
+
+
+
+
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/23andme.fa	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,14 @@
+>1
+CACGTNACGGCTGAAGTCCAAGGTAC
+CGTATCGAGTTCACAGTCGATAGCTC
+GATCGATAGCATCGCTAGCNNNACTA
+CGATCGATCGCTCTCCGTAACACTCA
+AAAACGATCGATCGACTGCTCTTTAG
+CGATGACTTTAGGGGAAAAA
+>2
+CGCTCAGCCGTACAGCCGAGCAGGAC
+ACGCTATTTTAGATCGACTGGCTNNG
+CGCTAGCTACGCTTTAGCACGAGAA
+>Y
+NNNGCATACGTGTCCATCACGATGAT
+AGCGATGATCGATC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/annotate.hdr	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,4 @@
+##INFO=<ID=T_STR,Number=1,Type=String,Description="Test String">
+##INFO=<ID=T_INT,Number=.,Type=Integer,Description="Test Integer">
+##INFO=<ID=T_FLOAT,Number=.,Type=Float,Description="Test Float">
+##INFO=<ID=INDEL,Number=0,Type=Float,Description="Test Flag">
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/annotate.tab	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,18 @@
+3	3212016	CTT	C,CT	indel_3212016	.	.	.	1
+4	3258448	TACACACAC	T	indel_3258448	.	.	.	1
+4	4000000	T	C	id1	.	.	.	1
+4	4000001	T	C,A	id2	.	.	.	1
+2	3199812	G	GTT,GT	indel_3199812	.	.	.	1
+1	3000150	C	CT	indel_3000150	.	.	.	1
+1	3000150	C	T	snp_3000150	999	1,2	1e-10,2e-10	.
+1	3000151	C	T	snp_3000151	999	1	2e-10	.
+1	3062915	G	T,C	snp_3062915	999	1	2e-10	.
+1	3062915	GTTT	G	indel_3062915	.	.	.	1
+1	3106154	A	C	snp_3106154	999	1	2e-10	.
+1	3106154	C	CT	indel_3106154	.	.	.	1
+1	3106154	CAAA	C	indel_3106154	.	.	.	1
+1	3157410	GA	G	indel_3157410	.	.	.	1
+1	3162006	GAA	G	indel_3162006	.	.	.	1
+1	3177144	G	.	ref_3177144	999	1	2e-10	.
+1	3177144	G	T	snp_3177144	999	1	2e-10	0
+1	3184885	TAAAA	TA,T	indel_3184885	.	.	.	1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/annotate.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,39 @@
+##fileformat=VCFv4.1
+##INFO=<ID=TEST,Number=1,Type=Integer,Description="Testing Tag">
+##FORMAT=<ID=TT,Number=A,Type=Integer,Description="Testing Tag, with commas and \"escapes\" and escaped escapes combined with \\\"quotes\\\\\"">
+##INFO=<ID=DP4,Number=4,Type=Integer,Description="# high-quality ref-forward bases, ref-reverse, alt-forward and alt-reverse bases">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood">
+##FILTER=<ID=q10,Description="Quality below 10">
+##FILTER=<ID=test,Description="Testing filter">
+##contig=<ID=1,assembly=b37,length=249250621>
+##contig=<ID=2,assembly=b37,length=249250621>
+##contig=<ID=3,assembly=b37,length=198022430>
+##contig=<ID=4,assembly=b37,length=191154276>
+##test=<ID=4,IE=5>
+##reference=file:///lustre/scratch105/projects/g1k/ref/main_project/human_g1k_v37.fasta
+##readme=AAAAAA
+##readme=BBBBBB
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+##INFO=<ID=INDEL,Number=0,Type=Flag,Description="Indicates that the variant is an INDEL.">
+##INFO=<ID=STR,Number=1,Type=String,Description="Test string type">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
+1	3000150	.	C	T	59.2	PASS	AN=4;AC=2	GT:GQ	0/1:245	0/1:245
+1	3000151	.	C	T	59.2	PASS	AN=4;AC=2	GT:DP:GQ	0/1:32:245	0/1:32:245
+1	3062915	id3D	GTTT	G	12.9	q10	DP4=1,2,3,4;AN=4;AC=2;INDEL;STR=test	GT:GQ:DP:GL	0/1:409:35:-20,-5,-20	0/1:409:35:-20,-5,-20
+1	3062915	idSNP	G	T,C	12.6	test	TEST=5;DP4=1,2,3,4;AN=3;AC=1,1	GT:TT:GQ:DP:GL	0/1:0,1:409:35:-20,-5,-20,-20,-5,-20	2:0,1:409:35:-20,-5,-20
+1	3106154	.	CAAA	C	342	PASS	AN=4;AC=2	GT:GQ:DP	0/1:245:32	0/1:245:32
+1	3106154	.	C	CT	59.2	PASS	AN=4;AC=2	GT:GQ:DP	0/1:245:32	0/1:245:32
+1	3157410	.	GA	G	90.6	q10	AN=4;AC=4	GT:GQ:DP	1/1:21:21	1/1:21:21
+1	3162006	.	GAA	G	60.2	PASS	AN=4;AC=2	GT:GQ:DP	0/1:212:22	0/1:212:22
+1	3177144	.	G	T	45	PASS	AN=4;AC=2	GT:GQ:DP	0/0:150:30	1/1:150:30
+1	3177144	.	G	.	45	PASS	AN=4;AC=0	GT:GQ:DP	0/0:150:30	0/0:150:30
+1	3184885	.	TAAAA	TA,T	61.5	PASS	AN=4;AC=2,2	GT:GQ:DP	1/2:12:10	1/2:12:10
+2	3199812	.	G	GTT,GT	82.7	PASS	AN=4;AC=2,2	GT:GQ:DP	1/2:322:26	1/2:322:26
+3	3212016	.	CTT	C,CT	79	PASS	AN=4;AC=2,2	GT:GQ:DP	1/2:91:26	1/2:91:26
+4	3258448	.	TACACACAC	T	59.9	PASS	AN=4;AC=2	GT:GQ:DP	0/1:325:31	0/1:325:31
+4	4000000	.	T	A,C	59.9	PASS	AN=4;AC=2	GT:GQ:DP	0/1:325:31	0/1:325:31
+4	4000001	.	T	A	59.9	PASS	AN=4;AC=2	GT:GQ:DP	0/1:325:31	0/1:325:31
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/annotate2.tab	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,2 @@
+2	3000000	3199812	region_3000000_3199812
+1	3000150	3106154	region_3000150_3106154
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/annotate2.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,17 @@
+##fileformat=VCFv4.1
+##contig=<ID=1,assembly=b37,length=249250621>
+##reference=file:///lustre/scratch105/projects/g1k/ref/main_project/human_g1k_v37.fasta
+##INFO=<ID=FLAG,Number=0,Type=Flag,Description="Test type">
+##INFO=<ID=IINT,Number=1,Type=Integer,Description="Test type">
+##INFO=<ID=IFLT,Number=1,Type=Float,Description="Test type">
+##INFO=<ID=ISTR,Number=1,Type=String,Description="Test type">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=FINT,Number=1,Type=Integer,Description="Test type">
+##FORMAT=<ID=FFLT,Number=1,Type=Float,Description="Test type">
+##FORMAT=<ID=FSTR,Number=1,Type=String,Description="Test type">
+##FILTER=<ID=q11,Description="Quality below 10">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B	C
+1	3000001	xx	C	T	11	PASS	FLAG;IINT=11;IFLT=1.1;ISTR=xxx	GT:FINT:FFLT:FSTR	0/0:11:1.1:xxx	0/0:11:1.1:x	0/0:11:1.1:x
+1	3000002	.	C	T	.	.	.	GT	.	.	.
+1	3000003	xx	C	T	11	q11	FLAG;IINT=.;IFLT=.;ISTR=.	GT:FINT:FFLT:FSTR	0/0:.:.:.	0/0:.:.:.	0/0:.:.:.
+1	3000004	xx	C	T	11	q11	FLAG;IINT=11;IFLT=1.1;ISTR=xxx	GT:FINT:FFLT:FSTR	0/0:11:1.1:x	0/0:11:1.1:xxx	0/0:11:1.1:xxx
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/annotate3.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,21 @@
+##fileformat=VCFv4.1
+##FILTER=<ID=PASS,Description="All filters passed">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=PL,Number=G,Type=Integer,Description="Genotype LK">
+##FORMAT=<ID=X,Number=1,Type=Integer,Description="rmme">
+##FORMAT=<ID=Y,Number=1,Type=Integer,Description="rmme">
+##FORMAT=<ID=AA,Number=1,Type=Integer,Description="rmme">
+##INFO=<ID=AA,Number=1,Type=Integer,Description="rmme">
+##INFO=<ID=BB,Number=1,Type=Integer,Description="rmme">
+##INFO=<ID=X,Number=1,Type=Integer,Description="rmme">
+##INFO=<ID=Y,Number=1,Type=Integer,Description="rmme">
+##FILTER=<ID=fltA,Description="rmme">
+##FILTER=<ID=fltB,Description="rmme">
+##FILTER=<ID=fltX,Description="rmme">
+##FILTER=<ID=fltY,Description="rmme">
+##contig=<ID=1,assembly=b37,length=249250621>
+##reference=file:///lustre/scratch105/projects/g1k/ref/main_project/human_g1k_v37.fasta
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
+1	3000000	id	C	.	20	.	AA=1;BB=2;X=3;Y=4	GT:X:PL:Y:AA	0/1:1:2:3:1	0/1:1:2:3:1
+1	3000001	id	C	.	20	PASS	AA=1;BB=2;X=3;Y=4	GT:X:PL:Y:AA	0/1:1:2:3:1	0/1:1:2:3:1
+1	3000002	id	C	.	20	fltY;fltA;fltB;fltX	BB=2;X=3;Y=4;AA=1	GT:Y:X:PL:AA	0/1:3:1:2:1	0/1:3:1:2:1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/annotate4.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,13 @@
+##fileformat=VCFv4.2
+##INFO=<ID=FR,Number=R,Type=Float,Description="test">
+##INFO=<ID=FA,Number=A,Type=Float,Description="test">
+##INFO=<ID=IA,Number=A,Type=Integer,Description="test">
+##INFO=<ID=IR,Number=R,Type=Integer,Description="test">
+##INFO=<ID=SA,Number=A,Type=String,Description="test">
+##INFO=<ID=SR,Number=R,Type=String,Description="test">
+##contig=<ID=1,assembly=b37,length=249250621>
+##reference=file:///lustre/scratch105/projects/g1k/ref/main_project/human_g1k_v37.fasta
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO
+1	1	.	C	T	.	.	.
+1	2	.	C	T,G	.	.	FA=.,9.9;FR=.,9.9,.;IA=.,99;IR=.,99,.;SA=.,99;SR=.,99,.
+1	3	.	C	A,T	.	.	.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/annots.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,37 @@
+##fileformat=VCFv4.1
+##INFO=<ID=TEST,Number=1,Type=Integer,Description="Testing Tag">
+##FORMAT=<ID=TT,Number=A,Type=Integer,Description="Testing Tag, with commas and \"escapes\" and escaped escapes combined with \\\"quotes\\\\\"">
+##INFO=<ID=DP4,Number=4,Type=Integer,Description="# high-quality ref-forward bases, ref-reverse, alt-forward and alt-reverse bases">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood">
+##FILTER=<ID=q10,Description="Quality below 10">
+##FILTER=<ID=test,Description="Testing filter">
+##contig=<ID=1,assembly=b37,length=249250621>
+##contig=<ID=2,assembly=b37,length=249250621>
+##contig=<ID=3,assembly=b37,length=198022430>
+##contig=<ID=4,assembly=b37,length=191154276>
+##test=<ID=4,IE=5>
+##reference=file:///lustre/scratch105/projects/g1k/ref/main_project/human_g1k_v37.fasta
+##readme=AAAAAA
+##readme=BBBBBB
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+##INFO=<ID=INDEL,Number=0,Type=Flag,Description="Indicates that the variant is an INDEL.">
+##INFO=<ID=STR,Number=1,Type=String,Description="Test string type">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
+1	3000150	id1	C	T	99	PASS	STR=id1;AN=4;AC=0	GT:GQ	0|0:999	0|0:999
+1	3000151	id2	C	T	99	PASS	STR=id2;AN=4;AC=0	GT:DP:GQ	0|0:99:999	0|0:99:999
+1	3062915	idIndel	GTTT	G	99	PASS	DP4=1,2,3,4;AN=4;AC=0;INDEL;STR=testIndel	GT:GQ:DP:GL	0|0:999:99:-99,-9,-99	0|0:999:99:-99,-9,-99
+1	3062915	idSNP	G	T,C	99	PASS	STR=testSNP;TEST=5;DP4=1,2,3,4;AN=3;AC=0,0	GT:TT:GQ:DP:GL	0|0:9,9:999:99:-99,-9,-99,-99,-9,-99	0:9,9:999:99:-99,-9,-99
+1	3106154	id4	CAAA	C	99	PASS	STR=id4;AN=4;AC=0	GT:GQ:DP	0|0:999:99	0|0:999:99
+1	3106154	id5	C	CT	99	PASS	STR=id5;AN=4;AC=0	GT:GQ:DP	0|0:999:99	0|0:999:99
+1	3157410	id6	GA	GC,G	99	PASS	STR=id6;AN=4;AC=0	GT:GQ:DP	0|0:99:99	0|0:99:99
+1	3162006	id7	GAA	GG	99	PASS	STR=id7;AN=4;AC=0	GT:GQ:DP	0|0:999:99	0|0:999:99
+1	3177144	id8	G	T	99	PASS	STR=id8;AN=4;AC=0	GT:GQ:DP	0|0:999:99	0|0:999:99
+1	3177144	id9	G	.	99	PASS	STR=id9;AN=4;AC=0	GT:GQ:DP	0|0:999:99	0|0:999:99
+1	3184885	id10	TAAAA	TA,T	99	PASS	STR=id10;AN=4;AC=0,0	GT:GQ:DP	0|0:99:99	0|0:99:99
+2	3199812	id11	G	GTT,GT	99	PASS	STR=id11;AN=4;AC=0,0	GT:GQ:DP	0|0:999:99	0|0:999:99
+3	3212016	id12	CTT	C,CT	99	PASS	STR=id12;AN=4;AC=0,0	GT:GQ:DP	0|0:99:99	0|0:99:99
+4	3258448	id13	TACACACAC	T	99	PASS	STR=id13;AN=4;AC=0	GT:GQ:DP	0|0:999:99	0|0:999:99
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/annots2.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,17 @@
+##fileformat=VCFv4.1
+##FILTER=<ID=q99,Description="Quality below 10">
+##contig=<ID=1,assembly=b37,length=249250621>
+##reference=file:///lustre/scratch105/projects/g1k/ref/main_project/human_g1k_v37.fasta
+##INFO=<ID=FLAG,Number=0,Type=Flag,Description="Test type">
+##INFO=<ID=IINT,Number=.,Type=Integer,Description="Test type">
+##INFO=<ID=IFLT,Number=.,Type=Float,Description="Test type">
+##INFO=<ID=ISTR,Number=.,Type=String,Description="Test type">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=FINT,Number=.,Type=Integer,Description="Test type">
+##FORMAT=<ID=FFLT,Number=.,Type=Float,Description="Test type">
+##FORMAT=<ID=FSTR,Number=.,Type=String,Description="Test type">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	B	A
+1	3000001	.	C	T	.	.	.	GT	.	.
+1	3000002	id	C	T	99	q99	FLAG;IINT=88,99;IFLT=8.8,9.9;ISTR=888,999	GT:FINT:FFLT:FSTR	1|1:88,99:8.8,9.9:888,999	0|1:77:7.7:77
+1	3000003	id	C	T	99	q99	FLAG;IINT=88,99;IFLT=8.8,9.9;ISTR=888,999	GT:FINT:FFLT:FSTR	1|1:88,99:8.8,9.9:888,999	0|1:77:7.7:77
+1	3000004	id	C	T	99	q99	FLAG;IINT=88,99;IFLT=8.8,9.9;ISTR=888,999	GT:FINT:FFLT:FSTR	1|1:88,99:8.8,9.9:888,999	0|1:77:7.7:77
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/annots4.tab	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,3 @@
+1	1	C	A,T,G	0,1.1,0	1.1,0,2.2,0	0,1,0	1,0,2,0	X,11,XXX	1,XX,222,XXX
+1	2	C	T,G	1.1,2.2	1.1,2.2,3.3	1,2	1,2,3	11,2	111,22,3
+1	3	C	T	1.1	1.1,2.2	1	1,2	11	11,2
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/annots4.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,13 @@
+##fileformat=VCFv4.2
+##INFO=<ID=FA,Number=A,Type=Float,Description="test">
+##INFO=<ID=FR,Number=R,Type=Float,Description="test">
+##INFO=<ID=IA,Number=A,Type=Integer,Description="test">
+##INFO=<ID=IR,Number=R,Type=Integer,Description="test">
+##INFO=<ID=SA,Number=A,Type=String,Description="test">
+##INFO=<ID=SR,Number=R,Type=String,Description="test">
+##contig=<ID=1,assembly=b37,length=249250621>
+##reference=file:///lustre/scratch105/projects/g1k/ref/main_project/human_g1k_v37.fasta
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO
+1	1	.	C	A,T,G	.	.	FA=0,1.1,0;FR=1.1,0,2.2,0;IA=0,1,0;IR=1,0,2,0;SA=X,11,XXX;SR=1,XX,222,XXX
+1	2	.	C	T,G	.	.	FA=1.1,2.2;FR=1.1,2.2,3.3;IA=1,2;IR=1,2,3;SA=11,2;SR=111,22,3
+1	3	.	C	T	.	.	FA=1.1;FR=1.1,2.2;IA=1;IR=1,2;SA=11;SR=11,2
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/check.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,38 @@
+##fileformat=VCFv4.1
+##INFO=<ID=TEST,Number=1,Type=Integer,Description="Testing Tag">
+##FORMAT=<ID=TT,Number=A,Type=Integer,Description="Testing Tag, with commas and \"escapes\" and escaped escapes combined with \\\"quotes\\\\\"">
+##INFO=<ID=DP,Number=1,Type=Integer,Description="read depth">
+##INFO=<ID=DP4,Number=4,Type=Integer,Description="# high-quality ref-forward bases, ref-reverse, alt-forward and alt-reverse bases">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood">
+##FILTER=<ID=q10,Description="Quality below 10">
+##FILTER=<ID=test,Description="Testing filter">
+##contig=<ID=1,assembly=b37,length=249250621>
+##contig=<ID=3,assembly=b37,length=198022430>
+##contig=<ID=4,assembly=b37,length=191154276>
+##reference=file:///lustre/scratch105/projects/g1k/ref/main_project/human_g1k_v37.fasta
+##readme=AAAAAA
+##readme=BBBBBB
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
+1	3062915	id3D	GTTT	G	12.9	q10	DP4=1,2,3,4;AN=4;AC=2	GT:GQ:DP:GL	0/1:409:35:-20,-5,-20	0/1:409:35:-20,-5,-20
+1	3062915	idSNP	G	T,C	12.6	test	TEST=5;DP4=1,2,3,4;AN=4;AC=1,1	GT:TT:GQ:DP:GL	0/1:0,1:409:35:-20,-5,-20,-20,-5,-20	0/2:0,1:409:35:-20,-5,-20,-20,-5,-20
+1	3106154	.	CAAA	C	342	PASS	AN=4;AC=2	GT:GQ:DP	0/1:245:32	0/1:245:32
+1	3106154	.	G	A	59.2	PASS	AN=4;AC=1	GT:GQ:DP	0/1:245:32	0/0:245:32
+1	3157410	.	G	A	90.6	q10	AN=4;AC=4	GT:GQ:DP	1/1:21:21	1/1:21:21
+1	3162006	.	G	A	60.2	PASS	AN=4;AC=3	GT:GQ:DP	1/1:212:22	0/1:212:22
+1	3177144	.	GT	G	45	PASS	AN=4;AC=2	GT:GQ:DP	0/1:150:30	0/1:150:30
+1	3184885	.	TAAAA	TA,T	61.5	PASS	AN=4;AC=2,2	GT:GQ:DP	1/2:12:10	1/2:12:10
+2	3199812	.	G	GTT,GT	82.7	PASS	AN=4;AC=2,2	GT:GQ:DP	1/2:322:26	1/2:322:26
+3	3212016	.	CTT	C,CT	79	PASS	AN=4;AC=2,2	GT:GQ:DP	1/2:91:26	1/2:91:26
+4	3258448	.	TACACACAC	T	59.9	PASS	DP=62;AN=4;AC=2	GT:GQ:DP	0/1:325:31	0/1:325:31
+4	3258449	.	GCAAA	GA,G	59.9	PASS	DP=62;AN=4;AC=2	GT:GQ:DP	0/1:325:31	0/1:325:31
+4	3258450	.	AAAAGAAAAAG	A,AAAAAAG	59.9	PASS	DP=60;AN=4;AC=2	GT:GQ:DP	0/1:325:31	0/1:325:31
+4	3258451	.	AAA	AGT	59.9	PASS	AN=4;AC=2	GT:GQ:DP	0/1:325:31	0/1:325:31
+4	3258452	.	AAA	AGA	59.9	PASS	AN=4;AC=2	GT:GQ:DP	0/1:325:31	0/1:325:31
+4	3258453	.	AACA	AGA	59.9	PASS	AN=4;AC=2	GT:GQ:DP	0/1:325:31	0/1:325:31
+4	3258453	.	ACA	AAGA	59.9	PASS	AN=4;AC=2	GT:GQ:DP	0/1:325:31	0/1:325:31
+4	3258454	.	AACA	AACA	59.9	PASS	AN=4;AC=2	GT:GQ:DP	0/1:325:31	0/1:325:31
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/concat.1.a.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,32 @@
+##fileformat=VCFv4.0
+##FILTER=<ID=Fail,Description="Test">
+##FILTER=<ID=q10,Description="Quality below 10">
+##INFO=<ID=XX,Number=1,Type=Integer,Description="Test">
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##contig=<ID=2,length=62435964>
+##contig=<ID=1,length=62435964>
+##samtoolsVersion=0.2.0-rc10+htslib-0.2.0-rc10
+##samtoolsCommand=samtools mpileup -t INFO/DPR -C50 -pm3 -F0.2 -d10000 -ug -r 1:1-1000000 -b mpileup.2014-07-03//lists/chr1-pooled.list -f human_g1k_v37.fasta
+##ALT=<ID=X,Description="Represents allele(s) other than observed.">
+##bcftools_callVersion=0.2.0-rc10-2-gcd94fde+htslib-0.2.0-rc10
+##bcftools_callCommand=call -vm -f GQ -S mpileup.2014-07-03//pooled/1/1:1-1000000.samples -
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A
+1	100	.	GTTT	G	1806	q10	XX=11;DP=35	GT:GQ:DP	0/1:409:35
+1	110	.	C	T,G	1792	Fail	DP=32	GT:GQ:DP	0/1:245:32
+1	110	.	CAAA	C	1792	Fail	DP=32	GT:GQ:DP	0/1:245:32
+1	120	.	GA	G	628	q10	DP=21	GT:GQ:DP	1/1:21:21
+1	130	.	G	T	1016	Fail	DP=22	GT:GQ:DP	0/1:212:22
+1	130	.	GAA	GG	1016	Fail	DP=22	GT:GQ:DP	0/1:212:22
+1	140	.	GT	G	727	PASS	DP=30	GT:GQ:DP	0/1:150:30
+1	150	.	TAAAA	TA,T	246	Fail	DP=10	GT:GQ:DP	1/2:12:10
+1	160	.	TAAAA	TA,T	246	Fail	DP=10	GT:GQ:DP	1/2:12:10
+2	100	.	GTTT	G	1806	q10	DP=35	GT:GQ:DP	0/1:409:35
+2	110	.	CAAA	C	1792	PASS	DP=32	GT:GQ:DP	0/1:245:32
+2	120	.	GA	G	628	q10	DP=21	GT:GQ:DP	1/1:21:21
+2	130	.	GAA	G	1016	PASS	DP=22	GT:GQ:DP	0/1:212:22
+2	140	.	GT	G	727	PASS	DP=30	GT:GQ:DP	0/1:150:30
+2	150	.	TAAAA	TA,T	246	PASS	DP=10	GT:GQ:DP	1/2:12:10
+2	160	.	TAAAA	TA,TC,T	246	PASS	DP=10	GT:GQ:DP	0/2:12:10
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/concat.1.b.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,19 @@
+##fileformat=VCFv4.0
+##samtoolsVersion=0.2.0-rc10+htslib-0.2.0-rc10
+##samtoolsCommand=samtools mpileup -t INFO/DPR -C50 -pm3 -F0.2 -d10000 -ug -r 1:1-1000000 -b mpileup.2014-07-03//lists/chr1-pooled.list -f human_g1k_v37.fasta
+##ALT=<ID=X,Description="Represents allele(s) other than observed.">
+##bcftools_callVersion=0.2.0-rc10-2-gcd94fde+htslib-0.2.0-rc10
+##bcftools_callCommand=call -vm -f GQ -S mpileup.2014-07-03//pooled/1/1:1-1000000.samples -
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FILTER=<ID=q10,Description="Quality below 10">
+##contig=<ID=3,length=62435964>
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A
+3	142	.	GTTT	G	1806	q10	DP=35	GT:GQ:DP	0/1:409:35
+3	152	.	CAAA	C	1792	PASS	DP=32	GT:GQ:DP	0/1:245:32
+3	162	.	GA	G	628	q10	DP=21	GT:GQ:DP	1/1:21:21
+3	172	.	GAA	G	1016	PASS	DP=22	GT:GQ:DP	0/1:212:22
+3	182	.	GT	G	727	PASS	DP=30	GT:GQ:DP	0/1:150:30
+3	192	.	TAAAA	TA,T	246	PASS	DP=10	GT:GQ:DP	1/2:12:10
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/concat.2.a.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,15 @@
+##fileformat=VCFv4.0
+##INFO=<ID=XX,Number=1,Type=Integer,Description="Test">
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FILTER=<ID=Fail,Description="Fail">
+##contig=<ID=1,length=62435964>
+##contig=<ID=2,length=62435964>
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A
+2	140	.	A	G	727	PASS	DP=30	GT:GQ:DP	0/1:150:30
+2	160	.	TAAAA	TA,TC,T	246	PASS	DP=10	GT:GQ:DP	0/2:12:10
+1	110	.	C	T,G	1792	Fail	XX=11;DP=32	GT:GQ:DP	0/1:245:32
+1	130	.	GAA	GG	1016	PASS	DP=22	GT:GQ:DP	0/1:212:22
+1	130	.	G	T	1016	PASS	DP=22	GT:GQ:DP	0/1:212:22
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/concat.2.b.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,24 @@
+##fileformat=VCFv4.0
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FILTER=<ID=q10,Description="Quality below 10">
+##contig=<ID=1,length=62435964>
+##contig=<ID=2,length=62435964>
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A
+1	100	.	GTTT	G	1806	q10	DP=35	GT:GQ:DP	0/1:409:35
+1	110	.	CAAA	C	1792	PASS	DP=32	GT:GQ:DP	0/1:245:32
+1	120	.	GA	G	628	q10	DP=21	GT:GQ:DP	1/1:21:21
+1	130	.	G	T	1016	PASS	DP=22	GT:GQ:DP	0/1:212:22
+1	130	.	GAA	GG	1016	PASS	DP=22	GT:GQ:DP	0/1:212:22
+1	140	.	GT	G	727	PASS	DP=30	GT:GQ:DP	0/1:150:30
+1	150	.	TAAAA	TA,T	246	PASS	DP=10	GT:GQ:DP	1/2:12:10
+1	160	.	TAAAA	TA,T	246	PASS	DP=10	GT:GQ:DP	1/2:12:10
+2	100	.	GTTT	G	1806	q10	DP=35	GT:GQ:DP	0/1:409:35
+2	110	.	CAAA	C	1792	PASS	DP=32	GT:GQ:DP	0/1:245:32
+2	120	.	GA	G	628	q10	DP=21	GT:GQ:DP	1/1:21:21
+2	130	.	GAA	G	1016	PASS	DP=22	GT:GQ:DP	0/1:212:22
+2	140	.	GT	G	727	PASS	DP=30	GT:GQ:DP	0/1:150:30
+2	150	.	TAAAA	TA,T	246	PASS	DP=10	GT:GQ:DP	1/2:12:10
+2	160	.	TAAAA	TA,TC,T	246	PASS	DP=10	GT:GQ:DP	0/2:12:10
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/concat.3.0.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,8 @@
+##fileformat=VCFv4.0
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FILTER=<ID=q10,Description="Quality below 10">
+##contig=<ID=2,length=62435964>
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/concat.3.a.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,27 @@
+##fileformat=VCFv4.0
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FILTER=<ID=q10,Description="Quality below 10">
+##contig=<ID=9,length=62435964>
+##contig=<ID=1,length=62435964>
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
+9	202	.	GTTT	G	1806	q10	DP=35	GT:GQ:DP	0|1:409:35	0|1
+9	212	.	C	T,G	1792	PASS	DP=32	GT:GQ:DP	0|1:245:32	0|1
+9	212	.	CAAA	C	1792	PASS	DP=32	GT:GQ:DP	0|1:245:32	0|1
+9	222	.	GA	G	628	q10	DP=21	GT:GQ:DP	0|1:21:21	0|1
+9	232	.	G	T	1016	PASS	DP=22	GT:GQ:DP	0|1:212:22	0|1
+9	232	.	GAA	GG	1016	PASS	DP=22	GT:GQ:DP	0|1:212:22	0|1
+9	242	.	GT	G	727	PASS	DP=30	GT:GQ:DP	0|1:150:30	0|1
+9	252	.	TAAAA	TA,T	246	PASS	DP=10	GT:GQ:DP	0|1:12:10	0|1
+9	262	.	TAAAA	TA,T	246	PASS	DP=10	GT:GQ:DP	0|1:12:10	0|1
+1	100	.	GTTT	G	1806	q10	DP=35	GT:GQ:DP	0|1:409:35	0|1
+1	110	.	C	T,G	1792	PASS	DP=32	GT:GQ:DP	0|1:245:32	0|1
+1	110	.	CAAA	C	1792	PASS	DP=32	GT:GQ:DP	0|1:245:32	0|1
+1	120	.	GA	G	628	q10	DP=21	GT:GQ:DP	0|1:21:21	0|1
+1	130	.	G	T	1016	PASS	DP=22	GT:GQ:DP	0|1:212:22	0|1
+1	130	.	GAA	GG	1016	PASS	DP=22	GT:GQ:DP	0|1:212:22	0|1
+1	140	.	GT	G	727	PASS	DP=30	GT:GQ:DP	0|1:150:30	0|1
+1	150	.	TAAAA	TA,T	246	PASS	DP=10	GT:GQ:DP	0|1:12:10	0|1
+1	160	.	TAAAA	TA,T	246	PASS	DP=10	GT:GQ:DP	0|1:12:10	0|1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/concat.3.b.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,223 @@
+##fileformat=VCFv4.0
+##INFO=<ID=T1,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T2,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T3,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T4,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T5,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T6,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T7,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T8,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T9,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T10,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T11,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T12,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T13,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T14,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T15,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T16,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T17,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T18,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T19,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T20,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T21,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T22,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T23,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T24,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T25,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T26,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T27,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T28,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T29,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T30,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T31,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T32,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T33,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T34,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T35,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T36,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T37,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T38,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T39,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T40,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T41,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T42,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T43,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T44,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T45,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T46,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T47,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T48,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T49,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T50,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T51,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T52,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T53,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T54,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T55,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T56,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T57,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T58,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T59,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T60,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T61,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T62,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T63,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T64,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T65,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T66,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T67,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T68,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T69,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T70,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T71,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T72,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T73,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T74,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T75,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T76,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T77,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T78,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T79,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T80,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T81,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T82,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T83,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T84,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T85,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T86,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T87,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T88,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T89,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T90,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T91,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T92,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T93,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T94,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T95,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T96,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T97,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T98,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T99,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T100,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T101,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T102,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T103,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T104,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T105,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T106,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T107,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T108,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T109,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T110,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T111,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T112,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T113,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T114,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T115,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T116,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T117,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T118,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T119,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T120,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T121,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T122,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T123,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T124,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T125,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T126,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T127,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T128,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T129,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T130,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T131,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T132,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T133,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T134,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T135,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T136,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T137,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T138,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T139,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T140,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T141,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T142,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T143,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T144,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T145,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T146,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T147,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T148,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T149,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T150,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T151,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T152,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T153,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T154,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T155,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T156,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T157,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T158,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T159,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T160,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T161,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T162,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T163,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T164,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T165,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T166,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T167,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T168,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T169,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T170,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T171,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T172,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T173,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T174,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T175,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T176,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T177,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T178,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T179,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T180,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T181,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T182,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T183,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T184,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T185,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T186,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T187,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T188,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T189,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T190,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T191,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T192,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T193,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T194,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T195,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T196,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T197,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T198,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=T199,Number=1,Type=Integer,Description="Test Tag: Big header">
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FILTER=<ID=q10,Description="Quality below 10">
+##contig=<ID=2,length=62435964>
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
+2	170	.	T	A	246	PASS	DP=10	GT	1|0	0|1
+2	180	.	T	A	246	PASS	DP=10	GT	1|0	0|1
+2	190	.	T	A	246	PASS	DP=10	GT	1|0	0|1
+2	200	.	T	A	246	PASS	DP=10	GT	1|0	0|1
+2	210	.	T	A	246	PASS	DP=10	GT	1|0	0|1
+2	220	.	T	A	246	PASS	DP=10	GT	1|0	0|1
+2	230	.	T	A	246	PASS	DP=10	GT	1|0	0|1
+2	240	.	T	A	246	PASS	DP=10	GT	1|0	0|1
+2	250	.	T	A	246	PASS	DP=10	GT	1|0	0|1
+2	260	.	T	A	246	PASS	DP=10	GT	1|0	0|1
+2	270	.	T	A	246	PASS	DP=10	GT	1|0	0|1
+2	280	.	T	A	246	PASS	DP=10	GT	1|0	0|1
+2	290	.	T	A	246	PASS	DP=10	GT	1|0	0|1
+2	300	.	T	A	246	PASS	DP=10	GT	1|0	0|1
+2	310	.	T	A	246	PASS	DP=10	GT	1|0	0|1
+2	320	.	T	A	246	PASS	DP=10	GT	1|0	0|1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/concat.3.c.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,22 @@
+##fileformat=VCFv4.0
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FILTER=<ID=q10,Description="Quality below 10">
+##contig=<ID=2,length=62435964>
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
+2	280	.	T	A	246	PASS	DP=10	GT	1|0	0|1
+2	290	.	T	A	246	PASS	DP=10	GT	1|0	1|0
+2	300	.	T	A	246	PASS	DP=10	GT	0|1	1|0
+2	310	.	T	A	246	PASS	DP=10	GT	0|1	1|0
+2	320	.	T	A	246	PASS	DP=10	GT	0|1	1|0
+2	330	.	T	A	246	PASS	DP=10	GT	0|1	1|0
+2	340	.	T	A	246	PASS	DP=10	GT	0|1	1|0
+2	350	.	T	A	246	PASS	DP=10	GT	0|1	1|0
+2	360	.	T	A	246	PASS	DP=10	GT	0|1	1|0
+2	370	.	T	A	246	PASS	DP=10	GT	0|1	1|0
+2	380	.	T	A	246	PASS	DP=10	GT	0|1	1|0
+2	390	.	T	A	246	PASS	DP=10	GT	0|1	1|0
+2	400	.	T	A	246	PASS	DP=10	GT	0|1	1|0
+2	410	.	T	A	246	PASS	DP=10	GT	0|1	1|0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/concat.3.d.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,20 @@
+##fileformat=VCFv4.0
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FILTER=<ID=q10,Description="Quality below 10">
+##contig=<ID=2,length=62435964>
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
+2	300	.	T	A	246	PASS	DP=10	GT	1|0	1|0
+2	320	.	T	A	246	PASS	DP=10	GT	1|0	1|0
+2	330	.	T	A	246	PASS	DP=10	GT	1|0	1|0
+2	340	.	T	A	246	PASS	DP=10	GT	1|0	1|0
+2	350	.	T	A	246	PASS	DP=10	GT	1|0	1|0
+2	360	.	T	A	246	PASS	DP=10	GT	1|0	1|0
+2	370	.	T	A	246	PASS	DP=10	GT	1|0	1|0
+2	380	.	T	A	246	PASS	DP=10	GT	1|0	1|0
+2	390	.	T	A	246	PASS	DP=10	GT	1|0	1|0
+2	490	.	T	A	246	PASS	DP=10	GT	1|0	1|0
+2	500	.	T	A	246	PASS	DP=10	GT	1|0	1|0
+2	510	.	T	A	246	PASS	DP=10	GT	1|0	1|0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/concat.3.e.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,20 @@
+##fileformat=VCFv4.0
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FILTER=<ID=q10,Description="Quality below 10">
+##contig=<ID=2,length=62435964>
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
+2	310	.	T	A	246	PASS	DP=10	GT	0|1	0|1
+2	320	.	T	A	246	PASS	DP=10	GT	0|1	0|1
+2	330	.	T	A	246	PASS	DP=10	GT	0|1	0|1
+2	340	.	T	A	246	PASS	DP=10	GT	0|1	0|1
+2	350	.	T	A	246	PASS	DP=10	GT	0|1	0|1
+2	360	.	T	A	246	PASS	DP=10	GT	0|1	0|1
+2	370	.	T	A	246	PASS	DP=10	GT	0|1	0|1
+2	380	.	T	A	246	PASS	DP=10	GT	0|1	0|1
+2	390	.	T	A	246	PASS	DP=10	GT	0|1	0|1
+2	490	.	T	A	246	PASS	DP=10	GT	0|1	0|1
+2	500	.	T	A	246	PASS	DP=10	GT	0|1	0|1
+2	510	.	T	A	246	PASS	DP=10	GT	0|1	0|1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/concat.3.f.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,20 @@
+##fileformat=VCFv4.0
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FILTER=<ID=q10,Description="Quality below 10">
+##contig=<ID=3,length=62435964>
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
+3	380	.	T	A	246	PASS	DP=10	GT	1|0	1|0
+3	390	.	T	A	246	PASS	DP=10	GT	1|0	1|0
+3	400	.	T	A	246	PASS	DP=10	GT	1|0	1|0
+3	410	.	T	A	246	PASS	DP=10	GT	1|0	1|0
+3	420	.	T	A	246	PASS	DP=10	GT	1|0	1|0
+3	430	.	T	A	246	PASS	DP=10	GT	1|0	1|0
+3	440	.	T	A	246	PASS	DP=10	GT	1|0	1|0
+3	450	.	T	A	246	PASS	DP=10	GT	1|0	1|0
+3	460	.	T	A	246	PASS	DP=10	GT	1|0	1|0
+3	470	.	T	A	246	PASS	DP=10	GT	1|0	1|0
+3	480	.	T	A	246	PASS	DP=10	GT	1|0	1|0
+3	490	.	T	A	246	PASS	DP=10	GT	1|0	1|0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/consensus.1.chain	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,12 @@
+chain 497 1 501 + 1 501 1 502 + 1 502 1
+11 3 1
+1 0 3
+485
+
+chain 485 2 501 + 0 501 2 495 + 0 495 2
+61 3 1
+54 3 1
+58 0 8
+21 10 0
+291
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/consensus.1.out	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,20 @@
+>1:2-501
+TACAAAATATGATAAAATCAAAAAGAACATAACCTACGTATCAACTAAAGTGGTTGTTTG
+AAGAAAAGGAAGACTTAAAAAGAGTCAGTACTAACCTACATAATATATACAATGTTCATT
+AAATAATAAAATGAGCTCATCATACTTAGGTCATCATAAATATATCTGAAATTCACAAAT
+ATTGATCAAATGGTAAAATAGACAAGTAGATTTTAATAGGTTAAACAATTACTGATTCTC
+TTGAAAGAATAAATTTAATATGAGACCTATTTCATTATAATGAACTCACAAATTAGAAAC
+TTCACACTGGGGGCTGGAGAGATGGCTCAGTAGTTAAGAACACTGACTGCTCTTCTGAAG
+GTCCTGAGTTCAAATCCCAGCAACCACATGGTGACTTACAACCATCTGTAATGACATCTG
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+TTTAAAAACAAAAAAAAAGAA
+>2
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+AAATTAGTGATTTTCCATATTCTTTAAGTCATTTTAGAGTAATGTGTTCTTAAGATTTCA
+GAAAAACAAAAACTTGTGCTTTCCTGTTTGAAAAACAAACAGCTGTGGGGAATGGACGTA
+CGTTGTCGGGACAGCCTTTTTATAAAATAATGTTGAGGCTTTGATACGTCAAAGNNNNNN
+NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGCT
+GCTGCCAATGACAGCACACCCTGGGAATGCCCCAACTACTTACTACAAAGCAGTGTTACA
+TGGAGAAGATCTTCAAGAGTCTTTTTGCTAGATCTTTCCTTGGCTTTTGATGTGACTCCT
+CTCAATAAAATCCACAGTAATATAGTGAGTGGTCTCCTGCTCCAAACCAGTATTCCAGAC
+ACAGTTAATCCAGAC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/consensus.fa	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,20 @@
+>1:2-501
+TACCATATGTGACATATAAAAAAGAACATAACCTACGTATCAACTAAAGTGGTTGTTTGC
+AGAAAAGGAAGACTTAAAAAGAGTCAGTACTAACCTACATAATATATACAATGTTCATTA
+AATAATAAAATGAGCTCATCATACTTAGGTCATCATAAATATATCTGAAATTCACAAATA
+TTGATCAAATGGTAAAATAGACAAGTAGATTTTAATAGGTTAAACAATTACTGATTCTCT
+TGAAAGAATAAATTTAATATGAGACCTATTTCATTATAATGAACTCACAAATTAGAAACT
+TCACACTGGGGGCTGGAGAGATGGCTCAGTAGTTAAGAACACTGACTGCTCTTCTGAAGG
+TCCTGAGTTCAAATCCCAGCAACCACATGGTGACTTACAACCATCTGTAATGACATCTGA
+TGCCCTCTGGTGTGTCTGAAGACAGCTACAGTGTACTTACATAAAATAATAAATAAATCT
+TTAAAAACAAAAAAAAAGAA
+>2
+GAAGATCTTTTCCTTATTAAGGATCTGAAGCTCTGTAGATTTGTATTCTATTAAACATGG
+AGAGATTAGTGATTTTCCATATTCTTTAAGTCATTTTAGAGTAATGTGTTCTTAAGATAA
+ATCAGAAAAACAAAAACTTGTGCTTTCCTGTTTGAAAAACAAACAGCTGTGGGGAATGGT
+GTCGGGACAGCCTTTTTATAAAATTTTTCTAAATAATGTTGAGGCTTTGATACGTCAAAG
+TTATATTTCAAATGGAATCACTTAGACCTCGTTTCTGAGTGTCAATGGCCATATTGGGGA
+TTTGCTGCTGCCAATGACAGCACACCCTGGGAATGCCCCAACTACTTACTACAAAGCAGT
+GTTACATGGAGAAGATCTTCAAGAGTCTTTTTGCTAGATCTTTCCTTGGCTTTTGATGTG
+ACTCCTCTCAATAAAATCCACAGTAATATAGTGAGTGGTCTCCTGCTCCAAACCAGTATT
+TCAGACACAGTTAATCCAGAC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/consensus.tab	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,3 @@
+1	421	480
+2	1   60
+2	241   300
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/consensus.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,18 @@
+##fileformat=VCFv4.2
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##INFO=<ID=END,Number=1,Type=Integer,Description="End position of the variant described in this record">
+##ALT=<ID=DEL,Description="Deletion">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	NA001
+1	5	.	C	a	.	PASS	.	GT	0/1
+1	5	.	C	t	.	PASS	.	GT	0/1
+1	7	.	T	a	.	PASS	.	GT	.
+1	10	.	G	a	.	PASS	.	GT	0/1
+1	12	.	GACA	ga	.	PASS	.	GT	0/1
+1	16	.	T	taaa	.	PASS	.	GT	1/1
+1	19	.	A	c	.	PASS	.	GT	0/1
+1	61	.	C	a	.	PASS	.	GT	0/1
+2	61	.	AGAG	aa	.	PASS	.	GT	0/1
+2	119	.	AAA	t	.	PASS	.	GT	0/1
+2	179	.	G	gacgtacgt	.	PASS	.	GT	0/1
+2	200	.	A	<DEL>	.	PASS	END=210	GT	1/0
+2	481	.	T	c,a	.	PASS	.	GT	0/2
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/convert.23andme	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,28 @@
+# rsid	chromosome	position	genotype
+rs001	1	2	AA
+rs002	1	10	AG
+rs003	1	14	AG
+rs004	1	24	TC
+rs005	1	44	CG
+rs006	1	53	GG
+rs007	1	60	GG
+rs008	1	62	CC
+rs009	1	75	AA
+rs010	1	80	GG
+rs011	1	89	TT
+rs012	1	96	--
+rs013	1	99	CC
+rs014	1	102	GG
+rs015	1	112	TT
+rs016	2	5	CC
+rs017	2	11	CT
+rs018	2	16	CC
+rs019	2	20	GG
+rs020	2	33	CT
+rs021	2	39	AA
+rs022	2	44	CC
+rs023	2	48	CC
+rs024	2	55	AA
+rs025	2	59	CT
+rs026	Y	12	T
+rs027	Y	20	C
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/convert.gs.gt.gen	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,32 @@
+X:2698560_G_A X:2698560_G_A 2698560 G A 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0
+X:2698630_A_G X:2698630_A_G 2698630 A G 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0
+X:2698758_CAA_C X:2698758_CAA_C 2698758 CAA C 1 0 0 0 1 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0
+X:2698769_AAG_A X:2698769_AAG_A 2698769 AAG A 0 1 0 0 0 1 0 1 0 0 1 0 0 1 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0
+X:2698789_C_G X:2698789_C_G 2698789 C G 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0
+X:2698822_A_C X:2698822_A_C 2698822 A C 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0
+X:2698831_G_A X:2698831_G_A 2698831 G A 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0
+X:2698889_T_C X:2698889_T_C 2698889 T C 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0
+X:2698923_G_A X:2698923_G_A 2698923 G A 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0
+X:2698953_A_AGG X:2698953_A_AGG 2698953 A AGG 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0
+X:2698954_G_A X:2698954_G_A 2698954 G A 0 1 0 0 0 1 0 1 0 0 1 0 0 1 0 1 0 0 1 0 0 0 1 0 1 0 0 1 0 0
+X:2699002_C_A X:2699002_C_A 2699002 C A 1 0 0 1 0 0 0.33 0.33 0.33 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0
+X:2699025_T_C X:2699025_T_C 2699025 T C 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0
+X:2699091_G_A X:2699091_G_A 2699091 G A 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0
+X:2699187_T_C X:2699187_T_C 2699187 T C 1 0 0 1 0 0 0 1 0 1 0 0 0 1 0 0 1 0 0 1 0 1 0 0 1 0 0 0 1 0
+X:2699188_G_C X:2699188_G_C 2699188 G C 1 0 0 1 0 0 0 1 0 1 0 0 0 1 0 0 1 0 0 1 0 1 0 0 1 0 0 0 1 0
+X:2699189_T_C X:2699189_T_C 2699189 T C 1 0 0 1 0 0 0 1 0 1 0 0 0 1 0 0 1 0 0 1 0 1 0 0 1 0 0 0 1 0
+X:2699217_C_T X:2699217_C_T 2699217 C T 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0
+X:2699246_C_A X:2699246_C_A 2699246 C A 0 1 0 0 0 1 0 1 0 0 0 1 0 1 0 0 1 0 1 0 0 0 1 0 1 0 0 0 1 0
+X:2699275_T_G X:2699275_T_G 2699275 T G 1 0 0 1 0 0 0 1 0 1 0 0 0 1 0 0 0 1 0 1 0 1 0 0 1 0 0 0 1 0
+X:2699350_A_T X:2699350_A_T 2699350 A T 1 0 0 1 0 0 0 1 0 1 0 0 0 1 0 0 1 0 0 1 0 1 0 0 1 0 0 0 1 0
+X:2699360_T_C X:2699360_T_C 2699360 T C 1 0 0 1 0 0 0 1 0 1 0 0 0 1 0 0 1 0 0 1 0 1 0 0 1 0 0 0 1 0
+X:2699450_A_C X:2699450_A_C 2699450 A C 1 0 0 1 0 0 0 1 0 1 0 0 0 1 0 0 1 0 0 1 0 1 0 0 1 0 0 0 1 0
+X:2699507_T_C X:2699507_T_C 2699507 T C 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0
+X:2699555_C_A X:2699555_C_A 2699555 C A 1 0 0 0 0 1 0 0 1 1 0 0 0 0 1 0 0 1 0 1 0 0 1 0 1 0 0 0 1 0
+X:2699645_G_T X:2699645_G_T 2699645 G T 1 0 0 0 0 1 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 0 1 0 1 0 0 1 0 0
+X:2699676_G_A X:2699676_G_A 2699676 G A 1 0 0 1 0 0 0 0 1 1 0 0 0 0 1 0 1 0 0 1 0 1 0 0 1 0 0 0 1 0
+X:2699728_C_T X:2699728_C_T 2699728 C T 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0
+X:2699775_C_A X:2699775_C_A 2699775 C A 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0
+X:2699898_C_CT X:2699898_C_CT 2699898 C CT 1 0 0 1 0 0 0 0 1 1 0 0 0 0 1 0 1 0 0 1 0 1 0 0 1 0 0 0 1 0
+X:2699968_A_G X:2699968_A_G 2699968 A G 0.5 0.0 0.5 1 0 0 1 0 0 0 0 1 1 0 0 0 1 0 1 0 0 1 0 0 0 1 0 0 1 0
+X:2699970_T_C X:2699970_T_C 2699970 T C 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0 1 0 0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/convert.gs.gt.samples	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,12 @@
+ID_1 ID_2 missing
+0 0 0
+NA00001 NA00001 0
+NA00002 NA00002 0
+NA00003 NA00003 0
+NA00004 NA00004 0
+NA00005 NA00005 0
+NA00006 NA00006 0
+NA00007 NA00007 0
+NA00008 NA00008 0
+NA00009 NA00009 0
+NA00010 NA00010 0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/convert.gvcf.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,105 @@
+##fileformat=VCFv4.1
+##FILTER=<ID=PASS,Description="All filters passed">
+##FORMAT=<ID=GQX,Number=1,Type=Integer,Description="Minimum of {Genotype quality assuming variant position,Genotype quality assuming non-variant position}">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Filtered basecall depth used for site genotyping">
+##FORMAT=<ID=DPF,Number=1,Type=Integer,Description="Basecalls filtered from input prior to site genotyping">
+##FORMAT=<ID=AD,Number=.,Type=Integer,Description="Allelic depths for the ref and alt alleles in the order listed. For indels this value only includes reads which confidently support each allele (posterior prob 0.999 or higher that read contains indicated allele vs all other intersecting indel alleles)">
+##FORMAT=<ID=DPI,Number=1,Type=Integer,Description="Read depth associated with indel, taken from the site preceding the indel.">
+##INFO=<ID=END,Number=1,Type=Integer,Description="End position of the region described in this record">
+##INFO=<ID=BLOCKAVG_min30p3a,Number=0,Type=Flag,Description="Non-variant site block. All sites in a block are constrained to be non-variant, have the same filter value, and have all sample values in range [x,y], y <= max(x+3,(x*1.3)). All printed site block sample values are the minimum observed in the region spanned by the block">
+##INFO=<ID=SNVSB,Number=1,Type=Float,Description="SNV site strand bias">
+##INFO=<ID=SNVHPOL,Number=1,Type=Integer,Description="SNV contextual homopolymer length">
+##INFO=<ID=CIGAR,Number=A,Type=String,Description="CIGAR alignment for each alternate indel allele">
+##INFO=<ID=RU,Number=A,Type=String,Description="Smallest repeating sequence unit extended or contracted in the indel allele relative to the reference. RUs are not reported if longer than 20 bases.">
+##INFO=<ID=REFREP,Number=A,Type=Integer,Description="Number of times RU is repeated in reference.">
+##INFO=<ID=IDREP,Number=A,Type=Integer,Description="Number of times RU is repeated in indel allele.">
+##FILTER=<ID=IndelConflict,Description="Locus is in region with conflicting indel calls">
+##FILTER=<ID=SiteConflict,Description="Site genotype conflicts with proximal indel call. This is typically a heterozygous SNV call made inside of a heterozygous deletion">
+##FILTER=<ID=LowGQX,Description="Locus GQX is less than 30 or not present">
+##FILTER=<ID=HighDPFRatio,Description="The fraction of basecalls filtered out at a site is greater than 0.3">
+##FILTER=<ID=HighSNVSB,Description="SNV strand bias value (SNVSB) exceeds 10">
+##FILTER=<ID=HighREFREP,Description="Locus contains an indel allele occurring in a homopolymer or dinucleotide track with a reference repeat greater than 8">
+##FILTER=<ID=HighDepth,Description="Locus depth is greater than 3x the mean chromosome depth">
+##contig=<ID=22,length=450>
+##SnvTheta=0.001
+##IndelTheta=0.0001
+##MaxDepth_1=114.18
+##MaxDepth_10=131.73
+##MaxDepth_11=117.27
+##MaxDepth_12=116.97
+##MaxDepth_13=102.24
+##MaxDepth_14=101.55
+##MaxDepth_15=95.22
+##MaxDepth_16=111.33
+##MaxDepth_17=112.59
+##MaxDepth_18=121.86
+##MaxDepth_19=111.12
+##MaxDepth_2=121.83
+##MaxDepth_20=111.24
+##MaxDepth_21=98.43
+##MaxDepth_22=76.23
+##MaxDepth_3=120.09
+##MaxDepth_4=124.50
+##MaxDepth_5=119.82
+##MaxDepth_6=122.22
+##MaxDepth_7=120.27
+##MaxDepth_8=120.45
+##MaxDepth_9=102.48
+##MaxDepth_M=7005.66
+##MaxDepth_X=61.05
+##MaxDepth_Y=37.17
+##FILTER=<ID=IndelSizeFilter,Description="Indel is outside reportable size range. Insertion range: [1,3], Deletion range: [1,11]">
+##gvcftools_version="0.16"
+##FILTER=<ID=HAPLOID_CONFLICT,Description="Locus has heterozygous genotype in a haploid region.">
+##FORMAT=<ID=OPL,Number=.,Type=Integer,Description="Original PL value before ploidy correction">
+##INFO=<ID=phastCons,Number=0,Type=Flag,Description="overlaps a phastCons element">
+##INFO=<ID=AA,Number=1,Type=String,Description="Ancestral Allele, ftp://ftp.1000genomes.ebi.ac.uk/vol1/ftp/pilot_data/technical/reference/ancestral_alignments/README">
+##INFO=<ID=AF,Number=A,Type=String,Description="1000 Genomes Allele Frequency based on AC/AN; Format: Allele:AlleleFrequency">
+##INFO=<ID=AMR_AF,Number=A,Type=String,Description="1000 Genomes Allele Frequency for samples from AMR population based on AC/AN; Format: Allele:AlleleFrequency">
+##INFO=<ID=ASN_AF,Number=A,Type=String,Description="1000 Genomes Allele Frequency for samples from ASN population based on AC/AN; Format: Allele:AlleleFrequency">
+##INFO=<ID=AFR_AF,Number=A,Type=String,Description="1000 Genomes Allele Frequency for samples from AFR population based on AC/AN; Format: Allele:AlleleFrequency">
+##INFO=<ID=EUR_AF,Number=A,Type=String,Description="1000 Genomes Allele Frequency for samples from EUR population based on AC/AN; Format: Allele:AlleleFrequency">
+##INFO=<ID=CLNACC,Number=.,Type=String,Description="Accession and version number assigned by ClinVar to the genotype/phenotype relationship. Multiple entries for an allele are pipe-delimited">
+##INFO=<ID=CLNSIG,Number=.,Type=String,Description="String that describes the clinical significance. Possible values: unknown, untested, non-pathogenic, probable-non-pathogenic, probable-pathogenic, pathogenic, drug-response, histocompatibility, other. Multiple values are pipe-delimited">
+##INFO=<ID=CLNORIGIN,Number=.,Type=String,Description="String that describes the origin of the variant allele. Possible values: unknown, germline, somatic, inherited, paternal, maternal, de-novo, biparental, uniparental, not-tested, test-inconclusive, other. Multiple values for an allele are pipe-delimited">
+##INFO=<ID=CLNSRC,Number=.,Type=String,Description="Variant clinical source or channel. Multiple values for an allele are pipe-delimited">
+##INFO=<ID=CLNSRCID,Number=.,Type=String,Description="Identifier used by source defined in CLNSRC. Multiple values are pipe-delimited">
+##INFO=<ID=CLNGENEINFO,Number=.,Type=String,Description="Gene symbol(s) and NCBI GeneID(s). The gene symbol and ID are delimited by a colon and multiple such pairs are pipe-delimited, Example SYMBOL1:GeneID1|SYMBOL2:GeneID2">
+##INFO=<ID=CLNDBN,Number=.,Type=String,Description="Disease name used by the database specified by CLNSRC. Values corresponding to each CLNACC entry are pipe-delimited">
+##INFO=<ID=CLNDSDB,Number=.,Type=String,Description="Colon-delimited list of variant disease database name(s). Multiple values from a single database are pipe-delimited">
+##INFO=<ID=CLNDSDBID,Number=.,Type=String,Description="Colon-delimited list of variant disease database identifier(s). Multiple values from a single database are pipe-delimited">
+##INFO=<ID=CSQ,Number=A,Type=String,Description="Consequence type as predicted by VEP. Format: Allele|Gene|Feature|Feature_type|Consequence|cDNA_position|CDS_position|Protein_position|Amino_acids|Codons|Existing_variation|EXON|INTRON|HGNC|MOTIF_NAME|MOTIF_POS|HIGH_INF_POS|MOTIF_SCORE_CHANGE|DISTANCE|CANONICAL|SIFT|PolyPhen|GMAF|ENSP|DOMAINS|CCDS|HGVSc|HGVSp|CELL_TYPE">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	SAMPLE99
+22	1	.	N	.	0	LowGQX	END=9;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	.:.:0:0
+22	10	.	C	.	0	LowGQX	END=20;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:5:2:0
+22	21	.	C	.	0	LowGQX	END=26;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:10:4:0
+22	27	.	C	.	0	LowGQX	END=42;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:15:6:0
+22	43	.	G	.	0	LowGQX	END=50;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:21:8:0
+22	51	.	C	.	0	PASS	END=55;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:30:11:0
+22	56	.	G	.	0	PASS	END=72;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:42:15:0
+22	73	.	T	.	0	PASS	END=85;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:54:19:0
+22	86	.	G	C	23	LowGQX	SNVSB=0;SNVHPOL=2	GT:GQ:GQX:DP:DPF:AD	0/1:56:23:22:0:16,6
+22	87	.	T	.	0	PASS	END=101;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:69:24:0
+22	102	.	A	.	0	PASS	END=140;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:84:29:0
+22	141	.	G	.	0	PASS	END=185;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:90:31:0
+22	186	.	T	.	0	PASS	END=187;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:93:32:2
+22	188	.	T	.	0	PASS	END=204;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:102:35:0
+22	205	.	T	.	0	PASS	.	GT:GQX:DP:DPF	0/0:72:36:0
+22	206	.	T	.	0	PASS	END=231;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:87:30:0
+22	232	.	A	.	0	PASS	END=249;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:66:23:0
+22	250	.	G	.	0	PASS	END=257;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:87:30:0
+22	258	.	A	.	0	PASS	END=269;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:114:39:0
+22	270	.	G	.	0	PASS	END=279;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:150:51:0
+22	280	.	A	.	0	PASS	END=314;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:166:63:0
+22	315	.	C	.	0	PASS	END=316;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:220:74:0
+22	317	.	T	.	0	HighDepth	END=342;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:229:77:0
+22	343	.	T	.	0	HighDepth	END=377;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:241:81:0
+22	378	.	T	.	0	HighDepth	END=384;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:200:75:0
+22	385	.	G	.	0	PASS	END=388;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:217:73:0
+22	389	.	C	.	0	HighDepth	END=390;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:223:75:0
+22	391	.	T	.	0	PASS	.	GT:GQX:DP:DPF	0/0:223:75:1
+22	392	.	T	.	0	HighDepth	END=397;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:223:75:0
+22	398	.	T	.	0	PASS	END=420;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:178:60:0
+22	421	.	C	.	0	PASS	END=450;BLOCKAVG_min30p3a	GT:GQX:DP:DPF	0/0:142:54:0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/convert.hls.gt.hap	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,35 @@
+0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+1 0 1 1 0 1 1 0 1 0 0 0 0 0 0 0 0 0 0 0
+0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0
+0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+1 0 0 1 0 1 1 0 1 0 0 0 0 0 0 0 0 0 0 0
+0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+1 0 1 1 0 1 1 0 1 0 0 0 0 0 0 1 0 0 0 0
+0 0 0 0 ? ? 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+0 0 0 0 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0* 1*
+0 0 0 0 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 1
+0 0 0 0 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 1
+0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+1 0 1 1 0 1 1 1 1 0 0 1 0 0 0 1 0 0 1 0
+0 0 0 0 1 0 0 0 0 1 1 1 1 0 0 0 0 0 0 1
+0 0 0 0 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 1
+0 0 0 0 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 1
+0 0 0 0 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 1
+0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+0 - 1 - 1 - 0 - 1 - 1 1 1 0 0 1 0 0 0 1
+0 - 1 - 0 - 0 - 0 - 0 0 0 0 0 1 0 0 0 0
+0 - 0 - 1 - 0 - 1 - 1 0 1 0 0 0 0 0 0 1
+0 - 0 - 0 - 0 - 0 - 0 0 0 0 0 0 0 0 0 0
+0 - 0 - 0 - 0 - 0 - 0 0 0 0 0 0 0 0 0 0
+0 - 0 - 1 - 0 - 1 - 1 0 1 0 0 0 0 0 0 1
+? - 0 - 0 - 1 - 0 - 0 1 0 0 0 0 0 1 1 0
+0 - 0 - 0 - 0 - 0 - 0 0 0 0 0 0 0 0 0 0
+0 0 0 0 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/convert.hls.gt.legend	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,36 @@
+id position a0 a1
+X:2698560_G_A 2698560 G A
+X:2698630_A_G 2698630 A G
+X:2698758_CAA_C 2698758 CAA C
+X:2698769_AAG_A 2698769 AAG A
+X:2698770_AG_A 2698770 AG A
+X:2698770_AG_AAGG 2698770 AG AAGG
+X:2698789_C_G 2698789 C G
+X:2698822_A_C 2698822 A C
+X:2698831_G_A 2698831 G A
+X:2698889_T_C 2698889 T C
+X:2698923_G_A 2698923 G A
+X:2698953_A_AGG 2698953 A AGG
+X:2698954_G_A 2698954 G A
+X:2699002_C_A 2699002 C A
+X:2699025_T_C 2699025 T C
+X:2699091_G_A 2699091 G A
+X:2699187_T_C 2699187 T C
+X:2699188_G_C 2699188 G C
+X:2699189_T_C 2699189 T C
+X:2699217_C_T 2699217 C T
+X:2699246_C_A 2699246 C A
+X:2699275_T_G 2699275 T G
+X:2699350_A_T 2699350 A T
+X:2699360_T_C 2699360 T C
+X:2699450_A_C 2699450 A C
+X:2699507_T_C 2699507 T C
+X:2699555_C_A 2699555 C A
+X:2699645_G_T 2699645 G T
+X:2699676_G_A 2699676 G A
+X:2699728_C_T 2699728 C T
+X:2699775_C_A 2699775 C A
+X:2699898_C_CT 2699898 C CT
+X:2699968_A_G 2699968 A G
+X:2699970_T_C 2699970 T C
+X:2699990_C_<INS:ME:LINE1>_2700054 2699990 C <INS:ME:LINE1>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/convert.hls.gt.samples	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,11 @@
+sample population group sex
+NA00001 NA00001 NA00001 2
+NA00002 NA00002 NA00002 2
+NA00003 NA00003 NA00003 2
+NA00004 NA00004 NA00004 2
+NA00005 NA00005 NA00005 2
+NA00006 NA00006 NA00006 2
+NA00007 NA00007 NA00007 2
+NA00008 NA00008 NA00008 2
+NA00009 NA00009 NA00009 2
+NA00010 NA00010 NA00010 2
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/convert.hs.gt.hap	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,35 @@
+X:2698560_G_A X:2698560_G_A 2698560 G A 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+X:2698630_A_G X:2698630_A_G 2698630 A G 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+X:2698758_CAA_C X:2698758_CAA_C 2698758 CAA C 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+X:2698769_AAG_A X:2698769_AAG_A 2698769 AAG A 1 0 1 1 0 1 1 0 1 0 0 0 0 0 0 0 0 0 0 0
+X:2698770_AG_A X:2698770_AG_A 2698770 AG A 0 0 0 1 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0
+X:2698770_AG_AAGG X:2698770_AG_AAGG 2698770 AG AAGG 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+X:2698789_C_G X:2698789_C_G 2698789 C G 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+X:2698822_A_C X:2698822_A_C 2698822 A C 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+X:2698831_G_A X:2698831_G_A 2698831 G A 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+X:2698889_T_C X:2698889_T_C 2698889 T C 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+X:2698923_G_A X:2698923_G_A 2698923 G A 1 0 0 1 0 1 1 0 1 0 0 0 0 0 0 0 0 0 0 0
+X:2698953_A_AGG X:2698953_A_AGG 2698953 A AGG 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+X:2698954_G_A X:2698954_G_A 2698954 G A 1 0 1 1 0 1 1 0 1 0 0 0 0 0 0 1 0 0 0 0
+X:2699002_C_A X:2699002_C_A 2699002 C A 0 0 0 0 ? ? 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+X:2699025_T_C X:2699025_T_C 2699025 T C 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+X:2699091_G_A X:2699091_G_A 2699091 G A 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+X:2699187_T_C X:2699187_T_C 2699187 T C 0 0 0 0 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0* 1*
+X:2699188_G_C X:2699188_G_C 2699188 G C 0 0 0 0 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 1
+X:2699189_T_C X:2699189_T_C 2699189 T C 0 0 0 0 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 1
+X:2699217_C_T X:2699217_C_T 2699217 C T 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+X:2699246_C_A X:2699246_C_A 2699246 C A 1 0 1 1 0 1 1 1 1 0 0 1 0 0 0 1 0 0 1 0
+X:2699275_T_G X:2699275_T_G 2699275 T G 0 0 0 0 1 0 0 0 0 1 1 1 1 0 0 0 0 0 0 1
+X:2699350_A_T X:2699350_A_T 2699350 A T 0 0 0 0 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 1
+X:2699360_T_C X:2699360_T_C 2699360 T C 0 0 0 0 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 1
+X:2699450_A_C X:2699450_A_C 2699450 A C 0 0 0 0 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 1
+X:2699507_T_C X:2699507_T_C 2699507 T C 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
+X:2699555_C_A X:2699555_C_A 2699555 C A 0 - 1 - 1 - 0 - 1 - 1 1 1 0 0 1 0 0 0 1
+X:2699645_G_T X:2699645_G_T 2699645 G T 0 - 1 - 0 - 0 - 0 - 0 0 0 0 0 1 0 0 0 0
+X:2699676_G_A X:2699676_G_A 2699676 G A 0 - 0 - 1 - 0 - 1 - 1 0 1 0 0 0 0 0 0 1
+X:2699728_C_T X:2699728_C_T 2699728 C T 0 - 0 - 0 - 0 - 0 - 0 0 0 0 0 0 0 0 0 0
+X:2699775_C_A X:2699775_C_A 2699775 C A 0 - 0 - 0 - 0 - 0 - 0 0 0 0 0 0 0 0 0 0
+X:2699898_C_CT X:2699898_C_CT 2699898 C CT 0 - 0 - 1 - 0 - 1 - 1 0 1 0 0 0 0 0 0 1
+X:2699968_A_G X:2699968_A_G 2699968 A G ? - 0 - 0 - 1 - 0 - 0 1 0 0 0 0 0 1 1 0
+X:2699970_T_C X:2699970_T_C 2699970 T C 0 - 0 - 0 - 0 - 0 - 0 0 0 0 0 0 0 0 0 0
+X:2699990_C_<INS:ME:LINE1>_2700054 X:2699990_C_<INS:ME:LINE1>_2700054 2699990 C <INS:ME:LINE1> 0 0 0 0 1 0 0 0 0 1 1 0 1 0 0 0 0 0 0 1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/convert.hs.gt.samples	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,12 @@
+ID_1 ID_2 missing
+0 0 0
+NA00001 NA00001 0
+NA00002 NA00002 0
+NA00003 NA00003 0
+NA00004 NA00004 0
+NA00005 NA00005 0
+NA00006 NA00006 0
+NA00007 NA00007 0
+NA00008 NA00008 0
+NA00009 NA00009 0
+NA00010 NA00010 0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/convert.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,40 @@
+##fileformat=VCFv4.1
+##FILTER=<ID=PASS,Description="All filters passed">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=PL,Number=G,Type=Integer,Description="List of Phred-scaled genotype likelihoods">
+##FORMAT=<ID=GP,Number=G,Type=Float,Description="Estimated Genotype Probability">
+##contig=<ID=X,assembly=b37,length=155270560>
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	NA00001	NA00002	NA00003	NA00004	NA00005	NA00006	NA00007	NA00008	NA00009	NA00010
+X	2698560	.	G	A	102	.	.	GT:PL:GP	0|0:0,21,177:1,0,0	0|0:0,30,206:1,0,0	0|0:0,21,177:1,0,0	0|0:0,15,132:1,0,0	0|0:0,9,90:1,0,0	0|0:0,15,114:1,0,0	0|0:0,15,118:1,0,0	0|0:0,15,133:1,0,0	0|0:0,15,144:1,0,0	0|0:0,24,191:1,0,0
+X	2698630	.	A	G	537	.	.	GT:PL:GP	0|0:0,21,186:1,0,0	0|0:0,21,176:1,0,0	0|0:0,15,106:1,0,0	0|0:0,18,127:1,0,0	0|0:0,6,62:1,0,0	0|0:0,15,146:1,0,0	0|0:0,18,141:1,0,0	0|0:0,21,173:1,0,0	0|0:0,12,119:1,0,0	0|0:0,15,145:1,0,0
+X	2698758	.	CAA	C	999	.	.	GT:PL:GP	0|0:0,6,16:0.8292,0.1708,0	0|1:0,0,0:0.0278,0.5743,0.3979	0|0:0,0,0:0.6336,0.3664,0	0|0:0,3,8:0.8611,0.1389,0	0|0:0,0,8:0.7628,0.2372,0	0|0:0,9,18:1,0,0	0|0:0,9,23:1,0,0	0|0:0,9,15:0.9855,0.0145,0	0|0:0,6,10:1,0,0	0|0:0,21,33:1,0,0
+X	2698769	.	AAG	A	999	.	.	GT:PL:GP	1|0:17,0,7:0.0069,0.9931,0	1|1:0,0,0:0.0004,0.0892,0.9104	0|1:17,3,0:0.0045,0.9954,0.0001	1|0:11,0,2:0.0085,0.9915,0	1|0:11,0,15:0.0003,0.9997,0	0|0:0,15,40:1,0,0	0|0:0,9,23:1,0,0	0|0:0,15,25:0.8474,0.1526,0	0|0:0,15,34:1,0,0	0|0:0,33,56:1,0,0
+X	2698770	.	AG	A,AAGG	999	.	.	GT:PL:GP	0|0:0,12,103,12,103,103:0.925,0.0717,0,0.0033,0,0	0|1:0,3,21,3,21,21:0.4944,0.368,0.0018,0.1343,0.0013,0.0002	0|0:0,0,0,0,0,0:0.5458,0.4085,0,0.0457,0,0	0|0:0,3,36,3,36,36:0.8126,0.1758,0,0.0116,0,0	1|0:37,0,86,49,92,130:0,1,0,0,0,0	0|0:0,15,125,15,125,125:1,0,0,0,0,0	0|0:0,9,105,9,105,105:1,0,0,0,0,0	0|0:0,15,109,15,109,109:0.9964,0.0034,0,0.0002,0,0	0|0:0,15,137,15,137,137:1,0,0,0,0,0	0|0:0,33,215,33,215,215:1,0,0,0,0,0
+X	2698789	.	C	G	153	.	.	GT:PL:GP	0|0:0,21,152:1,0,0	0|0:0,21,131:1,0,0	0|0:0,12,113:1,0,0	0|0:0,12,104:1,0,0	0|0:0,21,137:1,0,0	0|0:0,15,118:0.9999,0.0001,0	0|0:0,15,111:1,0,0	0|0:0,24,152:1,0,0	0|0:0,18,147:1,0,0	0|0:0,33,183:1,0,0
+X	2698822	.	A	C	85.2	.	.	GT:PL:GP	0|0:0,21,167:1,0,0	0|0:0,21,171:1,0,0	0|0:0,21,158:1,0,0	0|0:0,18,154:1,0,0	0|0:0,15,135:1,0,0	0|0:0,15,132:1,0,0	0|0:0,21,168:1,0,0	0|0:0,21,175:1,0,0	0|0:0,15,142:1,0,0	0|0:0,21,172:1,0,0
+X	2698831	.	G	A	303	.	.	GT:PL:GP	0|0:0,15,129:1,0,0	0|0:0,27,179:1,0,0	0|0:0,24,196:1,0,0	0|0:0,21,158:1,0,0	0|0:0,18,154:1,0,0	0|0:0,12,112:1,0,0	0|0:0,24,162:1,0,0	0|0:0,21,168:1,0,0	0|0:0,9,95:1,0,0	0|0:0,21,164:1,0,0
+X	2698889	.	T	C	74.4	.	.	GT:PL:GP	0|0:0,27,193:1,0,0	0|0:0,45,255:1,0,0	0|0:0,21,190:1,0,0	0|0:0,36,254:1,0,0	0|0:0,30,226:1,0,0	0|0:0,36,253:1,0,0	0|0:0,18,156:1,0,0	0|0:0,9,87:1,0,0	0|0:0,9,98:1,0,0	0|0:0,24,205:1,0,0
+X	2698923	.	G	A	999	.	.	GT:PL:GP	1|0:62,0,133:0,1,0	0|1:164,0,91:0,1,0	0|1:35,0,73:0,1,0	1|0:91,0,108:0,1,0	1|0:67,0,71:0,1,0	0|0:0,30,187:1,0,0	0|0:0,9,73:1,0,0	0|0:0,12,99:1,0,0	0|0:0,18,153:1,0,0	0|0:0,18,138:1,0,0
+X	2698953	.	A	AGG	267	.	.	GT:PL:GP	0|0:0,27,111:1,0,0	0|0:0,33,124:1,0,0	0|0:0,12,62:1,0,0	0|0:0,15,86:1,0,0	0|0:0,12,58:1,0,0	0|0:0,15,69:1,0,0	0|0:0,6,34:1,0,0	0|0:0,18,83:1,0,0	0|0:0,18,80:1,0,0	0|0:0,15,74:1,0,0
+X	2698954	.	G	A	999	.	.	GT:PL:GP	1|0:69,0,139:0,1,0	1|1:199,24,0:0,0,1	0|1:15,0,82:0,1,0	1|0:32,0,76:0,1,0	1|0:16,0,80:0,1,0	0|0:0,15,131:1,0,0	0|0:0,6,58:1,0,0	0|1:99,0,39:0,1,0	0|0:0,18,163:1,0,0	0|0:0,15,136:1,0,0
+X	2699002	.	C	A	65.1	.	.	GT:PL:GP	0|0:0,18,144:1,0,0	0|0:0,12,115:1,0,0	.|.:0,12,120:1,0,0	0|0:0,15,131:1,0,0	0|0:0,6,29:1,0,0	0|0:0,9,95:1,0,0	0|0:0,9,79:1,0,0	0|0:0,24,188:1,0,0	0|0:0,15,124:1,0,0	0|0:0,9,93:1,0,0
+X	2699025	.	T	C	44.9	.	.	GT:PL:GP	0|0:0,24,189:1,0,0	0|0:0,12,98:1,0,0	0|0:0,15,130:1,0,0	0|0:0,15,113:1,0,0	0|0:0,6,63:1,0,0	0|0:0,24,198:1,0,0	0|0:0,12,92:1,0,0	0|0:0,24,197:1,0,0	0|0:0,9,97:1,0,0	0|0:0,12,108:1,0,0
+X	2699091	.	G	A	45	.	.	GT:PL:GP	0|0:0,18,162:1,0,0	0|0:0,21,153:1,0,0	0|0:0,12,101:1,0,0	0|0:0,12,97:1,0,0	0|0:0,24,188:1,0,0	0|0:0,24,194:1,0,0	0|0:0,15,127:1,0,0	0|0:0,21,169:1,0,0	0|0:0,15,129:1,0,0	0|0:0,21,171:1,0,0
+X	2699187	.	T	C	999	.	.	GT:PL:GP	0|0:0,24,200:1,0,0	0|0:0,24,191:1,0,0	1|0:48,0,85:0,1,0	0|0:0,15,145:1,0,0	0|1:58,0,45:0,1,0	1|0:61,0,50:0,1,0	1|0:22,0,51:0,1,0	0|0:0,27,211:1,0,0	0|0:0,9,96:0.9999,0.0001,0	0/1:23,0,160:0,1,0
+X	2699188	.	G	C	999	.	.	GT:PL:GP	0|0:0,24,194:1,0,0	0|0:0,24,167:1,0,0	1|0:48,0,78:0,1,0	0|0:0,15,131:1,0,0	0|1:63,0,40:0,1,0	1|0:50,0,44:0,1,0	1|0:22,0,48:0,1,0	0|0:0,27,212:1,0,0	0|0:0,9,87:0.9999,0.0001,0	0|1:23,0,154:0,1,0
+X	2699189	.	T	C	999	.	.	GT:PL:GP	0|0:0,24,199:1,0,0	0|0:0,24,176:1,0,0	1|0:44,0,87:0,1,0	0|0:0,15,136:1,0,0	0|1:62,0,46:0,1,0	1|0:61,0,46:0,1,0	1|0:22,0,49:0,1,0	0|0:0,27,212:1,0,0	0|0:0,9,93:0.9999,0.0001,0	0|1:23,0,164:0,1,0
+X	2699217	.	C	T	60.3	.	.	GT:PL:GP	0|0:0,18,158:1,0,0	0|0:0,18,119:1,0,0	0|0:0,21,152:1,0,0	0|0:0,21,162:1,0,0	0|0:0,12,102:1,0,0	0|0:0,18,144:1,0,0	0|0:0,12,108:1,0,0	0|0:0,18,146:1,0,0	0|0:0,12,98:1,0,0	0|0:0,18,155:1,0,0
+X	2699246	.	C	A	999	.	.	GT:PL:GP	1|0:128,0,15:0,0.9998,0.0002	1|1:147,21,0:0,0.0001,0.9999	0|1:130,0,5:0,0.9977,0.0023	1|1:237,33,0:0,0,1	1|0:45,0,75:0,1,0	0|1:145,0,49:0,1,0	0|0:0,15,109:1,0,0	0|1:13,0,63:0.0002,0.9998,0	0|0:0,30,178:0.9953,0.0047,0	1|0:120,0,57:0,1,0
+X	2699275	.	T	G	999	.	.	GT:PL:GP	0|0:0,18,165:0.9998,0.0002,0	0|0:0,18,152:1,0,0	1|0:0,9,95:0.0023,0.9977,0	0|0:0,33,239:1,0,0	0|1:125,0,40:0,1,0	1|1:205,27,0:0,0,1	1|0:69,0,43:0,1,0	0|0:0,15,139:1,0,0	0|0:0,30,219:1,0,0	0|1:96,0,54:0,1,0
+X	2699350	.	A	T	999	.	.	GT:PL:GP	0|0:0,27,206:1,0,0	0|0:0,15,139:1,0,0	1|0:54,0,25:0,1,0	0|0:0,12,117:0.9996,0.0004,0	0|1:79,0,73:0,1,0	1|0:48,0,82:0,1,0	1|0:68,0,45:0,1,0	0|0:0,30,216:1,0,0	0|0:0,27,224:1,0,0	0|1:48,0,80:0,1,0
+X	2699360	.	T	C	999	.	.	GT:PL:GP	0|0:0,21,184:1,0,0	0|0:0,15,133:1,0,0	1|0:53,0,21:0,1,0	0|0:0,12,114:0.9996,0.0004,0	0|1:20,0,66:0,1,0	1|0:40,0,93:0,1,0	1|0:52,0,66:0,1,0	0|0:0,30,220:1,0,0	0|0:0,21,191:1,0,0	0|1:20,0,83:0,1,0
+X	2699450	.	A	C	999	.	.	GT:PL:GP	0|0:0,12,124:1,0,0	0|0:0,6,55:0.9976,0.0024,0	1|0:99,0,42:0,1,0	0|0:0,21,186:0.9999,0.0001,0	0|1:64,0,100:0,1,0	1|0:38,0,177:0,1,0	1|0:16,0,103:0,1,0	0|0:0,24,202:1,0,0	0|0:0,12,119:1,0,0	0|1:75,0,115:0,1,0
+X	2699507	.	T	C	195	.	.	GT:PL:GP	0|0:0,15,133:1,0,0	0|0:0,12,122:1,0,0	0|0:0,6,60:1,0,0	0|0:0,18,123:1,0,0	0|0:0,15,145:1,0,0	0|0:0,21,173:1,0,0	0|0:0,21,178:1,0,0	0|0:0,24,200:1,0,0	0|0:0,12,125:1,0,0	0|0:0,24,189:1,0,0
+X	2699555	.	C	A	999	.	.	GT:PL:GP	0:0,156:1,0	1:58,19:0,1	1:51,0:0,1	0:0,91:1,0	1:89,0:0,1	1|1:132,15,0:0,0,1	1|0:99,0,68:0,1,0	0|1:101,0,101:0,1,0	0|0:0,18,161:0.9998,0.0002,0	0|1:118,0,72:0,1,0
+X	2699645	.	G	T	999	.	.	GT:PL:GP	0:0,95:1,0	1:49,0:0,1	0:0,58:1,0	0:0,64:1,0	0:0,113:1,0	0|0:0,18,158:1,0,0	0|0:0,18,146:1,0,0	0|1:68,0,136:0,1,0	0|0:0,30,210:1,0,0	0|0:0,27,186:1,0,0
+X	2699676	.	G	A	999	.	.	GT:PL:GP	0:0,84:1,0	0:0,87:1,0	1:35,0:0,1	0:0,28:1,0	1:114,0:0,1	1|0:99,0,72:0,1,0	1|0:48,0,89:0,1,0	0|0:0,18,155:1,0,0	0|0:0,24,191:1,0,0	0|1:99,0,61:0,1,0
+X	2699728	.	C	T	69.7	.	.	GT:PL:GP	0:0,58:1,0	0:0,64:1,0	0:0,33:1,0	0:0,69:1,0	0:0,81:1,0	0|0:0,27,183:1,0,0	0|0:0,45,220:1,0,0	0|0:0,30,161:1,0,0	0|0:0,15,110:1,0,0	0|0:0,21,156:1,0,0
+X	2699775	.	C	A	71.1	.	.	GT:PL:GP	0:0,62:1,0	0:0,101:1,0	0:0,130:1,0	0:0,141:1,0	0:0,54:1,0	0|0:0,30,203:1,0,0	0|0:0,39,208:1,0,0	0|0:0,30,177:1,0,0	0|0:0,18,132:1,0,0	0|0:0,15,103:1,0,0
+X	2699898	.	C	CT	999	.	.	GT:PL:GP	0:0,32:1,0	0:0,11:1,0	1:11,0:0,1	0:0,11:1,0	1:31,0:0,1	1|0:11,0,24:0.0438,0.9562,0	1|0:8,0,17:0,1,0	0|0:0,33,72:1,0,0	0|0:0,27,69:1,0,0	0|1:11,4,12:0.0003,0.9997,0
+X	2699968	.	A	G	999	.	.	GT:PL:GP	.:0,84:1,0	0:0,32:1,0	0:0,57:1,0	1:131,0:0,1	0:0,66:1,0	0|1:89,0,44:0,1,0	0|0:0,18,157:1,0,0	0|0:0,45,255:1,0,0	0|1:75,0,109:0,1,0	1|0:98,0,62:0,1,0
+X	2699970	.	T	C	55.3	.	.	GT:PL:GP	0:0,68:1,0	0:0,34:1,0	0:0,32:1,0	0:0,162:1,0	0:0,63:1,0	0|0:0,15,149:1,0,0	0|0:0,21,181:1,0,0	0|0:0,45,255:1,0,0	0|0:0,27,207:1,0,0	0|0:0,24,196:1,0,0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/filter.1.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,33 @@
+##fileformat=VCFv4.1
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
+##INFO=<ID=DP4,Number=4,Type=Integer,Description="# high-quality ref-forward bases, ref-reverse, alt-forward and alt-reverse bases">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood">
+##FILTER=<ID=q10,Description="Quality below 10">
+##test=<xx=A,yy=B,zz=C>
+##reference=file:///lustre/scratch105/projects/g1k/ref/main_project/human_g1k_v37.fasta
+##contig=<ID=1,assembly=b37,length=249250621>
+##contig=<ID=2,assembly=b37,length=249250621>
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+##readme=AAAAAA
+##readme=BBBBBB
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A
+1	1000	.	G	A	1806	.	DP=35;DP4=1,2,3,4;AN=2;AC=1	GT:GQ:DP:GL	0/1:409:35:-20,-5,-20
+1	1001	.	G	A	1806	.	DP=35;DP4=1,2,3,4;AN=2;AC=1	GT:GQ:DP:GL	0/1:409:35:-20,-5,-20
+1	1003	.	GT	G	1806	.	DP=35;DP4=1,2,3,4;AN=2;AC=1	GT:GQ:DP:GL	0/1:409:35:-20,-5,-20
+1	1006	.	G	A	1806	.	DP=35;DP4=1,2,3,4;AN=2;AC=1	GT:GQ:DP:GL	0/1:409:35:-20,-5,-20
+1	1007	.	G	A	1806	.	DP=35;DP4=1,2,3,4;AN=2;AC=1	GT:GQ:DP:GL	0/1:409:35:-20,-5,-20
+1	2000	.	T	C	1806	.	DP=35;DP4=1,2,3,4;AN=2;AC=1	GT:GQ:DP:GL	0/1:409:35:-20,-5,-20
+1	2001	.	T	C	1806	.	DP=35;DP4=1,2,3,4;AN=2;AC=1	GT:GQ:DP:GL	0/1:409:35:-20,-5,-20
+1	2003	.	T	TC	1806	.	DP=35;DP4=1,2,3,4;AN=2;AC=1	GT:GQ:DP:GL	0/1:409:35:-20,-5,-20
+1	2005	.	T	C	1806	.	DP=35;DP4=1,2,3,4;AN=2;AC=1	GT:GQ:DP:GL	0/1:409:35:-20,-5,-20
+1	2006	.	T	C	1806	.	DP=35;DP4=1,2,3,4;AN=2;AC=1	GT:GQ:DP:GL	0/1:409:35:-20,-5,-20
+2	1001	.	GT	G	1806	.	DP=35;DP4=1,2,3,4;AN=2;AC=1	GT:GQ:DP:GL	0/1:409:35:-20,-5,-20
+2	1004	.	GT	G	1806	.	DP=35;DP4=1,2,3,4;AN=2;AC=1	GT:GQ:DP:GL	0/1:409:35:-20,-5,-20
+2	1008	.	GT	G	1806	.	DP=35;DP4=1,2,3,4;AN=2;AC=1	GT:GQ:DP:GL	0/1:409:35:-20,-5,-20
+2	2001	.	A	AT	1806	.	DP=35;DP4=1,2,3,4;AN=2;AC=1	GT:GQ:DP:GL	0/1:409:35:-20,-5,-20
+2	2003	.	A	AT	1806	.	DP=35;DP4=1,2,3,4;AN=2;AC=1	GT:GQ:DP:GL	0/1:409:35:-20,-5,-20
+2	2006	.	A	AT	1806	.	DP=35;DP4=1,2,3,4;AN=2;AC=1	GT:GQ:DP:GL	0/1:409:35:-20,-5,-20
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/filter.2.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,36 @@
+##fileformat=VCFv4.1
+##INFO=<ID=TEST,Number=1,Type=Integer,Description="Testing Tag">
+##FORMAT=<ID=TT,Number=A,Type=Integer,Description="Testing Tag, with commas and \"escapes\" and escaped escapes combined with \\\"quotes\\\\\"">
+##INFO=<ID=DP4,Number=4,Type=Integer,Description="# high-quality ref-forward bases, ref-reverse, alt-forward and alt-reverse bases">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood">
+##FILTER=<ID=q10,Description="Quality below 10">
+##FILTER=<ID=test,Description="Testing filter">
+##contig=<ID=1,assembly=b37,length=249250621>
+##contig=<ID=2,assembly=b37,length=249250621>
+##contig=<ID=3,assembly=b37,length=198022430>
+##contig=<ID=4,assembly=b37,length=191154276>
+##reference=file:///lustre/scratch105/projects/g1k/ref/main_project/human_g1k_v37.fasta
+##readme=AAAAAA
+##readme=BBBBBB
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+##INFO=<ID=INDEL,Number=0,Type=Flag,Description="Indicates that the variant is an INDEL.">
+##INFO=<ID=STR,Number=1,Type=String,Description="Test string type">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
+1	3000150	.	C	T	59.2	PASS	AN=4;AC=2	GT:GQ	0/1:245	0/1:245
+1	3000151	.	C	T	59.2	PASS	AN=4;AC=2	GT:DP:GQ	0/1:32:245	0/1:32:245
+1	3062915	id3D	GTTT	G	12.9	q10	DP4=1,2,3,4;AN=4;AC=2;INDEL;STR=test	GT:GQ:DP:GL	0/1:25:35:-20,-5,-20	0/1:45:11:-20,-5,-20
+1	3062915	idSNP	G	T,C	12.6	test	TEST=5;DP4=1,2,3,4;AN=3;AC=1,1	GT:TT:GQ:DP:GL	0/1:0,1:409:35:-20,-5,-20,-20,-5,-20	2:0,1:409:35:-20,-5,-20
+1	3106154	.	CAAA	C	342	PASS	AN=4;AC=2	GT:GQ:DP	0/1:245:32	0/1:25:300
+1	3106154	.	C	CT	59.2	PASS	AN=4;AC=2	GT:GQ:DP	0/1:25:12	0/1:245:310
+1	3157410	.	GA	G	90.6	q10	AN=4;AC=4	GT:GQ:DP	1/1:21:21	1/1:21:21
+1	3162006	.	GAA	G	60.2	PASS	AN=4;AC=2	GT:GQ:DP	0/1:212:22	0/1:212:22
+1	3177144	.	G	T	45	PASS	AN=4;AC=2	GT:GQ:DP	0/0:150:30	1/1:150:30
+1	3177144	.	G	.	45	PASS	AN=4;AC=0	GT:GQ:DP	0/0:150:30	0/0:150:30
+1	3184885	.	TAAAA	TA,T	61.5	PASS	AN=4;AC=2,2	GT:GQ:DP	1/2:12:10	1/2:12:20
+2	3199812	.	G	GTT,GT	82.7	PASS	AN=4;AC=2,2	GT:GQ:DP	1/2:322:20	1/2:322:10
+3	3212016	.	CTT	C,CT	79	PASS	AN=4;AC=2,2	GT:GQ:DP	1/2:91:26	1/2:91:26
+4	3258448	.	TACACACAC	T	59.9	PASS	AN=4;AC=2	GT	0/1	0/1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/filter.3.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,42 @@
+##fileformat=VCFv4.2
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
+##INFO=<ID=DP4,Number=4,Type=Integer,Description="# high-quality ref-forward bases, ref-reverse, alt-forward and alt-reverse bases">
+##INFO=<ID=STR,Number=A,Type=String,Description="Testing string and Number=A in INFO">
+##INFO=<ID=TXT0,Number=1,Type=String,Description="Testing in INFO">
+##INFO=<ID=TXT,Number=.,Type=String,Description="Testing in INFO">
+##INFO=<ID=XRF,Number=R,Type=Float,Description="Test Number=AGR in INFO">
+##INFO=<ID=XAF,Number=A,Type=Float,Description="Test Number=AGR in INFO">
+##INFO=<ID=XGF,Number=G,Type=Float,Description="Test Number=AGR in INFO">
+##INFO=<ID=XRI,Number=R,Type=Integer,Description="Test Number=AGR in INFO">
+##INFO=<ID=XAI,Number=A,Type=Integer,Description="Test Number=AGR in INFO">
+##INFO=<ID=XGI,Number=G,Type=Integer,Description="Test Number=AGR in INFO">
+##INFO=<ID=XRS,Number=R,Type=String,Description="Test Number=AGR in INFO">
+##INFO=<ID=XAS,Number=A,Type=String,Description="Test Number=AGR in INFO">
+##INFO=<ID=XGS,Number=G,Type=String,Description="Test Number=AGR in INFO">
+##SAMPLE=<ID=NORMAL,SampleName=B,Description="Less-than (\"<\") and greater-than (\">\") quoting nonsense where double brackets would do just fine",softwareName=<Nonsense,Software>,softwareVer=<119,65>,softwareParam=<.>,MetadataResource=http://somewhere.com/path>
+##INFO=<ID=CIGAR,Number=A,Type=String,Description="test">
+##INFO=<ID=AO,Number=A,Type=Integer,Description="Alternate allele observations, with partial observations recorded fractionally">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=FGS,Number=G,Type=String,Description="Test Number=AGR in FORMAT">
+##FORMAT=<ID=FGI,Number=G,Type=Integer,Description="Test Number=AGR in FORMAT">
+##FORMAT=<ID=FGF,Number=G,Type=Float,Description="Test Number=AGR in FORMAT">
+##FORMAT=<ID=FAS,Number=A,Type=String,Description="Test Number=AGR in FORMAT">
+##FORMAT=<ID=FAI,Number=A,Type=Integer,Description="Test Number=AGR in FORMAT">
+##FORMAT=<ID=FAF,Number=A,Type=Float,Description="Test Number=AGR in FORMAT">
+##FORMAT=<ID=FRS,Number=R,Type=String,Description="Test Number=AGR in FORMAT">
+##FORMAT=<ID=FRI,Number=R,Type=Integer,Description="Test Number=AGR in FORMAT">
+##FORMAT=<ID=FRF,Number=R,Type=Float,Description="Test Number=AGR in FORMAT">
+##FORMAT=<ID=STR,Number=1,Type=String,Description="Test">
+##FILTER=<ID=q20,Description="Mapping quality below 20">
+##contig=<ID=1,assembly=b37,length=249250621>
+##contig=<ID=2,assembly=b37,length=243199373>
+##contig=<ID=3,assembly=b37,length=198022430>
+##contig=<ID=4,assembly=b37,length=191154276>
+##reference=file:///lustre/scratch105/projects/g1k/ref/main_project/human_g1k_v37.fasta
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
+1	3162006	.	GAA	G,GA	238	q20	DP=19;AN=4;AC=1,1;XRF=1e6,2e6,3e6;XRI=1111,2222,3333;XRS=ABC,DEF,GHI;XAF=1e6,2e6;XAI=1111,2222;XAS=ABC,DEF;XGF=1e6,2e6,3e6,4e6,5e6,6e6;XGI=11,22,33,44,55,66;XGS=ABC,DEF,GHI,JKL,MNO,PQR;TXT=ABC,DEF,GHI	GT:GQ:DP:STR	0/1:589:19:XX	0/2:1:1:YY
+1	3162007	.	TAGGG	CAGGG,CAGGT	238	q20	AO=52101,113;CIGAR=1X4M,1X3M1X;TXT0=text	GT:FGS:FGI:FGF:FAS:FAI:FAF:FRS:FRI:FRF	0/1:AAAAAA,BBBBB,CCCC,DDD,EE,F:1,2,3,4,5,6:1e-1,2e-2,3e-3,4e-4,5e-5,6e-6:AAA,B:1,2:1e-1,2e-2:A,BB,CCC:1,2,3:1e-1,2e-2,3e-3	2:AAAAAA,BBB,C:1,2,3:1e-1,2e-2,3e-3:AAA,B:1,2:1e-1,2e-2:A,BB,CCC:1,2,3:1e-1,2e-2,3e-3
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/filter.4.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,10 @@
+##fileformat=VCFv4.1
+##contig=<ID=chr1,length=135006516>
+##INFO=<ID=TEST1,Number=1,Type=Integer,Description="Test1">
+##INFO=<ID=TEST2,Number=1,Type=Float,Description="Test2">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=TEST3,Number=1,Type=Integer,Description="Test3">
+##FORMAT=<ID=TEST4,Number=1,Type=Float,Description="Test4">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	sample1	sample2
+chr1	1	.	A	T	100	.	TEST1=10;TEST2=10	GT:TEST3:TEST4	0/1:10:10	0/1:30:30
+chr1	2	.	A	T	100	.	TEST1=50;TEST2=50	GT:TEST3:TEST4	0/1:20:20	0/1:40:40
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fixploidy.ploidy	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,9 @@
+1	3000001	3000001	X	0
+1	3000001	3000001	Y	1
+1	3000001	3000001	Z	2
+1	3000002	3000002	X	3
+1	3000002	3000002	Y	4
+1	3000002	3000002	Z	5
+1	3000004	3000004	X	6
+1	3000004	3000004	Y	7
+1	3000004	3000004	Z	8
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fixploidy.samples	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,3 @@
+A	X
+B	Y
+C	Z
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fixploidy.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,17 @@
+##fileformat=VCFv4.1
+##contig=<ID=1,assembly=b37,length=249250621>
+##reference=file:///lustre/scratch105/projects/g1k/ref/main_project/human_g1k_v37.fasta
+##INFO=<ID=FLAG,Number=0,Type=Flag,Description="Test type">
+##INFO=<ID=IINT,Number=1,Type=Integer,Description="Test type">
+##INFO=<ID=IFLT,Number=1,Type=Float,Description="Test type">
+##INFO=<ID=ISTR,Number=1,Type=String,Description="Test type">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=FINT,Number=1,Type=Integer,Description="Test type">
+##FORMAT=<ID=FFLT,Number=1,Type=Float,Description="Test type">
+##FORMAT=<ID=FSTR,Number=1,Type=String,Description="Test type">
+##FILTER=<ID=q11,Description="Quality below 10">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B	C
+1	3000001	xx	C	CT	11	PASS	FLAG;IINT=11;IFLT=1.1;ISTR=xxx	GT:FINT:FFLT:FSTR	0/0:11:1.1:xxx	0/0:11:1.1:x	0|0:11:1.1:x
+1	3000002	.	C	CTT	.	.	.	GT	./.	./.	.|.
+1	3000003	xx	C	CTTT	11	q11	FLAG;IINT=.;IFLT=.;ISTR=.	GT:FINT:FFLT:FSTR	0/0:.:.:.	0/0:.:.:.	0|0:.:.:.
+1	3000004	xx	C	CTTTT	11	q11	FLAG;IINT=11;IFLT=1.1;ISTR=xxx	GT:FINT:FFLT:FSTR	0/0:11:1.1:x	0/0:11:1.1:xxx	0|0:11:1.1:xxx
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gvcf.fa	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,9 @@
+>22
+NNNNNNNNCCTTGGCCAAGTCACTTCCTCCTTCAGGAACATTGCAGTGGGCCTAAGTGCC
+TCCTCTCGGGACTGGTATGGGGACGGTCATGCAATCTGGACAACATTCACCTTTAAAAGT
+TTATTGATCTTTTGTGACATGCACGTGGGTTCCCAGTAGCAAGAAACTAAAGGGTCGCAG
+GCCGGTTTCTGCTAATTTCTTTAATTCCAAGACAGTCTCAAATATTTTCTTATTAACTTC
+CTGGAGGGAGGCTTATCATTCTCTCTTTTGGATGATTCTAAGTACCAGCTAAAATACAGC
+TATCATTCATTTTCCTTGATTTGGGAGCCTAATTTCTTTAATTTAGTATGCAAGAAAACC
+AATTTGGAAATATCAACTGTTTTGGAAACCTTAGACCTAGGTCATCCTTAGTAAGATCTT
+CCCATTTATATAAATACTTGCAAGTAGTAGTGCCATAATT
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/isec.a.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,27 @@
+##fileformat=VCFv4.1
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
+##INFO=<ID=DP4,Number=4,Type=Integer,Description="# high-quality ref-forward bases, ref-reverse, alt-forward and alt-reverse bases">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood">
+##FILTER=<ID=q10,Description="Quality below 10">
+##test=<xx=A,yy=B,zz=C>
+##reference=file:///lustre/scratch105/projects/g1k/ref/main_project/human_g1k_v37.fasta
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+##readme=AAAAAA
+##readme=BBBBBB
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A
+1	3062915	.	GTTT	G	1806	q10	DP=35;DP4=1,2,3,4;AN=2;AC=1	GT:GQ:DP:GL	0/1:409:35:-20,-5,-20
+1	3062915	.	G	T	1806	q10	DP=35;DP4=1,2,3,4;AN=2;AC=1	GT:GQ:DP:GL	0/1:409:35:-20,-5,-20
+1	3106154	.	CAAA	C	1792	PASS	DP=32;AN=2;AC=1	GT:GQ:DP	0/1:245:32
+1	3106154	.	C	T,CT	1792	PASS	DP=32;AN=2;AC=1	GT:GQ:DP	0/1:245:32
+1	3157410	.	GA	G	628	q10	DP=21;AN=2;AC=2	GT:GQ:DP	1/1:21:21
+1	3162006	.	GAA	G	1016	PASS	DP=22;AN=2;AC=1	GT:GQ:DP	0/1:212:22
+1	3177144	.	GT	G	727	PASS	DP=30;AN=2;AC=1	GT:GQ:DP	0/1:150:30
+1	3184885	.	TAAAA	TA,T	246	PASS	DP=10;AN=2;AC=1,1	GT:GQ:DP	1/2:12:10
+2	3199812	.	G	GTT,GT	481	PASS	DP=26;AN=2;AC=1,1	GT:GQ:DP	1/2:322:26
+3	3212016	.	CTT	C,CT	565	PASS	DP=26;AN=2;AC=1,1	GT:GQ:DP	1/2:91:26
+4	3212016	.	TACACACAC	T	325	PASS	DP=31;AN=2;AC=1	GT:GQ:DP	0/1:325:31
+4	3258448	.	TACACACAC	T	325	PASS	DP=31;AN=2;AC=1	GT:GQ:DP	0/1:325:31
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/isec.b.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,27 @@
+##fileformat=VCFv4.1
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
+##INFO=<ID=DP4,Number=4,Type=Integer,Description="# high-quality ref-forward bases, ref-reverse, alt-forward and alt-reverse bases">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood">
+##FILTER=<ID=q20,Description="Mapping quality below 20">
+##contig=<ID=1,assembly=b37,length=249250621>
+##contig=<ID=2,assembly=b37,length=243199373>
+##contig=<ID=3,assembly=b37,length=198022430>
+##contig=<ID=4,assembly=b37,length=191154276>
+##reference=file:///lustre/scratch105/projects/g1k/ref/main_project/human_g1k_v37.fasta
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	B
+1	3062915	.	G	A	376	q20	DP=14;DP4=1,2,3,4;AN=2;AC=1	GT:GQ:DP:GL	0/1:376:14:-10,0,-10
+1	3062915	.	GTTT	GT	376	q20	DP=14;DP4=1,2,3,4;AN=2;AC=1	GT:GQ:DP:GL	0/1:376:14:-10,0,-10
+1	3106154	.	C	T	677	PASS	DP=15;AN=2;AC=1	GT:GQ:DP:GL	0/1:277:15:-10,0,-10
+1	3106154	.	CAAAA	C	677	PASS	DP=15;AN=2;AC=1	GT:GQ:DP:GL	0/1:277:15:-10,0,-10
+1	3157410	.	GA	G	249	PASS	DP=11;AN=2;AC=1	GT:GQ:DP	0/1:49:11
+1	3162006	.	GAA	G	663	PASS	DP=19;AN=2;AC=1	GT:GQ:DP	0/1:589:19
+1	3177144	.	GT	G	460	PASS	DP=24;AN=2;AC=1	GT:GQ:DP	0/1:236:24
+1	3184885	.	TAAA	T	598	PASS	DP=16;AN=2;AC=1	GT:GQ:DP	0/1:435:16
+2	3188209	.	GA	G	162	.	DP=15;AN=2;AC=1	GT:GQ:DP	0/1:162:15
+3	3199812	.	G	GTT,GT	353	PASS	DP=19;AN=2;AC=1,1	GT:GQ:DP	1/2:188:19
+4	3212016	.	CTT	C	677	q20	DP=15;AN=2;AC=1	GT:GQ:DP	0/1:158:15
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/merge.2.a.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,30 @@
+##fileformat=VCFv4.1
+##INFO=<ID=TEST,Number=1,Type=Integer,Description="Testing Tag">
+##FORMAT=<ID=TT,Number=A,Type=Integer,Description="Testing Tag, with commas and \"escapes\" and escaped escapes combined with \\\"quotes\\\\\"">
+##INFO=<ID=DP4,Number=4,Type=Integer,Description="# high-quality ref-forward bases, ref-reverse, alt-forward and alt-reverse bases">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood">
+##FILTER=<ID=q10,Description="Quality below 10">
+##FILTER=<ID=test,Description="Testing filter">
+##contig=<ID=1,assembly=b37,length=249250621>
+##contig=<ID=2,assembly=b37,length=249250621>
+##contig=<ID=3,assembly=b37,length=198022430>
+##contig=<ID=4,assembly=b37,length=191154276>
+##reference=file:///lustre/scratch105/projects/g1k/ref/main_project/human_g1k_v37.fasta
+##readme=AAAAAA
+##readme=BBBBBB
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+##INFO=<ID=INDEL,Number=0,Type=Flag,Description="Indicates that the variant is an INDEL.">
+##INFO=<ID=STR,Number=1,Type=String,Description="Test string type">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
+1	3000000	.	C	CCG	59.2	PASS	AN=4;AC=2	GT:GQ	0/1:245	0/1:245
+1	3000150	.	C	A	59.2	PASS	AN=4;AC=2	GT:GQ	0/1:245	0/1:245
+1	3000151	.	C	A	59.2	PASS	AN=4;AC=2	GT:DP:GQ	0/1:32:245	0/1:32:245
+1	3106154	.	C	CC	342	PASS	AN=4;AC=2	GT:GQ:DP	0/1:245:32	0/1:245:32
+1	3106154	.	C	A	59.2	PASS	AN=4;AC=2	GT:GQ:DP	0/1:245:32	0/1:245:32
+1	3200000	.	C	T	59.2	PASS	AN=4;AC=2	GT:GQ:DP	0/1:245:32	0/1:245:32
+1	3200010	.	C	T	59.2	PASS	AN=4;AC=2	GT:GQ:DP	0/1:245:32	0/1:245:32
+1	3200020	.	C	G,T	59.2	PASS	AN=4;AC=2	GT:GL	./.:1,2,3,4,5,6	.:1,2,3
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/merge.2.b.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,30 @@
+##fileformat=VCFv4.1
+##INFO=<ID=TEST,Number=1,Type=Integer,Description="Testing Tag">
+##FORMAT=<ID=TT,Number=A,Type=Integer,Description="Testing Tag, with commas and \"escapes\" and escaped escapes combined with \\\"quotes\\\\\"">
+##INFO=<ID=DP4,Number=4,Type=Integer,Description="# high-quality ref-forward bases, ref-reverse, alt-forward and alt-reverse bases">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood">
+##FILTER=<ID=q10,Description="Quality below 10">
+##FILTER=<ID=test,Description="Testing filter">
+##contig=<ID=1,assembly=b37,length=249250621>
+##contig=<ID=2,assembly=b37,length=249250621>
+##contig=<ID=3,assembly=b37,length=198022430>
+##contig=<ID=4,assembly=b37,length=191154276>
+##reference=file:///lustre/scratch105/projects/g1k/ref/main_project/human_g1k_v37.fasta
+##readme=AAAAAA
+##readme=BBBBBB
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+##INFO=<ID=INDEL,Number=0,Type=Flag,Description="Indicates that the variant is an INDEL.">
+##INFO=<ID=STR,Number=1,Type=String,Description="Test string type">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
+1	3000000	.	C	G	59.2	PASS	AN=4;AC=2	GT:GQ	0/1:245	0/1:245
+1	3000150	.	C	G	59.2	PASS	AN=4;AC=2	GT:GQ	0/1:245	0/1:245
+1	3000151	.	C	G	59.2	PASS	AN=4;AC=2	GT:DP:GQ	0/1:32:245	0/1:32:245
+1	3106154	.	C	CCC	342	PASS	AN=4;AC=2	GT:GQ:DP	0/1:245:32	0/1:245:32
+1	3106154	.	C	T	59.2	PASS	AN=4;AC=2	GT:GQ:DP	0/1:245:32	0/1:245:32
+1	3200000	.	C	T	59.2	PASS	AN=4;AC=2	GT:GQ:DP	0/1:245:32	0/1:245:32
+1	3200010	.	c	A,T	59.2	PASS	AN=4;AC=2	GT:GQ:DP	0/1:245:32	0/1:245:32
+1	3200020	.	C	T,G	59.2	PASS	AN=4;AC=2	GT:GL	./.:1,4,6,2,5,3	.:1,3,2
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/merge.3.a.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,26 @@
+##fileformat=VCFv4.1
+##INFO=<ID=TEST,Number=1,Type=Integer,Description="Testing Tag">
+##FORMAT=<ID=TT,Number=A,Type=Integer,Description="Testing Tag, with commas and \"escapes\" and escaped escapes combined with \\\"quotes\\\\\"">
+##INFO=<ID=DP4,Number=4,Type=Integer,Description="# high-quality ref-forward bases, ref-reverse, alt-forward and alt-reverse bases">
+##INFO=<ID=TR,Number=R,Type=Float,Description="Test tag">
+##INFO=<ID=TA,Number=A,Type=Float,Description="Test tag">
+##INFO=<ID=TG,Number=G,Type=Float,Description="Test tag">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood">
+##FILTER=<ID=q10,Description="Quality below 10">
+##FILTER=<ID=test,Description="Testing filter">
+##contig=<ID=1,assembly=b37,length=249250621>
+##contig=<ID=2,assembly=b37,length=249250621>
+##contig=<ID=3,assembly=b37,length=198022430>
+##contig=<ID=4,assembly=b37,length=191154276>
+##reference=file:///lustre/scratch105/projects/g1k/ref/main_project/human_g1k_v37.fasta
+##readme=AAAAAA
+##readme=BBBBBB
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+##INFO=<ID=INDEL,Number=0,Type=Flag,Description="Indicates that the variant is an INDEL.">
+##INFO=<ID=STR,Number=1,Type=String,Description="Test string type">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
+1	3000000	.	C	CCG	59.2	PASS	AN=4;AC=2;TR=1,2;TA=1;TG=1,2,3	GT:GQ	0/1:245	0/1:245
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/merge.3.b.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,26 @@
+##fileformat=VCFv4.1
+##INFO=<ID=TEST,Number=1,Type=Integer,Description="Testing Tag">
+##FORMAT=<ID=TT,Number=A,Type=Integer,Description="Testing Tag, with commas and \"escapes\" and escaped escapes combined with \\\"quotes\\\\\"">
+##INFO=<ID=DP4,Number=4,Type=Integer,Description="# high-quality ref-forward bases, ref-reverse, alt-forward and alt-reverse bases">
+##INFO=<ID=TR,Number=R,Type=Float,Description="Test tag">
+##INFO=<ID=TA,Number=A,Type=Float,Description="Test tag">
+##INFO=<ID=TG,Number=G,Type=Float,Description="Test tag">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood">
+##FILTER=<ID=q10,Description="Quality below 10">
+##FILTER=<ID=test,Description="Testing filter">
+##contig=<ID=1,assembly=b37,length=249250621>
+##contig=<ID=2,assembly=b37,length=249250621>
+##contig=<ID=3,assembly=b37,length=198022430>
+##contig=<ID=4,assembly=b37,length=191154276>
+##reference=file:///lustre/scratch105/projects/g1k/ref/main_project/human_g1k_v37.fasta
+##readme=AAAAAA
+##readme=BBBBBB
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+##INFO=<ID=INDEL,Number=0,Type=Flag,Description="Indicates that the variant is an INDEL.">
+##INFO=<ID=STR,Number=1,Type=String,Description="Test string type">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
+1	3000000	.	C	CG	59.2	PASS	AN=4;AC=2;TR=10,20;TA=10;TG=10,20,30	GT:GQ	0/1:245	0/1:245
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/merge.4.a.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,33 @@
+##fileformat=VCFv4.1
+##INFO=<ID=TEST,Number=1,Type=Integer,Description="Testing Tag">
+##FORMAT=<ID=TT,Number=A,Type=Integer,Description="Testing Tag, with commas and \"escapes\" and escaped escapes combined with \\\"quotes\\\\\"">
+##INFO=<ID=DP4,Number=4,Type=Integer,Description="# high-quality ref-forward bases, ref-reverse, alt-forward and alt-reverse bases">
+##INFO=<ID=TR,Number=R,Type=Float,Description="Test tag">
+##INFO=<ID=TA,Number=A,Type=Float,Description="Test tag">
+##INFO=<ID=TG,Number=G,Type=Float,Description="Test tag">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=XR,Number=R,Type=Integer,Description="Some description">
+##FORMAT=<ID=XA,Number=A,Type=Integer,Description="Some description">
+##FORMAT=<ID=XG,Number=G,Type=Integer,Description="Some description">
+##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood">
+##FILTER=<ID=q10,Description="Quality below 10">
+##FILTER=<ID=test,Description="Testing filter">
+##contig=<ID=1,assembly=b37,length=249250621>
+##contig=<ID=2,assembly=b37,length=249250621>
+##contig=<ID=3,assembly=b37,length=198022430>
+##contig=<ID=4,assembly=b37,length=191154276>
+##reference=file:///lustre/scratch105/projects/g1k/ref/main_project/human_g1k_v37.fasta
+##readme=AAAAAA
+##readme=BBBBBB
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+##INFO=<ID=INDEL,Number=0,Type=Flag,Description="Indicates that the variant is an INDEL.">
+##INFO=<ID=STR,Number=1,Type=String,Description="Test string type">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
+1	3000000	id1	C	CCG	59.2	PASS	AN=4;AC=2;TR=1,2;TA=1;TG=1,2,3	GT:GQ:XR:XA:XG	0/1:245:0,1:1:0,1,2	0/1:245:1,2:2:0,1,2
+1	3000000	.	C	CCG	59.2	PASS	AN=4;AC=2	GT:GQ:XR:XA:XG	0/1:245:1,2:2:0,1,2	0/1:245:2,3:3:1,2,3
+1	3000002	.	C	CCG	59.2	PASS	AN=4;AC=2	GT:GQ	0/1:245	0/1:245
+1	3000002	id2	C	CCG	59.2	PASS	AN=4;AC=2;TR=1,2;TA=1;TG=1,2,3	GT:GL:XR:XA:XG	0/1:245:.:.:.	0/1:245:.:.:.
+1	3000002	id3	C	CCG	59.2	PASS	AN=4;AC=2;TR=1,2;TA=1;TG=1,2,3	GT:GL:XR:XA:XG	0/1:245:.:.:.	0/1:245:.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/merge.4.b.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,33 @@
+##fileformat=VCFv4.1
+##INFO=<ID=TEST,Number=1,Type=Integer,Description="Testing Tag">
+##FORMAT=<ID=TT,Number=A,Type=Integer,Description="Testing Tag, with commas and \"escapes\" and escaped escapes combined with \\\"quotes\\\\\"">
+##INFO=<ID=DP4,Number=4,Type=Integer,Description="# high-quality ref-forward bases, ref-reverse, alt-forward and alt-reverse bases">
+##INFO=<ID=TR,Number=R,Type=Float,Description="Test tag">
+##INFO=<ID=TA,Number=A,Type=Float,Description="Test tag">
+##INFO=<ID=TG,Number=G,Type=Float,Description="Test tag">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood">
+##FORMAT=<ID=XR,Number=R,Type=Integer,Description="Some description">
+##FORMAT=<ID=XA,Number=A,Type=Integer,Description="Some description">
+##FORMAT=<ID=XG,Number=G,Type=Integer,Description="Some description">
+##FILTER=<ID=q10,Description="Quality below 10">
+##FILTER=<ID=test,Description="Testing filter">
+##contig=<ID=1,assembly=b37,length=249250621>
+##contig=<ID=2,assembly=b37,length=249250621>
+##contig=<ID=3,assembly=b37,length=198022430>
+##contig=<ID=4,assembly=b37,length=191154276>
+##reference=file:///lustre/scratch105/projects/g1k/ref/main_project/human_g1k_v37.fasta
+##readme=AAAAAA
+##readme=BBBBBB
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+##INFO=<ID=INDEL,Number=0,Type=Flag,Description="Indicates that the variant is an INDEL.">
+##INFO=<ID=STR,Number=1,Type=String,Description="Test string type">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	C	D
+1	3000000	.	C	A	59.2	PASS	AN=4;AC=2	GT:GQ	0/1:245	0/1:245
+1	3000000	id1	C	A	59.2	PASS	AN=4;AC=2;TR=1,2;TA=1;TG=1,2,3	GT:GQ:XR:XG:XA	0/1:245:4,5:3,4,5:5	0/1:245:6,7:6,7,8:7
+1	3000002	id3	C	A	59.2	PASS	AN=4;AC=2;TR=1,2;TA=1;TG=1,2,3	GT:GQ:XR:XG:XA	0/1:245:.	0/1:245:1,2:1,2,3:2
+1	3000002	id2	C	A	59.2	PASS	AN=4;AC=2;TR=1,2;TA=1;TG=1,2,3	GT:GQ:XR:XG:XA	0/1:245:.	0/1:245:.:.:.
+1	3000002	.	C	A	59.2	PASS	AN=4;AC=2	GT:GQ	0/1:245	0/1:245
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/merge.a.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,36 @@
+##fileformat=VCFv4.1
+##INFO=<ID=TEST,Number=1,Type=Integer,Description="Testing Tag">
+##FORMAT=<ID=TT,Number=A,Type=Integer,Description="Testing Tag, with commas and \"escapes\" and escaped escapes combined with \\\"quotes\\\\\"">
+##INFO=<ID=DP4,Number=4,Type=Integer,Description="# high-quality ref-forward bases, ref-reverse, alt-forward and alt-reverse bases">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood">
+##FILTER=<ID=q10,Description="Quality below 10">
+##FILTER=<ID=test,Description="Testing filter">
+##contig=<ID=1,assembly=b37,length=249250621>
+##contig=<ID=2,assembly=b37,length=249250621>
+##contig=<ID=3,assembly=b37,length=198022430>
+##contig=<ID=4,assembly=b37,length=191154276>
+##reference=file:///lustre/scratch105/projects/g1k/ref/main_project/human_g1k_v37.fasta
+##readme=AAAAAA
+##readme=BBBBBB
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+##INFO=<ID=INDEL,Number=0,Type=Flag,Description="Indicates that the variant is an INDEL.">
+##INFO=<ID=STR,Number=1,Type=String,Description="Test string type">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
+1	3000150	.	C	T	59.2	PASS	AN=4;AC=2	GT:GQ	0/1:245	0/1:245
+1	3000151	.	C	T	59.2	PASS	AN=4;AC=2	GT:DP:GQ	0/1:32:245	0/1:32:245
+1	3062915	id3D	GTTT	G	12.9	q10	DP4=1,2,3,4;AN=4;AC=2;INDEL;STR=test	GT:GQ:DP:GL	0/1:409:35:-20,-5,-20	0/1:409:35:-20,-5,-20
+1	3062915	idSNP	G	T,C	12.6	test	TEST=5;DP4=1,2,3,4;AN=3;AC=1,1	GT:TT:GQ:DP:GL	0/1:0,1:409:35:-20,-5,-20,-20,-5,-20	2:0,1:409:35:-20,-5,-20
+1	3106154	.	CAAA	C	342	PASS	AN=4;AC=2	GT:GQ:DP	0/1:245:32	0/1:245:32
+1	3106154	.	C	CT	59.2	PASS	AN=4;AC=2	GT:GQ:DP	0/1:245:32	0/1:245:32
+1	3157410	.	GA	G	90.6	q10	AN=4;AC=4	GT:GQ:DP	1/1:21:21	1/1:21:21
+1	3162006	.	GAA	G	60.2	PASS	AN=4;AC=2	GT:GQ:DP	0/1:212:22	0/1:212:22
+1	3177144	.	G	T	45	PASS	AN=4;AC=2	GT:GQ:DP	0/0:150:30	1/1:150:30
+1	3177144	.	G	.	45	PASS	AN=4;AC=0	GT:GQ:DP	0/0:150:30	0/0:150:30
+1	3184885	.	TAAAA	TA,T	61.5	PASS	AN=4;AC=2,2	GT:GQ:DP	1/2:12:10	1/2:12:10
+2	3199812	.	G	GTT,GT	82.7	PASS	AN=4;AC=2,2	GT:GQ:DP	1/2:322:26	1/2:322:26
+3	3212016	.	CTT	C,CT	79	PASS	AN=4;AC=2,2	GT:GQ:DP	1/2:91:26	1/2:91:26
+4	3258448	.	TACACACAC	T	.	PASS	AN=4;AC=2	GT:GQ:DP	0/1:325:31	0/1:325:31
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/merge.b.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,42 @@
+##fileformat=VCFv4.1
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
+##INFO=<ID=DP4,Number=4,Type=Integer,Description="# high-quality ref-forward bases, ref-reverse, alt-forward and alt-reverse bases">
+##INFO=<ID=STR,Number=1,Type=String,Description="Testing string and Number=A in INFO">
+##INFO=<ID=TXT,Number=.,Type=String,Description="Testing in INFO">
+##INFO=<ID=XRF,Number=R,Type=Float,Description="Test Number=AGR in INFO">
+##INFO=<ID=XAF,Number=A,Type=Float,Description="Test Number=AGR in INFO">
+##INFO=<ID=XGF,Number=G,Type=Float,Description="Test Number=AGR in INFO">
+##INFO=<ID=XRI,Number=R,Type=Integer,Description="Test Number=AGR in INFO">
+##INFO=<ID=XAI,Number=A,Type=Integer,Description="Test Number=AGR in INFO">
+##INFO=<ID=XGI,Number=G,Type=Integer,Description="Test Number=AGR in INFO">
+##INFO=<ID=XRS,Number=R,Type=String,Description="Test Number=AGR in INFO">
+##INFO=<ID=XAS,Number=A,Type=String,Description="Test Number=AGR in INFO">
+##INFO=<ID=XGS,Number=G,Type=String,Description="Test Number=AGR in INFO">
+##SAMPLE=<ID=NORMAL,SampleName=B,Description="Less-than (\"<\") and greater-than (\">\") quoting nonsense where double brackets would do just fine",softwareName=<Nonsense,Software>,softwareVer=<119,65>,softwareParam=<.>,MetadataResource=http://somewhere.com/path>
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood">
+##FORMAT=<ID=STR,Number=1,Type=String,Description="Testing string in format">
+##FILTER=<ID=q20,Description="Mapping quality below 20">
+##contig=<ID=1,assembly=b37,length=249250621>
+##contig=<ID=2,assembly=b37,length=243199373>
+##contig=<ID=3,assembly=b37,length=198022430>
+##contig=<ID=4,assembly=b37,length=191154276>
+##reference=file:///lustre/scratch105/projects/g1k/ref/main_project/human_g1k_v37.fasta
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	B
+1	3062915	idSNP	G	A	24.6	q20	DP=14;DP4=1,2,3,4;AN=2;STR=.;AC=1	GT:GQ:DP:STR:GL	0/1:376:14:ABC:-10,0,-10
+1	3062915	id1D	GTT	GT	101	q20	DP=14;DP4=1,2,3,4;AN=2;AC=1	GT:GQ:DP:GL:STR	0/1:376:14:-10,0,-10:DEF
+1	3062915	id3D	GTTT	G	84.6	q20	TXT=AA;DP=14;DP4=1,2,3,4;AN=2;AC=1	GT:GQ:DP:GL	0/1:376:14:-10,0,-10
+1	3106154	.	C	T	999	PASS	DP=15;AN=2;AC=1	GT:GQ:DP:GL	0/1:277:15:-10,0,-10
+1	3106154	.	CAAAA	C	15.4	PASS	DP=15;AN=2;AC=1	GT:GQ:DP:GL	0/1:277:15:-10,0,-10
+1	3157410	.	GAC	G	36.8	PASS	DP=11;AN=2;AC=1	GT:GQ:DP	0/1:49:11
+1	3162006	.	GAA	G	238	PASS	DP=19;AN=2;AC=1;XRF=1e6,2e6;XRI=1111,2222;XRS=AAA,BBB;XAF=1e6;XAI=1111;XAS=AAA;XGF=1e6,2e6,3e6;XGI=1111,2222,3333;XGS=A,B,C	GT:GQ:DP	0/1:589:19
+1	3177144	.	G	T	999	PASS	DP=24;AN=2;AC=1	GT:GQ:DP	0/1:236:24
+1	3177144	.	GT	G	999	PASS	DP=24;AN=2;AC=1	GT:GQ:DP	0/1:236:24
+1	3184885	.	TAAA	T	25.8	PASS	DP=16;AN=2;AC=1	GT:GQ:DP	0/1:435:16
+2	3188209	.	GA	G	41.5	.	DP=15;AN=2;AC=1	GT:GQ:DP	0/1:162:15
+3	3199812	.	GA	GTT,GT	17.5	PASS	DP=19;AN=2;AC=1,1	GT:GQ:DP	1/2:188:19
+4	3212016	.	CTT	C	999	q20	DP=15;AN=2;AC=1	GT:GQ:DP	0/1:158:15
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/merge.c.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,43 @@
+##fileformat=VCFv4.1
+##INFO=<ID=TEST,Number=1,Type=Integer,Description="Testing Tag">
+##INFO=<ID=TXT,Number=.,Type=String,Description="Testing in INFO">
+##FORMAT=<ID=TT,Number=A,Type=Integer,Description="Testing Tag, with commas and \"escapes\" and escaped escapes combined with \\\"quotes\\\\\"">
+##INFO=<ID=DP4,Number=4,Type=Integer,Description="# high-quality ref-forward bases, ref-reverse, alt-forward and alt-reverse bases">
+##INFO=<ID=INTA,Number=A,Type=Integer,Description="Testing Number=A in INFO">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood">
+##FILTER=<ID=q10,Description="Quality below 10">
+##FILTER=<ID=test,Description="Testing filter">
+##INFO=<ID=XRF,Number=R,Type=Float,Description="Test Number=AGR in INFO">
+##INFO=<ID=XAF,Number=A,Type=Float,Description="Test Number=AGR in INFO">
+##INFO=<ID=XGF,Number=G,Type=Float,Description="Test Number=AGR in INFO">
+##INFO=<ID=XRI,Number=R,Type=Integer,Description="Test Number=AGR in INFO">
+##INFO=<ID=XAI,Number=A,Type=Integer,Description="Test Number=AGR in INFO">
+##INFO=<ID=XGI,Number=G,Type=Integer,Description="Test Number=AGR in INFO">
+##INFO=<ID=XRS,Number=R,Type=String,Description="Test Number=AGR in INFO">
+##INFO=<ID=XAS,Number=A,Type=String,Description="Test Number=AGR in INFO">
+##INFO=<ID=XGS,Number=G,Type=String,Description="Test Number=AGR in INFO">
+##contig=<ID=1,assembly=b37,length=249250621>
+##contig=<ID=3,assembly=b37,length=198022430>
+##contig=<ID=4,assembly=b37,length=191154276>
+##reference=file:///lustre/scratch105/projects/g1k/ref/main_project/human_g1k_v37.fasta
+##readme=AAAAAA
+##readme=BBBBBB
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Allele count in genotypes">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	C	D
+1	3062915	id3D	GTTT	G	48.7	q10	TXT=BB;DP=999;DP4=4,3,2,1;AN=4;AC=2	GT:GQ:DP:GL	0/1:409:35:-20,-5,-20	0/1:409:35:-20,-5,-20
+1	3062915	idSNP	G	C,T	419	test	TEST=5;DP4=1,2,3,4;AN=4;AC=1,1;INTA=1,2	GT:TT:GQ:DP:GL	0/1:0,1:409:35:-20,-5,-20,-20,-5,-20	0/2:0,1:409:35:-20,-5,-20,-20,-5,-20
+1	3062915	id2D	GTT	G	999	q10	DP4=1,2,3,4;AN=4;AC=2	GT:GQ:DP:GL	0/1:409:35:-20,-5,-20	0/1:409:35:-20,-5,-20
+1	3106154	.	CAAA	C	72.6	PASS	AN=0;AC=0	GT:GQ:DP	.:245:32	./.:245:32
+1	3106154	.	C	CT	459	PASS	AN=4;AC=2	GT:GQ:DP	0/1:245:32	0/1:245:32
+1	3157410	.	G	T	46.7	q10	AN=4;AC=4	GT:GQ:DP	1/1:21:21	1/1:21:21
+1	3162006	.	GAA	GA	206	PASS	AN=4;AC=2;XRF=1e6,5e5;XRI=1111,5555;XRS=AAA,DDD;XAF=5e5;XAI=5555;XAS=DDD;XGF=1e6,5e5,9e9;XGI=1111,5555,9999;XGS=A,E,F	GT:GQ:DP	0/1:212:22	0/1:212:22
+1	3177144	.	G	.	364	PASS	AN=4;AC=0	GT:GQ:DP	0/0:150:30	0/0:150:30
+1	3184885	.	TAAAA	TA,T	8.42	PASS	AN=4;AC=2,2	GT:GQ:DP	1/2:12:10	1/2:12:10
+2	3199812	.	G	GTT,GT	291	PASS	AN=4;AC=2,2	GT:GQ:DP	1/2:322:26	1/2:322:26
+3	3212016	.	CTT	C,CT	52.5	PASS	AN=4;AC=2,2	GT:GQ:DP	1/2:91:26	1/2:91:26
+4	3258448	.	TACACACAC	T	.	PASS	AN=4;AC=2	GT:GQ:DP	0/1:325:31	0/1:325:31
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/mpileup.X.vcf	Wed Jul 06 07:06:43 2016 -0400
@@ -0,0 +1,4127 @@
+##fileformat=VCFv4.2
+##FILTER=<ID=PASS,Description="All filters passed">
+##samtoolsVersion=1.1-19-g6b249e2+htslib-1.1-74-g845c515
+##samtoolsCommand=samtools mpileup -uvDV -b xxx//mpileup.bam.list -f xxx//mpileup.ref.fa.gz
+##reference=file://xxx//mpileup.ref.fa.gz
+##contig=<ID=X,length=81195210>
+##ALT=<ID=X,Description="Represents allele(s) other than observed.">
+##INFO=<ID=INDEL,Number=0,Type=Flag,Description="Indicates that the variant is an INDEL.">
+##INFO=<ID=IDV,Number=1,Type=Integer,Description="Maximum number of reads supporting an indel">
+##INFO=<ID=IMF,Number=1,Type=Float,Description="Maximum fraction of reads supporting an indel">
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Raw read depth">
+##INFO=<ID=VDB,Number=1,Type=Float,Description="Variant Distance Bias for filtering splice-site artefacts in RNA-seq data (bigger is better)",Version="3">
+##INFO=<ID=RPB,Number=1,Type=Float,Description="Mann-Whitney U test of Read Position Bias (bigger is better)">
+##INFO=<ID=MQB,Number=1,Type=Float,Description="Mann-Whitney U test of Mapping Quality Bias (bigger is better)">
+##INFO=<ID=BQB,Number=1,Type=Float,Description="Mann-Whitney U test of Base Quality Bias (bigger is better)">
+##INFO=<ID=MQSB,Number=1,Type=Float,Description="Mann-Whitney U test of Mapping Quality vs Strand Bias (bigger is better)">
+##INFO=<ID=SGB,Number=1,Type=Float,Description="Segregation based metric.">
+##INFO=<ID=MQ0F,Number=1,Type=Float,Description="Fraction of MQ0 reads (smaller is better)">
+##INFO=<ID=I16,Number=16,Type=Float,Description="Auxiliary tag used for calling, see description of bcf_callret1_t in bam2bcf.h">
+##INFO=<ID=QS,Number=R,Type=Float,Description="Auxiliary tag used for calling">
+##FORMAT=<ID=PL,Number=G,Type=Integer,Description="List of Phred-scaled genotype likelihoods">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Number of high-quality bases">
+##FORMAT=<ID=DV,Number=1,Type=Integer,Description="Number of high-quality non-reference bases">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	HG00100	HG00101	HG00102
+X	1	.	A	<*>	0	.	DP=11;I16=11,0,0,0,452,18594,0,0,319,9251,0,0,223,4959,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
+X	2	.	A	<*>	0	.	DP=11;I16=11,0,0,0,439,17587,0,0,319,9251,0,0,226,5030,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
+X	3	.	G	<*>	0	.	DP=11;I16=11,0,0,0,431,16971,0,0,319,9251,0,0,229,5111,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
+X	4	.	C	<*>	0	.	DP=11;I16=11,0,0,0,423,16417,0,0,319,9251,0,0,232,5202,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,71:3:0
+X	5	.	T	<*>	0	.	DP=11;I16=11,0,0,0,450,18520,0,0,319,9251,0,0,234,5252,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
+X	6	.	T	<*>	0	.	DP=11;I16=11,0,0,0,403,14847,0,0,319,9251,0,0,236,5310,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
+X	7	.	C	<*>	0	.	DP=11;I16=11,0,0,0,446,18114,0,0,319,9251,0,0,237,5327,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
+X	8	.	T	<*>	0	.	DP=11;I16=11,0,0,0,465,19677,0,0,319,9251,0,0,238,5354,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
+X	9	.	C	<*>	0	.	DP=11;I16=11,0,0,0,447,18205,0,0,319,9251,0,0,239,5391,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
+X	10	.	A	<*>	0	.	DP=11;I16=11,0,0,0,426,16756,0,0,319,9251,0,0,240,5438,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,69:3:0
+X	11	.	C	<*>	0	.	DP=11;I16=11,0,0,0,413,15603,0,0,319,9251,0,0,241,5495,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
+X	12	.	C	<*>	0	.	DP=11;I16=11,0,0,0,438,17506,0,0,319,9251,0,0,242,5562,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
+X	13	.	C	<*>	0	.	DP=11;I16=11,0,0,0,437,17463,0,0,319,9251,0,0,243,5639,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
+X	14	.	T	<*>	0	.	DP=11;I16=11,0,0,0,453,18715,0,0,319,9251,0,0,242,5628,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
+X	15	.	G	<*>	0	.	DP=11;I16=11,0,0,0,439,17599,0,0,319,9251,0,0,240,5580,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
+X	16	.	T	<*>	0	.	DP=11;I16=11,0,0,0,426,16546,0,0,319,9251,0,0,238,5544,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
+X	17	.	T	<*>	0	.	DP=11;I16=11,0,0,0,407,15195,0,0,319,9251,0,0,235,5469,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
+X	18	.	C	<*>	0	.	DP=12;I16=12,0,0,0,450,17136,0,0,379,12851,0,0,231,5353,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,18,113:6:0	0,9,72:3:0	0,9,72:3:0
+X	19	.	C	<*>	0	.	DP=13;I16=13,0,0,0,502,19652,0,0,439,16451,0,0,228,5246,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,18,112:6:0	0,12,89:4:0	0,9,72:3:0
+X	20	.	T	<*>	0	.	DP=13;I16=13,0,0,0,532,21878,0,0,439,16451,0,0,226,5150,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,18,116:6:0	0,12,98:4:0	0,9,72:3:0
+X	21	.	G	<*>	0	.	DP=13;I16=13,0,0,0,498,19254,0,0,439,16451,0,0,224,5066,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,18,117:6:0	0,12,94:4:0	0,9,72:3:0
+X	22	.	C	<*>	0	.	DP=13;I16=13,0,0,0,511,20289,0,0,470,19210,0,0,223,4993,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,18,115:6:0	0,12,91:4:0	0,9,76:3:0
+X	23	.	A	<*>	0	.	DP=14;I16=14,0,0,0,513,19399,0,0,530,22810,0,0,223,4931,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,133:7:0	0,12,82:4:0	0,9,82:3:0
+X	24	.	T	<*>	0	.	DP=14;I16=14,0,0,0,534,20540,0,0,530,22810,0,0,224,4882,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,131:7:0	0,12,96:4:0	0,9,80:3:0
+X	25	.	A	<*>	0	.	DP=15;I16=15,0,0,0,561,21133,0,0,590,26410,0,0,225,4847,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,140:8:0	0,12,96:4:0	0,9,81:3:0
+X	26	.	G	<*>	0	.	DP=15;I16=15,0,0,0,591,23429,0,0,590,26410,0,0,227,4827,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,151:8:0	0,12,96:4:0	0,9,81:3:0
+X	27	.	A	<*>	0	.	DP=15;I16=15,0,0,0,588,23120,0,0,590,26410,0,0,229,4823,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,146:8:0	0,12,98:4:0	0,9,83:3:0
+X	28	.	T	<*>	0	.	DP=16;I16=16,0,0,0,605,23001,0,0,650,30010,0,0,231,4835,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,147:8:0	0,12,97:4:0	0,12,101:4:0
+X	29	.	A	<*>	0	.	DP=17;I16=17,0,0,0,615,22533,0,0,710,33610,0,0,234,4864,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,146:8:0	0,15,102:5:0	0,12,104:4:0
+X	30	.	A	<*>	0	.	DP=17;I16=17,0,0,0,660,25914,0,0,710,33610,0,0,238,4912,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,149:8:0	0,15,115:5:0	0,12,108:4:0
+X	31	.	T	<*>	0	.	DP=17;I16=17,0,0,0,656,25392,0,0,710,33610,0,0,242,4980,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,150:8:0	0,15,113:5:0	0,12,105:4:0
+X	32	.	T	<*>	0	.	DP=17;I16=17,0,0,0,605,21789,0,0,741,36369,0,0,247,5067,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,143:8:0	0,15,104:5:0	0,12,104:4:0
+X	33	.	G	<*>	0	.	DP=17;I16=17,0,0,0,659,25757,0,0,741,36369,0,0,252,5124,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,158:8:0	0,15,118:5:0	0,12,105:4:0
+X	34	.	C	<*>	0	.	DP=17;I16=17,0,0,0,658,25704,0,0,741,36369,0,0,257,5203,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,151:8:0	0,15,121:5:0	0,12,106:4:0
+X	35	.	A	<*>	0	.	DP=18;I16=18,0,0,0,677,25881,0,0,801,39969,0,0,262,5304,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,152:8:0	0,15,109:5:0	0,15,121:5:0
+X	36	.	T	<*>	0	.	DP=18;I16=18,0,0,0,678,25796,0,0,801,39969,0,0,268,5428,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,151:8:0	0,15,114:5:0	0,15,125:5:0
+X	37	.	G	<*>	0	.	DP=18;I16=18,0,0,0,685,26291,0,0,801,39969,0,0,274,5576,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,157:8:0	0,15,116:5:0	0,15,126:5:0
+X	38	.	A	<*>	0	.	DP=18;I16=18,0,0,0,697,27245,0,0,801,39969,0,0,280,5748,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,152:8:0	0,15,116:5:0	0,15,129:5:0
+X	39	.	C	<*>	0	.	DP=16;I16=16,0,0,0,591,22311,0,0,743,38287,0,0,288,5942,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,148:7:0	0,12,94:4:0	0,15,123:5:0
+X	40	.	A	<*>	0	.	DP=16;I16=16,0,0,0,630,24896,0,0,743,38287,0,0,295,6107,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,146:7:0	0,12,104:4:0	0,15,127:5:0
+X	41	.	A	<*>	0	.	DP=17;I16=17,0,0,0,645,24685,0,0,803,41887,0,0,302,6294,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,151:8:0	0,12,104:4:0	0,15,131:5:0
+X	42	.	T	<*>	0	.	DP=17;I16=17,0,0,0,618,23118,0,0,803,41887,0,0,310,6504,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,155:8:0	0,12,82:4:0	0,15,127:5:0
+X	43	.	T	<*>	0	.	DP=17;I16=17,0,0,0,631,23689,0,0,803,41887,0,0,318,6738,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,151:8:0	0,12,101:4:0	0,15,129:5:0
+X	44	.	G	<*>	0	.	DP=17;I16=17,0,0,0,664,26162,0,0,803,41887,0,0,324,6896,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,164:8:0	0,12,100:4:0	0,15,129:5:0
+X	45	.	C	<*>	0	.	DP=17;I16=17,0,0,0,657,25525,0,0,803,41887,0,0,329,7027,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,163:8:0	0,12,108:4:0	0,15,125:5:0
+X	46	.	C	<*>	0	.	DP=17;I16=17,0,0,0,646,25244,0,0,803,41887,0,0,334,7180,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,161:8:0	0,12,98:4:0	0,15,131:5:0
+X	47	.	T	<*>	0	.	DP=17;I16=17,0,0,0,700,28998,0,0,803,41887,0,0,339,7355,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,165:8:0	0,12,110:4:0	0,15,136:5:0
+X	48	.	T	<*>	0	.	DP=17;I16=17,0,0,0,648,25020,0,0,803,41887,0,0,343,7501,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,155:8:0	0,12,105:4:0	0,15,131:5:0
+X	49	.	G	<*>	0	.	DP=18;I16=18,0,0,0,686,26674,0,0,832,42728,0,0,346,7616,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,158:8:0	0,15,119:5:0	0,15,128:5:0
+X	50	.	T	<*>	0	.	DP=18;I16=17,0,0,0,650,24972,0,0,772,39128,0,0,332,7426,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,155:8:0	0,12,101:4:0	0,15,128:5:0
+X	51	.	C	<*>	0	.	DP=18;I16=18,0,0,0,681,26529,0,0,832,42728,0,0,353,7853,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,167:8:0	0,15,99:5:0	0,15,127:5:0
+X	52	.	C	<*>	0	.	DP=18;I16=17,0,0,0,645,24983,0,0,803,41887,0,0,353,7965,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,164:8:0	0,12,99:4:0	0,15,128:5:0
+X	53	.	C	<*>	0	.	DP=18;I16=18,0,0,0,687,26735,0,0,832,42728,0,0,359,8113,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,164:8:0	0,15,113:5:0	0,15,132:5:0
+X	54	.	T	<*>	0	.	DP=18;I16=18,0,0,0,736,30194,0,0,832,42728,0,0,361,8219,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,163:8:0	0,15,128:5:0	0,15,136:5:0
+X	55	.	G	<*>	0	.	DP=18;I16=18,0,0,0,674,26082,0,0,832,42728,0,0,362,8290,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,168:8:0	0,15,112:5:0	0,15,122:5:0
+X	56	.	C	<*>	0	.	DP=18;I16=18,0,0,0,701,27645,0,0,832,42728,0,0,363,8375,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,162:8:0	0,15,121:5:0	0,15,131:5:0
+X	57	.	T	<*>	0	.	DP=18;I16=17,0,0,0,694,29118,0,0,803,41887,0,0,356,8410,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,163:8:0	0,12,117:4:0	0,15,138:5:0
+X	58	.	G	<*>	0	.	DP=17;I16=16,0,0,0,616,24356,0,0,774,41046,0,0,356,8454,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,159:7:0	0,12,95:4:0	0,15,131:5:0
+X	59	.	A	<*>	0	.	DP=17;I16=17,0,0,0,656,26038,0,0,803,41887,0,0,366,8606,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,155:7:0	0,15,116:5:0	0,15,134:5:0
+X	60	.	A	<*>	0	.	DP=17;I16=17,0,0,0,663,26463,0,0,803,41887,0,0,367,8687,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,151:7:0	0,15,127:5:0	0,15,138:5:0
+X	61	.	T	<*>	0	.	DP=17;I16=16,0,0,0,605,23215,0,0,774,41046,0,0,355,8583,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,152:7:0	0,12,101:4:0	0,15,131:5:0
+X	62	.	G	<*>	0	.	DP=18;I16=17,0,0,0,646,24868,0,0,834,44646,0,0,353,8557,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,158:7:0	0,12,103:4:0	0,18,141:6:0
+X	63	.	T	<*>	0	.	DP=18;I16=17,0,0,0,590,21682,0,0,803,41887,0,0,341,8111,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,148:7:0	0,12,80:4:0	0,18,144:6:0
+X	64	.	G	<*>	0	.	DP=19;I16=19,0,0,0,696,26416,0,0,923,49087,0,0,366,8758,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,169:8:0	0,15,103:5:0	0,18,142:6:0
+X	65	.	C	<*>	0	.	DP=18;I16=18,0,0,0,686,26512,0,0,894,48246,0,0,367,8743,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,163:7:0	0,15,116:5:0	0,18,147:6:0
+X	66	.	T	<*>	0	.	DP=18;I16=17,0,0,0,691,28315,0,0,834,44646,0,0,342,8068,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,164:7:0	0,12,110:4:0	0,18,153:6:0
+X	67	.	C	<*>	0	.	DP=17;I16=17,0,0,0,645,25313,0,0,834,44646,0,0,341,7983,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,163:7:0	0,12,94:4:0	0,18,147:6:0
+X	68	.	T	<*>	0	.	DP=17;I16=17,0,0,0,691,28307,0,0,834,44646,0,0,339,7863,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,165:7:0	0,12,108:4:0	0,18,151:6:0
+X	69	.	G	<*>	0	.	DP=17;I16=17,0,0,0,657,25721,0,0,865,47405,0,0,338,7758,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,172:8:0	0,9,93:3:0	0,18,142:6:0
+X	70	.	G	<*>	0	.	DP=17;I16=16,0,0,0,575,21391,0,0,836,46564,0,0,317,7227,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,162:8:0	0,6,64:2:0	0,18,141:6:0
+X	71	.	G	<*>	0	.	DP=17;I16=15,0,0,0,571,21975,0,0,776,42964,0,0,307,7029,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,170:8:0	0,6,72:2:0	0,15,130:5:0
+X	72	.	G	<*>	0	.	DP=17;I16=15,0,0,0,572,22002,0,0,776,42964,0,0,305,6907,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,171:8:0	0,6,65:2:0	0,15,131:5:0
+X	73	.	T	<*>	0	.	DP=18;I16=16,0,0,0,623,25301,0,0,836,46564,0,0,314,6918,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,158:8:0	0,6,94:2:0	0,18,143:6:0
+X	74	.	C	<*>	0	.	DP=18;I16=17,0,0,0,674,28110,0,0,865,47405,0,0,338,7468,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,176:8:0	0,9,106:3:0	0,18,141:6:0
+X	75	.	T	<*>	0	.	DP=18;I16=16,0,0,0,685,30675,0,0,836,46564,0,0,312,6782,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,175:8:0	0,6,90:2:0	0,18,150:6:0
+X	76	.	C	<*>	0	.	DP=18;I16=17,0,0,0,683,29481,0,0,865,47405,0,0,336,7360,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,174:8:0	0,9,98:3:0	0,18,148:6:0
+X	77	.	T	<*>	0	.	DP=18;I16=16,0,0,0,710,33072,0,0,836,46564,0,0,310,6702,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,179:8:0	0,6,92:2:0	0,18,154:6:0
+X	78	.	G	<*>	0	.	DP=18;I16=16,0,0,0,692,31158,0,0,836,46564,0,0,309,6683,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,180:8:0	0,6,94:2:0	0,18,149:6:0
+X	79	.	G	<*>	0	.	DP=18;I16=15,0,0,0,605,26629,0,0,776,42964,0,0,283,6053,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,168:8:0	0,3,60:1:0	0,18,149:6:0
+X	80	.	G	<*>	0	.	DP=18;I16=17,0,0,0,688,30128,0,0,865,47405,0,0,332,7312,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,173:8:0	0,9,106:3:0	0,18,151:6:0
+X	81	.	G	<*>	0	.	DP=18;I16=16,0,0,0,631,27429,0,0,836,46564,0,0,326,7310,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,165:7:0	0,9,97:3:0	0,18,145:6:0
+X	82	.	T	<*>	0	.	DP=18;I16=15,0,0,0,559,22735,0,0,776,42964,0,0,280,6122,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,154:8:0	0,3,60:1:0	0,18,131:6:0
+X	83	.	C	<*>	0	.	DP=18;I16=16,0,0,0,622,27146,0,0,836,46564,0,0,304,6798,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,170:8:0	0,6,75:2:0	0,18,145:6:0
+X	84	.	T	<*>	0	.	DP=18;I16=17,0,0,0,705,32445,0,0,865,47405,0,0,328,7488,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,181:8:0	0,9,85:3:0	0,18,154:6:0
+X	85	.	C	<*>	0	.	DP=18;I16=17,0,0,0,708,31222,0,0,865,47405,0,0,327,7567,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,181:8:0	0,9,108:3:0	0,18,153:6:0
+X	86	.	A	<*>	0	.	DP=18;I16=17,0,0,0,692,29540,0,0,865,47405,0,0,326,7660,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,169:8:0	0,9,111:3:0	0,18,149:6:0
+X	87	.	C	<*>	0	.	DP=18;I16=17,0,0,0,683,29493,0,0,896,50164,0,0,326,7766,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,174:8:0	0,9,103:3:0	0,18,148:6:0
+X	88	.	C	<*>	0	.	DP=18;I16=17,0,0,0,703,31005,0,0,896,50164,0,0,326,7834,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,174:8:0	0,9,113:3:0	0,18,153:6:0
+X	89	.	C	<*>	0	.	DP=18;I16=17,0,0,0,697,30875,0,0,896,50164,0,0,326,7914,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,176:8:0	0,9,103:3:0	0,18,154:6:0
+X	90	.	A	<*>	0	.	DP=17;I16=16,0,0,0,668,29732,0,0,867,49323,0,0,326,7954,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,173:8:0	0,9,114:3:0	0,15,138:5:0
+X	91	.	C	<*>	0	.	DP=16;I16=15,0,0,0,613,26409,0,0,838,48482,0,0,327,8001,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,170:7:0	0,9,113:3:0	0,15,133:5:0
+X	92	.	G	<*>	0	.	DP=16;I16=15,0,0,0,499,18731,0,0,838,48482,0,0,328,8054,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,143:7:0	0,9,100:3:0	0,15,96:5:0
+X	93	.	A	<*>	0	.	DP=16;I16=15,0,0,0,635,28655,0,0,869,51241,0,0,329,8063,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,167:7:0	0,9,108:3:0	0,15,145:5:0
+X	94	.	C	<*>	0	.	DP=16;I16=15,0,0,0,607,25893,0,0,869,51241,0,0,331,8079,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,166:7:0	0,9,105:3:0	0,15,135:5:0
+X	95	.	C	<*>	0	.	DP=17;I16=15,0,0,0,615,26761,0,0,900,54000,0,0,306,7378,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,178:8:0	0,6,91:2:0	0,15,135:5:0
+X	96	.	A	<*>	0	.	DP=17;I16=16,0,0,0,625,26705,0,0,929,54841,0,0,332,7936,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,172:8:0	0,9,99:3:0	0,15,134:5:0
+X	97	.	A	<*>	0	.	DP=18;I16=17,0,0,0,675,29017,0,0,958,55682,0,0,333,7879,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,179:9:0	0,9,104:3:0	0,15,145:5:0
+X	98	.	C	<*>	0	.	DP=18;I16=17,0,0,0,655,27231,0,0,958,55682,0,0,333,7735,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,179:9:0	0,9,105:3:0	0,15,131:5:0
+X	99	.	T	<*>	0	.	DP=18;I16=17,0,0,0,720,32840,0,0,958,55682,0,0,333,7607,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,186:9:0	0,9,115:3:0	0,15,153:5:0
+X	100	.	C	<*>	0	.	DP=18;I16=17,0,0,0,688,29762,0,0,958,55682,0,0,332,7446,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,189:9:0	0,9,108:3:0	0,15,134:5:0
+X	101	.	C	<*>	0	.	DP=18;I16=17,0,0,0,650,27530,0,0,958,55682,0,0,331,7303,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,182:9:0	0,9,99:3:0	0,15,132:5:0
+X	102	.	C	<*>	0	.	DP=18;I16=17,0,0,0,695,30453,0,0,958,55682,0,0,330,7178,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,188:9:0	0,9,111:3:0	0,15,139:5:0
+X	103	.	T	<*>	0	.	DP=18;I16=16,0,0,0,692,31998,0,0,929,54841,0,0,323,7035,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,189:8:0	0,9,108:3:0	0,15,147:5:0
+X	104	.	G	<*>	0	.	DP=18;I16=15,0,0,0,611,26723,0,0,900,54000,0,0,295,6259,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,178:8:0	0,6,89:2:0	0,15,133:5:0
+X	105	.	G	<*>	0	.	DP=19;I16=17,0,0,0,604,23936,0,0,989,58441,0,0,317,6751,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,170:9:0	0,9,97:3:0	0,15,125:5:0
+X	106	.	G	<*>	0	.	DP=19;I16=17,0,0,0,644,26574,0,0,989,58441,0,0,299,6093,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,30,190:10:0	0,6,85:2:0	0,15,124:5:0
+X	107	.	C	<*>	0	.	DP=19;I16=17,0,0,0,694,30064,0,0,989,58441,0,0,313,6543,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,192:9:0	0,9,108:3:0	0,15,136:5:0
+X	108	.	C	<*>	0	.	DP=19;I16=17,0,0,0,692,30148,0,0,989,58441,0,0,310,6420,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,190:9:0	0,9,108:3:0	0,15,135:5:0
+X	109	.	T	<*>	0	.	DP=19;I16=17,0,0,0,741,34273,0,0,989,58441,0,0,307,6319,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,195:9:0	0,9,110:3:0	0,15,150:5:0
+X	110	.	G	<*>	0	.	DP=19;I16=17,0,0,0,704,31276,0,0,989,58441,0,0,304,6240,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,194:9:0	0,9,104:3:0	0,15,136:5:0
+X	111	.	G	<*>	0	.	DP=19;I16=16,0,0,0,584,24362,0,0,929,54841,0,0,272,5416,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,30,167:10:0	0,6,88:2:0	0,12,118:4:0
+X	112	.	C	<*>	0	.	DP=19;I16=17,0,0,0,680,29854,0,0,989,58441,0,0,296,6052,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,191:9:0	0,9,95:3:0	0,15,135:5:0
+X	113	.	A	<*>	0	.	DP=19;I16=16,0,0,0,645,28035,0,0,960,57600,0,0,266,5318,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,176:9:0	0,6,87:2:0	0,15,139:5:0
+X	114	.	C	<*>	0	.	DP=19;I16=17,0,0,0,674,28788,0,0,989,58441,0,0,286,5856,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,182:9:0	0,9,103:3:0	0,15,133:5:0
+X	115	.	C	<*>	0	.	DP=21;I16=18,0,0,0,708,30546,0,0,1049,62041,0,0,274,5490,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,30,189:10:0	0,6,89:2:0	0,18,147:6:0
+X	116	.	A	<*>	0	.	DP=21;I16=17,1,0,0,727,31755,0,0,1049,62041,0,0,253,5079,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,183:9:0	0,6,90:2:0	0,21,175:7:0
+X	117	.	G	<*>	0	.	DP=21;I16=17,1,0,0,723,31221,0,0,1049,62041,0,0,249,5019,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,186:9:0	0,6,86:2:0	0,21,177:7:0
+X	118	.	G	<*>	0	.	DP=20;I16=16,1,0,0,636,26574,0,0,958,55682,0,0,266,5426,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,175:9:0	0,3,60:1:0	0,21,162:7:0
+X	119	.	G	<*>	0	.	DP=19;I16=16,1,0,0,629,26439,0,0,958,55682,0,0,267,5553,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,175:8:0	0,6,73:2:0	0,21,160:7:0
+X	120	.	A	<*>	0	.	DP=19;I16=16,1,0,0,672,29188,0,0,958,55682,0,0,264,5518,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,175:8:0	0,6,83:2:0	0,21,171:7:0
+X	121	.	G	<*>	0	.	DP=19;I16=16,1,0,0,662,28460,0,0,958,55682,0,0,260,5454,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,181:8:0	0,6,80:2:0	0,21,168:7:0
+X	122	.	C	<*>	0	.	DP=20;I16=17,1,0,0,716,31224,0,0,1018,59282,0,0,256,5410,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,181:8:0	0,9,99:3:0	0,21,178:7:0
+X	123	.	T	<*>	0	.	DP=18;I16=15,1,0,0,661,29997,0,0,898,52082,0,0,255,5385,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,167:7:0	0,9,112:3:0	0,18,166:6:0
+X	124	.	T	<*>	0	.	DP=19;I16=17,1,0,0,626,24802,0,0,987,56523,0,0,279,6003,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,154:9:0	0,9,104:3:0	0,18,154:6:0
+X	125	.	A	<*>	0	.	DP=18;I16=15,1,0,0,611,25689,0,0,898,52082,0,0,254,5340,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,154:7:0	0,9,104:3:0	0,18,162:6:0
+X	126	.	A	<*>	0	.	DP=18;I16=16,1,0,0,648,27366,0,0,927,52923,0,0,279,5947,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,162:8:0	0,9,107:3:0	0,18,174:6:0
+X	127	.	C	<*>	0	.	DP=18;I16=16,1,0,0,646,26972,0,0,927,52923,0,0,279,5949,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,163:8:0	0,9,109:3:0	0,18,160:6:0
+X	128	.	A	<*>	0	.	DP=18;I16=16,1,0,0,673,28797,0,0,927,52923,0,0,279,5971,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,169:8:0	0,9,111:3:0	0,18,162:6:0
+X	129	.	A	<*>	0	.	DP=17;I16=15,1,0,0,645,27891,0,0,867,49323,0,0,280,6012,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,168:8:0	0,9,113:3:0	0,15,159:5:0
+X	130	.	A	<*>	0	.	DP=17;I16=15,1,0,0,641,27295,0,0,867,49323,0,0,281,6071,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,169:8:0	0,9,113:3:0	0,15,152:5:0
+X	131	.	C	<*>	0	.	DP=16;I16=14,1,0,0,606,25732,0,0,838,48482,0,0,256,5472,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,167:7:0	0,9,110:3:0	0,15,147:5:0
+X	132	.	A	<*>	0	.	DP=16;I16=14,1,0,0,627,27579,0,0,838,48482,0,0,256,5514,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,169:7:0	0,9,110:3:0	0,15,151:5:0
+X	133	.	T	<*>	0	.	DP=15;I16=13,2,0,0,584,22816,0,0,838,48482,0,0,282,6196,0,0;QS=3,0;MQSB=0.576923;MQ0F=0	PL:DP:DV	0,21,163:7:0	0,9,105:3:0	0,15,150:5:0
+X	134	.	C	<*>	0	.	DP=15;I16=13,2,0,0,607,24653,0,0,838,48482,0,0,283,6267,0,0;QS=3,0;MQSB=0.576923;MQ0F=0	PL:DP:DV	0,21,177:7:0	0,9,105:3:0	0,15,152:5:0
+X	135	.	T	<*>	0	.	DP=15;I16=13,2,0,0,600,24178,0,0,838,48482,0,0,284,6352,0,0;QS=3,0;MQSB=0.576923;MQ0F=0	PL:DP:DV	0,21,173:7:0	0,9,106:3:0	0,15,156:5:0
+X	136	.	G	<*>	0	.	DP=15;I16=13,2,0,0,574,22258,0,0,838,48482,0,0,286,6450,0,0;QS=3,0;MQSB=0.576923;MQ0F=0	PL:DP:DV	0,21,172:7:0	0,9,105:3:0	0,15,134:5:0
+X	137	.	T	<*>	0	.	DP=15;I16=13,2,0,0,563,21377,0,0,838,48482,0,0,289,6561,0,0;QS=3,0;MQSB=0.576923;MQ0F=0	PL:DP:DV	0,21,160:7:0	0,9,104:3:0	0,15,139:5:0
+X	138	.	C	<*>	0	.	DP=15;I16=13,2,0,0,584,23088,0,0,838,48482,0,0,291,6637,0,0;QS=3,0;MQSB=0.576923;MQ0F=0	PL:DP:DV	0,21,172:7:0	0,9,108:3:0	0,15,142:5:0
+X	139	.	C	<*>	0	.	DP=15;I16=13,2,0,0,554,20790,0,0,838,48482,0,0,292,6680,0,0;QS=3,0;MQSB=0.576923;MQ0F=0	PL:DP:DV	0,21,161:7:0	0,9,106:3:0	0,15,143:5:0
+X	140	.	A	<*>	0	.	DP=15;I16=13,2,0,0,583,22789,0,0,838,48482,0,0,292,6690,0,0;QS=3,0;MQSB=0.576923;MQ0F=0	PL:DP:DV	0,21,163:7:0	0,9,107:3:0	0,15,153:5:0
+X	141	.	G	<*>	0	.	DP=14;I16=12,2,0,0,534,20750,0,0,778,44882,0,0,292,6664,0,0;QS=3,0;MQSB=0.583333;MQ0F=0	PL:DP:DV	0,18,158:6:0	0,9,108:3:0	0,15,142:5:0
+X	142	.	C	<*>	0	.	DP=14;I16=12,2,0,0,503,18593,0,0,778,44882,0,0,292,6650,0,0;QS=3,0;MQSB=0.583333;MQ0F=0	PL:DP:DV	0,18,157:6:0	0,9,97:3:0	0,15,129:5:0
+X	143	.	G	<*>	0	.	DP=14;I16=11,2,0,0,415,13657,0,0,718,41282,0,0,285,6599,0,0;QS=3,0;MQSB=0.590909;MQ0F=0	PL:DP:DV	0,18,128:6:0	0,9,95:3:0	0,12,97:4:0
+X	144	.	A	<*>	0	.	DP=14;I16=12,2,0,0,519,19725,0,0,778,44882,0,0,291,6609,0,0;QS=3,0;MQSB=0.583333;MQ0F=0	PL:DP:DV	0,18,152:6:0	0,9,105:3:0	0,15,129:5:0
+X	145	.	A	<*>	0	.	DP=14;I16=12,2,0,0,527,20289,0,0,778,44882,0,0,290,6584,0,0;QS=3,0;MQSB=0.583333;MQ0F=0	PL:DP:DV	0,18,153:6:0	0,9,106:3:0	0,15,138:5:0
+X	146	.	T	<*>	0	.	DP=14;I16=12,2,0,0,514,19484,0,0,778,44882,0,0,289,6573,0,0;QS=3,0;MQSB=0.583333;MQ0F=0	PL:DP:DV	0,18,152:6:0	0,9,103:3:0	0,15,128:5:0
+X	147	.	A	<*>	0	.	DP=14;I16=12,2,0,0,515,19213,0,0,778,44882,0,0,288,6576,0,0;QS=3,0;MQSB=0.583333;MQ0F=0	PL:DP:DV	0,18,150:6:0	0,9,99:3:0	0,15,140:5:0
+X	148	.	C	<*>	0	.	DP=14;I16=12,2,0,0,541,21019,0,0,778,44882,0,0,286,6542,0,0;QS=3,0;MQSB=0.583333;MQ0F=0	PL:DP:DV	0,18,157:6:0	0,9,106:3:0	0,15,146:5:0
+X	149	.	C	<*>	0	.	DP=14;I16=12,2,0,0,512,19326,0,0,778,44882,0,0,283,6471,0,0;QS=3,0;MQSB=0.583333;MQ0F=0	PL:DP:DV	0,18,148:6:0	0,9,109:3:0	0,15,140:5:0
+X	150	.	T	<*>	0	.	DP=13;I16=11,2,0,0,511,20251,0,0,749,44041,0,0,280,6362,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,18,153:6:0	0,6,84:2:0	0,15,152:5:0
+X	151	.	G	<*>	0	.	DP=13;I16=11,2,0,0,506,19826,0,0,749,44041,0,0,277,6263,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,18,157:6:0	0,6,84:2:0	0,15,144:5:0
+X	152	.	C	<*>	0	.	DP=14;I16=12,2,0,0,543,21283,0,0,809,47641,0,0,274,6174,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,21,168:7:0	0,6,84:2:0	0,15,146:5:0
+X	153	.	A	<*>	0	.	DP=14;I16=12,2,0,0,536,20594,0,0,809,47641,0,0,272,6096,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,21,156:7:0	0,6,81:2:0	0,15,153:5:0
+X	154	.	T	<*>	0	.	DP=14;I16=12,2,0,0,523,20051,0,0,809,47641,0,0,270,6030,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,21,159:7:0	0,6,83:2:0	0,15,139:5:0
+X	155	.	C	<*>	0	.	DP=14;I16=12,2,0,0,542,21254,0,0,809,47641,0,0,268,5976,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,21,172:7:0	0,6,85:2:0	0,15,139:5:0
+X	156	.	C	<*>	0	.	DP=14;I16=12,2,0,0,536,20884,0,0,809,47641,0,0,266,5934,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,21,163:7:0	0,6,84:2:0	0,15,150:5:0
+X	157	.	C	<*>	0	.	DP=14;I16=12,2,0,0,555,22081,0,0,809,47641,0,0,264,5904,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,21,169:7:0	0,6,85:2:0	0,15,149:5:0
+X	158	.	T	<*>	0	.	DP=14;I16=12,2,0,0,568,23154,0,0,809,47641,0,0,262,5886,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,21,170:7:0	0,6,84:2:0	0,15,159:5:0
+X	159	.	A	<*>	0	.	DP=15;I16=12,2,0,0,519,19467,0,0,809,47641,0,0,260,5880,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,21,157:7:0	0,6,83:2:0	0,15,135:5:0
+X	160	.	G	<*>	0	.	DP=15;I16=13,2,0,0,547,20633,0,0,869,51241,0,0,259,5887,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,21,165:7:0	0,6,85:2:0	0,18,139:6:0
+X	161	.	A	<*>	0	.	DP=15;I16=13,2,0,0,568,21610,0,0,869,51241,0,0,258,5908,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,21,157:7:0	0,6,83:2:0	0,18,162:6:0
+X	162	.	A	<*>	0	.	DP=15;I16=13,2,0,0,557,21139,0,0,869,51241,0,0,255,5843,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,21,147:7:0	0,6,87:2:0	0,18,167:6:0
+X	163	.	G	<*>	0	.	DP=14;I16=12,2,0,0,503,18645,0,0,809,47641,0,0,253,5791,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,21,153:7:0	0,6,79:2:0	0,15,138:5:0
+X	164	.	T	<*>	0	.	DP=14;I16=12,2,0,0,460,15968,0,0,809,47641,0,0,252,5750,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,18,131:6:0	0,6,79:2:0	0,18,136:6:0
+X	165	.	G	<*>	0	.	DP=14;I16=10,2,0,0,456,17460,0,0,689,40441,0,0,226,5094,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,18,149:6:0	0,6,80:2:0	0,12,122:4:0
+X	166	.	A	<*>	0	.	DP=14;I16=11,2,0,0,496,19138,0,0,749,44041,0,0,227,5077,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,18,145:6:0	0,6,82:2:0	0,15,148:5:0
+X	167	.	A	<*>	0	.	DP=14;I16=11,2,0,0,477,17851,0,0,749,44041,0,0,227,5071,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,18,132:6:0	0,6,86:2:0	0,15,147:5:0
+X	168	.	G	<*>	0	.	DP=14;I16=12,2,0,0,481,18015,0,0,809,47641,0,0,252,5702,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,18,145:6:0	0,6,82:2:0	0,18,140:6:0
+X	169	.	C	<*>	0	.	DP=13;I16=10,2,0,0,402,14224,0,0,689,40441,0,0,227,5045,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,15,106:5:0	0,6,76:2:0	0,15,145:5:0
+X	170	.	C	<*>	0	.	DP=13;I16=11,2,0,0,447,16383,0,0,749,44041,0,0,251,5601,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,15,128:5:0	0,6,80:2:0	0,18,143:6:0
+X	171	.	A	<*>	0	.	DP=13;I16=11,2,0,0,500,19366,0,0,749,44041,0,0,250,5546,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,15,134:5:0	0,6,81:2:0	0,18,166:6:0
+X	172	.	C	<*>	0	.	DP=13;I16=10,2,0,0,439,16395,0,0,689,40441,0,0,241,5441,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,15,138:5:0	0,6,75:2:0	0,15,129:5:0
+X	173	.	C	<*>	0	.	DP=13;I16=11,2,0,0,435,15225,0,0,749,44041,0,0,248,5478,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,15,121:5:0	0,6,76:2:0	0,18,146:6:0
+X	174	.	G	<*>	0	.	DP=13;I16=11,1,0,0,351,10685,0,0,689,40441,0,0,238,5364,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,15,111:5:0	0,3,27:1:0	0,18,117:6:0
+X	175	.	C	<*>	0	.	DP=14;I16=13,1,0,0,511,19161,0,0,809,47641,0,0,249,5463,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,143:6:0	0,3,41:1:0	0,21,175:7:0
+X	176	.	C	<*>	0	.	DP=14;I16=13,1,0,0,489,17733,0,0,809,47641,0,0,251,5477,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,146:6:0	0,3,44:1:0	0,21,152:7:0
+X	177	.	C	<*>	0	.	DP=14;I16=13,1,0,0,488,17328,0,0,809,47641,0,0,253,5507,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,138:6:0	0,3,44:1:0	0,21,158:7:0
+X	178	.	A	<*>	0	.	DP=14;I16=13,1,0,0,519,19485,0,0,809,47641,0,0,254,5502,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,147:6:0	0,3,42:1:0	0,21,172:7:0
+X	179	.	A	<*>	0	.	DP=14;I16=13,1,0,0,478,17278,0,0,809,47641,0,0,255,5511,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,134:6:0	0,3,44:1:0	0,21,170:7:0
+X	180	.	A	<*>	0	.	DP=14;I16=12,1,0,0,425,14653,0,0,749,44041,0,0,250,5498,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,126:6:0	0,3,43:1:0	0,18,148:6:0
+X	181	.	G	<*>	0	.	DP=14;I16=11,1,0,0,450,17152,0,0,689,40441,0,0,233,5233,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,156:6:0	0,3,41:1:0	0,15,138:5:0
+X	182	.	A	<*>	0	.	DP=15;I16=14,1,0,0,515,18235,0,0,869,51241,0,0,258,5622,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,150:7:0	0,3,43:1:0	0,21,159:7:0
+X	183	.	C	<*>	0	.	DP=15;I16=13,1,0,0,483,17419,0,0,809,47641,0,0,235,5063,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,159:7:0	0,3,40:1:0	0,18,139:6:0
+X	184	.	A	<*>	0	.	DP=15;I16=14,1,0,0,535,19667,0,0,869,51241,0,0,262,5770,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,158:7:0	0,3,41:1:0	0,21,163:7:0
+X	185	.	C	<*>	0	.	DP=15;I16=13,1,0,0,487,17295,0,0,809,47641,0,0,238,5192,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,150:7:0	0,3,38:1:0	0,18,160:6:0
+X	186	.	G	<*>	0	.	DP=15;I16=12,1,0,0,381,11429,0,0,749,44041,0,0,239,5253,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,117:6:0	0,3,32:1:0	0,18,124:6:0
+X	187	.	C	<*>	0	.	DP=14;I16=13,1,0,0,511,18979,0,0,809,47641,0,0,266,5952,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,147:6:0	0,3,38:1:0	0,21,172:7:0
+X	188	.	C	<*>	0	.	DP=14;I16=13,1,0,0,496,18042,0,0,809,47641,0,0,267,5989,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,147:6:0	0,3,37:1:0	0,21,162:7:0
+X	189	.	C	<*>	0	.	DP=15;I16=13,2,0,0,552,20504,0,0,838,48482,0,0,268,6040,0,0;QS=3,0;MQSB=0;MQ0F=0	PL:DP:DV	0,18,152:6:0	0,6,67:2:0	0,21,167:7:0
+X	190	.	A	<*>	0	.	DP=15;I16=12,2,0,0,500,18230,0,0,778,44882,0,0,243,5381,0,0;QS=3,0;MQSB=0;MQ0F=0	PL:DP:DV	0,18,138:6:0	0,6,68:2:0	0,18,159:6:0
+X	191	.	T	<*>	0	.	DP=15;I16=13,2,0,0,534,19276,0,0,838,48482,0,0,267,5939,0,0;QS=3,0;MQSB=0;MQ0F=0	PL:DP:DV	0,18,143:6:0	0,6,67:2:0	0,21,169:7:0
+X	192	.	G	<*>	0	.	DP=15;I16=13,2,0,0,499,17439,0,0,838,48482,0,0,266,5890,0,0;QS=3,0;MQSB=0;MQ0F=0	PL:DP:DV	0,18,143:6:0	0,6,67:2:0	0,21,151:7:0
+X	193	.	T	<*>	0	.	DP=15;I16=13,2,0,0,505,17811,0,0,838,48482,0,0,265,5859,0,0;QS=3,0;MQSB=0;MQ0F=0	PL:DP:DV	0,18,140:6:0	0,6,63:2:0	0,21,157:7:0
+X	194	.	C	<*>	0	.	DP=14;I16=12,2,0,0,467,16569,0,0,778,44882,0,0,265,5845,0,0;QS=3,0;MQSB=0;MQ0F=0	PL:DP:DV	0,18,142:6:0	0,6,67:2:0	0,18,145:6:0
+X	195	.	C	<*>	0	.	DP=14;I16=11,3,0,0,503,18647,0,0,747,42123,0,0,266,5846,0,0;QS=3,0;MQSB=0.0368832;MQ0F=0	PL:DP:DV	0,18,159:6:0	0,6,71:2:0	0,18,160:6:0
+X	196	.	A	<*>	0	.	DP=14;I16=11,3,0,0,482,17400,0,0,747,42123,0,0,268,5862,0,0;QS=3,0;MQSB=0.0368832;MQ0F=0	PL:DP:DV	0,18,166:6:0	0,6,69:2:0	0,18,138:6:0
+X	197	.	G	<*>	0	.	DP=14;I16=11,3,0,0,481,17391,0,0,747,42123,0,0,270,5894,0,0;QS=3,0;MQSB=0.0368832;MQ0F=0	PL:DP:DV	0,18,164:6:0	0,6,68:2:0	0,18,134:6:0
+X	198	.	C	<*>	0	.	DP=14;I16=11,3,0,0,539,20957,0,0,747,42123,0,0,271,5893,0,0;QS=3,0;MQSB=0.0368832;MQ0F=0	PL:DP:DV	0,18,172:6:0	0,6,70:2:0	0,18,164:6:0
+X	199	.	T	<*>	0	.	DP=14;I16=11,3,0,0,505,19197,0,0,747,42123,0,0,271,5861,0,0;QS=3,0;MQSB=0.0368832;MQ0F=0	PL:DP:DV	0,18,162:6:0	0,6,73:2:0	0,18,154:6:0
+X	200	.	T	<*>	0	.	DP=15;I16=11,4,0,0,544,19918,0,0,776,42964,0,0,270,5798,0,0;QS=3,0;MQSB=0.0161635;MQ0F=0	PL:DP:DV	0,18,161:6:0	0,9,89:3:0	0,18,154:6:0
+X	201	.	A	<*>	0	.	DP=16;I16=12,4,0,0,568,20416,0,0,836,46564,0,0,269,5703,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,171:7:0	0,9,89:3:0	0,18,157:6:0
+X	202	.	A	<*>	0	.	DP=16;I16=12,4,0,0,566,20590,0,0,836,46564,0,0,269,5627,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,178:7:0	0,9,84:3:0	0,18,163:6:0
+X	203	.	C	<*>	0	.	DP=16;I16=12,4,0,0,557,20119,0,0,836,46564,0,0,269,5571,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,166:7:0	0,9,90:3:0	0,18,153:6:0
+X	204	.	C	<*>	0	.	DP=16;I16=12,4,0,0,591,22379,0,0,836,46564,0,0,269,5535,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,173:7:0	0,9,91:3:0	0,18,163:6:0
+X	205	.	T	<*>	0	.	DP=16;I16=12,4,0,0,635,25281,0,0,836,46564,0,0,269,5519,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,188:7:0	0,9,95:3:0	0,18,173:6:0
+X	206	.	G	<*>	0	.	DP=16;I16=12,4,0,0,577,21337,0,0,836,46564,0,0,269,5523,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,180:7:0	0,9,89:3:0	0,18,143:6:0
+X	207	.	C	<*>	0	.	DP=16;I16=12,4,0,0,574,21076,0,0,836,46564,0,0,269,5547,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,179:7:0	0,9,93:3:0	0,18,151:6:0
+X	208	.	A	<*>	0	.	DP=16;I16=12,4,0,0,576,21486,0,0,836,46564,0,0,268,5540,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,184:7:0	0,9,93:3:0	0,18,154:6:0
+X	209	.	T	<*>	0	.	DP=16;I16=12,4,0,0,567,20475,0,0,836,46564,0,0,267,5551,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,173:7:0	0,9,91:3:0	0,18,146:6:0
+X	210	.	C	<*>	0	.	DP=16;I16=12,4,0,0,577,21109,0,0,836,46564,0,0,266,5580,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,185:7:0	0,9,92:3:0	0,18,151:6:0
+X	211	.	C	<*>	0	.	DP=16;I16=12,4,0,0,563,20227,0,0,836,46564,0,0,265,5627,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,172:7:0	0,9,92:3:0	0,18,153:6:0
+X	212	.	C	<*>	0	.	DP=16;I16=12,4,0,0,589,22179,0,0,836,46564,0,0,263,5643,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,181:7:0	0,9,92:3:0	0,18,152:6:0
+X	213	.	T	<*>	0	.	DP=16;I16=12,4,0,0,598,22838,0,0,836,46564,0,0,262,5678,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,181:7:0	0,9,95:3:0	0,18,165:6:0
+X	214	.	A	<*>	0	.	DP=16;I16=11,4,0,0,529,19401,0,0,776,42964,0,0,240,5248,0,0;QS=3,0;MQSB=0.0161635;MQ0F=0	PL:DP:DV	0,21,176:7:0	0,9,92:3:0	0,15,118:5:0
+X	215	.	G	<*>	0	.	DP=15;I16=12,3,0,0,521,19073,0,0,807,45723,0,0,262,5754,0,0;QS=3,0;MQSB=0.0342181;MQ0F=0	PL:DP:DV	0,21,185:7:0	0,9,90:3:0	0,15,105:5:0
+X	216	.	A	<*>	0	.	DP=14;I16=10,3,0,0,464,16900,0,0,687,38523,0,0,238,5166,0,0;QS=3,0;MQSB=0.040184;MQ0F=0	PL:DP:DV	0,21,173:7:0	0,9,92:3:0	0,9,81:3:0
+X	217	.	A	<*>	0	.	DP=14;I16=11,3,0,0,515,19433,0,0,747,42123,0,0,264,5842,0,0;QS=3,0;MQSB=0.0368832;MQ0F=0	PL:DP:DV	0,21,181:7:0	0,9,90:3:0	0,12,97:4:0
+X	218	.	G	<*>	0	.	DP=14;I16=11,3,0,0,507,18957,0,0,747,42123,0,0,265,5907,0,0;QS=3,0;MQSB=0.0368832;MQ0F=0	PL:DP:DV	0,21,178:7:0	0,9,90:3:0	0,12,110:4:0
+X	219	.	T	<*>	0	.	DP=14;I16=11,3,0,0,470,16286,0,0,747,42123,0,0,266,5986,0,0;QS=3,0;MQSB=0.0368832;MQ0F=0	PL:DP:DV	0,21,173:7:0	0,9,88:3:0	0,12,89:4:0
+X	220	.	G	<*>	0	.	DP=14;I16=10,3,0,0,485,18307,0,0,687,38523,0,0,242,5454,0,0;QS=3,0;MQSB=0.040184;MQ0F=0	PL:DP:DV	0,21,188:7:0	0,9,88:3:0	0,9,80:3:0
+X	221	.	A	<*>	0	.	DP=14;I16=11,3,0,0,487,17615,0,0,747,42123,0,0,267,6135,0,0;QS=3,0;MQSB=0.0368832;MQ0F=0	PL:DP:DV	0,21,176:7:0	0,9,88:3:0	0,12,101:4:0
+X	222	.	A	<*>	0	.	DP=14;I16=10,3,0,0,465,17367,0,0,687,38523,0,0,242,5578,0,0;QS=3,0;MQSB=0.040184;MQ0F=0	PL:DP:DV	0,21,186:7:0	0,9,85:3:0	0,9,69:3:0
+X	223	.	G	<*>	0	.	DP=13;I16=9,3,0,0,405,14327,0,0,627,34923,0,0,243,5657,0,0;QS=3,0;MQSB=0.0443614;MQ0F=0	PL:DP:DV	0,18,168:6:0	0,6,53:2:0	0,12,81:4:0
+X	224	.	G	<*>	0	.	DP=12;I16=9,3,0,0,379,12759,0,0,627,34923,0,0,270,6370,0,0;QS=3,0;MQSB=0.0443614;MQ0F=0	PL:DP:DV	0,18,168:6:0	0,6,50:2:0	0,12,70:4:0
+X	225	.	C	<*>	0	.	DP=12;I16=8,3,0,0,382,13896,0,0,567,31323,0,0,261,6345,0,0;QS=3,0;MQSB=0.0497871;MQ0F=0	PL:DP:DV	0,18,165:6:0	0,6,48:2:0	0,9,83:3:0
+X	226	.	A	<*>	0	.	DP=13;I16=8,3,0,0,381,13669,0,0,567,31323,0,0,248,5894,0,0;QS=3,0;MQSB=0.0497871;MQ0F=0	PL:DP:DV	0,18,166:6:0	0,6,53:2:0	0,9,84:3:0
+X	227	.	C	<*>	0	.	DP=13;I16=8,4,0,0,406,14306,0,0,596,32164,0,0,267,6253,0,0;QS=3,0;MQSB=0.0249144;MQ0F=0	PL:DP:DV	0,21,190:7:0	0,6,53:2:0	0,9,73:3:0
+X	228	.	C	<*>	0	.	DP=13;I16=9,4,0,0,417,14381,0,0,656,35764,0,0,292,6884,0,0;QS=3,0;MQSB=0.0211283;MQ0F=0	PL:DP:DV	0,21,187:7:0	0,6,45:2:0	0,12,96:4:0
+X	229	.	G	<*>	0	.	DP=13;I16=9,3,0,0,358,11424,0,0,627,34923,0,0,270,6414,0,0;QS=3,0;MQSB=0.0443614;MQ0F=0	PL:DP:DV	0,18,136:6:0	0,6,53:2:0	0,12,70:4:0
+X	230	.	C	<*>	0	.	DP=13;I16=9,4,0,0,461,16861,0,0,656,35764,0,0,292,6920,0,0;QS=3,0;MQSB=0.0211283;MQ0F=0	PL:DP:DV	0,21,186:7:0	0,6,53:2:0	0,12,100:4:0
+X	231	.	C	<*>	0	.	DP=13;I16=7,4,0,0,414,15832,0,0,536,28564,0,0,247,5925,0,0;QS=3,0;MQSB=0.0401934;MQ0F=0	PL:DP:DV	0,18,184:6:0	0,6,53:2:0	0,9,82:3:0
+X	232	.	C	<*>	0	.	DP=14;I16=9,4,0,0,471,17371,0,0,656,35764,0,0,267,6363,0,0;QS=3,0;MQSB=0.0211283;MQ0F=0	PL:DP:DV	0,21,198:7:0	0,6,53:2:0	0,12,101:4:0
+X	233	.	A	<*>	0	.	DP=14;I16=10,4,0,0,496,18142,0,0,716,39364,0,0,292,6984,0,0;QS=3,0;MQSB=0.0183156;MQ0F=0	PL:DP:DV	0,21,192:7:0	0,6,53:2:0	0,15,119:5:0
+X	234	.	A	<*>	0	.	DP=14;I16=10,4,0,0,502,18390,0,0,716,39364,0,0,292,6988,0,0;QS=3,0;MQSB=0.0183156;MQ0F=0	PL:DP:DV	0,21,185:7:0	0,6,53:2:0	0,15,123:5:0
+X	235	.	A	<*>	0	.	DP=14;I16=9,4,0,0,476,17652,0,0,656,35764,0,0,267,6375,0,0;QS=3,0;MQSB=0.0211283;MQ0F=0	PL:DP:DV	0,21,186:7:0	0,6,53:2:0	0,12,111:4:0
+X	236	.	G	<*>	0	.	DP=15;I16=11,4,0,0,501,17481,0,0,776,42964,0,0,290,6924,0,0;QS=3,0;MQSB=0.0161635;MQ0F=0	PL:DP:DV	0,24,206:8:0	0,6,53:2:0	0,15,103:5:0
+X	237	.	A	<*>	0	.	DP=14;I16=9,4,0,0,465,16877,0,0,656,35764,0,0,266,6282,0,0;QS=3,0;MQSB=0.0211283;MQ0F=0	PL:DP:DV	0,24,206:8:0	0,6,53:2:0	0,9,92:3:0
+X	238	.	C	<*>	0	.	DP=14;I16=10,4,0,0,482,17238,0,0,716,39364,0,0,292,6900,0,0;QS=3,0;MQSB=0.0183156;MQ0F=0	PL:DP:DV	0,24,211:8:0	0,6,53:2:0	0,12,82:4:0
+X	239	.	A	<*>	0	.	DP=15;I16=10,5,0,0,525,19155,0,0,776,42964,0,0,292,6852,0,0;QS=3,0;MQSB=0.0497871;MQ0F=0	PL:DP:DV	0,27,223:9:0	0,6,50:2:0	0,12,108:4:0
+X	240	.	C	<*>	0	.	DP=15;I16=10,5,0,0,512,17930,0,0,776,42964,0,0,292,6764,0,0;QS=3,0;MQSB=0.0497871;MQ0F=0	PL:DP:DV	0,27,220:9:0	0,6,53:2:0	0,12,106:4:0
+X	241	.	G	<*>	0	.	DP=15;I16=9,5,0,0,444,14636,0,0,716,39364,0,0,269,6159,0,0;QS=3,0;MQSB=0.0561348;MQ0F=0	PL:DP:DV	0,27,203:9:0	0,6,53:2:0	0,9,59:3:0
+X	242	.	C	<*>	0	.	DP=15;I16=10,5,0,0,555,21177,0,0,776,42964,0,0,292,6624,0,0;QS=3,0;MQSB=0.0497871;MQ0F=0	PL:DP:DV	0,27,242:9:0	0,6,53:2:0	0,12,94:4:0
+X	243	.	C	<*>	0	.	DP=16;I16=9,5,0,0,523,19737,0,0,716,39364,0,0,284,6508,0,0;QS=3,0;MQSB=0.0561348;MQ0F=0	PL:DP:DV	0,24,220:8:0	0,6,53:2:0	0,12,104:4:0
+X	244	.	C	<*>	0	.	DP=16;I16=10,6,0,0,620,24272,0,0,805,43805,0,0,298,6568,0,0;QS=3,0;MQSB=0.0253122;MQ0F=0	PL:DP:DV	0,27,245:9:0	0,9,72:3:0	0,12,106:4:0
+X	245	.	A	<*>	0	.	DP=17;I16=10,7,0,0,649,24843,0,0,865,47405,0,0,299,6553,0,0;QS=3,0;MQSB=0.0509867;MQ0F=0	PL:DP:DV	0,27,236:9:0	0,12,93:4:0	0,12,115:4:0
+X	246	.	T	<*>	0	.	DP=18;I16=10,8,0,0,649,23833,0,0,894,48246,0,0,301,6553,0,0;QS=3,0;MQSB=0.0286491;MQ0F=0	PL:DP:DV	0,30,247:10:0	0,12,94:4:0	0,12,98:4:0
+X	247	.	G	<*>	0	.	DP=18;I16=10,8,0,0,642,23610,0,0,894,48246,0,0,304,6570,0,0;QS=3,0;MQSB=0.0286491;MQ0F=0	PL:DP:DV	0,30,252:10:0	0,12,83:4:0	0,12,103:4:0
+X	248	.	T	<*>	0	.	DP=18;I16=10,8,0,0,636,22944,0,0,894,48246,0,0,307,6605,0,0;QS=3,0;MQSB=0.0286491;MQ0F=0	PL:DP:DV	0,30,234:10:0	0,12,86:4:0	0,12,114:4:0
+X	249	.	C	<*>	0	.	DP=18;I16=10,8,0,0,656,24846,0,0,894,48246,0,0,310,6658,0,0;QS=3,0;MQSB=0.0286491;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,12,79:4:0	0,12,112:4:0
+X	250	.	C	<*>	0	.	DP=19;I16=10,9,0,0,694,26160,0,0,923,49087,0,0,311,6631,0,0;QS=3,0;MQSB=0.0168512;MQ0F=0	PL:DP:DV	0,30,248:10:0	0,12,89:4:0	0,15,142:5:0
+X	251	.	A	<*>	0	.	DP=19;I16=9,9,0,0,688,26506,0,0,863,45487,0,0,313,6627,0,0;QS=3,0;MQSB=0.0208913;MQ0F=0	PL:DP:DV	0,27,233:9:0	0,12,97:4:0	0,15,148:5:0
+X	252	.	G	<*>	0	.	DP=18;I16=8,9,0,0,641,24631,0,0,803,41887,0,0,304,6502,0,0;QS=3,0;MQSB=0.026526;MQ0F=0	PL:DP:DV	0,27,243:9:0	0,12,91:4:0	0,12,121:4:0
+X	253	.	C	<*>	0	.	DP=19;I16=9,10,0,0,705,26921,0,0,892,46328,0,0,319,6687,0,0;QS=3,0;MQSB=0.0132999;MQ0F=0	PL:DP:DV	0,27,247:9:0	0,12,86:4:0	0,18,155:6:0
+X	254	.	T	<*>	0	.	DP=20;I16=10,9,0,0,719,27517,0,0,892,46328,0,0,314,6670,0,0;QS=3,0;MQSB=0.00482795;MQ0F=0	PL:DP:DV	0,30,254:10:0	0,9,72:3:0	0,18,164:6:0
+X	255	.	T	<*>	0	.	DP=21;I16=11,10,0,0,750,27076,0,0,1012,53528,0,0,328,6840,0,0;QS=3,0;MQSB=0.00822975;MQ0F=0	PL:DP:DV	0,33,241:11:0	0,12,95:4:0	0,18,161:6:0
+X	256	.	A	<*>	0	.	DP=22;I16=11,11,0,0,811,30063,0,0,1049,54897,0,0,334,6956,0,0;QS=3,0;MQSB=0.00507916;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,110:5:0	0,18,166:6:0
+X	257	.	T	<*>	0	.	DP=22;I16=11,11,0,0,814,30420,0,0,1049,54897,0,0,341,7101,0,0;QS=3,0;MQSB=0.00507916;MQ0F=0	PL:DP:DV	0,33,247:11:0	0,15,113:5:0	0,18,168:6:0
+X	258	.	T	<*>	0	.	DP=22;I16=11,11,0,0,791,28943,0,0,1049,54897,0,0,347,7225,0,0;QS=3,0;MQSB=0.00507916;MQ0F=0	PL:DP:DV	0,33,254:11:0	0,15,116:5:0	0,18,155:6:0
+X	259	.	C	<*>	0	.	DP=22;I16=11,10,0,0,785,29809,0,0,1020,54056,0,0,332,6936,0,0;QS=3,0;MQSB=0.00822975;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,90:4:0	0,18,170:6:0
+X	260	.	T	<*>	0	.	DP=21;I16=10,11,0,0,829,32899,0,0,989,51297,0,0,360,7556,0,0;QS=3,0;MQSB=0.00660016;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,118:5:0	0,15,156:5:0
+X	261	.	G	<*>	0	.	DP=21;I16=10,11,0,0,735,27379,0,0,989,51297,0,0,367,7761,0,0;QS=3,0;MQSB=0.00660016;MQ0F=0	PL:DP:DV	0,33,254:11:0	0,15,111:5:0	0,15,122:5:0
+X	262	.	C	<*>	0	.	DP=22;I16=10,12,0,0,806,30278,0,0,1049,54897,0,0,373,7941,0,0;QS=3,0;MQSB=0.0122507;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,99:5:0	0,18,164:6:0
+X	263	.	C	<*>	0	.	DP=22;I16=10,12,0,0,799,29717,0,0,1049,54897,0,0,380,8146,0,0;QS=3,0;MQSB=0.0122507;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,98:5:0	0,18,168:6:0
+X	264	.	C	<*>	0	.	DP=22;I16=10,12,0,0,821,31325,0,0,1049,54897,0,0,386,8326,0,0;QS=3,0;MQSB=0.0122507;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,104:5:0	0,18,172:6:0
+X	265	.	A	<*>	0	.	DP=21;I16=9,12,0,0,800,31906,0,0,989,51297,0,0,390,8380,0,0;QS=3,0;MQSB=0.0158903;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,114:5:0	0,15,129:5:0
+X	266	.	G	<*>	0	.	DP=21;I16=9,11,0,0,747,28155,0,0,960,50456,0,0,369,7833,0,0;QS=3,0;MQSB=0.0237479;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,97:4:0	0,15,138:5:0
+X	267	.	T	<*>	0	.	DP=21;I16=9,11,0,0,739,27465,0,0,960,50456,0,0,373,7935,0,0;QS=3,0;MQSB=0.0237479;MQ0F=0	PL:DP:DV	0,33,254:11:0	0,12,101:4:0	0,15,149:5:0
+X	268	.	T	<*>	0	.	DP=21;I16=9,12,0,0,748,27708,0,0,989,51297,0,0,402,8686,0,0;QS=3,0;MQSB=0.0158903;MQ0F=0	PL:DP:DV	0,33,238:11:0	0,15,110:5:0	0,15,156:5:0
+X	269	.	C	<*>	0	.	DP=22;I16=9,12,0,0,764,28632,0,0,989,51297,0,0,381,8211,0,0;QS=3,0;MQSB=0.0158903;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,91:4:0	0,15,154:5:0
+X	270	.	C	<*>	0	.	DP=22;I16=9,12,0,0,758,28146,0,0,989,51297,0,0,385,8337,0,0;QS=3,0;MQSB=0.0158903;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,96:4:0	0,15,143:5:0
+X	271	.	T	<*>	0	.	DP=22;I16=9,13,0,0,847,32935,0,0,1018,52138,0,0,413,9065,0,0;QS=3,0;MQSB=0.0109431;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,113:5:0	0,15,152:5:0
+X	272	.	C	<*>	0	.	DP=22;I16=9,12,0,0,809,31413,0,0,989,51297,0,0,390,8518,0,0;QS=3,0;MQSB=0.0158903;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,96:4:0	0,15,149:5:0
+X	273	.	T	<*>	0	.	DP=22;I16=9,12,0,0,798,30664,0,0,989,51297,0,0,392,8620,0,0;QS=3,0;MQSB=0.0158903;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,95:4:0	0,15,161:5:0
+X	274	.	C	<*>	0	.	DP=22;I16=9,12,0,0,763,28177,0,0,989,51297,0,0,394,8746,0,0;QS=3,0;MQSB=0.0158903;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,101:4:0	0,15,144:5:0
+X	275	.	C	<*>	0	.	DP=20;I16=7,13,0,0,768,29994,0,0,898,44938,0,0,423,9519,0,0;QS=3,0;MQSB=0.0213617;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,114:5:0	0,12,122:4:0
+X	276	.	A	<*>	0	.	DP=20;I16=7,13,0,0,805,32931,0,0,898,44938,0,0,424,9538,0,0;QS=3,0;MQSB=0.0213617;MQ0F=0	PL:DP:DV	0,33,253:11:0	0,15,122:5:0	0,12,124:4:0
+X	277	.	G	<*>	0	.	DP=20;I16=7,13,0,0,764,29732,0,0,898,44938,0,0,425,9579,0,0;QS=3,0;MQSB=0.0213617;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,114:5:0	0,12,121:4:0
+X	278	.	A	<*>	0	.	DP=21;I16=6,14,0,0,722,26452,0,0,867,42179,0,0,415,9521,0,0;QS=3,0;MQSB=0.0246228;MQ0F=0	PL:DP:DV	0,30,238:10:0	0,18,123:6:0	0,12,121:4:0
+X	279	.	A	<*>	0	.	DP=22;I16=7,15,0,0,786,28694,0,0,956,46620,0,0,427,9677,0,0;QS=3,0;MQSB=0.0124927;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,123:6:0	0,12,122:4:0
+X	280	.	A	<*>	0	.	DP=22;I16=7,15,0,0,815,31561,0,0,956,46620,0,0,428,9684,0,0;QS=3,0;MQSB=0.0124927;MQ0F=0	PL:DP:DV	0,36,253:12:0	0,18,130:6:0	0,12,129:4:0
+X	281	.	G	<*>	0	.	DP=22;I16=7,15,0,0,820,31416,0,0,956,46620,0,0,428,9662,0,0;QS=3,0;MQSB=0.0124927;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,122:6:0	0,12,123:4:0
+X	282	.	G	<*>	0	.	DP=22;I16=7,15,0,0,806,30420,0,0,956,46620,0,0,427,9609,0,0;QS=3,0;MQSB=0.0124927;MQ0F=0	PL:DP:DV	0,36,253:12:0	0,18,124:6:0	0,12,119:4:0
+X	283	.	C	<*>	0	.	DP=23;I16=7,15,0,0,827,31785,0,0,956,46620,0,0,426,9574,0,0;QS=3,0;MQSB=0.0124927;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,125:6:0	0,12,122:4:0
+X	284	.	T	<*>	0	.	DP=23;I16=7,16,0,0,901,35479,0,0,1016,50220,0,0,431,9593,0,0;QS=3,0;MQSB=0.0194969;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,126:6:0	0,15,144:5:0
+X	285	.	G	<*>	0	.	DP=23;I16=7,16,0,0,860,32856,0,0,1016,50220,0,0,431,9607,0,0;QS=3,0;MQSB=0.0194969;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,119:6:0	0,15,132:5:0
+X	286	.	C	<*>	0	.	DP=24;I16=8,16,0,0,875,32883,0,0,1076,53820,0,0,431,9641,0,0;QS=3,0;MQSB=0.0132999;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,150:7:0	0,15,134:5:0
+X	287	.	A	<*>	0	.	DP=25;I16=9,16,0,0,895,32957,0,0,1136,57420,0,0,432,9696,0,0;QS=3,0;MQSB=0.00934348;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,178:8:0	0,15,133:5:0
+X	288	.	T	<*>	0	.	DP=25;I16=9,16,0,0,931,35011,0,0,1136,57420,0,0,432,9674,0,0;QS=3,0;MQSB=0.00934348;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,184:8:0	0,15,146:5:0
+X	289	.	G	<*>	0	.	DP=25;I16=9,16,0,0,939,36117,0,0,1136,57420,0,0,432,9676,0,0;QS=3,0;MQSB=0.00934348;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,185:8:0	0,15,136:5:0
+X	290	.	G	<*>	0	.	DP=23;I16=8,15,0,0,805,29157,0,0,1047,52979,0,0,433,9651,0,0;QS=3,0;MQSB=0.0177152;MQ0F=0	PL:DP:DV	0,33,240:11:0	0,21,164:7:0	0,15,126:5:0
+X	291	.	T	<*>	0	.	DP=24;I16=8,15,0,0,840,31616,0,0,1047,52979,0,0,421,9479,0,0;QS=3,0;MQSB=0.0177152;MQ0F=0	PL:DP:DV	0,33,244:11:0	0,21,168:7:0	0,15,136:5:0
+X	292	.	T	<*>	0	.	DP=25;I16=9,16,0,0,888,32274,0,0,1167,60179,0,0,436,9668,0,0;QS=3,0;MQSB=0.0197089;MQ0F=0	PL:DP:DV	0,33,253:11:0	0,24,181:8:0	0,18,156:6:0
+X	293	.	G	<*>	0	.	DP=26;I16=10,15,0,0,934,35232,0,0,1167,60179,0,0,424,9488,0,0;QS=3,0;MQSB=0.0095249;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,196:8:0	0,15,145:5:0
+X	294	.	A	<*>	0	.	DP=26;I16=10,16,0,0,931,33937,0,0,1227,63779,0,0,443,9785,0,0;QS=3,0;MQSB=0.0149748;MQ0F=0	PL:DP:DV	0,36,252:12:0	0,24,201:8:0	0,18,161:6:0
+X	295	.	C	<*>	0	.	DP=25;I16=10,14,0,0,897,33973,0,0,1169,62097,0,0,430,9544,0,0;QS=3,0;MQSB=0.0310726;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,180:7:0	0,18,159:6:0
+X	296	.	A	<*>	0	.	DP=25;I16=10,15,0,0,874,31846,0,0,1198,62938,0,0,451,9905,0,0;QS=3,0;MQSB=0.0213617;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,169:8:0	0,18,169:6:0
+X	297	.	C	<*>	0	.	DP=25;I16=9,15,0,0,901,34305,0,0,1138,59338,0,0,445,9901,0,0;QS=3,0;MQSB=0.0273237;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,174:7:0	0,18,161:6:0
+X	298	.	A	<*>	0	.	DP=26;I16=11,15,0,0,936,34652,0,0,1258,66538,0,0,459,10121,0,0;QS=3,0;MQSB=0.017008;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,184:8:0	0,21,191:7:0
+X	299	.	C	<*>	0	.	DP=27;I16=11,15,0,0,971,36863,0,0,1258,66538,0,0,464,10266,0,0;QS=3,0;MQSB=0.017008;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,193:8:0	0,21,189:7:0
+X	300	.	A	<*>	0	.	DP=27;I16=11,15,0,0,1001,39455,0,0,1258,66538,0,0,469,10437,0,0;QS=3,0;MQSB=0.017008;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,204:8:0	0,21,210:7:0
+X	301	.	G	<*>	0	.	DP=25;I16=10,14,0,0,928,36116,0,0,1169,62097,0,0,476,10632,0,0;QS=3,0;MQSB=0.0310726;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,195:7:0	0,21,196:7:0
+X	302	.	T	<*>	0	.	DP=25;I16=10,14,0,0,879,32885,0,0,1169,62097,0,0,483,10849,0,0;QS=3,0;MQSB=0.0310726;MQ0F=0	PL:DP:DV	0,30,231:10:0	0,21,172:7:0	0,21,202:7:0
+X	302	.	T	TA	0	.	INDEL;IDV=7;IMF=1;DP=25;I16=2,4,8,11,214,7674,793,33369,236,10564,993,55133,109,2229,377,8629;QS=0.511212,2.48879;VDB=0.27613;SGB=-4.22417;MQSB=0.0443614;MQ0F=0	PL:DP:DV	167,0,96:11:6	157,0,9:7:6	201,21,0:7:7
+X	303	.	G	<*>	0	.	DP=25;I16=10,15,0,0,976,38516,0,0,1229,65697,0,0,497,11181,0,0;QS=3,0;MQSB=0.0443614;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,197:7:0	0,21,195:7:0
+X	304	.	C	<*>	0	.	DP=27;I16=11,16,0,0,991,37005,0,0,1318,70138,0,0,503,11359,0,0;QS=3,0;MQSB=0.129164;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,206:8:0	0,24,200:8:0
+X	305	.	C	<*>	0	.	DP=27;I16=11,16,0,0,1057,41761,0,0,1318,70138,0,0,510,11508,0,0;QS=3,0;MQSB=0.129164;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,213:8:0	0,24,211:8:0
+X	306	.	T	<*>	0	.	DP=27;I16=11,16,0,0,1033,40253,0,0,1318,70138,0,0,517,11679,0,0;QS=3,0;MQSB=0.129164;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,207:8:0	0,24,217:8:0
+X	307	.	G	<*>	0	.	DP=27;I16=11,15,0,0,984,37886,0,0,1289,69297,0,0,498,11198,0,0;QS=3,0;MQSB=0.174566;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,189:7:0	0,24,203:8:0
+X	308	.	C	<*>	0	.	DP=27;I16=11,16,0,0,892,30810,0,0,1318,70138,0,0,529,11991,0,0;QS=3,0;MQSB=0.129164;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,178:8:0	0,24,185:8:0
+X	309	.	G	<*>	0	.	DP=27;I16=11,16,0,0,951,34599,0,0,1318,70138,0,0,535,12183,0,0;QS=3,0;MQSB=0.129164;MQ0F=0	PL:DP:DV	0,33,243:11:0	0,24,183:8:0	0,24,205:8:0
+X	310	.	A	<*>	0	.	DP=27;I16=11,16,0,0,1001,38063,0,0,1318,70138,0,0,540,12350,0,0;QS=3,0;MQSB=0.129164;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,200:8:0	0,24,217:8:0
+X	311	.	C	<*>	0	.	DP=27;I16=11,16,0,0,1037,40263,0,0,1318,70138,0,0,544,12492,0,0;QS=3,0;MQSB=0.129164;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,215:8:0	0,24,210:8:0
+X	312	.	A	<*>	0	.	DP=26;I16=10,16,0,0,985,38043,0,0,1258,66538,0,0,549,12657,0,0;QS=3,0;MQSB=0.157183;MQ0F=0	PL:DP:DV	0,30,237:10:0	0,24,215:8:0	0,24,218:8:0
+X	313	.	A	<*>	0	.	DP=26;I16=10,16,0,0,983,37969,0,0,1258,66538,0,0,551,12695,0,0;QS=3,0;MQSB=0.157183;MQ0F=0	PL:DP:DV	0,30,235:10:0	0,24,219:8:0	0,24,215:8:0
+X	314	.	A	<*>	0	.	DP=27;I16=10,17,0,0,1050,41798,0,0,1318,70138,0,0,553,12757,0,0;QS=3,0;MQSB=0.195223;MQ0F=0	PL:DP:DV	0,33,250:11:0	0,24,217:8:0	0,24,227:8:0
+X	315	.	G	<*>	0	.	DP=26;I16=10,16,0,0,1025,40941,0,0,1289,69297,0,0,557,12843,0,0;QS=3,0;MQSB=0.252051;MQ0F=0	PL:DP:DV	0,30,252:10:0	0,24,216:8:0	0,24,225:8:0
+X	316	.	C	<*>	0	.	DP=27;I16=10,15,0,0,983,39393,0,0,1252,67928,0,0,535,12277,0,0;QS=3,0;MQSB=0.312403;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,183:7:0	0,24,224:8:0
+X	317	.	T	<*>	0	.	DP=27;I16=10,16,0,0,1028,41392,0,0,1320,72056,0,0,547,12557,0,0;QS=3,0;MQSB=0.377061;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,24,230:8:0	0,24,206:8:0
+X	318	.	G	<*>	0	.	DP=27;I16=10,17,0,0,1038,40546,0,0,1349,72897,0,0,570,13018,0,0;QS=3,0;MQSB=0.297797;MQ0F=0	PL:DP:DV	0,30,249:10:0	0,27,235:9:0	0,24,208:8:0
+X	319	.	A	<*>	0	.	DP=27;I16=9,17,0,0,994,38654,0,0,1289,69297,0,0,560,12906,0,0;QS=3,0;MQSB=0.346864;MQ0F=0	PL:DP:DV	0,30,249:10:0	0,27,228:9:0	0,21,185:7:0
+X	320	.	A	<*>	0	.	DP=27;I16=10,17,0,0,1022,39418,0,0,1349,72897,0,0,573,13053,0,0;QS=3,0;MQSB=0.297797;MQ0F=0	PL:DP:DV	0,30,247:10:0	0,27,230:9:0	0,24,211:8:0
+X	321	.	T	<*>	0	.	DP=27;I16=10,17,0,0,1026,39772,0,0,1349,72897,0,0,573,13029,0,0;QS=3,0;MQSB=0.297797;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,27,214:9:0	0,24,218:8:0
+X	322	.	G	<*>	0	.	DP=28;I16=10,18,0,0,1091,43151,0,0,1409,76497,0,0,573,13029,0,0;QS=3,0;MQSB=0.343265;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,27,226:9:0	0,27,223:9:0
+X	323	.	C	<*>	0	.	DP=28;I16=9,18,0,0,1067,42619,0,0,1349,72897,0,0,565,12939,0,0;QS=3,0;MQSB=0.394987;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,27,225:9:0	0,24,198:8:0
+X	324	.	T	<*>	0	.	DP=30;I16=12,18,0,0,1145,44221,0,0,1529,83697,0,0,573,13001,0,0;QS=3,0;MQSB=0.264959;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,27,237:9:0	0,33,255:11:0
+X	325	.	A	<*>	0	.	DP=31;I16=13,18,0,0,1132,42058,0,0,1589,87297,0,0,573,12925,0,0;QS=3,0;MQSB=0.235201;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,208:9:0	0,33,255:11:0
+X	326	.	T	<*>	0	.	DP=31;I16=13,18,0,0,1157,44193,0,0,1589,87297,0,0,574,12878,0,0;QS=3,0;MQSB=0.235201;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,216:9:0	0,33,255:11:0
+X	327	.	C	<*>	0	.	DP=31;I16=13,18,0,0,1147,43895,0,0,1589,87297,0,0,575,12861,0,0;QS=3,0;MQSB=0.235201;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,198:9:0	0,33,255:11:0
+X	328	.	A	<*>	0	.	DP=31;I16=13,18,0,0,1167,44531,0,0,1589,87297,0,0,574,12776,0,0;QS=3,0;MQSB=0.235201;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,226:9:0	0,33,255:11:0
+X	329	.	T	<*>	0	.	DP=31;I16=13,18,0,0,1210,47742,0,0,1589,87297,0,0,572,12676,0,0;QS=3,0;MQSB=0.235201;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,237:9:0	0,33,255:11:0
+X	330	.	T	<*>	0	.	DP=31;I16=13,18,0,0,1185,45839,0,0,1589,87297,0,0,568,12510,0,0;QS=3,0;MQSB=0.235201;MQ0F=0	PL:DP:DV	0,33,254:11:0	0,27,231:9:0	0,33,255:11:0
+X	331	.	T	<*>	0	.	DP=32;I16=14,18,0,0,1154,42510,0,0,1649,90897,0,0,563,12327,0,0;QS=3,0;MQSB=0.210122;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,222:9:0	0,36,255:12:0
+X	332	.	A	<*>	0	.	DP=32;I16=14,18,0,0,1156,42666,0,0,1649,90897,0,0,560,12178,0,0;QS=3,0;MQSB=0.210122;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,214:9:0	0,33,255:11:0
+X	333	.	A	<*>	0	.	DP=32;I16=14,18,0,0,1141,41987,0,0,1649,90897,0,0,558,12064,0,0;QS=3,0;MQSB=0.210122;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,223:9:0	0,33,255:11:0
+X	334	.	A	<*>	0	.	DP=32;I16=14,18,0,0,1162,43328,0,0,1649,90897,0,0,556,11986,0,0;QS=3,0;MQSB=0.210122;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,221:9:0	0,33,255:11:0
+X	335	.	A	<*>	0	.	DP=32;I16=12,18,0,0,1077,40287,0,0,1529,83697,0,0,552,11934,0,0;QS=3,0;MQSB=0.264959;MQ0F=0	PL:DP:DV	0,30,250:10:0	0,27,219:9:0	0,33,251:11:0
+X	336	.	A	<*>	0	.	DP=32;I16=14,17,0,0,1088,39758,0,0,1612,89528,0,0,536,11574,0,0;QS=3,0;MQSB=0.274662;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,211:8:0	0,36,255:12:0
+X	337	.	C	<*>	0	.	DP=32;I16=13,17,0,0,1115,42381,0,0,1552,85928,0,0,531,11565,0,0;QS=3,0;MQSB=0.301511;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,24,202:8:0	0,36,255:12:0
+X	338	.	T	<*>	0	.	DP=30;I16=14,16,0,0,1191,47979,0,0,1560,86456,0,0,554,11878,0,0;QS=3,0;MQSB=0.242376;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,24,226:8:0	0,36,255:12:0
+X	339	.	C	<*>	0	.	DP=31;I16=14,17,0,0,1130,43210,0,0,1589,87297,0,0,554,11874,0,0;QS=3,0;MQSB=0.175471;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,185:8:0	0,36,255:12:0
+X	340	.	C	<*>	0	.	DP=31;I16=14,17,0,0,1196,47044,0,0,1589,87297,0,0,554,11852,0,0;QS=3,0;MQSB=0.175471;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,221:8:0	0,36,255:12:0
+X	341	.	T	<*>	0	.	DP=31;I16=14,17,0,0,1227,48995,0,0,1589,87297,0,0,554,11862,0,0;QS=3,0;MQSB=0.175471;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,216:8:0	0,36,255:12:0
+X	342	.	T	<*>	0	.	DP=31;I16=14,17,0,0,1162,43942,0,0,1589,87297,0,0,554,11904,0,0;QS=3,0;MQSB=0.175471;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,210:8:0	0,36,255:12:0
+X	343	.	G	<*>	0	.	DP=32;I16=14,17,0,0,1150,43702,0,0,1620,90056,0,0,550,11962,0,0;QS=3,0;MQSB=0.283511;MQ0F=0	PL:DP:DV	0,30,249:10:0	0,27,218:9:0	0,36,255:12:0
+X	344	.	C	<*>	0	.	DP=32;I16=14,18,0,0,1181,45169,0,0,1649,90897,0,0,554,12036,0,0;QS=3,0;MQSB=0.210122;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,217:9:0	0,36,255:12:0
+X	345	.	T	<*>	0	.	DP=31;I16=14,17,0,0,1205,47259,0,0,1589,87297,0,0,555,12129,0,0;QS=3,0;MQSB=0.175471;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,221:8:0	0,36,255:12:0
+X	346	.	G	<*>	0	.	DP=31;I16=15,16,0,0,1147,43597,0,0,1620,90056,0,0,557,12255,0,0;QS=3,0;MQSB=0.220358;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,212:8:0	0,36,255:12:0
+X	347	.	G	<*>	0	.	DP=31;I16=14,16,0,0,1119,42227,0,0,1560,86456,0,0,545,12189,0,0;QS=3,0;MQSB=0.242376;MQ0F=0	PL:DP:DV	0,30,251:10:0	0,24,207:8:0	0,36,255:12:0
+X	348	.	T	<*>	0	.	DP=32;I16=15,16,0,0,1145,43007,0,0,1620,90056,0,0,546,12300,0,0;QS=3,0;MQSB=0.220358;MQ0F=0	PL:DP:DV	0,30,243:10:0	0,27,228:9:0	0,36,255:12:0
+X	349	.	T	<*>	0	.	DP=32;I16=16,16,0,0,1194,45350,0,0,1680,93656,0,0,565,12731,0,0;QS=3,0;MQSB=0.201402;MQ0F=0	PL:DP:DV	0,33,246:11:0	0,27,230:9:0	0,36,255:12:0
+X	350	.	T	<*>	0	.	DP=31;I16=16,15,0,0,1142,43072,0,0,1651,92815,0,0,567,12837,0,0;QS=3,0;MQSB=0.286505;MQ0F=0	PL:DP:DV	0,33,249:11:0	0,27,230:9:0	0,33,255:11:0
+X	351	.	G	<*>	0	.	DP=31;I16=16,15,0,0,1146,43750,0,0,1651,92815,0,0,568,12920,0,0;QS=3,0;MQSB=0.286505;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,212:9:0	0,33,255:11:0
+X	352	.	A	<*>	0	.	DP=31;I16=16,14,0,0,1150,45520,0,0,1591,89215,0,0,544,12404,0,0;QS=3,0;MQSB=0.242376;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,224:8:0	0,33,255:11:0
+X	353	.	G	<*>	0	.	DP=29;I16=15,14,0,0,1109,43095,0,0,1562,88374,0,0,570,13064,0,0;QS=3,0;MQSB=0.424373;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,27,231:9:0	0,30,255:10:0
+X	354	.	A	<*>	0	.	DP=28;I16=14,14,0,0,1078,42938,0,0,1502,84774,0,0,571,13075,0,0;QS=3,0;MQSB=0.450096;MQ0F=0	PL:DP:DV	0,27,225:9:0	0,27,244:9:0	0,30,255:10:0
+X	355	.	G	T,<*>	0	.	DP=28;I16=14,13,0,1,1001,37907,41,1681,1442,81174,60,3600,547,12487,25,625;QS=2.875,0.125,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.450096;BQB=1;MQ0F=0	PL:DP:DV	14,0,200,38,203,231:9:1	0,27,222,27,222,222:9:0	0,30,255,30,255,255:10:0
+X	356	.	G	<*>	0	.	DP=27;I16=14,13,0,0,993,37481,0,0,1465,83405,0,0,574,13174,0,0;QS=3,0;MQSB=0.580277;MQ0F=0	PL:DP:DV	0,27,228:9:0	0,24,201:8:0	0,30,255:10:0
+X	357	.	C	<*>	0	.	DP=28;I16=14,13,0,0,1021,39471,0,0,1465,83405,0,0,550,12584,0,0;QS=3,0;MQSB=0.580277;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,24,205:8:0	0,27,251:9:0
+X	358	.	A	<*>	0	.	DP=28;I16=15,13,0,0,1050,40518,0,0,1525,87005,0,0,576,13216,0,0;QS=3,0;MQSB=0.556581;MQ0F=0	PL:DP:DV	0,30,254:10:0	0,24,197:8:0	0,30,255:10:0
+X	359	.	G	<*>	0	.	DP=29;I16=15,13,0,0,1085,42761,0,0,1525,87005,0,0,552,12620,0,0;QS=3,0;MQSB=0.556581;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,187:7:0	0,33,255:11:0
+X	360	.	A	<*>	0	.	DP=29;I16=15,14,0,0,1111,43259,0,0,1585,90605,0,0,579,13297,0,0;QS=3,0;MQSB=0.604224;MQ0F=0	PL:DP:DV	0,30,252:10:0	0,24,220:8:0	0,33,255:11:0
+X	361	.	A	<*>	0	.	DP=29;I16=15,14,0,0,1116,43442,0,0,1585,90605,0,0,579,13273,0,0;QS=3,0;MQSB=0.604224;MQ0F=0	PL:DP:DV	0,30,252:10:0	0,24,219:8:0	0,33,255:11:0
+X	362	.	A	<*>	0	.	DP=29;I16=16,13,0,0,1104,42700,0,0,1585,90605,0,0,580,13272,0,0;QS=3,0;MQSB=0.535133;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,218:8:0	0,30,255:10:0
+X	363	.	A	<*>	0	.	DP=29;I16=16,13,0,0,1087,41437,0,0,1585,90605,0,0,581,13245,0,0;QS=3,0;MQSB=0.535133;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,213:8:0	0,30,255:10:0
+X	364	.	T	<*>	0	.	DP=29;I16=16,13,0,0,1032,37960,0,0,1585,90605,0,0,582,13244,0,0;QS=3,0;MQSB=0.535133;MQ0F=0	PL:DP:DV	0,33,250:11:0	0,24,205:8:0	0,30,255:10:0
+X	365	.	G	<*>	0	.	DP=29;I16=16,13,0,0,1105,43079,0,0,1585,90605,0,0,582,13218,0,0;QS=3,0;MQSB=0.535133;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,211:8:0	0,30,255:10:0
+X	366	.	A	<*>	0	.	DP=29;I16=16,13,0,0,1090,41562,0,0,1585,90605,0,0,581,13167,0,0;QS=3,0;MQSB=0.535133;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,211:8:0	0,30,255:10:0
+X	367	.	T	<*>	0	.	DP=29;I16=16,13,0,0,1055,39149,0,0,1585,90605,0,0,579,13093,0,0;QS=3,0;MQSB=0.535133;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,204:8:0	0,30,255:10:0
+X	368	.	A	<*>	0	.	DP=29;I16=16,13,0,0,1054,39632,0,0,1585,90605,0,0,576,12998,0,0;QS=3,0;MQSB=0.535133;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,208:8:0	0,30,255:10:0
+X	369	.	T	<*>	0	.	DP=28;I16=16,11,0,0,1037,40275,0,0,1496,86164,0,0,548,12256,0,0;QS=3,0;MQSB=0.659218;MQ0F=0	PL:DP:DV	0,30,250:10:0	0,21,196:7:0	0,30,255:10:0
+X	370	.	C	<*>	0	.	DP=28;I16=16,12,0,0,1045,40219,0,0,1556,89764,0,0,570,12790,0,0;QS=3,0;MQSB=0.705296;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,24,201:8:0	0,30,255:10:0
+X	371	.	T	<*>	0	.	DP=29;I16=16,13,0,0,1155,46591,0,0,1616,93364,0,0,567,12725,0,0;QS=3,0;MQSB=0.744925;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,24,227:8:0	0,33,255:11:0
+X	372	.	C	<*>	0	.	DP=30;I16=16,14,0,0,1139,44019,0,0,1676,96964,0,0,564,12636,0,0;QS=3,0;MQSB=0.779025;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,215:8:0	0,33,255:11:0
+X	373	.	A	<*>	0	.	DP=30;I16=16,14,0,0,1142,44118,0,0,1676,96964,0,0,561,12525,0,0;QS=3,0;MQSB=0.779025;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,220:8:0	0,33,255:11:0
+X	374	.	T	<*>	0	.	DP=30;I16=16,14,0,0,1098,41180,0,0,1676,96964,0,0,556,12344,0,0;QS=3,0;MQSB=0.779025;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,221:8:0	0,33,255:11:0
+X	375	.	A	T,<*>	0	.	DP=31;I16=17,13,0,1,1138,43798,14,196,1676,96964,60,3600,547,12177,4,16;QS=2.9661,0.0338983,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.763662;BQB=1;MQ0F=0	PL:DP:DV	0,36,255,36,255,255:12:0	0,24,218,24,218,218:8:0	0,18,255,30,255,255:11:1
+X	376	.	G	<*>	0	.	DP=31;I16=17,14,0,0,1131,42581,0,0,1736,100564,0,0,547,12073,0,0;QS=3,0;MQSB=0.763662;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,220:8:0	0,33,255:11:0
+X	377	.	T	<*>	0	.	DP=31;I16=16,14,0,0,1105,41629,0,0,1676,96964,0,0,518,11360,0,0;QS=3,0;MQSB=0.779025;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,211:8:0	0,33,255:11:0
+X	378	.	T	<*>	0	.	DP=30;I16=18,12,0,0,1098,41066,0,0,1707,99723,0,0,541,11927,0,0;QS=3,0;MQSB=0.878946;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,186:7:0	0,30,255:10:0
+X	379	.	G	<*>	0	.	DP=29;I16=18,10,0,0,1053,40181,0,0,1618,95282,0,0,534,11848,0,0;QS=3,0;MQSB=0.981777;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,187:7:0	0,30,255:10:0
+X	380	.	C	<*>	0	.	DP=29;I16=18,10,0,0,1087,42743,0,0,1618,95282,0,0,514,11172,0,0;QS=3,0;MQSB=0.981777;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,177:6:0	0,30,255:10:0
+X	381	.	T	<*>	0	.	DP=29;I16=18,11,0,0,1168,47412,0,0,1678,98882,0,0,537,11729,0,0;QS=3,0;MQSB=0.987702;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,212:7:0	0,30,255:10:0
+X	382	.	T	<*>	0	.	DP=29;I16=17,11,0,0,1054,40450,0,0,1618,95282,0,0,510,11068,0,0;QS=3,0;MQSB=0.990092;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,182:7:0	0,30,255:10:0
+X	383	.	T	<*>	0	.	DP=29;I16=18,10,0,0,1052,39798,0,0,1618,95282,0,0,507,11013,0,0;QS=3,0;MQSB=0.981777;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,165:6:0	0,30,255:10:0
+X	384	.	A	<*>	0	.	DP=31;I16=19,11,0,0,1077,39885,0,0,1738,102482,0,0,504,10988,0,0;QS=3,0;MQSB=0.985292;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,176:7:0	0,30,255:10:0
+X	385	.	C	<*>	0	.	DP=31;I16=19,12,0,0,1118,41180,0,0,1798,106082,0,0,527,11569,0,0;QS=3,0;MQSB=0.989977;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,24,186:8:0	0,30,255:10:0
+X	386	.	T	<*>	0	.	DP=30;I16=18,12,0,0,1158,45592,0,0,1738,102482,0,0,526,11556,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,191:7:0	0,30,255:10:0
+X	387	.	T	<*>	0	.	DP=30;I16=18,12,0,0,1105,41821,0,0,1738,102482,0,0,525,11573,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,187:7:0	0,30,255:10:0
+X	388	.	T	<*>	0	.	DP=29;I16=17,12,0,0,1089,41577,0,0,1678,98882,0,0,523,11519,0,0;QS=3,0;MQSB=0.993891;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,180:6:0	0,30,255:10:0
+X	389	.	G	<*>	0	.	DP=29;I16=17,12,0,0,1067,40095,0,0,1678,98882,0,0,520,11444,0,0;QS=3,0;MQSB=0.993891;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,171:6:0	0,30,255:10:0
+X	390	.	C	<*>	0	.	DP=29;I16=17,12,0,0,1071,40423,0,0,1678,98882,0,0,517,11399,0,0;QS=3,0;MQSB=0.993891;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,162:6:0	0,30,255:10:0
+X	391	.	A	<*>	0	.	DP=29;I16=18,11,0,0,1091,41603,0,0,1647,96123,0,0,515,11383,0,0;QS=3,0;MQSB=0.995968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,163:6:0	0,30,255:10:0
+X	392	.	T	<*>	0	.	DP=29;I16=18,11,0,0,1046,38838,0,0,1647,96123,0,0,515,11395,0,0;QS=3,0;MQSB=0.995968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,153:5:0	0,33,255:11:0
+X	393	.	A	<*>	0	.	DP=28;I16=17,11,0,0,1014,37582,0,0,1587,92523,0,0,517,11435,0,0;QS=3,0;MQSB=0.993109;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,133:5:0	0,33,255:11:0
+X	394	.	T	<*>	0	.	DP=28;I16=17,11,0,0,1022,38342,0,0,1587,92523,0,0,519,11503,0,0;QS=3,0;MQSB=0.993109;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,141:5:0	0,33,255:11:0
+X	395	.	T	<*>	0	.	DP=28;I16=17,11,0,0,1060,40596,0,0,1587,92523,0,0,521,11599,0,0;QS=3,0;MQSB=0.993109;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,164:5:0	0,33,255:11:0
+X	396	.	T	<*>	0	.	DP=28;I16=17,11,0,0,1032,39228,0,0,1587,92523,0,0,523,11723,0,0;QS=3,0;MQSB=0.993109;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,158:5:0	0,33,255:11:0
+X	397	.	T	<*>	0	.	DP=28;I16=17,11,0,0,1046,39510,0,0,1587,92523,0,0,524,11824,0,0;QS=3,0;MQSB=0.993109;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,149:5:0	0,33,255:11:0
+X	398	.	A	<*>	0	.	DP=28;I16=17,11,0,0,1021,38105,0,0,1587,92523,0,0,524,11850,0,0;QS=3,0;MQSB=0.993109;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,144:5:0	0,30,255:10:0
+X	399	.	A	<*>	0	.	DP=28;I16=17,11,0,0,1015,38469,0,0,1587,92523,0,0,526,11900,0,0;QS=3,0;MQSB=0.993109;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,140:5:0	0,30,255:10:0
+X	400	.	A	<*>	0	.	DP=29;I16=17,12,0,0,1056,39702,0,0,1647,96123,0,0,526,11828,0,0;QS=3,0;MQSB=0.988062;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,159:5:0	0,33,255:11:0
+X	401	.	A	<*>	0	.	DP=29;I16=17,11,0,0,1052,40302,0,0,1587,92523,0,0,501,11113,0,0;QS=3,0;MQSB=0.993109;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,160:5:0	0,30,255:10:0
+X	402	.	T	<*>	0	.	DP=29;I16=17,12,0,0,1082,41232,0,0,1647,96123,0,0,526,11680,0,0;QS=3,0;MQSB=0.988062;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,149:5:0	0,33,255:11:0
+X	403	.	T	<*>	0	.	DP=29;I16=17,12,0,0,1085,40985,0,0,1647,96123,0,0,526,11654,0,0;QS=3,0;MQSB=0.988062;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,148:5:0	0,33,255:11:0
+X	404	.	G	<*>	0	.	DP=29;I16=17,12,0,0,1074,40524,0,0,1647,96123,0,0,525,11609,0,0;QS=3,0;MQSB=0.988062;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,131:5:0	0,33,255:11:0
+X	405	.	T	<*>	0	.	DP=27;I16=16,10,0,0,988,37870,0,0,1498,88082,0,0,519,11543,0,0;QS=3,0;MQSB=0.987578;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,103:3:0	0,30,255:10:0
+X	406	.	G	<*>	0	.	DP=27;I16=16,11,0,0,976,36752,0,0,1558,91682,0,0,527,11601,0,0;QS=3,0;MQSB=0.992419;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,125:4:0	0,30,247:10:0
+X	407	.	A	<*>	0	.	DP=27;I16=16,11,0,0,1007,38355,0,0,1558,91682,0,0,526,11538,0,0;QS=3,0;MQSB=0.992419;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,125:4:0	0,30,255:10:0
+X	408	.	C	<*>	0	.	DP=28;I16=16,11,0,0,1006,38136,0,0,1558,91682,0,0,521,11489,0,0;QS=3,0;MQSB=0.992419;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,110:3:0	0,30,244:10:0
+X	409	.	T	<*>	0	.	DP=29;I16=17,12,0,0,1100,42734,0,0,1678,98882,0,0,525,11503,0,0;QS=3,0;MQSB=0.993891;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,131:4:0	0,33,255:11:0
+X	410	.	T	<*>	0	.	DP=29;I16=17,12,0,0,1035,38325,0,0,1678,98882,0,0,524,11432,0,0;QS=3,0;MQSB=0.993891;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,125:4:0	0,33,255:11:0
+X	411	.	T	<*>	0	.	DP=29;I16=17,10,0,0,1003,37747,0,0,1558,91682,0,0,496,10716,0,0;QS=3,0;MQSB=0.984677;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,104:3:0	0,30,255:10:0
+X	412	.	C	T,<*>	0	.	DP=30;I16=17,12,1,0,1094,42458,14,196,1678,98882,60,3600,495,10659,25,625;QS=2.97455,0.0254545,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.991968;BQB=1;MQ0F=0	PL:DP:DV	0,30,255,42,255,255:15:1	0,12,124,12,124,124:4:0	0,33,255,33,255,255:11:0
+X	413	.	A	<*>	0	.	DP=31;I16=18,13,0,0,1189,45985,0,0,1798,106082,0,0,520,11258,0,0;QS=3,0;MQSB=0.995005;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,9,102:3:0	0,33,255:11:0
+X	414	.	T	<*>	0	.	DP=30;I16=18,12,0,0,1151,44355,0,0,1738,102482,0,0,523,11265,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,109:3:0	0,33,255:11:0
+X	415	.	G	<*>	0	.	DP=30;I16=18,12,0,0,1131,43175,0,0,1738,102482,0,0,526,11306,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,110:3:0	0,33,255:11:0
+X	416	.	G	<*>	0	.	DP=30;I16=17,12,0,0,1083,41273,0,0,1678,98882,0,0,514,11156,0,0;QS=3,0;MQSB=0.993891;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,114:3:0	0,30,253:10:0
+X	417	.	C	<*>	0	.	DP=30;I16=18,12,0,0,1114,42244,0,0,1738,102482,0,0,531,11439,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,108:3:0	0,33,255:11:0
+X	418	.	A	<*>	0	.	DP=30;I16=18,12,0,0,1146,44248,0,0,1738,102482,0,0,532,11478,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,111:3:0	0,33,255:11:0
+X	419	.	T	<*>	0	.	DP=30;I16=18,12,0,0,1117,42327,0,0,1738,102482,0,0,532,11498,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,112:3:0	0,33,255:11:0
+X	420	.	A	<*>	0	.	DP=31;I16=18,13,0,0,1117,41011,0,0,1798,106082,0,0,532,11550,0,0;QS=3,0;MQSB=0.995005;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,108:3:0	0,36,255:12:0
+X	421	.	A	<*>	0	.	DP=33;I16=19,14,0,0,1208,45398,0,0,1887,110523,0,0,533,11635,0,0;QS=3,0;MQSB=0.986656;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,113:3:0	0,42,255:14:0
+X	422	.	A	<*>	0	.	DP=33;I16=19,13,0,0,1205,46441,0,0,1827,106923,0,0,510,11082,0,0;QS=3,0;MQSB=0.991023;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,116:3:0	0,39,255:13:0
+X	423	.	T	<*>	0	.	DP=32;I16=19,13,0,0,1202,45416,0,0,1827,106923,0,0,538,11818,0,0;QS=3,0;MQSB=0.991023;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,110:3:0	0,39,255:13:0
+X	424	.	A	<*>	0	.	DP=32;I16=19,13,0,0,1147,41685,0,0,1827,106923,0,0,539,11867,0,0;QS=3,0;MQSB=0.991023;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,106:3:0	0,39,255:13:0
+X	425	.	A	<*>	0	.	DP=29;I16=16,13,0,0,1070,40616,0,0,1647,96123,0,0,542,11900,0,0;QS=3,0;MQSB=0.976248;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,111:3:0	0,33,249:11:0
+X	426	.	T	<*>	0	.	DP=29;I16=16,12,0,0,997,36561,0,0,1587,92523,0,0,519,11287,0,0;QS=3,0;MQSB=0.982906;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,105:3:0	0,30,225:10:0
+X	427	.	A	<*>	0	.	DP=29;I16=16,13,0,0,1024,37266,0,0,1647,96123,0,0,546,11952,0,0;QS=3,0;MQSB=0.976248;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,111:3:0	0,33,242:11:0
+X	428	.	C	<*>	0	.	DP=29;I16=16,13,0,0,1064,39706,0,0,1647,96123,0,0,548,12020,0,0;QS=3,0;MQSB=0.976248;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,111:3:0	0,33,254:11:0
+X	429	.	T	<*>	0	.	DP=30;I16=16,14,0,0,1150,44918,0,0,1707,99723,0,0,549,12067,0,0;QS=3,0;MQSB=0.969373;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,115:3:0	0,33,255:11:0
+X	430	.	G	<*>	0	.	DP=30;I16=16,14,0,0,1113,42443,0,0,1707,99723,0,0,551,12145,0,0;QS=3,0;MQSB=0.969373;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,112:3:0	0,33,246:11:0
+X	431	.	G	<*>	0	.	DP=30;I16=14,14,0,0,1003,36953,0,0,1587,92523,0,0,553,12255,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,101:3:0	0,30,225:10:0
+X	432	.	T	<*>	0	.	DP=28;I16=14,14,0,0,1049,39621,0,0,1587,92523,0,0,556,12346,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,114:3:0	0,30,255:10:0
+X	433	.	T	<*>	0	.	DP=28;I16=14,12,0,0,949,35443,0,0,1467,85323,0,0,509,11217,0,0;QS=3,0;MQSB=0.967472;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,112:3:0	0,27,227:9:0
+X	434	.	T	<*>	0	.	DP=29;I16=15,14,0,0,1036,37654,0,0,1647,96123,0,0,561,12567,0,0;QS=3,0;MQSB=0.960561;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,98:3:0	0,30,243:10:0
+X	435	.	A	<*>	0	.	DP=29;I16=15,13,0,0,1024,37970,0,0,1587,92523,0,0,556,12560,0,0;QS=3,0;MQSB=0.968414;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,103:3:0	0,30,237:10:0
+X	436	.	T	<*>	0	.	DP=28;I16=14,14,0,0,998,36220,0,0,1587,92523,0,0,564,12654,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,110:3:0	0,27,223:9:0
+X	437	.	T	<*>	0	.	DP=28;I16=13,14,0,0,990,36832,0,0,1558,91682,0,0,549,12435,0,0;QS=3,0;MQSB=0.999706;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,109:3:0	0,24,207:8:0
+X	438	.	A	<*>	0	.	DP=28;I16=14,13,0,0,972,35640,0,0,1527,88923,0,0,540,12082,0,0;QS=3,0;MQSB=0.9585;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,107:3:0	0,24,216:8:0
+X	439	.	C	<*>	0	.	DP=28;I16=14,14,0,0,1055,40273,0,0,1587,92523,0,0,563,12649,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,107:3:0	0,27,224:9:0
+X	440	.	A	<*>	0	.	DP=28;I16=14,14,0,0,1095,43251,0,0,1587,92523,0,0,561,12615,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,115:3:0	0,27,247:9:0
+X	441	.	G	<*>	0	.	DP=29;I16=15,14,0,0,1068,40344,0,0,1647,96123,0,0,559,12605,0,0;QS=3,0;MQSB=0.960561;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,9,104:3:0	0,27,198:9:0
+X	442	.	A	<*>	0	.	DP=29;I16=15,14,0,0,1091,41507,0,0,1647,96123,0,0,558,12620,0,0;QS=3,0;MQSB=0.960561;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,9,112:3:0	0,27,233:9:0
+X	443	.	A	<*>	0	.	DP=30;I16=15,14,0,0,1173,49439,0,0,1647,96123,0,0,557,12661,0,0;QS=3,0;MQSB=0.960561;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,9,129:3:0	0,27,246:9:0
+X	444	.	G	<*>	0	.	DP=29;I16=15,13,0,0,1095,44661,0,0,1587,92523,0,0,557,12727,0,0;QS=3,0;MQSB=0.968414;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,91:2:0	0,27,227:9:0
+X	445	.	C	<*>	0	.	DP=30;I16=16,13,0,0,1100,43706,0,0,1647,96123,0,0,557,12817,0,0;QS=3,0;MQSB=0.976248;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,9,111:3:0	0,27,219:9:0
+X	446	.	A	<*>	0	.	DP=30;I16=16,13,0,0,1107,44265,0,0,1647,96123,0,0,557,12881,0,0;QS=3,0;MQSB=0.976248;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,9,115:3:0	0,27,232:9:0
+X	447	.	C	<*>	0	.	DP=29;I16=16,12,0,0,1108,45364,0,0,1618,95282,0,0,555,12817,0,0;QS=3,0;MQSB=0.856268;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,114:3:0	0,27,235:9:0
+X	448	.	T	<*>	0	.	DP=29;I16=16,12,0,0,1125,47237,0,0,1618,95282,0,0,553,12773,0,0;QS=3,0;MQSB=0.856268;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,118:3:0	0,27,240:9:0
+X	449	.	A	<*>	0	.	DP=28;I16=15,12,0,0,1091,45981,0,0,1558,91682,0,0,552,12748,0,0;QS=3,0;MQSB=0.84246;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,90:2:0	0,27,245:9:0
+X	450	.	G	<*>	0	.	DP=28;I16=15,12,0,0,1069,44603,0,0,1558,91682,0,0,551,12741,0,0;QS=3,0;MQSB=0.84246;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,91:2:0	0,27,233:9:0
+X	451	.	A	<*>	0	.	DP=28;I16=15,12,0,0,1021,41371,0,0,1558,91682,0,0,550,12752,0,0;QS=3,0;MQSB=0.84246;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,93:2:0	0,27,244:9:0
+X	452	.	A	<*>	0	.	DP=31;I16=18,11,0,0,1079,43353,0,0,1678,98882,0,0,530,12420,0,0;QS=3,0;MQSB=0.884952;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,9,110:3:0	0,24,225:8:0
+X	453	.	A	<*>	0	.	DP=31;I16=17,11,0,0,1037,41069,0,0,1649,98041,0,0,508,11882,0,0;QS=3,0;MQSB=0.967085;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,9,111:3:0	0,21,221:7:0
+X	454	.	A	<*>	0	.	DP=31;I16=18,12,0,0,1158,47028,0,0,1738,102482,0,0,554,12904,0,0;QS=3,0;MQSB=0.878946;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,9,113:3:0	0,30,255:10:0
+X	455	.	T	<*>	0	.	DP=32;I16=17,13,0,0,1148,46574,0,0,1715,100251,0,0,550,12864,0,0;QS=3,0;MQSB=0.973855;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,113:3:0	0,33,255:11:0
+X	456	.	G	<*>	0	.	DP=32;I16=17,13,0,0,1161,47287,0,0,1746,103010,0,0,534,12296,0,0;QS=3,0;MQSB=0.998031;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,9,116:3:0	0,30,245:10:0
+X	457	.	C	<*>	0	.	DP=33;I16=19,13,0,0,1218,48642,0,0,1835,107451,0,0,563,12967,0,0;QS=3,0;MQSB=0.985204;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,9,118:3:0	0,33,255:11:0
+X	458	.	A	<*>	0	.	DP=33;I16=19,13,0,0,1226,49034,0,0,1835,107451,0,0,568,12990,0,0;QS=3,0;MQSB=0.985204;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,9,111:3:0	0,33,255:11:0
+X	459	.	T	<*>	0	.	DP=33;I16=18,13,0,0,1167,46981,0,0,1775,103851,0,0,565,12945,0,0;QS=3,0;MQSB=0.980167;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,92:2:0	0,33,255:11:0
+X	460	.	G	<*>	0	.	DP=32;I16=19,12,0,0,1219,50105,0,0,1775,103851,0,0,575,12929,0,0;QS=3,0;MQSB=0.989977;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,9,116:3:0	0,30,255:10:0
+X	461	.	T	<*>	0	.	DP=32;I16=19,12,0,0,1213,49819,0,0,1775,103851,0,0,577,12845,0,0;QS=3,0;MQSB=0.989977;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,9,115:3:0	0,30,255:10:0
+X	462	.	G	<*>	0	.	DP=32;I16=19,12,0,0,1190,48962,0,0,1775,103851,0,0,580,12792,0,0;QS=3,0;MQSB=0.989977;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,119:4:0	0,30,241:10:0
+X	463	.	G	<*>	0	.	DP=32;I16=19,12,0,0,1114,44214,0,0,1775,103851,0,0,584,12770,0,0;QS=3,0;MQSB=0.989977;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,114:4:0	0,30,221:10:0
+X	464	.	A	<*>	0	.	DP=32;I16=18,11,0,0,1100,43908,0,0,1686,99410,0,0,556,12106,0,0;QS=3,0;MQSB=0.99095;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,133:4:0	0,24,213:8:0
+X	465	.	C	<*>	0	.	DP=33;I16=20,11,0,0,1191,48085,0,0,1775,103851,0,0,586,12786,0,0;QS=3,0;MQSB=0.996597;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,140:5:0	0,27,231:9:0
+X	466	.	A	<*>	0	.	DP=34;I16=21,12,0,0,1293,53311,0,0,1895,111051,0,0,597,12897,0,0;QS=3,0;MQSB=0.995633;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,154:5:0	0,30,255:10:0
+X	467	.	A	<*>	0	.	DP=34;I16=21,11,0,0,1256,51450,0,0,1835,107451,0,0,597,12891,0,0;QS=3,0;MQSB=0.998231;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,157:5:0	0,27,248:9:0
+X	468	.	A	<*>	0	.	DP=35;I16=22,12,0,0,1274,51268,0,0,1955,114651,0,0,604,12904,0,0;QS=3,0;MQSB=0.997406;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,154:5:0	0,30,251:10:0
+X	469	.	A	<*>	0	.	DP=35;I16=22,12,0,0,1285,52989,0,0,1955,114651,0,0,608,12940,0,0;QS=3,0;MQSB=0.997406;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,146:5:0	0,30,255:10:0
+X	470	.	G	<*>	0	.	DP=35;I16=22,12,0,0,1281,51055,0,0,1955,114651,0,0,612,13016,0,0;QS=3,0;MQSB=0.997406;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,148:5:0	0,30,238:10:0
+X	471	.	T	<*>	0	.	DP=36;I16=22,11,0,0,1239,49021,0,0,1918,113282,0,0,599,12825,0,0;QS=3,0;MQSB=0.915545;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,150:5:0	0,27,232:9:0
+X	472	.	T	<*>	0	.	DP=35;I16=21,12,0,0,1245,48915,0,0,1926,113810,0,0,595,12559,0,0;QS=3,0;MQSB=0.988858;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,153:5:0	0,27,237:9:0
+X	473	.	G	<*>	0	.	DP=35;I16=21,12,0,0,1307,53473,0,0,1926,113810,0,0,599,12651,0,0;QS=3,0;MQSB=0.988858;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,141:5:0	0,27,249:9:0
+X	474	.	G	<*>	0	.	DP=36;I16=22,12,0,0,1284,51708,0,0,1986,117410,0,0,602,12734,0,0;QS=3,0;MQSB=0.986937;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,131:5:0	0,30,255:10:0
+X	475	.	G	<*>	0	.	DP=36;I16=23,12,0,0,1311,51609,0,0,2015,118251,0,0,631,13485,0,0;QS=3,0;MQSB=0.998642;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,141:5:0	0,33,252:11:0
+X	476	.	A	<*>	0	.	DP=36;I16=23,12,0,0,1312,52078,0,0,2015,118251,0,0,634,13606,0,0;QS=3,0;MQSB=0.998642;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,157:5:0	0,33,255:11:0
+X	477	.	T	<*>	0	.	DP=36;I16=23,12,0,0,1318,52668,0,0,2015,118251,0,0,637,13773,0,0;QS=3,0;MQSB=0.998642;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,148:5:0	0,33,255:11:0
+X	478	.	T	<*>	0	.	DP=38;I16=25,12,0,0,1338,51774,0,0,2135,125451,0,0,637,13833,0,0;QS=3,0;MQSB=0.999868;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,18,154:6:0	0,33,255:11:0
+X	479	.	A	<*>	0	.	DP=38;I16=25,12,0,0,1420,57788,0,0,2135,125451,0,0,639,13935,0,0;QS=3,0;MQSB=0.999868;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,18,163:6:0	0,33,255:11:0
+X	480	.	G	<*>	0	.	DP=37;I16=25,11,0,0,1438,60172,0,0,2075,121851,0,0,641,14029,0,0;QS=3,0;MQSB=0.999853;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,18,165:6:0	0,33,255:11:0
+X	481	.	G	<*>	0	.	DP=37;I16=25,11,0,0,1392,55824,0,0,2075,121851,0,0,642,14112,0,0;QS=3,0;MQSB=0.999853;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,18,165:6:0	0,33,255:11:0
+X	482	.	A	<*>	0	.	DP=37;I16=24,11,0,0,1352,55134,0,0,2015,118251,0,0,618,13608,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,143:5:0	0,33,255:11:0
+X	483	.	G	<*>	0	.	DP=37;I16=24,12,0,0,1417,57747,0,0,2075,121851,0,0,642,14240,0,0;QS=3,0;MQSB=0.999437;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,18,165:6:0	0,33,255:11:0
+X	484	.	A	<*>	0	.	DP=36;I16=24,11,0,0,1340,53992,0,0,2015,118251,0,0,643,14281,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,168:6:0	0,33,255:11:0
+X	485	.	G	<*>	0	.	DP=35;I16=23,12,0,0,1329,51411,0,0,2015,118251,0,0,669,14931,0,0;QS=3,0;MQSB=0.998642;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,160:6:0	0,33,255:11:0
+X	486	.	A	<*>	0	.	DP=34;I16=22,12,0,0,1311,51523,0,0,1955,114651,0,0,671,14989,0,0;QS=3,0;MQSB=0.997406;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,173:6:0	0,33,255:11:0
+X	487	.	G	<*>	0	.	DP=34;I16=22,12,0,0,1306,50760,0,0,1955,114651,0,0,672,15030,0,0;QS=3,0;MQSB=0.997406;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,169:6:0	0,33,255:11:0
+X	488	.	A	<*>	0	.	DP=35;I16=22,12,0,0,1274,48140,0,0,1986,117410,0,0,646,14380,0,0;QS=3,0;MQSB=0.986937;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,177:6:0	0,30,255:10:0
+X	489	.	A	<*>	0	.	DP=35;I16=23,12,0,0,1264,46916,0,0,2015,118251,0,0,671,15015,0,0;QS=3,0;MQSB=0.998642;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,175:6:0	0,33,255:11:0
+X	490	.	A	<*>	0	.	DP=36;I16=24,12,0,0,1332,50280,0,0,2075,121851,0,0,671,15061,0,0;QS=3,0;MQSB=0.999437;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,188:7:0	0,33,255:11:0
+X	491	.	T	<*>	0	.	DP=36;I16=24,12,0,0,1284,46802,0,0,2075,121851,0,0,671,15093,0,0;QS=3,0;MQSB=0.999437;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,178:7:0	0,33,255:11:0
+X	492	.	G	<*>	0	.	DP=35;I16=21,12,0,0,1252,48326,0,0,1926,113810,0,0,621,13859,0,0;QS=3,0;MQSB=0.988858;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,172:6:0	0,30,251:10:0
+X	493	.	A	<*>	0	.	DP=34;I16=22,11,0,0,1273,49481,0,0,1926,113810,0,0,650,14672,0,0;QS=3,0;MQSB=0.981935;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,186:7:0	0,24,240:8:0
+X	494	.	A	<*>	0	.	DP=34;I16=22,12,0,0,1326,52604,0,0,1986,117410,0,0,672,15182,0,0;QS=3,0;MQSB=0.986937;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,196:7:0	0,27,255:9:0
+X	495	.	G	<*>	0	.	DP=34;I16=21,12,0,0,1255,48577,0,0,1926,113810,0,0,647,14611,0,0;QS=3,0;MQSB=0.988858;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,168:6:0	0,27,244:9:0
+X	496	.	A	<*>	0	.	DP=34;I16=22,12,0,0,1250,46926,0,0,1986,117410,0,0,670,15220,0,0;QS=3,0;MQSB=0.986937;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,186:7:0	0,27,249:9:0
+X	497	.	C	<*>	0	.	DP=34;I16=22,12,0,0,1250,47006,0,0,1986,117410,0,0,665,15087,0,0;QS=3,0;MQSB=0.986937;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,164:7:0	0,27,239:9:0
+X	498	.	A	<*>	0	.	DP=34;I16=22,12,0,0,1286,49158,0,0,1986,117410,0,0,661,14987,0,0;QS=3,0;MQSB=0.986937;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,185:7:0	0,27,252:9:0
+X	499	.	T	<*>	0	.	DP=34;I16=23,11,0,0,1224,45284,0,0,1986,117410,0,0,659,14919,0,0;QS=3,0;MQSB=0.979712;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,183:7:0	0,30,255:10:0
+X	500	.	A	<*>	0	.	DP=34;I16=23,11,0,0,1230,45152,0,0,1986,117410,0,0,657,14833,0,0;QS=3,0;MQSB=0.979712;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,179:7:0	0,30,255:10:0
+X	501	.	T	<*>	0	.	DP=33;I16=23,10,0,0,1241,47167,0,0,1926,113810,0,0,656,14778,0,0;QS=3,0;MQSB=0.972757;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,186:7:0	0,27,241:9:0
+X	502	.	G	<*>	0	.	DP=33;I16=23,10,0,0,1215,45829,0,0,1926,113810,0,0,655,14753,0,0;QS=3,0;MQSB=0.972757;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,183:7:0	0,27,235:9:0
+X	503	.	T	<*>	0	.	DP=34;I16=23,11,0,0,1194,43366,0,0,1986,117410,0,0,654,14758,0,0;QS=3,0;MQSB=0.979712;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,177:7:0	0,27,234:9:0
+X	504	.	C	<*>	0	.	DP=34;I16=23,11,0,0,1218,45552,0,0,1986,117410,0,0,651,14643,0,0;QS=3,0;MQSB=0.979712;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,183:7:0	0,27,219:9:0
+X	505	.	C	<*>	0	.	DP=35;I16=23,11,0,0,1207,44321,0,0,1986,117410,0,0,641,14509,0,0;QS=3,0;MQSB=0.979712;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,189:7:0	0,27,221:9:0
+X	506	.	A	<*>	0	.	DP=35;I16=24,11,0,0,1266,46776,0,0,2046,121010,0,0,646,14504,0,0;QS=3,0;MQSB=0.977529;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,188:7:0	0,27,231:9:0
+X	507	.	C	<*>	0	.	DP=35;I16=23,11,0,0,1220,45016,0,0,1986,117410,0,0,635,14401,0,0;QS=3,0;MQSB=0.979712;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,183:7:0	0,27,226:9:0
+X	508	.	A	<*>	0	.	DP=34;I16=24,10,0,0,1204,44542,0,0,1986,117410,0,0,643,14491,0,0;QS=3,0;MQSB=0.970272;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,189:7:0	0,27,220:9:0
+X	509	.	C	<*>	0	.	DP=34;I16=24,10,0,0,1272,48272,0,0,1986,117410,0,0,640,14430,0,0;QS=3,0;MQSB=0.970272;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,186:7:0	0,27,241:9:0
+X	510	.	A	<*>	0	.	DP=34;I16=22,11,0,0,1194,44196,0,0,1926,113810,0,0,613,13773,0,0;QS=3,0;MQSB=0.981935;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,187:7:0	0,24,221:8:0
+X	511	.	A	<*>	0	.	DP=34;I16=23,11,0,0,1222,45562,0,0,1986,117410,0,0,637,14395,0,0;QS=3,0;MQSB=0.979712;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,195:7:0	0,24,233:8:0
+X	512	.	A	C,<*>	0	.	DP=33;I16=22,10,0,1,1121,40793,13,169,1866,110210,60,3600,628,14340,9,81;QS=2.97719,0.022807,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.981935;BQB=1;MQ0F=0	PL:DP:DV	0,39,255,51,255,255:18:1	0,21,183,21,183,183:7:0	0,24,231,24,231,231:8:0
+X	513	.	A	<*>	0	.	DP=32;I16=20,10,0,0,1115,42183,0,0,1746,103010,0,0,598,13624,0,0;QS=3,0;MQSB=0.980594;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,175:6:0	0,24,233:8:0
+X	514	.	A	T,<*>	0	.	DP=32;I16=20,9,0,1,1066,40004,16,256,1686,99410,60,3600,586,13500,11,121;QS=2.97075,0.0292505,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.980594;BQB=1;MQ0F=0	PL:DP:DV	0,31,255,45,255,255:16:1	0,18,171,18,171,171:6:0	0,24,235,24,235,235:8:0
+X	515	.	C	<*>	0	.	DP=32;I16=18,10,0,0,1010,37294,0,0,1626,95810,0,0,561,12915,0,0;QS=3,0;MQSB=0.986018;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,167:6:0	0,24,211:8:0
+X	516	.	C	<*>	0	.	DP=32;I16=21,10,0,0,1100,40570,0,0,1806,106610,0,0,612,13954,0,0;QS=3,0;MQSB=0.977926;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,187:7:0	0,24,215:8:0
+X	517	.	T	<*>	0	.	DP=33;I16=23,10,0,0,1269,49995,0,0,1926,113810,0,0,636,14626,0,0;QS=3,0;MQSB=0.972757;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,201:7:0	0,24,242:8:0
+X	518	.	G	<*>	0	.	DP=34;I16=24,10,0,0,1247,46839,0,0,1986,117410,0,0,636,14696,0,0;QS=3,0;MQSB=0.970272;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,182:7:0	0,24,220:8:0
+X	519	.	T	<*>	0	.	DP=36;I16=25,11,0,0,1283,46693,0,0,2106,124610,0,0,636,14742,0,0;QS=3,0;MQSB=0.975394;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,21,177:7:0	0,24,224:8:0
+X	520	.	T	<*>	0	.	DP=36;I16=24,11,0,0,1238,44894,0,0,2046,121010,0,0,613,14193,0,0;QS=3,0;MQSB=0.977529;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,21,180:7:0	0,24,223:8:0
+X	521	.	C	<*>	0	.	DP=34;I16=25,9,0,0,1280,49454,0,0,1986,117410,0,0,641,14875,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,21,191:7:0	0,21,204:7:0
+X	522	.	A	<*>	0	.	DP=32;I16=24,8,0,0,1158,43228,0,0,1897,112969,0,0,646,14960,0,0;QS=3,0;MQSB=0.872525;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,21,185:7:0	0,15,170:5:0
+X	523	.	T	G,<*>	0	.	DP=32;I16=23,8,1,0,1184,45708,15,225,1837,109369,60,3600,626,14446,25,625;QS=2.9794,0.0206044,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.872525;BQB=1;MQ0F=0	PL:DP:DV	0,44,255,57,255,255:20:1	0,21,191,21,191,191:7:0	0,15,166,15,166,166:5:0
+X	524	.	T	<*>	0	.	DP=32;I16=24,7,0,0,1084,39474,0,0,1837,109369,0,0,629,14483,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,21,194:7:0	0,12,140:4:0
+X	525	.	G	<*>	0	.	DP=32;I16=24,7,0,0,1181,45669,0,0,1837,109369,0,0,631,14495,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,21,188:7:0	0,12,129:4:0
+X	526	.	C	<*>	0	.	DP=32;I16=24,7,0,0,1146,43950,0,0,1860,111600,0,0,633,14531,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,21,185:7:0	0,12,131:4:0
+X	527	.	A	<*>	0	.	DP=33;I16=24,8,0,0,1209,46265,0,0,1897,112969,0,0,636,14634,0,0;QS=3,0;MQSB=0.872525;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,194:7:0	0,18,181:6:0
+X	528	.	G	<*>	0	.	DP=33;I16=24,8,0,0,1256,49824,0,0,1897,112969,0,0,634,14484,0,0;QS=3,0;MQSB=0.872525;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,18,169:6:0	0,18,193:6:0
+X	529	.	C	<*>	0	.	DP=32;I16=24,7,0,0,1148,44362,0,0,1837,109369,0,0,633,14357,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,187:7:0	0,18,184:6:0
+X	530	.	T	<*>	0	.	DP=32;I16=25,7,0,0,1244,49168,0,0,1897,112969,0,0,657,14883,0,0;QS=3,0;MQSB=0.850154;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,196:7:0	0,18,202:6:0
+X	531	.	T	<*>	0	.	DP=32;I16=25,7,0,0,1177,44171,0,0,1897,112969,0,0,654,14714,0,0;QS=3,0;MQSB=0.850154;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,181:7:0	0,18,193:6:0
+X	532	.	T	<*>	0	.	DP=32;I16=24,7,0,0,1153,43543,0,0,1837,109369,0,0,630,14116,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,181:7:0	0,18,192:6:0
+X	533	.	C	<*>	0	.	DP=32;I16=24,7,0,0,1142,43940,0,0,1837,109369,0,0,619,13649,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,178:7:0	0,18,180:6:0
+X	534	.	T	<*>	0	.	DP=31;I16=24,6,0,0,1212,49426,0,0,1777,105769,0,0,615,13479,0,0;QS=3,0;MQSB=0.82403;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,205:7:0	0,18,205:6:0
+X	535	.	A	<*>	0	.	DP=31;I16=24,6,0,0,1080,39870,0,0,1777,105769,0,0,611,13341,0,0;QS=3,0;MQSB=0.82403;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,194:7:0	0,18,189:6:0
+X	536	.	C	<*>	0	.	DP=31;I16=24,7,0,0,1097,40707,0,0,1837,109369,0,0,631,13809,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,184:7:0	0,18,157:6:0
+X	537	.	C	<*>	0	.	DP=31;I16=22,7,0,0,1034,38564,0,0,1717,102169,0,0,587,12861,0,0;QS=3,0;MQSB=0.854582;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,172:7:0	0,18,183:6:0
+X	538	.	A	<*>	0	.	DP=31;I16=24,7,0,0,1138,42478,0,0,1837,109369,0,0,620,13536,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,189:7:0	0,18,181:6:0
+X	539	.	T	<*>	0	.	DP=31;I16=24,7,0,0,1134,42070,0,0,1837,109369,0,0,614,13422,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,178:7:0	0,18,181:6:0
+X	540	.	C	<*>	0	.	DP=31;I16=24,7,0,0,1148,43768,0,0,1837,109369,0,0,608,13340,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,177:7:0	0,18,178:6:0
+X	541	.	A	<*>	0	.	DP=32;I16=24,6,0,0,1083,40483,0,0,1777,105769,0,0,551,11991,0,0;QS=3,0;MQSB=0.82403;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,180:8:0	0,15,150:5:0
+X	542	.	C	<*>	0	.	DP=33;I16=25,6,0,0,1123,41759,0,0,1837,109369,0,0,570,12552,0,0;QS=3,0;MQSB=0.822578;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,172:8:0	0,18,174:6:0
+X	543	.	C	<*>	0	.	DP=34;I16=25,9,0,0,1219,45959,0,0,1986,117410,0,0,601,13245,0,0;QS=3,0;MQSB=0.621145;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,27,194:9:0	0,18,188:6:0
+X	544	.	A	<*>	0	.	DP=33;I16=24,8,0,0,1170,43898,0,0,1866,110210,0,0,570,12506,0,0;QS=3,0;MQSB=0.579578;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,24,192:8:0	0,18,180:6:0
+X	545	.	A	<*>	0	.	DP=33;I16=25,8,0,0,1174,43602,0,0,1926,113810,0,0,587,12951,0,0;QS=3,0;MQSB=0.576102;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,24,190:8:0	0,18,184:6:0
+X	546	.	A	<*>	0	.	DP=32;I16=24,8,0,0,1126,41444,0,0,1866,110210,0,0,580,12802,0,0;QS=3,0;MQSB=0.579578;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,166:7:0	0,18,193:6:0
+X	547	.	A	<*>	0	.	DP=32;I16=24,7,0,0,1129,42381,0,0,1806,106610,0,0,547,12009,0,0;QS=3,0;MQSB=0.525788;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,180:7:0	0,18,195:6:0
+X	548	.	A	<*>	0	.	DP=33;I16=23,9,0,0,1153,42673,0,0,1866,110210,0,0,561,12489,0,0;QS=3,0;MQSB=0.628357;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,181:7:0	0,21,211:7:0
+X	549	.	T	G,<*>	0	.	DP=32;I16=22,8,0,1,1101,40987,20,400,1746,103010,60,3600,530,11716,25,625;QS=2.96748,0.0325203,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.632337;BQB=1;MQ0F=0	PL:DP:DV	0,31,255,48,255,255:17:1	0,21,168,21,168,168:7:0	0,21,208,21,208,208:7:0
+X	550	.	T	<*>	0	.	DP=32;I16=22,9,0,0,1052,37298,0,0,1806,106610,0,0,548,12176,0,0;QS=3,0;MQSB=0.632337;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,150:7:0	0,21,220:7:0
+X	551	.	G	<*>	0	.	DP=31;I16=22,9,0,0,1121,41639,0,0,1806,106610,0,0,541,12045,0,0;QS=3,0;MQSB=0.632337;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,172:7:0	0,21,208:7:0
+X	552	.	C	<*>	0	.	DP=30;I16=21,9,0,0,1093,41365,0,0,1746,103010,0,0,535,11947,0,0;QS=3,0;MQSB=0.636601;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,167:7:0	0,21,208:7:0
+X	553	.	A	<*>	0	.	DP=30;I16=20,8,0,0,981,35387,0,0,1626,95810,0,0,485,10831,0,0;QS=3,0;MQSB=0.596163;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,150:6:0	0,21,194:7:0
+X	554	.	A	<*>	0	.	DP=30;I16=19,9,0,0,975,35601,0,0,1626,95810,0,0,488,10906,0,0;QS=3,0;MQSB=0.646113;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,139:5:0	0,24,211:8:0
+X	555	.	A	<*>	0	.	DP=30;I16=20,10,0,0,1024,36526,0,0,1746,103010,0,0,514,11392,0,0;QS=3,0;MQSB=0.679025;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,150:6:0	0,21,211:7:0
+X	556	.	C	<*>	0	.	DP=29;I16=20,9,0,0,1055,39195,0,0,1709,101641,0,0,509,11219,0,0;QS=3,0;MQSB=0.894839;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,158:6:0	0,18,186:6:0
+X	557	.	A	<*>	0	.	DP=27;I16=18,9,0,0,987,36749,0,0,1589,94441,0,0,506,11074,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,157:6:0	0,18,186:6:0
+X	558	.	A	<*>	0	.	DP=27;I16=18,8,0,0,948,35808,0,0,1560,93600,0,0,477,10281,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,143:5:0	0,18,177:6:0
+X	559	.	C	A,<*>	0	.	DP=27;I16=17,8,0,1,908,33726,14,196,1500,90000,29,841,448,9516,25,625;QS=2.92708,0.0729167,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.90038;BQB=1;MQ0F=0	PL:DP:DV	0,42,255,42,255,255:14:0	0,4,116,15,119,123:6:1	0,18,169,18,169,169:6:0
+X	560	.	C	<*>	0	.	DP=28;I16=19,9,0,0,992,36552,0,0,1649,98041,0,0,494,10654,0,0;QS=3,0;MQSB=0.896555;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,160:6:0	0,21,181:7:0
+X	561	.	A	<*>	0	.	DP=28;I16=18,9,0,0,963,35455,0,0,1589,94441,0,0,466,9946,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,158:6:0	0,21,194:7:0
+X	562	.	C	<*>	0	.	DP=28;I16=18,9,0,0,1006,38392,0,0,1589,94441,0,0,463,9893,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,153:6:0	0,21,187:7:0
+X	563	.	A	<*>	0	.	DP=27;I16=17,9,0,0,893,32413,0,0,1529,90841,0,0,460,9820,0,0;QS=3,0;MQSB=0.90038;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,149:5:0	0,21,179:7:0
+X	564	.	C	<*>	0	.	DP=27;I16=18,9,0,0,859,28747,0,0,1589,94441,0,0,482,10402,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,121:5:0	0,21,182:7:0
+X	565	.	G	<*>	0	.	DP=30;I16=17,9,0,0,818,26928,0,0,1560,93600,0,0,454,9764,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,96:4:0	0,21,154:7:0
+X	566	.	C	<*>	0	.	DP=29;I16=15,11,0,0,903,33405,0,0,1529,90841,0,0,424,9084,0,0;QS=3,0;MQSB=0.927041;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,155:5:0	0,18,167:6:0
+X	567	.	C	<*>	0	.	DP=30;I16=15,12,0,0,932,33774,0,0,1589,94441,0,0,462,10178,0,0;QS=3,0;MQSB=0.935229;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,155:5:0	0,21,196:7:0
+X	568	.	C	<*>	0	.	DP=29;I16=15,13,0,0,1057,40817,0,0,1649,98041,0,0,482,10438,0,0;QS=3,0;MQSB=0.942064;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,183:6:0	0,18,189:6:0
+X	569	.	T	<*>	0	.	DP=30;I16=16,12,0,0,1056,41296,0,0,1649,98041,0,0,493,10655,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,190:6:0	0,21,213:7:0
+X	570	.	T	<*>	0	.	DP=30;I16=16,12,0,0,954,34972,0,0,1680,100800,0,0,472,10086,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,157:5:0	0,21,195:7:0
+X	571	.	C	<*>	0	.	DP=31;I16=17,12,0,0,1061,40675,0,0,1740,104400,0,0,472,10158,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,155:5:0	0,21,193:7:0
+X	572	.	A	<*>	0	.	DP=31;I16=18,12,0,0,1102,42642,0,0,1769,105241,0,0,499,10887,0,0;QS=3,0;MQSB=0.929991;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,203:7:0	0,18,175:6:0
+X	573	.	A	<*>	0	.	DP=31;I16=18,12,0,0,1057,38473,0,0,1769,105241,0,0,501,10975,0,0;QS=3,0;MQSB=0.929991;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,199:7:0	0,18,178:6:0
+X	574	.	C	A,<*>	0	.	DP=31;I16=18,11,0,1,1088,41328,15,225,1740,104400,29,841,478,10422,25,625;QS=2.94071,0.0592885,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.929991;BQB=1;MQ0F=0	PL:DP:DV	0,48,255,48,255,255:16:0	0,9,170,21,173,177:8:1	0,18,173,18,173,173:6:0
+X	575	.	T	<*>	0	.	DP=30;I16=16,10,0,0,1024,41260,0,0,1560,93600,0,0,448,9842,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,21,209:7:0	0,15,163:5:0
+X	576	.	G	<*>	0	.	DP=30;I16=17,12,0,0,1047,40077,0,0,1709,101641,0,0,507,11087,0,0;QS=3,0;MQSB=0.931617;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,208:8:0	0,15,151:5:0
+X	577	.	G	<*>	0	.	DP=30;I16=16,12,0,0,999,37747,0,0,1649,98041,0,0,489,10755,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,204:8:0	0,15,146:5:0
+X	578	.	G	<*>	0	.	DP=29;I16=16,13,0,0,975,34803,0,0,1709,101641,0,0,520,11286,0,0;QS=3,0;MQSB=0.940317;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,198:8:0	0,15,151:5:0
+X	579	.	G	<*>	0	.	DP=30;I16=15,13,0,0,1028,38752,0,0,1649,98041,0,0,484,10514,0,0;QS=3,0;MQSB=0.942064;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,224:8:0	0,12,145:4:0
+X	580	.	A	C,<*>	0	.	DP=30;I16=15,14,1,0,1060,39178,16,256,1709,101641,60,3600,510,11078,17,289;QS=2.97338,0.0266223,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.946202;BQB=1;MQ0F=0	PL:DP:DV	0,34,255,48,255,255:17:1	0,24,221,24,221,221:8:0	0,15,155,15,155,155:5:0
+X	581	.	A	<*>	0	.	DP=31;I16=16,15,0,0,1083,39215,0,0,1829,108841,0,0,530,11384,0,0;QS=3,0;MQSB=0.951229;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,24,223:8:0	0,15,153:5:0
+X	582	.	C	<*>	0	.	DP=31;I16=15,15,0,0,1080,39870,0,0,1769,105241,0,0,519,11211,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,207:8:0	0,15,151:5:0
+X	583	.	T	<*>	0	.	DP=30;I16=16,14,0,0,1136,43996,0,0,1769,105241,0,0,539,11523,0,0;QS=3,0;MQSB=0.946202;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,238:8:0	0,15,163:5:0
+X	584	.	C	<*>	0	.	DP=31;I16=16,13,0,0,1051,39351,0,0,1709,101641,0,0,499,10619,0,0;QS=3,0;MQSB=0.960189;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,207:7:0	0,15,157:5:0
+X	585	.	A	<*>	0	.	DP=31;I16=17,14,0,0,1096,39866,0,0,1798,106082,0,0,549,11751,0,0;QS=3,0;MQSB=0.998229;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,24,211:8:0	0,15,157:5:0
+X	586	.	T	<*>	0	.	DP=31;I16=16,14,0,0,1081,39839,0,0,1738,102482,0,0,546,11796,0,0;QS=3,0;MQSB=0.999136;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,212:8:0	0,15,156:5:0
+X	587	.	C	<*>	0	.	DP=31;I16=17,13,0,0,1070,39402,0,0,1769,105241,0,0,532,11350,0,0;QS=3,0;MQSB=0.963674;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,201:7:0	0,15,155:5:0
+X	588	.	A	<*>	0	.	DP=31;I16=17,14,0,0,1126,41642,0,0,1798,106082,0,0,562,12140,0,0;QS=3,0;MQSB=0.998229;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,24,222:8:0	0,15,164:5:0
+X	589	.	A	<*>	0	.	DP=31;I16=17,14,0,0,1157,43973,0,0,1798,106082,0,0,568,12340,0,0;QS=3,0;MQSB=0.998229;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,24,236:8:0	0,15,165:5:0
+X	590	.	C	<*>	0	.	DP=32;I16=16,14,0,0,1094,41302,0,0,1769,105241,0,0,549,11951,0,0;QS=3,0;MQSB=0.958545;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,192:6:0	0,18,175:6:0
+X	591	.	A	<*>	0	.	DP=31;I16=16,15,0,0,1165,44163,0,0,1798,106082,0,0,579,12695,0,0;QS=3,0;MQSB=0.999805;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,209:7:0	0,18,188:6:0
+X	592	.	A	<*>	0	.	DP=31;I16=15,15,0,0,1114,42144,0,0,1738,102482,0,0,571,12651,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,215:7:0	0,18,182:6:0
+X	593	.	C	<*>	0	.	DP=31;I16=15,14,0,0,1065,39889,0,0,1709,101641,0,0,550,12132,0,0;QS=3,0;MQSB=0.954405;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,191:6:0	0,18,174:6:0
+X	594	.	A	<*>	0	.	DP=33;I16=16,16,0,0,1163,42917,0,0,1858,109682,0,0,572,12672,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,205:7:0	0,24,212:8:0
+X	595	.	A	<*>	0	.	DP=33;I16=17,16,0,0,1130,39996,0,0,1918,113282,0,0,589,12905,0,0;QS=3,0;MQSB=0.999838;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,198:7:0	0,24,213:8:0
+X	596	.	A	<*>	0	.	DP=33;I16=16,16,0,0,1059,37039,0,0,1858,109682,0,0,590,12952,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,169:7:0	0,24,230:8:0
+X	597	.	C	<*>	0	.	DP=33;I16=17,16,0,0,1196,44890,0,0,1918,113282,0,0,592,12990,0,0;QS=3,0;MQSB=0.999838;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,204:7:0	0,24,220:8:0
+X	598	.	T	<*>	0	.	DP=33;I16=16,16,0,0,1214,47104,0,0,1858,109682,0,0,593,13013,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,217:7:0	0,24,239:8:0
+X	599	.	T	<*>	0	.	DP=33;I16=16,17,0,0,1183,43669,0,0,1918,113282,0,0,599,13095,0,0;QS=3,0;MQSB=0.999838;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,197:7:0	0,27,247:9:0
+X	600	.	G	<*>	0	.	DP=32;I16=15,17,0,0,1174,44066,0,0,1858,109682,0,0,601,13145,0,0;QS=3,0;MQSB=0.999287;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,194:7:0	0,24,232:8:0
+X	601	.	T	<*>	0	.	DP=32;I16=15,17,0,0,1114,39954,0,0,1858,109682,0,0,603,13227,0,0;QS=3,0;MQSB=0.999287;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,188:7:0	0,24,235:8:0
+X	602	.	G	<*>	0	.	DP=32;I16=15,15,0,0,1090,40326,0,0,1769,105241,0,0,555,12091,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,185:6:0	0,24,229:8:0
+X	603	.	G	<*>	0	.	DP=31;I16=15,16,0,0,1052,37460,0,0,1798,106082,0,0,607,13437,0,0;QS=3,0;MQSB=0.999805;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,186:7:0	0,24,219:8:0
+X	604	.	T	<*>	0	.	DP=31;I16=14,16,0,0,1009,35893,0,0,1769,105241,0,0,564,12540,0,0;QS=3,0;MQSB=0.958545;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,195:8:0	0,21,212:7:0
+X	605	.	T	<*>	0	.	DP=31;I16=12,15,0,0,1001,37741,0,0,1589,94441,0,0,514,11258,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,200:7:0	0,21,214:7:0
+X	606	.	T	<*>	0	.	DP=31;I16=13,16,0,0,992,35202,0,0,1709,101641,0,0,587,13125,0,0;QS=3,0;MQSB=0.960189;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,21,189:7:0	0,24,217:8:0
+X	607	.	A	<*>	0	.	DP=31;I16=14,16,0,0,1027,36129,0,0,1738,102482,0,0,607,13577,0,0;QS=3,0;MQSB=0.999136;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,176:7:0	0,24,222:8:0
+X	608	.	C	<*>	0	.	DP=32;I16=15,15,0,0,983,33775,0,0,1769,105241,0,0,564,12564,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,21,178:7:0	0,27,214:9:0
+X	609	.	C	<*>	0	.	DP=32;I16=14,17,0,0,1074,38220,0,0,1798,106082,0,0,606,13678,0,0;QS=3,0;MQSB=0.998229;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,190:7:0	0,27,238:9:0
+X	610	.	C	<*>	0	.	DP=32;I16=15,16,0,0,1158,44218,0,0,1829,108841,0,0,594,13444,0,0;QS=3,0;MQSB=0.951229;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,211:8:0	0,27,246:9:0
+X	611	.	A	<*>	0	.	DP=32;I16=15,16,0,0,1080,39204,0,0,1798,106082,0,0,590,13260,0,0;QS=3,0;MQSB=0.999805;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,220:9:0	0,27,246:9:0
+X	612	.	C	<*>	0	.	DP=33;I16=16,17,0,0,1175,43305,0,0,1918,113282,0,0,617,13993,0,0;QS=3,0;MQSB=0.999838;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,27,214:9:0	0,27,250:9:0
+X	613	.	A	<*>	0	.	DP=34;I16=16,17,0,0,1131,40011,0,0,1949,116041,0,0,604,13874,0,0;QS=3,0;MQSB=0.954207;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,27,223:9:0	0,27,239:9:0
+X	614	.	C	<*>	0	.	DP=34;I16=16,17,0,0,1183,43743,0,0,1949,116041,0,0,608,14022,0,0;QS=3,0;MQSB=0.954207;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,27,223:9:0	0,27,245:9:0
+X	615	.	A	<*>	0	.	DP=34;I16=16,18,0,0,1199,43809,0,0,1978,116882,0,0,626,14394,0,0;QS=3,0;MQSB=0.999405;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,30,240:10:0	0,27,254:9:0
+X	616	.	A	<*>	0	.	DP=34;I16=16,17,0,0,1190,44024,0,0,1949,116041,0,0,615,14351,0,0;QS=3,0;MQSB=0.954207;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,27,247:9:0	0,27,255:9:0
+X	617	.	T	<*>	0	.	DP=33;I16=15,18,0,0,1170,43066,0,0,1918,113282,0,0,630,14624,0,0;QS=3,0;MQSB=0.998531;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,30,241:10:0	0,27,255:9:0
+X	618	.	G	<*>	0	.	DP=34;I16=15,19,0,0,1166,41452,0,0,1978,116882,0,0,632,14706,0,0;QS=3,0;MQSB=0.997597;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,30,248:10:0	0,27,240:9:0
+X	619	.	G	<*>	0	.	DP=32;I16=14,18,0,0,1153,42591,0,0,1858,109682,0,0,638,14816,0,0;QS=3,0;MQSB=0.997118;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,30,254:10:0	0,27,247:9:0
+X	620	.	A	<*>	0	.	DP=32;I16=14,17,0,0,1083,39757,0,0,1798,106082,0,0,616,14176,0,0;QS=3,0;MQSB=0.998229;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,30,248:10:0	0,27,255:9:0
+X	621	.	A	<*>	0	.	DP=32;I16=13,18,0,0,1170,45248,0,0,1798,106082,0,0,627,14519,0,0;QS=3,0;MQSB=0.995005;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,255:9:0	0,27,255:9:0
+X	622	.	G	<*>	0	.	DP=32;I16=12,18,0,0,1060,39160,0,0,1769,105241,0,0,604,13888,0,0;QS=3,0;MQSB=0.968257;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,236:9:0	0,27,249:9:0
+X	623	.	A	T,<*>	0	.	DP=32;I16=10,18,1,0,1010,37414,15,225,1649,98041,60,3600,563,12953,25,625;QS=2.96144,0.0385604,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.969907;BQB=1;MQ0F=0	PL:DP:DV	0,20,241,33,244,246:12:1	0,24,213,24,213,213:8:0	0,27,255,27,255,255:9:0
+X	624	.	C	<*>	0	.	DP=32;I16=13,17,0,0,1034,37292,0,0,1738,102482,0,0,607,13887,0,0;QS=3,0;MQSB=0.996503;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,220:9:0	0,27,242:9:0
+X	625	.	C	<*>	0	.	DP=32;I16=13,18,0,0,1108,41138,0,0,1798,106082,0,0,632,14470,0,0;QS=3,0;MQSB=0.995005;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,234:9:0	0,27,249:9:0
+X	626	.	A	<*>	0	.	DP=32;I16=13,17,0,0,1090,40718,0,0,1738,102482,0,0,607,13827,0,0;QS=3,0;MQSB=0.996503;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,237:9:0	0,27,247:9:0
+X	627	.	C	<*>	0	.	DP=32;I16=12,18,0,0,1146,44452,0,0,1769,105241,0,0,607,13833,0,0;QS=3,0;MQSB=0.968257;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,244:9:0	0,27,255:9:0
+X	628	.	T	<*>	0	.	DP=32;I16=11,19,0,0,1124,43114,0,0,1769,105241,0,0,608,13862,0,0;QS=3,0;MQSB=0.972375;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,249:9:0	0,24,249:8:0
+X	629	.	T	<*>	0	.	DP=32;I16=12,19,0,0,1114,41138,0,0,1798,106082,0,0,634,14490,0,0;QS=3,0;MQSB=0.989977;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,247:9:0	0,24,226:8:0
+X	630	.	A	<*>	0	.	DP=31;I16=11,18,0,0,1101,42885,0,0,1740,104400,0,0,610,13844,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,24,242:8:0	0,24,235:8:0
+X	631	.	G	<*>	0	.	DP=31;I16=12,18,0,0,1083,40525,0,0,1769,105241,0,0,636,14474,0,0;QS=3,0;MQSB=0.929991;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,233:8:0	0,24,223:8:0
+X	632	.	C	<*>	0	.	DP=31;I16=11,18,0,0,1105,42665,0,0,1740,104400,0,0,612,13880,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,24,233:8:0	0,24,224:8:0
+X	633	.	A	<*>	0	.	DP=31;I16=12,18,0,0,1056,38190,0,0,1769,105241,0,0,638,14562,0,0;QS=3,0;MQSB=0.929991;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,218:8:0	0,24,214:8:0
+X	634	.	A	<*>	0	.	DP=31;I16=12,18,0,0,1110,42208,0,0,1769,105241,0,0,638,14594,0,0;QS=3,0;MQSB=0.929991;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,238:8:0	0,24,229:8:0
+X	635	.	C	<*>	0	.	DP=31;I16=11,18,0,0,1031,37871,0,0,1740,104400,0,0,613,14025,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,24,220:8:0	0,24,229:8:0
+X	636	.	A	<*>	0	.	DP=31;I16=11,18,0,0,1115,43327,0,0,1740,104400,0,0,611,14005,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,24,228:8:0	0,24,243:8:0
+X	637	.	A	<*>	0	.	DP=31;I16=12,18,0,0,1152,44602,0,0,1769,105241,0,0,634,14634,0,0;QS=3,0;MQSB=0.929991;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,238:8:0	0,24,242:8:0
+X	638	.	A	<*>	0	.	DP=31;I16=12,18,0,0,1118,42406,0,0,1769,105241,0,0,631,14611,0,0;QS=3,0;MQSB=0.929991;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,235:8:0	0,24,238:8:0
+X	639	.	A	<*>	0	.	DP=30;I16=11,18,0,0,1037,38233,0,0,1709,101641,0,0,602,13934,0,0;QS=3,0;MQSB=0.921439;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,24,230:8:0	0,24,227:8:0
+X	640	.	A	<*>	0	.	DP=31;I16=11,19,0,0,1154,45368,0,0,1769,105241,0,0,596,13804,0,0;QS=3,0;MQSB=0.91982;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,242:8:0	0,24,240:8:0
+X	641	.	G	<*>	0	.	DP=31;I16=11,19,0,0,1018,36496,0,0,1769,105241,0,0,590,13650,0,0;QS=3,0;MQSB=0.91982;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,214:8:0	0,24,218:8:0
+X	642	.	G	<*>	0	.	DP=30;I16=11,19,0,0,1057,38459,0,0,1769,105241,0,0,610,14148,0,0;QS=3,0;MQSB=0.91982;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,187:7:0	0,24,221:8:0
+X	643	.	A	<*>	0	.	DP=29;I16=11,17,0,0,969,35477,0,0,1649,98041,0,0,585,13605,0,0;QS=3,0;MQSB=0.923174;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,199:7:0	0,24,237:8:0
+X	644	.	C	A,<*>	0	.	DP=29;I16=9,18,1,0,898,30864,17,289,1620,97200,60,3600,549,12567,25,625;QS=2.95685,0.0431472,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=1;BQB=1;MQ0F=0	PL:DP:DV	0,22,236,36,239,243:13:1	0,21,195,21,195,195:7:0	0,24,204,24,204,204:8:0
+X	645	.	C	<*>	0	.	DP=30;I16=10,19,0,0,1067,40337,0,0,1709,101641,0,0,584,13274,0,0;QS=3,0;MQSB=0.909373;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,21,198:7:0	0,24,226:8:0
+X	646	.	A	T,<*>	0	.	DP=31;I16=9,20,1,0,1044,38174,14,196,1740,104400,60,3600,553,12499,25,625;QS=2.97113,0.028866,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=1;BQB=1;MQ0F=0	PL:DP:DV	0,27,255,39,255,255:14:1	0,21,197,21,197,197:7:0	0,27,229,27,229,229:9:0
+X	647	.	A	<*>	0	.	DP=33;I16=10,21,0,0,1041,35883,0,0,1829,108841,0,0,573,12999,0,0;QS=3,0;MQSB=0.906252;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,21,189:7:0	0,30,213:10:0
+X	648	.	A	<*>	0	.	DP=33;I16=11,22,0,0,1030,34122,0,0,1949,116041,0,0,594,13478,0,0;QS=3,0;MQSB=0.915545;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,188:7:0	0,30,194:10:0
+X	649	.	C	<*>	0	.	DP=32;I16=10,21,0,0,1099,39879,0,0,1860,111600,0,0,566,12738,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,188:7:0	0,27,217:9:0
+X	650	.	T	<*>	0	.	DP=31;I16=11,18,0,0,1006,37114,0,0,1709,101641,0,0,549,12407,0,0;QS=3,0;MQSB=0.921439;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,187:6:0	0,24,226:8:0
+X	651	.	C	<*>	0	.	DP=32;I16=11,20,0,0,1117,41181,0,0,1829,108841,0,0,581,13107,0,0;QS=3,0;MQSB=0.918304;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,186:6:0	0,27,229:9:0
+X	652	.	C	<*>	0	.	DP=32;I16=9,21,0,0,1126,43084,0,0,1769,105241,0,0,557,12423,0,0;QS=3,0;MQSB=0.893237;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,196:6:0	0,24,213:8:0
+X	653	.	T	<*>	0	.	DP=33;I16=9,23,0,0,1141,42631,0,0,1889,112441,0,0,556,12382,0,0;QS=3,0;MQSB=0.890331;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,198:6:0	0,24,225:8:0
+X	654	.	G	<*>	0	.	DP=33;I16=10,23,0,0,1171,43025,0,0,1949,116041,0,0,578,12798,0,0;QS=3,0;MQSB=0.903508;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,18,191:6:0	0,24,223:8:0
+X	655	.	G	<*>	0	.	DP=32;I16=10,22,0,0,1118,40202,0,0,1889,112441,0,0,575,12573,0,0;QS=3,0;MQSB=0.904837;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,181:6:0	0,24,213:8:0
+X	656	.	T	<*>	0	.	DP=32;I16=10,22,0,0,1090,38566,0,0,1889,112441,0,0,571,12333,0,0;QS=3,0;MQSB=0.904837;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,185:6:0	0,24,213:8:0
+X	657	.	A	<*>	0	.	DP=32;I16=10,21,0,0,1100,40006,0,0,1829,108841,0,0,557,12029,0,0;QS=3,0;MQSB=0.906252;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,183:6:0	0,24,191:8:0
+X	658	.	C	<*>	0	.	DP=32;I16=10,21,0,0,1115,41039,0,0,1829,108841,0,0,542,11520,0,0;QS=3,0;MQSB=0.906252;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,168:5:0	0,24,211:8:0
+X	659	.	A	<*>	0	.	DP=32;I16=10,21,0,0,1141,42897,0,0,1829,108841,0,0,547,11685,0,0;QS=3,0;MQSB=0.906252;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,191:6:0	0,24,216:8:0
+X	660	.	T	<*>	0	.	DP=33;I16=10,22,0,0,1139,41887,0,0,1889,112441,0,0,553,11659,0,0;QS=3,0;MQSB=0.904837;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,186:6:0	0,24,214:8:0
+X	661	.	G	<*>	0	.	DP=32;I16=9,22,0,0,1107,41531,0,0,1829,108841,0,0,549,11549,0,0;QS=3,0;MQSB=0.891738;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,191:6:0	0,21,188:7:0
+X	662	.	C	<*>	0	.	DP=32;I16=8,22,0,0,1087,40811,0,0,1800,108000,0,0,523,10991,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,192:6:0	0,21,187:7:0
+X	663	.	A	<*>	0	.	DP=32;I16=9,22,0,0,1036,36816,0,0,1829,108841,0,0,540,11388,0,0;QS=3,0;MQSB=0.891738;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,192:6:0	0,21,186:7:0
+X	664	.	A	<*>	0	.	DP=32;I16=9,23,0,0,1125,40759,0,0,1889,112441,0,0,552,11628,0,0;QS=3,0;MQSB=0.890331;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,18,188:6:0	0,21,184:7:0
+X	665	.	C	<*>	0	.	DP=30;I16=9,21,0,0,1075,39697,0,0,1769,105241,0,0,550,11650,0,0;QS=3,0;MQSB=0.893237;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,186:6:0	0,21,184:7:0
+X	666	.	T	<*>	0	.	DP=29;I16=9,20,0,0,1096,41946,0,0,1709,101641,0,0,547,11607,0,0;QS=3,0;MQSB=0.894839;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,171:5:0	0,21,194:7:0
+X	667	.	G	<*>	0	.	DP=31;I16=11,19,0,0,1037,37627,0,0,1769,105241,0,0,524,11198,0,0;QS=3,0;MQSB=0.91982;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,189:6:0	0,21,188:7:0
+X	668	.	A	<*>	0	.	DP=31;I16=11,20,0,0,1102,39980,0,0,1829,108841,0,0,543,11625,0,0;QS=3,0;MQSB=0.918304;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,190:6:0	0,21,187:7:0
+X	669	.	C	<*>	0	.	DP=30;I16=10,19,0,0,1051,38869,0,0,1740,104400,0,0,528,11464,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,182:6:0	0,21,189:7:0
+X	670	.	A	<*>	0	.	DP=30;I16=11,19,0,0,1121,43423,0,0,1769,105241,0,0,540,11642,0,0;QS=3,0;MQSB=0.91982;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,194:6:0	0,21,205:7:0
+X	671	.	G	<*>	0	.	DP=30;I16=11,19,0,0,1101,41035,0,0,1769,105241,0,0,537,11637,0,0;QS=3,0;MQSB=0.91982;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,181:6:0	0,21,191:7:0
+X	672	.	A	<*>	0	.	DP=30;I16=10,19,0,0,1031,37795,0,0,1740,104400,0,0,521,11479,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,185:6:0	0,21,185:7:0
+X	673	.	T	<*>	0	.	DP=29;I16=8,19,0,0,954,34984,0,0,1589,94441,0,0,497,10885,0,0;QS=3,0;MQSB=0.880529;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,126:4:0	0,21,192:7:0
+X	674	.	G	<*>	0	.	DP=29;I16=10,18,0,0,974,35736,0,0,1649,98041,0,0,497,10827,0,0;QS=3,0;MQSB=0.911099;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,146:5:0	0,21,185:7:0
+X	675	.	A	<*>	0	.	DP=28;I16=9,19,0,0,996,36338,0,0,1649,98041,0,0,517,11389,0,0;QS=3,0;MQSB=0.896555;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,124:4:0	0,21,189:7:0
+X	676	.	A	<*>	0	.	DP=29;I16=8,19,0,0,988,36578,0,0,1589,94441,0,0,462,10106,0,0;QS=3,0;MQSB=0.880529;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,128:4:0	0,21,186:7:0
+X	677	.	T	<*>	0	.	DP=29;I16=9,20,0,0,1006,36126,0,0,1709,101641,0,0,507,11303,0,0;QS=3,0;MQSB=0.894839;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,12,120:4:0	0,21,192:7:0
+X	678	.	C	<*>	0	.	DP=29;I16=9,20,0,0,1020,36984,0,0,1709,101641,0,0,502,11280,0,0;QS=3,0;MQSB=0.894839;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,12,117:4:0	0,21,191:7:0
+X	679	.	T	<*>	0	.	DP=27;I16=6,19,0,0,902,33612,0,0,1469,87241,0,0,460,10414,0,0;QS=3,0;MQSB=0.833024;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,96:3:0	0,21,195:7:0
+X	680	.	C	<*>	0	.	DP=26;I16=7,18,0,0,879,32295,0,0,1469,87241,0,0,468,10482,0,0;QS=3,0;MQSB=0.862128;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,98:3:0	0,21,181:7:0
+X	681	.	A	<*>	0	.	DP=27;I16=7,17,0,0,844,30190,0,0,1409,83641,0,0,465,10425,0,0;QS=3,0;MQSB=0.864405;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,106:3:0	0,21,174:7:0
+X	682	.	A	<*>	0	.	DP=27;I16=7,20,0,0,919,32179,0,0,1589,94441,0,0,500,11096,0,0;QS=3,0;MQSB=0.858077;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,145:5:0	0,21,176:7:0
+X	683	.	A	<*>	0	.	DP=29;I16=8,21,0,0,949,32735,0,0,1709,101641,0,0,499,11103,0,0;QS=3,0;MQSB=0.876998;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,172:6:0	0,21,167:7:0
+X	684	.	C	<*>	0	.	DP=29;I16=6,21,0,0,802,24468,0,0,1589,94441,0,0,473,10459,0,0;QS=3,0;MQSB=0.829029;MQ0F=0	PL:DP:DV	0,45,251:15:0	0,15,118:5:0	0,21,145:7:0
+X	685	.	G	<*>	0	.	DP=28;I16=6,21,0,0,908,32092,0,0,1620,97200,0,0,498,11090,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,130:5:0	0,21,175:7:0
+X	686	.	C	<*>	0	.	DP=28;I16=7,21,0,0,977,35493,0,0,1680,100800,0,0,500,11080,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,170:6:0	0,21,180:7:0
+X	687	.	A	<*>	0	.	DP=28;I16=6,20,0,0,900,31952,0,0,1560,93600,0,0,475,10469,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,175:6:0	0,21,174:7:0
+X	688	.	T	<*>	0	.	DP=27;I16=6,21,0,0,937,33971,0,0,1620,97200,0,0,501,11135,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,153:6:0	0,21,187:7:0
+X	689	.	T	A,<*>	0	.	DP=27;I16=5,20,1,0,829,28967,13,169,1500,90000,60,3600,463,10359,25,625;QS=2.97105,0.0289532,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=1;BQB=1;MQ0F=0	PL:DP:DV	0,28,231,39,234,234:14:1	0,15,116,15,116,116:5:0	0,21,185,21,185,185:7:0
+X	690	.	C	<*>	0	.	DP=27;I16=6,20,0,0,935,34553,0,0,1560,93600,0,0,486,10974,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,146:5:0	0,21,165:7:0
+X	691	.	C	<*>	0	.	DP=26;I16=5,18,0,0,842,31906,0,0,1380,82800,0,0,446,10166,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,129:4:0	0,18,161:6:0
+X	692	.	T	<*>	0	.	DP=26;I16=6,19,0,0,886,32434,0,0,1500,90000,0,0,486,11082,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,146:5:0	0,18,164:6:0
+X	693	.	C	<*>	0	.	DP=27;I16=6,20,0,0,891,31839,0,0,1560,93600,0,0,483,11007,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,141:5:0	0,21,172:7:0
+X	694	.	C	<*>	0	.	DP=27;I16=6,21,0,0,808,25004,0,0,1620,97200,0,0,498,11248,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,242:14:0	0,18,136:6:0	0,21,146:7:0
+X	695	.	G	<*>	0	.	DP=25;I16=4,20,0,0,807,28037,0,0,1440,86400,0,0,476,10692,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,246:13:0	0,18,145:6:0	0,15,124:5:0
+X	696	.	T	<*>	0	.	DP=25;I16=5,20,0,0,896,32870,0,0,1500,90000,0,0,499,11129,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,150:6:0	0,15,141:5:0
+X	697	.	G	<*>	0	.	DP=26;I16=5,19,0,0,852,30594,0,0,1409,83641,0,0,450,9858,0,0;QS=3,0;MQSB=0.796124;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,142:5:0	0,15,120:5:0
+X	698	.	T	<*>	0	.	DP=27;I16=6,20,0,0,917,33201,0,0,1529,90841,0,0,502,11114,0,0;QS=3,0;MQSB=0.83095;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,154:6:0	0,15,131:5:0
+X	699	.	G	<*>	0	.	DP=28;I16=5,21,0,0,923,34103,0,0,1529,90841,0,0,498,10884,0,0;QS=3,0;MQSB=0.79189;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,163:6:0	0,15,132:5:0
+X	700	.	A	<*>	0	.	DP=28;I16=6,22,0,0,989,35833,0,0,1618,95282,0,0,530,11626,0,0;QS=3,0;MQSB=0.904554;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,169:7:0	0,18,148:6:0
+X	701	.	A	<*>	0	.	DP=29;I16=5,23,0,0,992,35956,0,0,1618,95282,0,0,517,11459,0,0;QS=3,0;MQSB=0.864394;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,186:7:0	0,18,144:6:0
+X	702	.	A	<*>	0	.	DP=29;I16=5,23,0,0,1103,44105,0,0,1618,95282,0,0,520,11508,0,0;QS=3,0;MQSB=0.864394;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,204:7:0	0,18,159:6:0
+X	703	.	G	<*>	0	.	DP=29;I16=5,23,0,0,1014,37508,0,0,1618,95282,0,0,522,11534,0,0;QS=3,0;MQSB=0.864394;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,172:7:0	0,18,144:6:0
+X	704	.	A	T,<*>	0	.	DP=29;I16=4,23,1,0,954,34200,16,256,1558,91682,60,3600,499,10963,13,169;QS=2.97064,0.0293578,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.864394;BQB=1;MQ0F=0	PL:DP:DV	0,31,255,45,255,255:16:1	0,18,154,18,154,154:6:0	0,18,139,18,139,139:6:0
+X	705	.	A	<*>	0	.	DP=29;I16=6,22,0,0,1042,39930,0,0,1618,95282,0,0,513,11189,0,0;QS=3,0;MQSB=0.904554;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,189:7:0	0,18,157:6:0
+X	706	.	G	<*>	0	.	DP=30;I16=6,23,0,0,1029,37763,0,0,1678,98882,0,0,513,11225,0,0;QS=3,0;MQSB=0.900586;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,170:7:0	0,18,131:6:0
+X	707	.	C	<*>	0	.	DP=30;I16=5,22,0,0,944,34494,0,0,1558,91682,0,0,464,10040,0,0;QS=3,0;MQSB=0.868709;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,131:5:0	0,18,134:6:0
+X	708	.	C	<*>	0	.	DP=30;I16=6,24,0,0,898,27574,0,0,1738,102482,0,0,540,12010,0,0;QS=3,0;MQSB=0.896846;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,153:8:0	0,18,110:6:0
+X	709	.	G	<*>	0	.	DP=29;I16=5,22,0,0,968,36130,0,0,1558,91682,0,0,507,11343,0,0;QS=3,0;MQSB=0.868709;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,178:8:0	0,15,132:5:0
+X	710	.	G	<*>	0	.	DP=29;I16=5,23,0,0,961,34825,0,0,1618,95282,0,0,533,12029,0,0;QS=3,0;MQSB=0.864394;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,174:8:0	0,15,122:5:0
+X	711	.	A	<*>	0	.	DP=29;I16=6,23,0,0,996,35700,0,0,1647,96123,0,0,565,12723,0,0;QS=3,0;MQSB=0.957107;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,171:7:0	0,18,142:6:0
+X	712	.	C	<*>	0	.	DP=29;I16=6,23,0,0,1069,40863,0,0,1647,96123,0,0,565,12767,0,0;QS=3,0;MQSB=0.957107;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,156:7:0	0,18,146:6:0
+X	713	.	T	<*>	0	.	DP=29;I16=6,23,0,0,1072,40426,0,0,1647,96123,0,0,565,12835,0,0;QS=3,0;MQSB=0.957107;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,187:7:0	0,18,149:6:0
+X	714	.	C	<*>	0	.	DP=28;I16=6,21,0,0,988,37236,0,0,1558,91682,0,0,541,12301,0,0;QS=3,0;MQSB=0.90877;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,153:6:0	0,15,125:5:0
+X	715	.	A	<*>	0	.	DP=28;I16=6,20,0,0,884,31414,0,0,1498,88082,0,0,522,12004,0,0;QS=3,0;MQSB=0.913254;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,138:6:0	0,15,120:5:0
+X	716	.	C	<*>	0	.	DP=29;I16=4,23,0,0,998,37756,0,0,1527,88923,0,0,547,12501,0,0;QS=3,0;MQSB=0.877203;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,141:5:0	0,18,145:6:0
+X	717	.	A	<*>	0	.	DP=31;I16=8,23,0,0,1136,42928,0,0,1767,103323,0,0,574,13254,0,0;QS=3,0;MQSB=0.987595;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,212:8:0	0,18,153:6:0
+X	718	.	G	<*>	0	.	DP=29;I16=7,22,0,0,1066,40006,0,0,1647,96123,0,0,579,13407,0,0;QS=3,0;MQSB=0.979435;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,223:8:0	0,18,139:6:0
+X	719	.	G	<*>	0	.	DP=29;I16=7,19,0,0,952,35868,0,0,1529,90841,0,0,510,11756,0,0;QS=3,0;MQSB=0.860025;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,204:8:0	0,12,120:4:0
+X	720	.	G	<*>	0	.	DP=28;I16=6,20,0,0,986,37838,0,0,1467,85323,0,0,552,12940,0,0;QS=3,0;MQSB=0.970805;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,216:8:0	0,18,147:6:0
+X	721	.	C	<*>	0	.	DP=28;I16=6,21,0,0,989,36901,0,0,1527,88923,0,0,567,13183,0,0;QS=3,0;MQSB=0.966147;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,24,197:8:0	0,18,147:6:0
+X	722	.	A	<*>	0	.	DP=28;I16=6,21,0,0,949,33837,0,0,1527,88923,0,0,569,13225,0,0;QS=3,0;MQSB=0.966147;MQ0F=0	PL:DP:DV	0,39,244:13:0	0,24,205:8:0	0,18,143:6:0
+X	723	.	A	<*>	0	.	DP=28;I16=6,19,0,0,925,34825,0,0,1438,84482,0,0,530,12366,0,0;QS=3,0;MQSB=0.918029;MQ0F=0	PL:DP:DV	0,36,253:12:0	0,24,206:8:0	0,15,135:5:0
+X	724	.	C	<*>	0	.	DP=28;I16=5,22,0,0,967,35983,0,0,1527,88923,0,0,566,13028,0,0;QS=3,0;MQSB=0.932273;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,21,161:7:0	0,18,140:6:0
+X	725	.	A	<*>	0	.	DP=28;I16=6,21,0,0,911,31971,0,0,1527,88923,0,0,565,12987,0,0;QS=3,0;MQSB=0.966147;MQ0F=0	PL:DP:DV	0,42,246:14:0	0,21,168:7:0	0,18,137:6:0
+X	726	.	C	<*>	0	.	DP=28;I16=6,21,0,0,947,34531,0,0,1527,88923,0,0,563,12919,0,0;QS=3,0;MQSB=0.966147;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,21,166:7:0	0,18,136:6:0
+X	727	.	A	C,<*>	0	.	DP=28;I16=6,20,0,1,904,32194,17,289,1498,88082,29,841,535,12199,25,625;QS=2.90811,0.0918919,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.966147;BQB=1;MQ0F=0	PL:DP:DV	0,42,247,42,247,247:14:0	0,21,191,21,191,191:7:0	0,1,109,15,112,119:6:1
+X	728	.	C	<*>	0	.	DP=29;I16=6,22,0,0,1018,37990,0,0,1587,92523,0,0,557,12701,0,0;QS=3,0;MQSB=0.961573;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,208:8:0	0,18,142:6:0
+X	729	.	T	<*>	0	.	DP=29;I16=7,22,0,0,1063,39315,0,0,1647,96123,0,0,581,13227,0,0;QS=3,0;MQSB=0.979435;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,244:9:0	0,18,142:6:0
+X	730	.	A	<*>	0	.	DP=29;I16=7,21,0,0,993,35883,0,0,1618,95282,0,0,555,12529,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,219:9:0	0,15,135:5:0
+X	731	.	T	<*>	0	.	DP=29;I16=7,22,0,0,1024,37312,0,0,1647,96123,0,0,578,13058,0,0;QS=3,0;MQSB=0.979435;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,210:9:0	0,18,148:6:0
+X	732	.	C	<*>	0	.	DP=29;I16=7,21,0,0,1006,37058,0,0,1618,95282,0,0,550,12314,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,219:9:0	0,15,129:5:0
+X	733	.	T	<*>	0	.	DP=29;I16=7,21,0,0,985,35497,0,0,1618,95282,0,0,547,12221,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,222:9:0	0,15,134:5:0
+X	734	.	G	<*>	0	.	DP=29;I16=7,21,0,0,997,36453,0,0,1587,92523,0,0,544,12154,0,0;QS=3,0;MQSB=0.982906;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,204:8:0	0,18,139:6:0
+X	735	.	A	<*>	0	.	DP=30;I16=7,21,0,0,963,33993,0,0,1618,95282,0,0,515,11437,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,190:8:0	0,18,148:6:0
+X	736	.	C	<*>	0	.	DP=30;I16=8,20,0,0,1042,39326,0,0,1618,95282,0,0,512,11320,0,0;QS=3,0;MQSB=0.954515;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,218:8:0	0,18,152:6:0
+X	737	.	T	<*>	0	.	DP=30;I16=8,22,0,0,1071,39825,0,0,1707,99723,0,0,560,12480,0,0;QS=3,0;MQSB=0.990151;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,243:9:0	0,21,149:7:0
+X	738	.	G	<*>	0	.	DP=30;I16=8,21,0,0,1016,36816,0,0,1678,98882,0,0,533,11793,0,0;QS=3,0;MQSB=0.950946;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,210:9:0	0,18,141:6:0
+X	739	.	T	<*>	0	.	DP=30;I16=7,22,0,0,1020,37326,0,0,1647,96123,0,0,534,11900,0,0;QS=3,0;MQSB=0.979435;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,202:8:0	0,21,155:7:0
+X	740	.	T	<*>	0	.	DP=29;I16=7,21,0,0,1011,37465,0,0,1587,92523,0,0,532,11848,0,0;QS=3,0;MQSB=0.982906;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,24,232:8:0	0,21,155:7:0
+X	741	.	T	<*>	0	.	DP=29;I16=7,21,0,0,984,36052,0,0,1587,92523,0,0,528,11722,0,0;QS=3,0;MQSB=0.982906;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,24,224:8:0	0,21,151:7:0
+X	742	.	C	<*>	0	.	DP=30;I16=8,21,0,0,1046,39056,0,0,1678,98882,0,0,525,11671,0,0;QS=3,0;MQSB=0.950946;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,243:9:0	0,18,136:6:0
+X	743	.	A	<*>	0	.	DP=30;I16=8,21,0,0,1026,37156,0,0,1678,98882,0,0,520,11500,0,0;QS=3,0;MQSB=0.950946;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,239:9:0	0,18,131:6:0
+X	744	.	T	<*>	0	.	DP=30;I16=8,22,0,0,1100,41010,0,0,1707,99723,0,0,540,11984,0,0;QS=3,0;MQSB=0.990151;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,247:9:0	0,21,154:7:0
+X	745	.	G	<*>	0	.	DP=31;I16=9,22,0,0,1078,38890,0,0,1767,103323,0,0,535,11873,0,0;QS=3,0;MQSB=0.996219;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,227:9:0	0,24,178:8:0
+X	746	.	G	<*>	0	.	DP=31;I16=9,21,0,0,1001,35191,0,0,1707,99723,0,0,531,11793,0,0;QS=3,0;MQSB=0.997698;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,201:9:0	0,24,178:8:0
+X	747	.	G	<*>	0	.	DP=30;I16=9,20,0,0,1017,36831,0,0,1647,96123,0,0,509,11343,0,0;QS=3,0;MQSB=0.99889;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,201:8:0	0,21,174:7:0
+X	748	.	A	<*>	0	.	DP=30;I16=10,20,0,0,1046,37438,0,0,1707,99723,0,0,529,11721,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,27,242:9:0	0,18,159:6:0
+X	749	.	A	<*>	0	.	DP=31;I16=10,21,0,0,1077,38303,0,0,1767,103323,0,0,530,11728,0,0;QS=3,0;MQSB=0.999777;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,27,240:9:0	0,18,164:6:0
+X	750	.	A	<*>	0	.	DP=32;I16=10,20,0,0,1129,43093,0,0,1738,102482,0,0,500,11252,0,0;QS=3,0;MQSB=0.976097;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,232:8:0	0,15,161:5:0
+X	751	.	G	<*>	0	.	DP=31;I16=11,20,0,0,1065,37955,0,0,1767,103323,0,0,535,11787,0,0;QS=3,0;MQSB=0.999148;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,27,206:9:0	0,18,150:6:0
+X	752	.	T	<*>	0	.	DP=31;I16=11,20,0,0,1034,35786,0,0,1767,103323,0,0,537,11793,0,0;QS=3,0;MQSB=0.999148;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,27,223:9:0	0,18,143:6:0
+X	753	.	C	<*>	0	.	DP=31;I16=12,19,0,0,1073,38779,0,0,1767,103323,0,0,540,11834,0,0;QS=3,0;MQSB=0.994873;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,30,227:10:0	0,18,158:6:0
+X	754	.	T	<*>	0	.	DP=31;I16=12,19,0,0,1135,42527,0,0,1767,103323,0,0,542,11808,0,0;QS=3,0;MQSB=0.994873;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,30,255:10:0	0,18,172:6:0
+X	755	.	G	<*>	0	.	DP=31;I16=12,19,0,0,1157,43695,0,0,1767,103323,0,0,544,11814,0,0;QS=3,0;MQSB=0.994873;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,30,255:10:0	0,18,162:6:0
+X	756	.	G	<*>	0	.	DP=30;I16=12,17,0,0,1002,35566,0,0,1647,96123,0,0,539,11753,0,0;QS=3,0;MQSB=0.988062;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,30,242:10:0	0,18,157:6:0
+X	757	.	A	<*>	0	.	DP=30;I16=12,17,0,0,1035,37723,0,0,1678,98882,0,0,523,11197,0,0;QS=3,0;MQSB=0.993891;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,30,248:10:0	0,15,152:5:0
+X	758	.	A	<*>	0	.	DP=30;I16=12,18,0,0,1015,35685,0,0,1707,99723,0,0,549,11825,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,30,247:10:0	0,18,156:6:0
+X	759	.	A	<*>	0	.	DP=30;I16=12,16,0,0,998,36498,0,0,1618,95282,0,0,526,11472,0,0;QS=3,0;MQSB=0.995699;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,242:9:0	0,15,151:5:0
+X	760	.	C	<*>	0	.	DP=31;I16=12,18,0,0,916,29466,0,0,1707,99723,0,0,547,11741,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,30,217:10:0	0,18,128:6:0
+X	761	.	G	<*>	0	.	DP=30;I16=11,16,0,0,932,32884,0,0,1589,94441,0,0,512,11028,0,0;QS=3,0;MQSB=0.925036;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,220:9:0	0,15,153:5:0
+X	762	.	G	<*>	0	.	DP=29;I16=11,18,0,0,1012,36984,0,0,1647,96123,0,0,541,11629,0,0;QS=3,0;MQSB=0.995968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,220:9:0	0,21,173:7:0
+X	763	.	C	A,<*>	0	.	DP=29;I16=11,16,0,1,948,35124,15,225,1558,91682,29,841,527,11473,2,4;QS=2.93697,0.0630252,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.993109;BQB=1;MQ0F=0	PL:DP:DV	0,39,255,39,255,255:13:0	0,24,193,24,193,193:8:0	0,6,158,18,161,165:7:1
+X	764	.	A	<*>	0	.	DP=31;I16=12,18,0,0,1051,37737,0,0,1738,102482,0,0,516,11020,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,30,250:10:0	0,18,163:6:0
+X	765	.	A	<*>	0	.	DP=32;I16=12,18,0,0,1071,39369,0,0,1738,102482,0,0,525,11379,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,30,254:10:0	0,18,169:6:0
+X	766	.	C	<*>	0	.	DP=31;I16=13,18,0,0,1065,38285,0,0,1798,106082,0,0,547,11797,0,0;QS=3,0;MQSB=0.995005;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,33,235:11:0	0,18,164:6:0
+X	767	.	A	<*>	0	.	DP=30;I16=12,18,0,0,996,34692,0,0,1738,102482,0,0,552,11926,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,33,244:11:0	0,18,148:6:0
+X	768	.	C	<*>	0	.	DP=30;I16=12,18,0,0,1095,40739,0,0,1738,102482,0,0,556,12038,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,33,255:11:0	0,18,173:6:0
+X	769	.	C	<*>	0	.	DP=30;I16=12,18,0,0,1110,42272,0,0,1738,102482,0,0,559,12133,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,33,255:11:0	0,18,173:6:0
+X	770	.	A	<*>	0	.	DP=30;I16=12,18,0,0,1098,40852,0,0,1738,102482,0,0,562,12262,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,33,255:11:0	0,18,171:6:0
+X	771	.	T	<*>	0	.	DP=30;I16=12,18,0,0,1111,41771,0,0,1738,102482,0,0,563,12325,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,33,255:11:0	0,18,177:6:0
+X	772	.	T	<*>	0	.	DP=30;I16=12,18,0,0,1107,41429,0,0,1738,102482,0,0,563,12373,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,33,255:11:0	0,18,176:6:0
+X	773	.	G	<*>	0	.	DP=30;I16=12,18,0,0,1123,42761,0,0,1738,102482,0,0,562,12406,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,33,255:11:0	0,18,175:6:0
+X	774	.	A	<*>	0	.	DP=30;I16=12,18,0,0,1151,44801,0,0,1738,102482,0,0,560,12422,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,33,255:11:0	0,18,179:6:0
+X	775	.	G	<*>	0	.	DP=30;I16=12,18,0,0,1136,43766,0,0,1738,102482,0,0,557,12419,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,33,255:11:0	0,18,177:6:0
+X	776	.	A	<*>	0	.	DP=29;I16=12,17,0,0,1053,38865,0,0,1678,98882,0,0,553,12345,0,0;QS=3,0;MQSB=0.993891;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,30,255:10:0	0,18,169:6:0
+X	777	.	C	<*>	0	.	DP=28;I16=12,16,0,0,1019,37631,0,0,1618,95282,0,0,550,12298,0,0;QS=3,0;MQSB=0.995699;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,229:9:0	0,18,165:6:0
+X	778	.	A	<*>	0	.	DP=28;I16=12,16,0,0,1079,42041,0,0,1618,95282,0,0,547,12277,0,0;QS=3,0;MQSB=0.995699;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,241:9:0	0,18,181:6:0
+X	779	.	G	<*>	0	.	DP=28;I16=12,16,0,0,1025,38825,0,0,1618,95282,0,0,543,12231,0,0;QS=3,0;MQSB=0.995699;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,231:9:0	0,18,170:6:0
+X	780	.	A	<*>	0	.	DP=28;I16=12,16,0,0,1005,36773,0,0,1618,95282,0,0,538,12160,0,0;QS=3,0;MQSB=0.995699;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,242:9:0	0,18,166:6:0
+X	781	.	A	<*>	0	.	DP=28;I16=12,15,0,0,965,35857,0,0,1589,94441,0,0,519,11889,0,0;QS=3,0;MQSB=0.935229;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,222:8:0	0,15,159:5:0
+X	782	.	A	<*>	0	.	DP=28;I16=12,16,0,0,1003,37315,0,0,1618,95282,0,0,530,12044,0,0;QS=3,0;MQSB=0.995699;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,229:8:0	0,18,171:6:0
+X	783	.	A	<*>	0	.	DP=28;I16=12,16,0,0,989,36477,0,0,1618,95282,0,0,527,12001,0,0;QS=3,0;MQSB=0.995699;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,24,230:8:0	0,21,178:7:0
+X	784	.	C	<*>	0	.	DP=26;I16=11,15,0,0,967,36387,0,0,1498,88082,0,0,527,11983,0,0;QS=3,0;MQSB=0.994627;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,207:7:0	0,21,178:7:0
+X	785	.	A	<*>	0	.	DP=26;I16=11,15,0,0,989,38499,0,0,1498,88082,0,0,527,11989,0,0;QS=3,0;MQSB=0.994627;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,213:7:0	0,21,187:7:0
+X	786	.	G	<*>	0	.	DP=26;I16=11,14,0,0,938,35698,0,0,1438,84482,0,0,501,11343,0,0;QS=3,0;MQSB=0.996634;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,211:7:0	0,21,180:7:0
+X	787	.	G	<*>	0	.	DP=26;I16=11,15,0,0,914,33428,0,0,1498,88082,0,0,525,11969,0,0;QS=3,0;MQSB=0.994627;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,189:7:0	0,21,175:7:0
+X	788	.	T	<*>	0	.	DP=26;I16=11,15,0,0,913,33357,0,0,1498,88082,0,0,524,11992,0,0;QS=3,0;MQSB=0.994627;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,180:7:0	0,21,188:7:0
+X	789	.	G	<*>	0	.	DP=26;I16=11,15,0,0,963,36645,0,0,1498,88082,0,0,523,12037,0,0;QS=3,0;MQSB=0.994627;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,193:7:0	0,21,183:7:0
+X	790	.	A	<*>	0	.	DP=26;I16=11,15,0,0,999,39113,0,0,1498,88082,0,0,520,12002,0,0;QS=3,0;MQSB=0.994627;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,198:7:0	0,21,201:7:0
+X	791	.	G	<*>	0	.	DP=26;I16=11,15,0,0,934,34208,0,0,1498,88082,0,0,516,11934,0,0;QS=3,0;MQSB=0.994627;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,180:7:0	0,21,172:7:0
+X	792	.	T	<*>	0	.	DP=26;I16=11,15,0,0,895,32009,0,0,1498,88082,0,0,511,11833,0,0;QS=3,0;MQSB=0.994627;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,184:7:0	0,21,172:7:0
+X	793	.	G	<*>	0	.	DP=27;I16=11,15,0,0,965,36389,0,0,1498,88082,0,0,504,11652,0,0;QS=3,0;MQSB=0.994627;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,193:7:0	0,21,170:7:0
+X	794	.	G	<*>	0	.	DP=26;I16=11,15,0,0,888,31804,0,0,1498,88082,0,0,508,11592,0,0;QS=3,0;MQSB=0.994627;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,198:8:0	0,18,161:6:0
+X	795	.	T	<*>	0	.	DP=26;I16=9,15,0,0,859,31399,0,0,1409,83641,0,0,472,10908,0,0;QS=3,0;MQSB=0.96464;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,211:7:0	0,18,160:6:0
+X	796	.	T	<*>	0	.	DP=27;I16=11,16,0,0,907,31641,0,0,1558,91682,0,0,499,11375,0,0;QS=3,0;MQSB=0.992419;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,221:9:0	0,15,150:5:0
+X	797	.	G	<*>	0	.	DP=26;I16=11,15,0,0,882,31700,0,0,1529,90841,0,0,498,11298,0,0;QS=3,0;MQSB=0.927041;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,215:9:0	0,12,135:4:0
+X	798	.	C	<*>	0	.	DP=26;I16=9,15,0,0,806,28552,0,0,1440,86400,0,0,466,10582,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,207:8:0	0,12,126:4:0
+X	799	.	C	<*>	0	.	DP=26;I16=10,15,0,0,947,36407,0,0,1500,90000,0,0,491,11185,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,234:9:0	0,12,137:4:0
+X	800	.	T	<*>	0	.	DP=26;I16=11,15,0,0,993,38475,0,0,1529,90841,0,0,495,11199,0,0;QS=3,0;MQSB=0.927041;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,255:9:0	0,12,139:4:0
+X	801	.	G	<*>	0	.	DP=25;I16=11,14,0,0,938,35854,0,0,1469,87241,0,0,495,11209,0,0;QS=3,0;MQSB=0.929204;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,240:9:0	0,12,145:4:0
+X	802	.	G	<*>	0	.	DP=25;I16=11,14,0,0,892,32802,0,0,1469,87241,0,0,495,11239,0,0;QS=3,0;MQSB=0.929204;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,229:9:0	0,12,137:4:0
+X	803	.	G	<*>	0	.	DP=25;I16=11,14,0,0,906,33502,0,0,1469,87241,0,0,495,11289,0,0;QS=3,0;MQSB=0.929204;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,237:9:0	0,12,136:4:0
+X	804	.	G	<*>	0	.	DP=25;I16=11,12,0,0,868,33326,0,0,1349,80041,0,0,466,10846,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,223:8:0	0,12,138:4:0
+X	805	.	C	<*>	0	.	DP=24;I16=9,14,0,0,810,29684,0,0,1380,82800,0,0,482,11208,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,220:8:0	0,12,128:4:0
+X	806	.	C	<*>	0	.	DP=25;I16=9,14,0,0,814,29856,0,0,1380,82800,0,0,483,11293,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,214:8:0	0,12,122:4:0
+X	807	.	A	<*>	0	.	DP=25;I16=10,15,0,0,939,35997,0,0,1500,90000,0,0,503,11525,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,242:9:0	0,12,146:4:0
+X	808	.	G	<*>	0	.	DP=25;I16=10,15,0,0,918,34720,0,0,1500,90000,0,0,505,11591,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,238:9:0	0,12,136:4:0
+X	809	.	G	<*>	0	.	DP=25;I16=10,15,0,0,926,34932,0,0,1500,90000,0,0,506,11626,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,226:9:0	0,12,136:4:0
+X	810	.	G	C,<*>	0	.	DP=25;I16=10,13,0,1,824,30436,14,196,1380,82800,60,3600,480,11288,14,196;QS=2.96552,0.0344828,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=1;BQB=1;MQ0F=0	PL:DP:DV	0,21,255,33,255,255:12:1	0,24,216,24,216,216:8:0	0,12,132,12,132,132:4:0
+X	811	.	A	<*>	0	.	DP=25;I16=9,14,0,0,808,29404,0,0,1380,82800,0,0,484,11294,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,204:7:0	0,12,139:4:0
+X	812	.	A	<*>	0	.	DP=25;I16=10,15,0,0,831,29515,0,0,1500,90000,0,0,500,11392,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,216:9:0	0,12,139:4:0
+X	813	.	C	<*>	0	.	DP=25;I16=10,15,0,0,915,34093,0,0,1500,90000,0,0,497,11307,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,239:9:0	0,12,138:4:0
+X	814	.	T	<*>	0	.	DP=25;I16=10,15,0,0,987,39343,0,0,1500,90000,0,0,494,11244,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,255:9:0	0,12,148:4:0
+X	815	.	T	<*>	0	.	DP=25;I16=10,15,0,0,894,32670,0,0,1500,90000,0,0,491,11203,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,235:9:0	0,12,143:4:0
+X	816	.	T	<*>	0	.	DP=25;I16=10,15,0,0,898,32990,0,0,1500,90000,0,0,488,11184,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,239:9:0	0,12,136:4:0
+X	817	.	C	<*>	0	.	DP=24;I16=10,14,0,0,898,34256,0,0,1440,86400,0,0,485,11137,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,235:9:0	0,12,124:4:0
+X	818	.	T	<*>	0	.	DP=23;I16=9,14,0,0,883,34371,0,0,1380,82800,0,0,484,11110,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,225:8:0	0,12,143:4:0
+X	819	.	G	<*>	0	.	DP=23;I16=9,13,0,0,832,31932,0,0,1320,79200,0,0,461,10573,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,24,217:8:0	0,12,142:4:0
+X	820	.	G	<*>	0	.	DP=24;I16=10,14,0,0,844,30848,0,0,1440,86400,0,0,484,11114,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,230:9:0	0,12,135:4:0
+X	821	.	G	<*>	0	.	DP=24;I16=10,14,0,0,852,31572,0,0,1440,86400,0,0,484,11098,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,234:9:0	0,12,142:4:0
+X	822	.	G	<*>	0	.	DP=25;I16=10,15,0,0,879,31785,0,0,1500,90000,0,0,481,10955,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,220:9:0	0,12,127:4:0
+X	823	.	T	<*>	0	.	DP=25;I16=10,15,0,0,844,29686,0,0,1500,90000,0,0,478,10786,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,217:9:0	0,12,127:4:0
+X	824	.	C	<*>	0	.	DP=25;I16=9,14,0,0,824,30252,0,0,1380,82800,0,0,427,9477,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,215:9:0	0,9,98:3:0
+X	825	.	A	<*>	0	.	DP=25;I16=10,15,0,0,881,31665,0,0,1500,90000,0,0,467,10277,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,234:9:0	0,12,116:4:0
+X	826	.	T	<*>	0	.	DP=25;I16=10,15,0,0,826,28364,0,0,1500,90000,0,0,461,10039,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,250:12:0	0,27,232:9:0	0,12,117:4:0
+X	827	.	A	<*>	0	.	DP=25;I16=10,15,0,0,851,29477,0,0,1500,90000,0,0,455,9829,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,227:9:0	0,12,123:4:0
+X	828	.	T	C,<*>	0	.	DP=25;I16=2,4,8,11,199,6917,656,23340,360,21600,1140,68400,116,2716,333,6931;QS=0.597777,2.40222,0;VDB=0.842082;SGB=-4.20907;RPB=0.950652;MQB=1;MQSB=1;BQB=0.929717;MQ0F=0	PL:DP:DV	211,0,35,217,65,255:12:10	116,0,91,128,106,213:9:5	120,12,0,120,12,120:4:4
+X	829	.	T	<*>	0	.	DP=24;I16=10,13,0,0,863,32931,0,0,1380,82800,0,0,418,8818,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,242:8:0	0,12,132:4:0
+X	830	.	C	<*>	0	.	DP=24;I16=10,14,0,0,910,34966,0,0,1440,86400,0,0,437,9267,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,220:8:0	0,12,134:4:0
+X	831	.	T	<*>	0	.	DP=24;I16=10,14,0,0,906,34886,0,0,1440,86400,0,0,431,9119,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,243:8:0	0,12,133:4:0
+X	832	.	C	<*>	0	.	DP=24;I16=10,14,0,0,888,33634,0,0,1440,86400,0,0,425,8999,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,220:8:0	0,12,123:4:0
+X	833	.	T	<*>	0	.	DP=25;I16=10,14,0,0,820,29920,0,0,1440,86400,0,0,418,8856,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,224:8:0	0,12,113:4:0
+X	834	.	G	A,<*>	0	.	DP=25;I16=2,3,7,10,164,5898,590,21124,300,18000,1020,61200,104,2296,305,6441;QS=0.520056,2.47994,0;VDB=0.788006;SGB=-4.01214;RPB=0.999233;MQB=1;MQSB=1;BQB=0.821668;MQ0F=0	PL:DP:DV	185,0,46,191,73,246:11:9	128,0,59,137,74,193:8:5	89,9,0,89,9,89:3:3
+X	835	.	T	<*>	0	.	DP=26;I16=9,15,0,0,767,26675,0,0,1440,86400,0,0,406,8652,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,240:12:0	0,24,213:8:0	0,12,98:4:0
+X	836	.	G	<*>	0	.	DP=23;I16=8,15,0,0,833,30561,0,0,1380,82800,0,0,403,8541,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,243:11:0	0,24,214:8:0	0,12,130:4:0
+X	837	.	T	<*>	0	.	DP=23;I16=8,15,0,0,843,31499,0,0,1380,82800,0,0,400,8456,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,241:11:0	0,24,221:8:0	0,12,143:4:0
+X	838	.	T	<*>	0	.	DP=23;I16=8,15,0,0,870,33172,0,0,1380,82800,0,0,397,8397,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,252:11:0	0,24,224:8:0	0,12,134:4:0
+X	839	.	G	<*>	0	.	DP=24;I16=8,15,0,0,862,32774,0,0,1380,82800,0,0,393,8315,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,249:11:0	0,24,212:8:0	0,12,142:4:0
+X	840	.	A	<*>	0	.	DP=25;I16=9,15,0,0,876,32682,0,0,1440,86400,0,0,375,7731,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,243:11:0	0,21,196:7:0	0,18,180:6:0
+X	841	.	T	<*>	0	.	DP=25;I16=9,16,0,0,861,30879,0,0,1500,90000,0,0,396,8260,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,213:11:0	0,24,226:8:0	0,18,185:6:0
+X	842	.	T	<*>	0	.	DP=24;I16=9,15,0,0,872,31990,0,0,1440,86400,0,0,393,8199,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,227:10:0	0,24,231:8:0	0,18,175:6:0
+X	843	.	C	<*>	0	.	DP=24;I16=9,15,0,0,844,30604,0,0,1440,86400,0,0,390,8172,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,228:10:0	0,24,229:8:0	0,18,160:6:0
+X	844	.	T	<*>	0	.	DP=24;I16=9,15,0,0,900,34094,0,0,1440,86400,0,0,386,8128,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,227:10:0	0,24,238:8:0	0,18,189:6:0
+X	845	.	G	<*>	0	.	DP=25;I16=10,15,0,0,916,33866,0,0,1500,90000,0,0,382,8116,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,239:10:0	0,24,225:8:0	0,21,196:7:0
+X	846	.	G	<*>	0	.	DP=24;I16=9,14,0,0,802,28414,0,0,1380,82800,0,0,354,7460,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,223:9:0	0,24,208:8:0	0,18,164:6:0
+X	847	.	T	<*>	0	.	DP=24;I16=8,15,0,0,809,29007,0,0,1380,82800,0,0,377,8083,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,210:9:0	0,24,219:8:0	0,18,149:6:0
+X	848	.	G	<*>	0	.	DP=23;I16=8,15,0,0,829,30351,0,0,1380,82800,0,0,384,8138,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,199:8:0	0,27,243:9:0	0,18,167:6:0
+X	849	.	G	<*>	0	.	DP=22;I16=8,12,0,0,684,23844,0,0,1200,72000,0,0,349,7517,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,160:6:0	0,27,233:9:0	0,15,140:5:0
+X	850	.	T	<*>	0	.	DP=21;I16=6,14,0,0,706,25508,0,0,1200,72000,0,0,360,7568,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,153:6:0	0,24,226:8:0	0,18,147:6:0
+X	851	.	G	<*>	0	.	DP=21;I16=7,14,0,0,707,24667,0,0,1260,75600,0,0,386,8254,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,140:6:0	0,27,233:9:0	0,18,156:6:0
+X	852	.	G	<*>	0	.	DP=21;I16=7,13,0,0,687,24223,0,0,1200,72000,0,0,368,7976,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,147:6:0	0,27,222:9:0	0,15,146:5:0
+X	853	.	A	<*>	0	.	DP=21;I16=7,14,0,0,721,25603,0,0,1260,75600,0,0,388,8442,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,146:6:0	0,27,223:9:0	0,18,166:6:0
+X	854	.	A	<*>	0	.	DP=21;I16=7,14,0,0,725,25843,0,0,1260,75600,0,0,389,8517,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,179:7:0	0,24,209:8:0	0,18,168:6:0
+X	855	.	A	<*>	0	.	DP=21;I16=7,14,0,0,683,23803,0,0,1260,75600,0,0,391,8611,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,171:7:0	0,24,204:8:0	0,18,152:6:0
+X	856	.	C	<*>	0	.	DP=21;I16=7,14,0,0,763,28293,0,0,1260,75600,0,0,392,8676,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,192:7:0	0,24,222:8:0	0,18,172:6:0
+X	857	.	A	<*>	0	.	DP=22;I16=8,14,0,0,786,28480,0,0,1320,79200,0,0,393,8763,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,182:7:0	0,24,220:8:0	0,21,194:7:0
+X	858	.	A	<*>	0	.	DP=22;I16=8,14,0,0,816,31358,0,0,1320,79200,0,0,395,8873,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,192:7:0	0,24,236:8:0	0,21,198:7:0
+X	859	.	G	<*>	0	.	DP=22;I16=8,14,0,0,824,31356,0,0,1320,79200,0,0,395,8907,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,202:7:0	0,24,223:8:0	0,21,203:7:0
+X	860	.	A	<*>	0	.	DP=22;I16=8,13,0,0,743,26985,0,0,1260,75600,0,0,369,8291,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,184:7:0	0,21,202:7:0	0,21,190:7:0
+X	861	.	C	<*>	0	.	DP=22;I16=8,14,0,0,770,28376,0,0,1320,79200,0,0,393,8899,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,206:8:0	0,24,216:8:0	0,18,161:6:0
+X	862	.	T	<*>	0	.	DP=22;I16=8,14,0,0,762,27500,0,0,1320,79200,0,0,393,8905,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,188:8:0	0,24,213:8:0	0,18,177:6:0
+X	863	.	G	<*>	0	.	DP=23;I16=9,14,0,0,836,30660,0,0,1380,82800,0,0,393,8935,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,228:9:0	0,24,221:8:0	0,18,180:6:0
+X	864	.	T	<*>	0	.	DP=22;I16=9,13,0,0,795,29085,0,0,1320,79200,0,0,395,8989,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,215:8:0	0,24,221:8:0	0,18,180:6:0
+X	865	.	C	<*>	0	.	DP=22;I16=8,14,0,0,785,28475,0,0,1320,79200,0,0,397,9015,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,227:9:0	0,21,193:7:0	0,18,177:6:0
+X	866	.	C	<*>	0	.	DP=21;I16=7,13,0,0,694,24890,0,0,1200,72000,0,0,395,8985,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,220:8:0	0,18,149:6:0	0,18,177:6:0
+X	867	.	C	<*>	0	.	DP=21;I16=7,14,0,0,761,28443,0,0,1260,75600,0,0,403,9023,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,223:9:0	0,18,182:6:0	0,18,187:6:0
+X	868	.	A	<*>	0	.	DP=21;I16=7,14,0,0,799,31183,0,0,1260,75600,0,0,406,9054,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,228:9:0	0,18,189:6:0	0,18,202:6:0
+X	869	.	G	<*>	0	.	DP=21;I16=7,14,0,0,795,30733,0,0,1260,75600,0,0,409,9103,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,236:9:0	0,18,190:6:0	0,18,187:6:0
+X	870	.	C	<*>	0	.	DP=21;I16=7,13,0,0,758,29080,0,0,1200,72000,0,0,403,9089,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,226:8:0	0,18,183:6:0	0,18,187:6:0
+X	871	.	C	<*>	0	.	DP=21;I16=7,14,0,0,769,29383,0,0,1260,75600,0,0,413,9155,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,232:9:0	0,18,176:6:0	0,18,192:6:0
+X	872	.	T	<*>	0	.	DP=21;I16=7,14,0,0,785,29879,0,0,1260,75600,0,0,413,9109,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,228:9:0	0,18,187:6:0	0,18,188:6:0
+X	873	.	G	<*>	0	.	DP=21;I16=7,14,0,0,768,28506,0,0,1260,75600,0,0,413,9083,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,233:9:0	0,18,172:6:0	0,18,182:6:0
+X	874	.	G	<*>	0	.	DP=21;I16=7,12,0,0,700,26434,0,0,1140,68400,0,0,374,8234,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,227:8:0	0,15,143:5:0	0,18,189:6:0
+X	875	.	G	<*>	0	.	DP=21;I16=7,14,0,0,717,25659,0,0,1260,75600,0,0,411,8995,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,227:9:0	0,18,163:6:0	0,18,159:6:0
+X	876	.	T	<*>	0	.	DP=21;I16=7,14,0,0,719,25261,0,0,1260,75600,0,0,410,8984,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,222:9:0	0,18,156:6:0	0,18,173:6:0
+X	877	.	G	<*>	0	.	DP=21;I16=7,14,0,0,747,27419,0,0,1260,75600,0,0,409,8995,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,235:9:0	0,18,162:6:0	0,18,176:6:0
+X	878	.	A	<*>	0	.	DP=21;I16=7,13,0,0,738,27650,0,0,1200,72000,0,0,391,8739,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,216:8:0	0,18,172:6:0	0,18,191:6:0
+X	879	.	T	<*>	0	.	DP=21;I16=7,13,0,0,731,26927,0,0,1200,72000,0,0,389,8759,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,214:8:0	0,18,175:6:0	0,18,184:6:0
+X	880	.	A	<*>	0	.	DP=21;I16=7,14,0,0,737,26481,0,0,1260,75600,0,0,405,9109,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,227:9:0	0,18,165:6:0	0,18,172:6:0
+X	881	.	C	<*>	0	.	DP=20;I16=7,13,0,0,742,27898,0,0,1200,72000,0,0,404,9154,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,231:8:0	0,18,164:6:0	0,18,183:6:0
+X	882	.	A	<*>	0	.	DP=20;I16=7,13,0,0,776,30564,0,0,1200,72000,0,0,403,9217,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,225:8:0	0,18,188:6:0	0,18,200:6:0
+X	883	.	G	<*>	0	.	DP=20;I16=7,13,0,0,702,25898,0,0,1200,72000,0,0,401,9247,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,214:8:0	0,18,175:6:0	0,18,176:6:0
+X	884	.	C	<*>	0	.	DP=19;I16=7,12,0,0,629,21449,0,0,1140,68400,0,0,400,9292,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,201:8:0	0,18,155:6:0	0,15,144:5:0
+X	885	.	G	<*>	0	.	DP=18;I16=7,11,0,0,605,20851,0,0,1080,64800,0,0,400,9350,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,215:8:0	0,15,140:5:0	0,15,130:5:0
+X	886	.	A	<*>	0	.	DP=18;I16=7,11,0,0,681,26145,0,0,1080,64800,0,0,400,9420,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,222:8:0	0,15,164:5:0	0,15,163:5:0
+X	887	.	G	<*>	0	.	DP=18;I16=7,11,0,0,631,22891,0,0,1080,64800,0,0,399,9451,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,222:8:0	0,15,138:5:0	0,15,149:5:0
+X	888	.	A	<*>	0	.	DP=18;I16=7,10,0,0,593,21563,0,0,1020,61200,0,0,373,8867,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,216:8:0	0,15,132:5:0	0,12,127:4:0
+X	889	.	C	<*>	0	.	DP=18;I16=7,11,0,0,624,22732,0,0,1080,64800,0,0,396,9492,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,213:8:0	0,15,134:5:0	0,15,160:5:0
+X	890	.	C	<*>	0	.	DP=19;I16=7,11,0,0,616,22426,0,0,1080,64800,0,0,368,8826,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,215:8:0	0,15,138:5:0	0,15,152:5:0
+X	891	.	C	<*>	0	.	DP=19;I16=7,11,0,0,661,24891,0,0,1080,64800,0,0,365,8745,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,227:8:0	0,15,141:5:0	0,15,165:5:0
+X	892	.	C	<*>	0	.	DP=19;I16=7,12,0,0,691,25761,0,0,1140,68400,0,0,387,9299,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,230:9:0	0,15,146:5:0	0,15,167:5:0
+X	893	.	A	<*>	0	.	DP=19;I16=7,12,0,0,673,24521,0,0,1140,68400,0,0,384,9238,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,221:9:0	0,15,142:5:0	0,15,166:5:0
+X	894	.	T	<*>	0	.	DP=19;I16=7,12,0,0,670,24268,0,0,1140,68400,0,0,380,9138,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,225:9:0	0,15,134:5:0	0,15,165:5:0
+X	895	.	C	<*>	0	.	DP=20;I16=8,12,0,0,712,26186,0,0,1200,72000,0,0,376,9050,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,248:10:0	0,15,149:5:0	0,15,162:5:0
+X	896	.	T	<*>	0	.	DP=19;I16=8,10,0,0,684,26696,0,0,1080,64800,0,0,348,8300,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,238:9:0	0,12,141:4:0	0,15,180:5:0
+X	897	.	C	<*>	0	.	DP=18;I16=8,10,0,0,693,27001,0,0,1080,64800,0,0,370,8764,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,12,131:4:0	0,15,166:5:0
+X	898	.	T	<*>	0	.	DP=18;I16=8,10,0,0,674,25656,0,0,1080,64800,0,0,367,8617,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,243:9:0	0,12,125:4:0	0,15,172:5:0
+X	899	.	A	<*>	0	.	DP=18;I16=9,8,0,0,597,21451,0,0,1020,61200,0,0,340,7858,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,239:9:0	0,9,99:3:0	0,15,145:5:0
+X	900	.	C	<*>	0	.	DP=18;I16=9,9,0,0,658,24550,0,0,1080,64800,0,0,364,8362,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,98:3:0	0,15,166:5:0
+X	901	.	C	<*>	0	.	DP=18;I16=9,9,0,0,680,26004,0,0,1080,64800,0,0,363,8255,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,99:3:0	0,15,169:5:0
+X	902	.	A	<*>	0	.	DP=18;I16=9,9,0,0,681,26253,0,0,1080,64800,0,0,362,8162,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,9,115:3:0	0,15,174:5:0
+X	903	.	A	<*>	0	.	DP=18;I16=9,8,0,0,645,24625,0,0,1020,61200,0,0,336,7458,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,250:9:0	0,9,101:3:0	0,15,171:5:0
+X	904	.	A	<*>	0	.	DP=18;I16=9,9,0,0,640,23412,0,0,1080,64800,0,0,359,7969,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,249:10:0	0,9,85:3:0	0,15,174:5:0
+X	905	.	A	<*>	0	.	DP=18;I16=9,9,0,0,675,25673,0,0,1080,64800,0,0,357,7871,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,103:3:0	0,15,172:5:0
+X	906	.	A	<*>	0	.	DP=18;I16=9,9,0,0,669,25193,0,0,1080,64800,0,0,355,7789,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,102:3:0	0,15,166:5:0
+X	907	.	A	<*>	0	.	DP=18;I16=9,9,0,0,661,24541,0,0,1080,64800,0,0,353,7723,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,94:3:0	0,15,165:5:0
+X	908	.	T	<*>	0	.	DP=18;I16=9,9,0,0,673,25579,0,0,1080,64800,0,0,351,7673,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,83:3:0	0,15,168:5:0
+X	909	.	T	<*>	0	.	DP=18;I16=9,9,0,0,653,23847,0,0,1080,64800,0,0,348,7590,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,95:3:0	0,15,161:5:0
+X	910	.	A	<*>	0	.	DP=18;I16=9,9,0,0,652,23790,0,0,1080,64800,0,0,344,7476,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,248:10:0	0,9,104:3:0	0,15,162:5:0
+X	911	.	A	<*>	0	.	DP=18;I16=9,9,0,0,688,26440,0,0,1080,64800,0,0,340,7382,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,109:3:0	0,15,168:5:0
+X	912	.	A	<*>	0	.	DP=18;I16=9,9,0,0,691,26705,0,0,1080,64800,0,0,336,7308,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,115:3:0	0,15,173:5:0
+X	913	.	A	<*>	0	.	DP=19;I16=9,10,0,0,692,25762,0,0,1140,68400,0,0,332,7254,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,109:3:0	0,15,171:5:0
+X	914	.	A	<*>	0	.	DP=19;I16=9,10,0,0,712,26966,0,0,1140,68400,0,0,329,7221,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,109:3:0	0,15,164:5:0
+X	915	.	T	<*>	0	.	DP=18;I16=9,9,0,0,638,23228,0,0,1080,64800,0,0,326,7160,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,247:10:0	0,9,99:3:0	0,15,163:5:0
+X	916	.	T	<*>	0	.	DP=19;I16=9,8,0,0,626,23136,0,0,1020,61200,0,0,296,6396,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,241:9:0	0,9,103:3:0	0,15,164:5:0
+X	917	.	A	<*>	0	.	DP=19;I16=9,10,0,0,726,27962,0,0,1117,66169,0,0,318,6908,0,0;QS=3,0;MQSB=0.934728;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,125:4:0	0,15,171:5:0
+X	918	.	G	<*>	0	.	DP=19;I16=9,10,0,0,688,25456,0,0,1117,66169,0,0,314,6818,0,0;QS=3,0;MQSB=0.934728;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,129:4:0	0,15,147:5:0
+X	919	.	C	<*>	0	.	DP=18;I16=8,10,0,0,672,25786,0,0,1057,62569,0,0,311,6751,0,0;QS=3,0;MQSB=0.938795;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,92:3:0	0,15,152:5:0
+X	920	.	T	<*>	0	.	DP=18;I16=8,10,0,0,681,26113,0,0,1057,62569,0,0,308,6706,0,0;QS=3,0;MQSB=0.938795;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,95:3:0	0,15,171:5:0
+X	921	.	G	<*>	0	.	DP=17;I16=7,10,0,0,617,22841,0,0,997,58969,0,0,304,6582,0,0;QS=3,0;MQSB=0.943335;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,6,47:2:0	0,15,164:5:0
+X	922	.	G	<*>	0	.	DP=16;I16=7,8,0,0,560,21156,0,0,877,51769,0,0,276,5852,0,0;QS=3,0;MQSB=0.921243;MQ0F=0	PL:DP:DV	0,24,243:8:0	0,6,64:2:0	0,15,151:5:0
+X	923	.	G	<*>	0	.	DP=16;I16=7,8,0,0,562,21350,0,0,877,51769,0,0,273,5765,0,0;QS=3,0;MQSB=0.921243;MQ0F=0	PL:DP:DV	0,24,245:8:0	0,6,65:2:0	0,15,144:5:0
+X	924	.	C	<*>	0	.	DP=16;I16=7,9,0,0,603,22955,0,0,937,55369,0,0,295,6321,0,0;QS=3,0;MQSB=0.933674;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,6,57:2:0	0,15,157:5:0
+X	925	.	A	<*>	0	.	DP=16;I16=7,9,0,0,576,21618,0,0,937,55369,0,0,291,6219,0,0;QS=3,0;MQSB=0.933674;MQ0F=0	PL:DP:DV	0,27,244:9:0	0,6,58:2:0	0,15,163:5:0
+X	926	.	T	<*>	0	.	DP=16;I16=7,9,0,0,585,22015,0,0,937,55369,0,0,287,6133,0,0;QS=3,0;MQSB=0.933674;MQ0F=0	PL:DP:DV	0,27,241:9:0	0,6,63:2:0	0,15,161:5:0
+X	927	.	G	<*>	0	.	DP=17;I16=7,10,0,0,641,24481,0,0,997,58969,0,0,283,6063,0,0;QS=3,0;MQSB=0.943335;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,9,82:3:0	0,15,158:5:0
+X	928	.	G	<*>	0	.	DP=17;I16=7,10,0,0,625,23195,0,0,997,58969,0,0,280,6010,0,0;QS=3,0;MQSB=0.943335;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,9,84:3:0	0,15,150:5:0
+X	929	.	T	<*>	0	.	DP=16;I16=7,9,0,0,580,21580,0,0,937,55369,0,0,277,5925,0,0;QS=3,0;MQSB=0.933674;MQ0F=0	PL:DP:DV	0,27,248:9:0	0,9,79:3:0	0,12,128:4:0
+X	930	.	G	<*>	0	.	DP=16;I16=7,8,0,0,565,21561,0,0,877,51769,0,0,249,5233,0,0;QS=3,0;MQSB=0.921243;MQ0F=0	PL:DP:DV	0,24,247:8:0	0,9,82:3:0	0,12,127:4:0
+X	931	.	G	<*>	0	.	DP=16;I16=7,9,0,0,553,19935,0,0,937,55369,0,0,271,5809,0,0;QS=3,0;MQSB=0.933674;MQ0F=0	PL:DP:DV	0,27,244:9:0	0,9,80:3:0	0,12,113:4:0
+X	932	.	T	<*>	0	.	DP=16;I16=7,9,0,0,558,20128,0,0,937,55369,0,0,268,5778,0,0;QS=3,0;MQSB=0.933674;MQ0F=0	PL:DP:DV	0,27,229:9:0	0,9,89:3:0	0,12,122:4:0
+X	933	.	G	<*>	0	.	DP=16;I16=7,8,0,0,558,20926,0,0,877,51769,0,0,239,5091,0,0;QS=3,0;MQSB=0.921243;MQ0F=0	PL:DP:DV	0,24,241:8:0	0,9,94:3:0	0,12,116:4:0
+X	934	.	C	<*>	0	.	DP=15;I16=7,8,0,0,548,20256,0,0,877,51769,0,0,261,5673,0,0;QS=3,0;MQSB=0.921243;MQ0F=0	PL:DP:DV	0,27,244:9:0	0,9,83:3:0	0,9,99:3:0
+X	935	.	A	<*>	0	.	DP=15;I16=7,8,0,0,534,19780,0,0,846,49010,0,0,259,5647,0,0;QS=3,0;MQSB=0.720273;MQ0F=0	PL:DP:DV	0,27,233:9:0	0,9,86:3:0	0,9,101:3:0
+X	936	.	T	<*>	0	.	DP=15;I16=7,8,0,0,579,22499,0,0,846,49010,0,0,257,5589,0,0;QS=3,0;MQSB=0.720273;MQ0F=0	PL:DP:DV	0,27,252:9:0	0,9,91:3:0	0,9,100:3:0
+X	937	.	G	<*>	0	.	DP=16;I16=8,7,0,0,550,20650,0,0,846,49010,0,0,232,5022,0,0;QS=3,0;MQSB=0.651439;MQ0F=0	PL:DP:DV	0,24,228:8:0	0,9,84:3:0	0,12,115:4:0
+X	938	.	C	<*>	0	.	DP=16;I16=8,7,0,0,553,20669,0,0,846,49010,0,0,231,5001,0,0;QS=3,0;MQSB=0.651439;MQ0F=0	PL:DP:DV	0,24,234:8:0	0,9,77:3:0	0,12,119:4:0
+X	939	.	C	<*>	0	.	DP=16;I16=8,8,0,0,582,22100,0,0,906,52610,0,0,250,5392,0,0;QS=3,0;MQSB=0.702619;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,9,71:3:0	0,12,115:4:0
+X	940	.	T	<*>	0	.	DP=15;I16=8,7,0,0,583,23339,0,0,846,49010,0,0,248,5320,0,0;QS=3,0;MQSB=0.651439;MQ0F=0	PL:DP:DV	0,27,252:9:0	0,6,71:2:0	0,12,124:4:0
+X	941	.	G	<*>	0	.	DP=14;I16=7,7,0,0,501,18707,0,0,786,45410,0,0,246,5216,0,0;QS=3,0;MQSB=0.714506;MQ0F=0	PL:DP:DV	0,27,240:9:0	0,6,59:2:0	0,9,93:3:0
+X	942	.	T	<*>	0	.	DP=14;I16=7,7,0,0,525,19799,0,0,786,45410,0,0,244,5128,0,0;QS=3,0;MQSB=0.714506;MQ0F=0	PL:DP:DV	0,27,237:9:0	0,6,70:2:0	0,9,94:3:0
+X	943	.	A	<*>	0	.	DP=14;I16=7,7,0,0,545,21399,0,0,786,45410,0,0,242,5056,0,0;QS=3,0;MQSB=0.714506;MQ0F=0	PL:DP:DV	0,27,248:9:0	0,6,71:2:0	0,9,93:3:0
+X	944	.	G	<*>	0	.	DP=14;I16=7,7,0,0,529,20143,0,0,786,45410,0,0,240,5000,0,0;QS=3,0;MQSB=0.714506;MQ0F=0	PL:DP:DV	0,27,249:9:0	0,6,65:2:0	0,9,95:3:0
+X	945	.	T	<*>	0	.	DP=14;I16=7,7,0,0,523,19621,0,0,786,45410,0,0,238,4960,0,0;QS=3,0;MQSB=0.714506;MQ0F=0	PL:DP:DV	0,27,239:9:0	0,6,70:2:0	0,9,95:3:0
+X	946	.	C	<*>	0	.	DP=13;I16=6,6,0,0,455,17581,0,0,666,38210,0,0,223,4739,0,0;QS=3,0;MQSB=0.660716;MQ0F=0	PL:DP:DV	0,24,240:8:0	0,6,56:2:0	0,6,70:2:0
+X	947	.	C	<*>	0	.	DP=14;I16=7,7,0,0,509,19007,0,0,755,42651,0,0,238,4928,0,0;QS=3,0;MQSB=0.925999;MQ0F=0	PL:DP:DV	0,27,251:9:0	0,9,83:3:0	0,6,66:2:0
+X	948	.	C	<*>	0	.	DP=14;I16=7,7,0,0,520,20050,0,0,755,42651,0,0,237,4887,0,0;QS=3,0;MQSB=0.925999;MQ0F=0	PL:DP:DV	0,27,254:9:0	0,9,78:3:0	0,6,69:2:0
+X	949	.	A	<*>	0	.	DP=15;I16=7,8,0,0,547,20705,0,0,815,46251,0,0,236,4864,0,0;QS=3,0;MQSB=0.959011;MQ0F=0	PL:DP:DV	0,30,250:10:0	0,9,90:3:0	0,6,72:2:0
+X	950	.	G	<*>	0	.	DP=15;I16=6,8,0,0,563,22871,0,0,786,45410,0,0,231,4835,0,0;QS=3,0;MQSB=0.740818;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,6,71:2:0	0,6,72:2:0
+X	951	.	C	<*>	0	.	DP=16;I16=7,8,0,0,554,21080,0,0,846,49010,0,0,230,4840,0,0;QS=3,0;MQSB=0.720273;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,65:2:0	0,6,73:2:0
+X	952	.	T	<*>	0	.	DP=16;I16=8,8,0,0,595,22565,0,0,875,49851,0,0,237,4913,0,0;QS=3,0;MQSB=0.934676;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,93:3:0	0,6,73:2:0
+X	953	.	A	<*>	0	.	DP=16;I16=8,8,0,0,567,20515,0,0,875,49851,0,0,237,4921,0,0;QS=3,0;MQSB=0.934676;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,91:3:0	0,6,69:2:0
+X	954	.	T	<*>	0	.	DP=15;I16=7,8,0,0,544,20412,0,0,815,46251,0,0,238,4948,0,0;QS=3,0;MQSB=0.959011;MQ0F=0	PL:DP:DV	0,30,249:10:0	0,9,94:3:0	0,6,69:2:0
+X	955	.	T	<*>	0	.	DP=15;I16=7,8,0,0,543,19953,0,0,815,46251,0,0,239,4993,0,0;QS=3,0;MQSB=0.959011;MQ0F=0	PL:DP:DV	0,30,246:10:0	0,9,95:3:0	0,6,68:2:0
+X	956	.	C	<*>	0	.	DP=15;I16=6,8,0,0,543,21255,0,0,786,45410,0,0,229,4935,0,0;QS=3,0;MQSB=0.740818;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,6,62:2:0	0,6,70:2:0
+X	957	.	A	<*>	0	.	DP=15;I16=7,8,0,0,504,17684,0,0,815,46251,0,0,241,5137,0,0;QS=3,0;MQSB=0.959011;MQ0F=0	PL:DP:DV	0,30,240:10:0	0,9,74:3:0	0,6,67:2:0
+X	958	.	C	<*>	0	.	DP=14;I16=6,8,0,0,505,18981,0,0,755,42651,0,0,243,5235,0,0;QS=3,0;MQSB=0.981425;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,9,78:3:0	0,3,39:1:0
+X	959	.	A	<*>	0	.	DP=14;I16=5,8,0,0,519,20885,0,0,726,41810,0,0,231,5153,0,0;QS=3,0;MQSB=0.765017;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,6,72:2:0	0,3,38:1:0
+X	960	.	G	<*>	0	.	DP=15;I16=6,9,0,0,539,19901,0,0,815,46251,0,0,247,5479,0,0;QS=3,0;MQSB=0.99308;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,106:4:0	0,3,41:1:0
+X	961	.	T	<*>	0	.	DP=14;I16=6,8,0,0,523,19835,0,0,755,42651,0,0,250,5574,0,0;QS=3,0;MQSB=0.981425;MQ0F=0	PL:DP:DV	0,27,248:9:0	0,12,114:4:0	0,3,39:1:0
+X	962	.	G	<*>	0	.	DP=14;I16=5,8,0,0,498,19194,0,0,726,41810,0,0,236,5394,0,0;QS=3,0;MQSB=0.765017;MQ0F=0	PL:DP:DV	0,27,253:9:0	0,9,91:3:0	0,3,36:1:0
+X	963	.	C	<*>	0	.	DP=13;I16=5,8,0,0,500,19610,0,0,695,39051,0,0,256,5754,0,0;QS=3,0;MQSB=0.997325;MQ0F=0	PL:DP:DV	0,24,234:8:0	0,12,118:4:0	0,3,40:1:0
+X	964	.	T	<*>	0	.	DP=13;I16=5,8,0,0,512,20430,0,0,695,39051,0,0,259,5835,0,0;QS=3,0;MQSB=0.997325;MQ0F=0	PL:DP:DV	0,24,227:8:0	0,12,128:4:0	0,3,42:1:0
+X	965	.	G	<*>	0	.	DP=13;I16=4,8,0,0,467,18429,0,0,666,38210,0,0,241,5477,0,0;QS=3,0;MQSB=0.793923;MQ0F=0	PL:DP:DV	0,24,228:8:0	0,9,93:3:0	0,3,40:1:0
+X	966	.	A	<*>	0	.	DP=13;I16=4,8,0,0,443,16785,0,0,666,38210,0,0,242,5490,0,0;QS=3,0;MQSB=0.793923;MQ0F=0	PL:DP:DV	0,24,212:8:0	0,9,95:3:0	0,3,40:1:0
+X	967	.	G	<*>	0	.	DP=13;I16=4,8,0,0,464,18036,0,0,666,38210,0,0,243,5513,0,0;QS=3,0;MQSB=0.793923;MQ0F=0	PL:DP:DV	0,24,230:8:0	0,9,91:3:0	0,3,41:1:0
+X	968	.	G	<*>	0	.	DP=13;I16=4,8,0,0,441,16549,0,0,666,38210,0,0,244,5546,0,0;QS=3,0;MQSB=0.793923;MQ0F=0	PL:DP:DV	0,24,218:8:0	0,9,87:3:0	0,3,42:1:0
+X	969	.	T	<*>	0	.	DP=13;I16=4,8,0,0,450,16970,0,0,666,38210,0,0,245,5589,0,0;QS=3,0;MQSB=0.793923;MQ0F=0	PL:DP:DV	0,24,220:8:0	0,9,98:3:0	0,3,31:1:0
+X	970	.	G	<*>	0	.	DP=13;I16=4,7,0,0,413,15579,0,0,629,36841,0,0,220,4968,0,0;QS=3,0;MQSB=0.924449;MQ0F=0	PL:DP:DV	0,24,221:8:0	0,6,71:2:0	0,3,33:1:0
+X	971	.	G	<*>	0	.	DP=13;I16=4,8,0,0,459,17711,0,0,666,38210,0,0,245,5609,0,0;QS=3,0;MQSB=0.793923;MQ0F=0	PL:DP:DV	0,24,223:8:0	0,9,93:3:0	0,3,38:1:0
+X	972	.	G	<*>	0	.	DP=13;I16=4,8,0,0,446,17192,0,0,666,38210,0,0,245,5637,0,0;QS=3,0;MQSB=0.793923;MQ0F=0	PL:DP:DV	0,24,210:8:0	0,9,96:3:0	0,3,39:1:0
+X	973	.	A	<*>	0	.	DP=12;I16=4,7,0,0,402,15018,0,0,606,34610,0,0,246,5676,0,0;QS=3,0;MQSB=0.763675;MQ0F=0	PL:DP:DV	0,21,192:7:0	0,9,89:3:0	0,3,42:1:0
+X	974	.	A	<*>	0	.	DP=12;I16=4,7,0,0,417,16273,0,0,606,34610,0,0,247,5725,0,0;QS=3,0;MQSB=0.763675;MQ0F=0	PL:DP:DV	0,21,198:7:0	0,9,96:3:0	0,3,42:1:0
+X	975	.	G	<*>	0	.	DP=13;I16=4,8,0,0,454,17560,0,0,666,38210,0,0,247,5733,0,0;QS=3,0;MQSB=0.793923;MQ0F=0	PL:DP:DV	0,24,213:8:0	0,9,95:3:0	0,3,42:1:0
+X	976	.	A	<*>	0	.	DP=13;I16=4,8,0,0,431,16083,0,0,666,38210,0,0,248,5750,0,0;QS=3,0;MQSB=0.793923;MQ0F=0	PL:DP:DV	0,24,227:8:0	0,9,70:3:0	0,3,41:1:0
+X	977	.	T	<*>	0	.	DP=13;I16=4,8,0,0,438,16316,0,0,666,38210,0,0,248,5726,0,0;QS=3,0;MQSB=0.793923;MQ0F=0	PL:DP:DV	0,24,210:8:0	0,9,93:3:0	0,3,37:1:0
+X	978	.	G	<*>	0	.	DP=12;I16=4,8,0,0,430,16060,0,0,666,38210,0,0,248,5710,0,0;QS=3,0;MQSB=0.793923;MQ0F=0	PL:DP:DV	0,24,224:8:0	0,9,75:3:0	0,3,40:1:0
+X	979	.	C	<*>	0	.	DP=13;I16=4,8,0,0,453,17461,0,0,689,40441,0,0,223,5077,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,27,232:9:0	0,6,72:2:0	0,3,41:1:0
+X	980	.	T	<*>	0	.	DP=13;I16=4,8,0,0,438,16412,0,0,689,40441,0,0,224,5078,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,27,220:9:0	0,6,76:2:0	0,3,43:1:0
+X	981	.	T	<*>	0	.	DP=13;I16=4,9,0,0,484,18602,0,0,726,41810,0,0,250,5714,0,0;QS=3,0;MQSB=0.826565;MQ0F=0	PL:DP:DV	0,27,224:9:0	0,9,97:3:0	0,3,41:1:0
+X	982	.	G	<*>	0	.	DP=14;I16=4,10,0,0,520,20128,0,0,786,45410,0,0,250,5686,0,0;QS=3,0;MQSB=0.852144;MQ0F=0	PL:DP:DV	0,30,237:10:0	0,9,99:3:0	0,3,40:1:0
+X	983	.	A	<*>	0	.	DP=14;I16=4,10,0,0,570,23360,0,0,786,45410,0,0,251,5671,0,0;QS=3,0;MQSB=0.852144;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,101:3:0	0,3,42:1:0
+X	984	.	G	<*>	0	.	DP=15;I16=4,10,0,0,529,20459,0,0,786,45410,0,0,252,5670,0,0;QS=3,0;MQSB=0.852144;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,9,88:3:0	0,3,43:1:0
+X	985	.	C	<*>	0	.	DP=17;I16=4,13,0,0,580,20280,0,0,966,56210,0,0,261,5747,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,33,246:11:0	0,12,100:4:0	0,6,65:2:0
+X	986	.	C	A,<*>	0	.	DP=17;I16=3,12,0,1,519,18353,13,169,846,49010,60,3600,235,5101,4,16;QS=2.95873,0.0412698,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.921781;BQB=1;MQ0F=0	PL:DP:DV	0,16,197,27,200,201:10:1	0,12,108,12,108,108:4:0	0,6,69,6,69,69:2:0
+X	987	.	C	<*>	0	.	DP=17;I16=4,13,0,0,634,23914,0,0,966,56210,0,0,267,5755,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,107:4:0	0,6,69:2:0
+X	988	.	A	<*>	0	.	DP=17;I16=4,13,0,0,633,24341,0,0,966,56210,0,0,269,5737,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,111:4:0	0,6,82:2:0
+X	989	.	G	<*>	0	.	DP=17;I16=4,13,0,0,635,24149,0,0,966,56210,0,0,271,5739,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,114:4:0	0,6,80:2:0
+X	990	.	G	<*>	0	.	DP=16;I16=4,12,0,0,591,22177,0,0,906,52610,0,0,274,5760,0,0;QS=3,0;MQSB=0.88901;MQ0F=0	PL:DP:DV	0,30,246:10:0	0,12,105:4:0	0,6,83:2:0
+X	991	.	A	<*>	0	.	DP=16;I16=3,11,0,0,548,21542,0,0,809,47641,0,0,227,4549,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,27,232:9:0	0,9,100:3:0	0,6,80:2:0
+X	992	.	G	<*>	0	.	DP=16;I16=4,12,0,0,562,20436,0,0,906,52610,0,0,278,5760,0,0;QS=3,0;MQSB=0.88901;MQ0F=0	PL:DP:DV	0,30,240:10:0	0,12,102:4:0	0,6,76:2:0
+X	993	.	T	<*>	0	.	DP=16;I16=4,12,0,0,564,20752,0,0,906,52610,0,0,280,5790,0,0;QS=3,0;MQSB=0.88901;MQ0F=0	PL:DP:DV	0,30,222:10:0	0,12,121:4:0	0,6,73:2:0
+X	994	.	T	<*>	0	.	DP=17;I16=5,11,0,0,597,22625,0,0,906,52610,0,0,270,5696,0,0;QS=3,0;MQSB=0.851779;MQ0F=0	PL:DP:DV	0,27,227:9:0	0,12,123:4:0	0,9,103:3:0
+X	995	.	C	<*>	0	.	DP=16;I16=4,11,0,0,588,23228,0,0,846,49010,0,0,273,5741,0,0;QS=3,0;MQSB=0.872525;MQ0F=0	PL:DP:DV	0,24,216:8:0	0,12,119:4:0	0,9,110:3:0
+X	996	.	A	<*>	0	.	DP=16;I16=4,12,0,0,562,20416,0,0,906,52610,0,0,290,6000,0,0;QS=3,0;MQSB=0.88901;MQ0F=0	PL:DP:DV	0,27,207:9:0	0,12,107:4:0	0,9,113:3:0
+X	997	.	A	<*>	0	.	DP=16;I16=4,12,0,0,600,23520,0,0,906,52610,0,0,294,6110,0,0;QS=3,0;MQSB=0.88901;MQ0F=0	PL:DP:DV	0,27,209:9:0	0,12,123:4:0	0,9,121:3:0
+X	998	.	G	<*>	0	.	DP=17;I16=4,13,0,0,603,22299,0,0,966,56210,0,0,298,6240,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,30,226:10:0	0,12,99:4:0	0,9,115:3:0
+X	999	.	G	<*>	0	.	DP=17;I16=4,12,0,0,575,21519,0,0,906,52610,0,0,302,6390,0,0;QS=3,0;MQSB=0.88901;MQ0F=0	PL:DP:DV	0,27,202:9:0	0,12,118:4:0	0,9,111:3:0
+X	1000	.	C	<*>	0	.	DP=17;I16=4,13,0,0,637,24465,0,0,966,56210,0,0,308,6564,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,30,235:10:0	0,12,118:4:0	0,9,109:3:0
+X	1001	.	T	<*>	0	.	DP=17;I16=4,13,0,0,647,24907,0,0,966,56210,0,0,312,6708,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,30,228:10:0	0,12,120:4:0	0,9,122:3:0
+X	1002	.	G	<*>	0	.	DP=17;I16=4,13,0,0,627,23691,0,0,966,56210,0,0,316,6872,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,30,220:10:0	0,12,123:4:0	0,9,109:3:0
+X	1003	.	C	T,<*>	0	.	DP=18;I16=4,13,0,1,633,23953,22,484,966,56210,60,3600,297,6515,21,441;QS=2.9375,0.0625,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.913725;BQB=1;MQ0F=0	PL:DP:DV	0,8,207,27,211,220:10:1	0,15,132,15,132,132:5:0	0,9,102,9,102,102:3:0
+X	1004	.	A	<*>	0	.	DP=19;I16=5,14,0,0,653,23107,0,0,1086,63410,0,0,321,7061,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,33,231:11:0	0,15,131:5:0	0,9,98:3:0
+X	1005	.	A	<*>	0	.	DP=19;I16=5,14,0,0,670,24380,0,0,1086,63410,0,0,324,7138,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,33,231:11:0	0,15,132:5:0	0,9,113:3:0
+X	1006	.	T	<*>	0	.	DP=19;I16=4,14,0,0,659,24869,0,0,1026,59810,0,0,327,7237,0,0;QS=3,0;MQSB=0.913725;MQ0F=0	PL:DP:DV	0,30,220:10:0	0,15,134:5:0	0,9,115:3:0
+X	1007	.	G	<*>	0	.	DP=18;I16=4,13,0,0,651,25373,0,0,966,56210,0,0,306,6732,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,27,225:9:0	0,15,138:5:0	0,9,113:3:0
+X	1008	.	A	<*>	0	.	DP=18;I16=4,13,0,0,667,27041,0,0,966,56210,0,0,309,6821,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,27,222:9:0	0,15,147:5:0	0,9,118:3:0
+X	1009	.	G	<*>	0	.	DP=18;I16=4,13,0,0,635,24431,0,0,966,56210,0,0,312,6928,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,27,213:9:0	0,15,139:5:0	0,9,116:3:0
+X	1010	.	C	<*>	0	.	DP=18;I16=4,14,0,0,661,25289,0,0,1026,59810,0,0,339,7629,0,0;QS=3,0;MQSB=0.913725;MQ0F=0	PL:DP:DV	0,30,234:10:0	0,15,126:5:0	0,9,114:3:0
+X	1011	.	T	<*>	0	.	DP=18;I16=4,14,0,0,671,25325,0,0,1026,59810,0,0,339,7623,0,0;QS=3,0;MQSB=0.913725;MQ0F=0	PL:DP:DV	0,30,226:10:0	0,15,131:5:0	0,9,118:3:0
+X	1012	.	A	<*>	0	.	DP=19;I16=5,14,0,0,639,22891,0,0,1063,61179,0,0,339,7633,0,0;QS=3,0;MQSB=0.990403;MQ0F=0	PL:DP:DV	0,30,201:10:0	0,18,154:6:0	0,9,113:3:0
+X	1013	.	T	<*>	0	.	DP=18;I16=5,12,0,0,623,23913,0,0,943,53979,0,0,325,7385,0,0;QS=3,0;MQSB=0.998612;MQ0F=0	PL:DP:DV	0,24,202:8:0	0,18,161:6:0	0,9,115:3:0
+X	1014	.	G	<*>	0	.	DP=18;I16=5,13,0,0,656,24596,0,0,1003,57579,0,0,341,7605,0,0;QS=3,0;MQSB=0.995153;MQ0F=0	PL:DP:DV	0,27,218:9:0	0,18,159:6:0	0,9,113:3:0
+X	1015	.	A	<*>	0	.	DP=18;I16=5,13,0,0,646,23878,0,0,1003,57579,0,0,342,7618,0,0;QS=3,0;MQSB=0.995153;MQ0F=0	PL:DP:DV	0,27,209:9:0	0,18,164:6:0	0,9,109:3:0
+X	1016	.	T	<*>	0	.	DP=17;I16=4,12,0,0,588,22114,0,0,929,54841,0,0,340,7632,0,0;QS=3,0;MQSB=0.971017;MQ0F=0	PL:DP:DV	0,27,212:9:0	0,12,124:4:0	0,9,101:3:0
+X	1017	.	T	<*>	0	.	DP=18;I16=5,13,0,0,635,23433,0,0,1026,59810,0,0,346,7694,0,0;QS=3,0;MQSB=0.942222;MQ0F=0	PL:DP:DV	0,27,213:9:0	0,18,155:6:0	0,9,105:3:0
+X	1018	.	G	<*>	0	.	DP=18;I16=5,13,0,0,650,24550,0,0,1026,59810,0,0,349,7757,0,0;QS=3,0;MQSB=0.942222;MQ0F=0	PL:DP:DV	0,27,215:9:0	0,18,179:6:0	0,9,91:3:0
+X	1019	.	C	<*>	0	.	DP=18;I16=5,12,0,0,555,18561,0,0,966,56210,0,0,327,7213,0,0;QS=3,0;MQSB=0.951229;MQ0F=0	PL:DP:DV	0,24,181:8:0	0,18,143:6:0	0,9,104:3:0
+X	1020	.	G	<*>	0	.	DP=19;I16=6,12,0,0,625,22287,0,0,1026,59810,0,0,332,7402,0,0;QS=3,0;MQSB=0.97296;MQ0F=0	PL:DP:DV	0,27,228:9:0	0,18,157:6:0	0,9,87:3:0
+X	1021	.	C	<*>	0	.	DP=19;I16=5,13,0,0,625,22761,0,0,1026,59810,0,0,332,7326,0,0;QS=3,0;MQSB=0.942222;MQ0F=0	PL:DP:DV	0,27,220:9:0	0,18,153:6:0	0,9,92:3:0
+X	1022	.	C	<*>	0	.	DP=19;I16=6,13,0,0,727,27975,0,0,1086,63410,0,0,360,8034,0,0;QS=3,0;MQSB=0.965977;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,168:6:0	0,9,110:3:0
+X	1023	.	A	<*>	0	.	DP=19;I16=6,12,0,0,647,23997,0,0,1026,59810,0,0,338,7510,0,0;QS=3,0;MQSB=0.97296;MQ0F=0	PL:DP:DV	0,27,216:9:0	0,18,168:6:0	0,9,112:3:0
+X	1024	.	C	<*>	0	.	DP=20;I16=7,13,0,0,729,27471,0,0,1146,67010,0,0,364,8154,0,0;QS=3,0;MQSB=0.980568;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,169:6:0	0,9,106:3:0
+X	1025	.	T	<*>	0	.	DP=20;I16=7,13,0,0,757,29387,0,0,1146,67010,0,0,366,8192,0,0;QS=3,0;MQSB=0.980568;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,181:6:0	0,9,117:3:0
+X	1026	.	G	<*>	0	.	DP=20;I16=7,13,0,0,747,28435,0,0,1146,67010,0,0,367,8201,0,0;QS=3,0;MQSB=0.980568;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,169:6:0	0,9,113:3:0
+X	1027	.	C	<*>	0	.	DP=20;I16=7,13,0,0,720,26688,0,0,1146,67010,0,0,368,8232,0,0;QS=3,0;MQSB=0.980568;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,145:6:0	0,9,110:3:0
+X	1028	.	A	<*>	0	.	DP=19;I16=6,12,0,0,645,23681,0,0,1026,59810,0,0,348,7800,0,0;QS=3,0;MQSB=0.97296;MQ0F=0	PL:DP:DV	0,30,238:10:0	0,15,146:5:0	0,9,99:3:0
+X	1029	.	C	<*>	0	.	DP=19;I16=7,12,0,0,699,26817,0,0,1086,63410,0,0,371,8305,0,0;QS=3,0;MQSB=0.985816;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,138:5:0	0,9,111:3:0
+X	1030	.	T	<*>	0	.	DP=19;I16=7,12,0,0,749,29789,0,0,1086,63410,0,0,371,8293,0,0;QS=3,0;MQSB=0.985816;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,158:5:0	0,9,122:3:0
+X	1031	.	T	<*>	0	.	DP=21;I16=9,12,0,0,748,27726,0,0,1206,70610,0,0,371,8297,0,0;QS=3,0;MQSB=0.997478;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,144:5:0	0,9,113:3:0
+X	1032	.	T	<*>	0	.	DP=21;I16=9,12,0,0,761,28033,0,0,1206,70610,0,0,373,8319,0,0;QS=3,0;MQSB=0.997478;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,156:5:0	0,9,111:3:0
+X	1033	.	G	<*>	0	.	DP=22;I16=10,12,0,0,773,28227,0,0,1266,74210,0,0,375,8361,0,0;QS=3,0;MQSB=0.999457;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,169:6:0	0,9,101:3:0
+X	1034	.	G	<*>	0	.	DP=22;I16=8,12,0,0,703,25617,0,0,1169,69241,0,0,340,7684,0,0;QS=3,0;MQSB=0.953497;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,149:5:0	0,9,102:3:0
+X	1035	.	C	<*>	0	.	DP=21;I16=10,11,0,0,719,26103,0,0,1237,73369,0,0,382,8508,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,163:6:0	0,9,94:3:0
+X	1036	.	C	<*>	0	.	DP=22;I16=11,10,0,0,756,28390,0,0,1237,73369,0,0,360,7938,0,0;QS=3,0;MQSB=0.939898;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,175:6:0	0,12,135:4:0
+X	1037	.	T	<*>	0	.	DP=22;I16=11,11,0,0,839,32737,0,0,1297,76969,0,0,389,8641,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,188:6:0	0,12,138:4:0
+X	1038	.	G	<*>	0	.	DP=21;I16=10,10,0,0,752,28750,0,0,1177,69769,0,0,368,8066,0,0;QS=3,0;MQSB=0.931063;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,184:6:0	0,9,107:3:0
+X	1039	.	G	<*>	0	.	DP=21;I16=10,11,0,0,775,29373,0,0,1237,73369,0,0,397,8761,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,189:6:0	0,9,111:3:0
+X	1040	.	A	<*>	0	.	DP=21;I16=10,11,0,0,759,28007,0,0,1237,73369,0,0,401,8851,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,177:6:0	0,9,107:3:0
+X	1041	.	C	<*>	0	.	DP=21;I16=8,11,0,0,713,27117,0,0,1140,68400,0,0,371,8255,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,155:5:0	0,9,110:3:0
+X	1042	.	A	<*>	0	.	DP=23;I16=12,10,0,0,800,29464,0,0,1297,76969,0,0,384,8466,0,0;QS=3,0;MQSB=0.947103;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,185:6:0	0,15,145:5:0
+X	1043	.	A	<*>	0	.	DP=23;I16=12,11,0,0,850,32160,0,0,1357,80569,0,0,414,9192,0,0;QS=3,0;MQSB=0.944319;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,188:6:0	0,15,159:5:0
+X	1044	.	C	<*>	0	.	DP=23;I16=12,10,0,0,812,30758,0,0,1297,76969,0,0,394,8690,0,0;QS=3,0;MQSB=0.947103;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,181:6:0	0,15,150:5:0
+X	1045	.	A	<*>	0	.	DP=23;I16=12,11,0,0,887,34519,0,0,1357,80569,0,0,424,9460,0,0;QS=3,0;MQSB=0.944319;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,197:6:0	0,15,156:5:0
+X	1046	.	G	<*>	0	.	DP=23;I16=12,11,0,0,862,33240,0,0,1357,80569,0,0,428,9576,0,0;QS=3,0;MQSB=0.944319;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,183:6:0	0,15,158:5:0
+X	1047	.	A	<*>	0	.	DP=23;I16=12,11,0,0,890,34804,0,0,1357,80569,0,0,432,9712,0,0;QS=3,0;MQSB=0.944319;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,198:6:0	0,15,165:5:0
+X	1048	.	G	<*>	0	.	DP=23;I16=12,10,0,0,846,33054,0,0,1297,76969,0,0,411,9243,0,0;QS=3,0;MQSB=0.947103;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,195:6:0	0,15,156:5:0
+X	1049	.	C	<*>	0	.	DP=22;I16=12,10,0,0,808,30644,0,0,1297,76969,0,0,441,10043,0,0;QS=3,0;MQSB=0.947103;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,182:6:0	0,15,160:5:0
+X	1050	.	A	<*>	0	.	DP=22;I16=11,10,0,0,808,31334,0,0,1237,73369,0,0,430,9940,0,0;QS=3,0;MQSB=0.939898;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,193:6:0	0,12,138:4:0
+X	1051	.	A	<*>	0	.	DP=21;I16=11,9,0,0,731,27495,0,0,1177,69769,0,0,423,9621,0,0;QS=3,0;MQSB=0.943233;MQ0F=0	PL:DP:DV	0,27,238:9:0	0,18,187:6:0	0,15,150:5:0
+X	1052	.	A	<*>	0	.	DP=21;I16=11,9,0,0,759,29327,0,0,1177,69769,0,0,427,9747,0,0;QS=3,0;MQSB=0.943233;MQ0F=0	PL:DP:DV	0,27,247:9:0	0,18,190:6:0	0,15,150:5:0
+X	1053	.	A	<*>	0	.	DP=21;I16=11,8,0,0,674,25210,0,0,1117,66169,0,0,406,9264,0,0;QS=3,0;MQSB=0.946915;MQ0F=0	PL:DP:DV	0,24,224:8:0	0,18,161:6:0	0,15,149:5:0
+X	1054	.	C	<*>	0	.	DP=21;I16=11,10,0,0,791,30157,0,0,1237,73369,0,0,459,10623,0,0;QS=3,0;MQSB=0.939898;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,189:6:0	0,15,153:5:0
+X	1055	.	C	<*>	0	.	DP=22;I16=12,10,0,0,818,31448,0,0,1297,76969,0,0,462,10750,0,0;QS=3,0;MQSB=0.947103;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,191:6:0	0,15,157:5:0
+X	1056	.	C	<*>	0	.	DP=22;I16=12,9,0,0,793,31265,0,0,1237,73369,0,0,441,10271,0,0;QS=3,0;MQSB=0.950149;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,195:6:0	0,15,161:5:0
+X	1057	.	T	<*>	0	.	DP=23;I16=12,10,0,0,821,31667,0,0,1297,76969,0,0,467,10911,0,0;QS=3,0;MQSB=0.947103;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,196:6:0	0,15,159:5:0
+X	1058	.	G	<*>	0	.	DP=23;I16=12,11,0,0,863,32871,0,0,1357,80569,0,0,493,11569,0,0;QS=3,0;MQSB=0.944319;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,197:7:0	0,15,155:5:0
+X	1059	.	T	<*>	0	.	DP=23;I16=12,10,0,0,797,29803,0,0,1297,76969,0,0,468,10944,0,0;QS=3,0;MQSB=0.947103;MQ0F=0	PL:DP:DV	0,30,249:10:0	0,21,202:7:0	0,15,152:5:0
+X	1060	.	C	<*>	0	.	DP=23;I16=12,11,0,0,829,31041,0,0,1357,80569,0,0,492,11536,0,0;QS=3,0;MQSB=0.944319;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,178:7:0	0,15,163:5:0
+X	1061	.	T	<*>	0	.	DP=22;I16=12,9,0,0,810,31840,0,0,1237,73369,0,0,465,10797,0,0;QS=3,0;MQSB=0.950149;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,175:5:0	0,15,158:5:0
+X	1062	.	C	A,<*>	0	.	DP=22;I16=12,9,0,1,826,32780,33,1089,1237,73369,60,3600,462,10652,25,625;QS=2.85398,0.146018,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.947103;BQB=1;MQ0F=0	PL:DP:DV	0,33,255,33,255,255:11:0	15,0,151,30,154,176:6:1	0,15,164,15,164,164:5:0
+X	1063	.	T	<*>	0	.	DP=22;I16=12,9,0,0,820,32460,0,0,1237,73369,0,0,459,10525,0,0;QS=3,0;MQSB=0.950149;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,183:6:0	0,15,166:5:0
+X	1064	.	A	<*>	0	.	DP=23;I16=12,9,0,0,793,30355,0,0,1237,73369,0,0,464,10752,0,0;QS=3,0;MQSB=0.950149;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,180:6:0	0,15,162:5:0
+X	1065	.	A	<*>	0	.	DP=23;I16=12,9,0,0,814,31978,0,0,1237,73369,0,0,462,10694,0,0;QS=3,0;MQSB=0.950149;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,186:6:0	0,15,174:5:0
+X	1066	.	A	<*>	0	.	DP=27;I16=15,9,0,0,890,34378,0,0,1417,84169,0,0,460,10652,0,0;QS=3,0;MQSB=0.96464;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,198:7:0	0,18,181:6:0
+X	1067	.	A	<*>	0	.	DP=27;I16=15,10,0,0,913,35031,0,0,1477,87769,0,0,470,10600,0,0;QS=3,0;MQSB=0.962269;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,208:7:0	0,18,182:6:0
+X	1068	.	A	<*>	0	.	DP=27;I16=15,9,0,0,898,34580,0,0,1417,84169,0,0,456,10342,0,0;QS=3,0;MQSB=0.96464;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,24,218:8:0	0,18,181:6:0
+X	1069	.	A	<*>	0	.	DP=28;I16=16,10,0,0,914,33888,0,0,1537,91369,0,0,481,10925,0,0;QS=3,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,207:8:0	0,21,177:7:0
+X	1070	.	A	<*>	0	.	DP=28;I16=15,11,0,0,955,36445,0,0,1537,91369,0,0,467,10351,0,0;QS=3,0;MQSB=0.960078;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,223:8:0	0,21,188:7:0
+X	1071	.	G	<*>	0	.	DP=28;I16=16,10,0,0,974,37570,0,0,1537,91369,0,0,466,10284,0,0;QS=3,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,192:7:0	0,21,191:7:0
+X	1072	.	A	<*>	0	.	DP=28;I16=16,11,0,0,1007,38205,0,0,1597,94969,0,0,490,10868,0,0;QS=3,0;MQSB=0.96384;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,239:8:0	0,21,195:7:0
+X	1073	.	A	<*>	0	.	DP=28;I16=16,10,0,0,976,37822,0,0,1537,91369,0,0,463,10177,0,0;QS=3,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,33,254:11:0	0,24,236:8:0	0,21,199:7:0
+X	1074	.	A	<*>	0	.	DP=28;I16=16,11,0,0,1003,38097,0,0,1597,94969,0,0,484,10664,0,0;QS=3,0;MQSB=0.96384;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,232:8:0	0,21,203:7:0
+X	1075	.	A	<*>	0	.	DP=28;I16=16,10,0,0,964,36762,0,0,1537,91369,0,0,476,10564,0,0;QS=3,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,222:8:0	0,21,200:7:0
+X	1076	.	G	<*>	0	.	DP=28;I16=16,10,0,0,966,37048,0,0,1537,91369,0,0,476,10536,0,0;QS=3,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,209:8:0	0,21,183:7:0
+X	1077	.	A	<*>	0	.	DP=29;I16=17,11,0,0,1038,39240,0,0,1657,98569,0,0,480,10548,0,0;QS=3,0;MQSB=0.967085;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,231:8:0	0,24,209:8:0
+X	1078	.	A	<*>	0	.	DP=29;I16=17,11,0,0,1053,40425,0,0,1657,98569,0,0,480,10562,0,0;QS=3,0;MQSB=0.967085;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,234:8:0	0,24,214:8:0
+X	1079	.	A	<*>	0	.	DP=28;I16=17,10,0,0,1019,39007,0,0,1597,94969,0,0,479,10505,0,0;QS=3,0;MQSB=0.968979;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,223:8:0	0,24,206:8:0
+X	1080	.	A	<*>	0	.	DP=29;I16=18,10,0,0,1049,40827,0,0,1657,98569,0,0,478,10478,0,0;QS=3,0;MQSB=0.971673;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,246:9:0	0,24,218:8:0
+X	1081	.	G	<*>	0	.	DP=30;I16=19,8,0,0,988,37392,0,0,1597,94969,0,0,436,9550,0,0;QS=3,0;MQSB=0.977696;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,24,210:8:0	0,27,210:9:0
+X	1082	.	A	<*>	0	.	DP=30;I16=20,7,0,0,989,37109,0,0,1597,94969,0,0,438,9564,0,0;QS=3,0;MQSB=0.981425;MQ0F=0	PL:DP:DV	0,27,224:9:0	0,27,226:9:0	0,27,217:9:0
+X	1083	.	A	<*>	0	.	DP=30;I16=20,8,0,0,1039,39827,0,0,1657,98569,0,0,455,9803,0,0;QS=3,0;MQSB=0.979523;MQ0F=0	PL:DP:DV	0,30,246:10:0	0,27,233:9:0	0,27,217:9:0
+X	1084	.	A	<*>	0	.	DP=31;I16=21,8,0,0,1049,39097,0,0,1717,102169,0,0,457,9849,0,0;QS=3,0;MQSB=0.981133;MQ0F=0	PL:DP:DV	0,33,253:11:0	0,27,226:9:0	0,27,215:9:0
+X	1085	.	A	<*>	0	.	DP=30;I16=21,8,0,0,1052,39534,0,0,1717,102169,0,0,486,10552,0,0;QS=3,0;MQSB=0.981133;MQ0F=0	PL:DP:DV	0,30,232:10:0	0,30,247:10:0	0,27,214:9:0
+X	1086	.	A	<*>	0	.	DP=28;I16=21,6,0,0,969,36223,0,0,1597,94969,0,0,492,10660,0,0;QS=3,0;MQSB=0.98481;MQ0F=0	PL:DP:DV	0,30,219:10:0	0,27,236:9:0	0,24,179:8:0
+X	1087	.	C	<*>	0	.	DP=28;I16=22,6,0,0,984,36046,0,0,1657,98569,0,0,498,10796,0,0;QS=3,0;MQSB=0.985992;MQ0F=0	PL:DP:DV	0,30,234:10:0	0,27,229:9:0	0,27,173:9:0
+X	1088	.	T	<*>	0	.	DP=29;I16=23,6,0,0,1133,45203,0,0,1717,102169,0,0,503,10863,0,0;QS=3,0;MQSB=0.987041;MQ0F=0	PL:DP:DV	0,30,252:10:0	0,30,250:10:0	0,27,198:9:0
+X	1089	.	C	<*>	0	.	DP=29;I16=23,6,0,0,1093,42347,0,0,1717,102169,0,0,509,10965,0,0;QS=3,0;MQSB=0.987041;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,30,237:10:0	0,27,188:9:0
+X	1090	.	A	<*>	0	.	DP=29;I16=23,6,0,0,1061,39845,0,0,1717,102169,0,0,515,11103,0,0;QS=3,0;MQSB=0.987041;MQ0F=0	PL:DP:DV	0,30,221:10:0	0,30,250:10:0	0,27,183:9:0
+X	1091	.	C	<*>	0	.	DP=29;I16=23,6,0,0,1063,39713,0,0,1717,102169,0,0,521,11277,0,0;QS=3,0;MQSB=0.987041;MQ0F=0	PL:DP:DV	0,30,247:10:0	0,30,244:10:0	0,27,177:9:0
+X	1092	.	T	<*>	0	.	DP=29;I16=23,6,0,0,1121,44489,0,0,1717,102169,0,0,524,11334,0,0;QS=3,0;MQSB=0.987041;MQ0F=0	PL:DP:DV	0,30,244:10:0	0,30,251:10:0	0,27,198:9:0
+X	1093	.	G	<*>	0	.	DP=29;I16=23,6,0,0,1085,41377,0,0,1717,102169,0,0,526,11372,0,0;QS=3,0;MQSB=0.987041;MQ0F=0	PL:DP:DV	0,30,249:10:0	0,30,243:10:0	0,27,184:9:0
+X	1094	.	G	<*>	0	.	DP=29;I16=22,6,0,0,1018,38808,0,0,1657,98569,0,0,521,11393,0,0;QS=3,0;MQSB=0.985992;MQ0F=0	PL:DP:DV	0,30,243:10:0	0,30,232:10:0	0,24,185:8:0
+X	1095	.	A	<*>	0	.	DP=28;I16=22,6,0,0,1023,38551,0,0,1657,98569,0,0,529,11443,0,0;QS=3,0;MQSB=0.985992;MQ0F=0	PL:DP:DV	0,30,236:10:0	0,30,244:10:0	0,24,178:8:0
+X	1096	.	T	<*>	0	.	DP=30;I16=24,5,0,0,1020,37168,0,0,1717,102169,0,0,505,10849,0,0;QS=3,0;MQSB=0.989637;MQ0F=0	PL:DP:DV	0,33,234:11:0	0,27,220:9:0	0,27,178:9:0
+X	1097	.	A	<*>	0	.	DP=30;I16=24,6,0,0,1056,38166,0,0,1777,105769,0,0,533,11537,0,0;QS=3,0;MQSB=0.987976;MQ0F=0	PL:DP:DV	0,33,230:11:0	0,30,237:10:0	0,27,177:9:0
+X	1098	.	T	<*>	0	.	DP=29;I16=24,5,0,0,1081,40557,0,0,1717,102169,0,0,537,11633,0,0;QS=3,0;MQSB=0.989637;MQ0F=0	PL:DP:DV	0,30,210:10:0	0,30,251:10:0	0,27,186:9:0
+X	1099	.	G	<*>	0	.	DP=29;I16=24,5,0,0,1091,41719,0,0,1717,102169,0,0,540,11712,0,0;QS=3,0;MQSB=0.989637;MQ0F=0	PL:DP:DV	0,30,229:10:0	0,30,242:10:0	0,27,182:9:0
+X	1100	.	A	<*>	0	.	DP=29;I16=24,5,0,0,1106,42976,0,0,1717,102169,0,0,543,11825,0,0;QS=3,0;MQSB=0.989637;MQ0F=0	PL:DP:DV	0,30,210:10:0	0,30,255:10:0	0,27,191:9:0
+X	1101	.	A	<*>	0	.	DP=29;I16=24,5,0,0,1154,46420,0,0,1717,102169,0,0,545,11921,0,0;QS=3,0;MQSB=0.989637;MQ0F=0	PL:DP:DV	0,30,222:10:0	0,30,255:10:0	0,27,198:9:0
+X	1102	.	T	<*>	0	.	DP=29;I16=24,4,0,0,1046,39520,0,0,1657,98569,0,0,522,11424,0,0;QS=3,0;MQSB=0.991416;MQ0F=0	PL:DP:DV	0,30,210:10:0	0,27,233:9:0	0,27,186:9:0
+X	1103	.	G	<*>	0	.	DP=30;I16=24,6,0,0,1134,43486,0,0,1777,105769,0,0,548,12158,0,0;QS=3,0;MQSB=0.987976;MQ0F=0	PL:DP:DV	0,30,223:10:0	0,30,255:10:0	0,30,222:10:0
+X	1104	.	A	<*>	0	.	DP=28;I16=23,5,0,0,1089,43067,0,0,1657,98569,0,0,552,12296,0,0;QS=3,0;MQSB=0.988819;MQ0F=0	PL:DP:DV	0,27,213:9:0	0,27,233:9:0	0,30,233:10:0
+X	1105	.	T	<*>	0	.	DP=28;I16=23,5,0,0,1035,38743,0,0,1657,98569,0,0,556,12462,0,0;QS=3,0;MQSB=0.988819;MQ0F=0	PL:DP:DV	0,27,203:9:0	0,27,227:9:0	0,30,222:10:0
+X	1106	.	A	<*>	0	.	DP=29;I16=23,5,0,0,1003,36715,0,0,1657,98569,0,0,532,11882,0,0;QS=3,0;MQSB=0.988819;MQ0F=0	PL:DP:DV	0,30,227:10:0	0,24,198:8:0	0,30,217:10:0
+X	1107	.	C	<*>	0	.	DP=29;I16=23,6,0,0,1093,41509,0,0,1717,102169,0,0,558,12532,0,0;QS=3,0;MQSB=0.987041;MQ0F=0	PL:DP:DV	0,30,244:10:0	0,27,233:9:0	0,30,220:10:0
+X	1108	.	A	<*>	0	.	DP=29;I16=23,6,0,0,1138,44908,0,0,1717,102169,0,0,558,12536,0,0;QS=3,0;MQSB=0.987041;MQ0F=0	PL:DP:DV	0,30,239:10:0	0,27,253:9:0	0,30,227:10:0
+X	1109	.	G	<*>	0	.	DP=29;I16=23,6,0,0,1140,45200,0,0,1717,102169,0,0,557,12519,0,0;QS=3,0;MQSB=0.987041;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,27,240:9:0	0,30,224:10:0
+X	1110	.	G	<*>	0	.	DP=29;I16=23,6,0,0,1086,41054,0,0,1717,102169,0,0,555,12481,0,0;QS=3,0;MQSB=0.987041;MQ0F=0	PL:DP:DV	0,30,242:10:0	0,27,229:9:0	0,30,224:10:0
+X	1111	.	T	<*>	0	.	DP=29;I16=22,6,0,0,1025,37919,0,0,1680,100800,0,0,552,12470,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,227:10:0	0,24,227:8:0	0,30,211:10:0
+X	1112	.	T	<*>	0	.	DP=28;I16=22,6,0,0,1034,38986,0,0,1680,100800,0,0,550,12440,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,226:10:0	0,24,221:8:0	0,30,221:10:0
+X	1113	.	G	<*>	0	.	DP=28;I16=23,5,0,0,1085,42273,0,0,1680,100800,0,0,548,12386,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,202:7:0	0,33,222:11:0
+X	1114	.	A	<*>	0	.	DP=28;I16=23,5,0,0,1079,42279,0,0,1680,100800,0,0,546,12306,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,235:10:0	0,21,209:7:0	0,33,238:11:0
+X	1115	.	G	<*>	0	.	DP=28;I16=23,5,0,0,1114,44550,0,0,1680,100800,0,0,544,12250,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,208:7:0	0,33,234:11:0
+X	1116	.	G	<*>	0	.	DP=29;I16=24,5,0,0,1059,39531,0,0,1740,104400,0,0,542,12218,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,236:10:0	0,24,204:8:0	0,33,226:11:0
+X	1117	.	A	<*>	0	.	DP=29;I16=24,5,0,0,1124,43896,0,0,1740,104400,0,0,541,12211,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,235:10:0	0,24,227:8:0	0,33,234:11:0
+X	1118	.	T	<*>	0	.	DP=29;I16=24,4,0,0,1100,44802,0,0,1680,100800,0,0,539,12131,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,230:10:0	0,21,188:7:0	0,33,248:11:0
+X	1119	.	C	<*>	0	.	DP=29;I16=23,4,0,0,1078,44864,0,0,1620,97200,0,0,526,11958,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,224:9:0	0,21,191:7:0	0,33,255:11:0
+X	1120	.	C	<*>	0	.	DP=29;I16=23,5,0,0,1113,46071,0,0,1680,100800,0,0,536,12054,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,227:9:0	0,24,214:8:0	0,33,255:11:0
+X	1121	.	A	<*>	0	.	DP=30;I16=24,5,0,0,1167,48549,0,0,1740,104400,0,0,536,12056,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,233:9:0	0,24,220:8:0	0,36,255:12:0
+X	1122	.	T	<*>	0	.	DP=32;I16=26,5,0,0,1235,50967,0,0,1860,111600,0,0,535,11985,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,230:10:0	0,27,238:9:0	0,36,255:12:0
+X	1123	.	T	<*>	0	.	DP=32;I16=26,5,0,0,1219,50121,0,0,1860,111600,0,0,535,11893,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,221:10:0	0,27,236:9:0	0,36,255:12:0
+X	1124	.	A	<*>	0	.	DP=31;I16=25,5,0,0,1187,48827,0,0,1800,108000,0,0,536,11832,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,218:9:0	0,27,235:9:0	0,36,255:12:0
+X	1125	.	T	<*>	0	.	DP=31;I16=25,5,0,0,1211,51001,0,0,1800,108000,0,0,537,11801,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,228:9:0	0,27,235:9:0	0,36,255:12:0
+X	1126	.	C	<*>	0	.	DP=31;I16=25,5,0,0,1225,52001,0,0,1800,108000,0,0,538,11800,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,234:9:0	0,27,241:9:0	0,36,255:12:0
+X	1127	.	T	<*>	0	.	DP=31;I16=25,5,0,0,1257,55245,0,0,1800,108000,0,0,539,11829,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,231:9:0	0,27,252:9:0	0,36,255:12:0
+X	1128	.	G	<*>	0	.	DP=31;I16=25,5,0,0,1217,51743,0,0,1800,108000,0,0,540,11888,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,236:9:0	0,27,229:9:0	0,36,255:12:0
+X	1129	.	A	G,<*>	0	.	DP=31;I16=24,4,0,1,1101,45631,32,1024,1680,100800,60,3600,514,11300,25,625;QS=2.93535,0.0646465,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=1;BQB=1;MQ0F=0	PL:DP:DV	0,24,204,24,204,204:8:0	0,27,229,27,229,229:9:0	0,4,198,33,201,219:12:1
+X	1130	.	A	<*>	0	.	DP=31;I16=25,5,0,0,1189,49509,0,0,1800,108000,0,0,539,11943,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,215:9:0	0,27,236:9:0	0,36,255:12:0
+X	1131	.	A	<*>	0	.	DP=29;I16=23,5,0,0,1156,49362,0,0,1680,100800,0,0,540,11988,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,206:7:0	0,27,250:9:0	0,36,255:12:0
+X	1132	.	T	<*>	0	.	DP=29;I16=23,5,0,0,1123,47359,0,0,1680,100800,0,0,540,12008,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,198:7:0	0,27,229:9:0	0,36,255:12:0
+X	1133	.	G	<*>	0	.	DP=30;I16=23,5,0,0,1148,48796,0,0,1680,100800,0,0,540,12052,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,214:7:0	0,27,232:9:0	0,36,255:12:0
+X	1134	.	C	<*>	0	.	DP=29;I16=22,6,0,0,1162,50224,0,0,1680,100800,0,0,547,12155,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,209:7:0	0,27,254:9:0	0,36,255:12:0
+X	1135	.	T	<*>	0	.	DP=29;I16=22,6,0,0,1214,55020,0,0,1680,100800,0,0,549,12257,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,209:7:0	0,27,255:9:0	0,36,255:12:0
+X	1136	.	T	<*>	0	.	DP=29;I16=22,6,0,0,1148,49270,0,0,1680,100800,0,0,551,12383,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,200:7:0	0,27,255:9:0	0,36,255:12:0
+X	1137	.	G	<*>	0	.	DP=28;I16=21,6,0,0,1087,46051,0,0,1620,97200,0,0,554,12532,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,214:7:0	0,27,234:9:0	0,33,254:11:0
+X	1138	.	G	<*>	0	.	DP=28;I16=21,6,0,0,1040,42504,0,0,1620,97200,0,0,557,12703,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,197:7:0	0,27,234:9:0	0,33,246:11:0
+X	1139	.	A	<*>	0	.	DP=28;I16=21,6,0,0,1103,47389,0,0,1620,97200,0,0,559,12845,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,200:7:0	0,27,254:9:0	0,33,255:11:0
+X	1140	.	C	<*>	0	.	DP=28;I16=21,6,0,0,1072,44372,0,0,1620,97200,0,0,561,13007,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,214:7:0	0,27,234:9:0	0,33,250:11:0
+X	1141	.	C	<*>	0	.	DP=28;I16=21,6,0,0,1106,47298,0,0,1620,97200,0,0,562,13140,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,212:7:0	0,27,245:9:0	0,33,255:11:0
+X	1142	.	A	<*>	0	.	DP=28;I16=21,6,0,0,1114,47788,0,0,1620,97200,0,0,560,13146,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,212:7:0	0,27,255:9:0	0,33,251:11:0
+X	1143	.	G	<*>	0	.	DP=26;I16=19,7,0,0,1041,42249,0,0,1560,93600,0,0,585,13799,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,222:7:0	0,27,249:9:0	0,30,253:10:0
+X	1144	.	A	<*>	0	.	DP=26;I16=19,7,0,0,1018,40154,0,0,1560,93600,0,0,585,13847,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,205:7:0	0,27,250:9:0	0,30,255:10:0
+X	1145	.	T	<*>	0	.	DP=26;I16=19,7,0,0,1016,39852,0,0,1560,93600,0,0,584,13866,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,206:7:0	0,27,250:9:0	0,30,249:10:0
+X	1146	.	G	<*>	0	.	DP=26;I16=19,7,0,0,1011,39743,0,0,1560,93600,0,0,582,13856,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,210:7:0	0,27,246:9:0	0,30,254:10:0
+X	1147	.	T	<*>	0	.	DP=27;I16=20,6,0,0,1010,39730,0,0,1560,93600,0,0,579,13815,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,207:8:0	0,24,234:8:0	0,30,255:10:0
+X	1148	.	T	<*>	0	.	DP=26;I16=20,6,0,0,1002,39214,0,0,1560,93600,0,0,576,13690,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,196:8:0	0,24,237:8:0	0,30,255:10:0
+X	1149	.	T	<*>	0	.	DP=26;I16=20,6,0,0,1022,40532,0,0,1560,93600,0,0,573,13579,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,205:8:0	0,24,231:8:0	0,30,255:10:0
+X	1150	.	T	<*>	0	.	DP=26;I16=20,6,0,0,1032,41212,0,0,1560,93600,0,0,569,13433,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,208:8:0	0,24,236:8:0	0,30,255:10:0
+X	1151	.	G	<*>	0	.	DP=26;I16=20,6,0,0,1021,40285,0,0,1560,93600,0,0,565,13303,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,220:8:0	0,24,231:8:0	0,30,248:10:0
+X	1152	.	A	<*>	0	.	DP=27;I16=20,7,0,0,1040,40772,0,0,1620,97200,0,0,561,13189,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,202:8:0	0,24,230:8:0	0,33,255:11:0
+X	1153	.	A	<*>	0	.	DP=27;I16=20,7,0,0,1039,40717,0,0,1620,97200,0,0,557,13043,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,202:8:0	0,24,233:8:0	0,33,255:11:0
+X	1154	.	T	<*>	0	.	DP=28;I16=21,7,0,0,1073,41861,0,0,1680,100800,0,0,552,12866,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,212:9:0	0,24,236:8:0	0,33,255:11:0
+X	1155	.	T	<*>	0	.	DP=27;I16=20,7,0,0,1074,43046,0,0,1620,97200,0,0,549,12707,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,211:8:0	0,24,236:8:0	0,33,255:11:0
+X	1156	.	T	<*>	0	.	DP=28;I16=19,8,0,0,1065,42533,0,0,1620,97200,0,0,520,11892,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,210:8:0	0,24,239:8:0	0,33,255:11:0
+X	1157	.	T	<*>	0	.	DP=28;I16=20,8,0,0,1094,43108,0,0,1680,100800,0,0,541,12299,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,230:9:0	0,24,230:8:0	0,33,255:11:0
+X	1158	.	G	<*>	0	.	DP=28;I16=20,8,0,0,1098,43584,0,0,1680,100800,0,0,536,12056,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,240:9:0	0,24,224:8:0	0,33,255:11:0
+X	1159	.	G	<*>	0	.	DP=28;I16=20,8,0,0,1096,43222,0,0,1680,100800,0,0,530,11790,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,249:9:0	0,24,229:8:0	0,33,255:11:0
+X	1160	.	A	<*>	0	.	DP=30;I16=20,10,0,0,1146,44510,0,0,1800,108000,0,0,524,11552,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,229:9:0	0,24,242:8:0	0,39,255:13:0
+X	1161	.	T	<*>	0	.	DP=30;I16=20,10,0,0,1136,43548,0,0,1800,108000,0,0,520,11344,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,221:9:0	0,24,230:8:0	0,39,255:13:0
+X	1162	.	T	<*>	0	.	DP=30;I16=20,10,0,0,1147,44365,0,0,1800,108000,0,0,516,11168,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,232:9:0	0,24,229:8:0	0,39,255:13:0
+X	1163	.	T	<*>	0	.	DP=31;I16=20,11,0,0,1176,45394,0,0,1860,111600,0,0,511,10975,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,243:10:0	0,24,231:8:0	0,39,255:13:0
+X	1164	.	T	<*>	0	.	DP=31;I16=20,11,0,0,1166,44864,0,0,1860,111600,0,0,506,10768,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,235:10:0	0,24,234:8:0	0,39,255:13:0
+X	1165	.	T	<*>	0	.	DP=31;I16=20,11,0,0,1189,46635,0,0,1860,111600,0,0,501,10599,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,240:10:0	0,24,231:8:0	0,39,255:13:0
+X	1166	.	T	<*>	0	.	DP=30;I16=19,11,0,0,1137,43791,0,0,1800,108000,0,0,497,10467,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,231:9:0	0,24,228:8:0	0,39,255:13:0
+X	1167	.	C	<*>	0	.	DP=28;I16=17,11,0,0,1114,44588,0,0,1680,100800,0,0,495,10369,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,21,216:7:0	0,36,255:12:0
+X	1168	.	A	<*>	0	.	DP=28;I16=17,11,0,0,1074,41862,0,0,1680,100800,0,0,493,10303,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,238:9:0	0,21,203:7:0	0,36,255:12:0
+X	1169	.	T	<*>	0	.	DP=28;I16=17,11,0,0,1089,42589,0,0,1680,100800,0,0,491,10269,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,247:9:0	0,21,212:7:0	0,36,255:12:0
+X	1170	.	A	<*>	0	.	DP=27;I16=16,11,0,0,1033,39891,0,0,1620,97200,0,0,490,10266,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,244:9:0	0,21,214:7:0	0,33,255:11:0
+X	1171	.	T	<*>	0	.	DP=28;I16=17,11,0,0,1086,42472,0,0,1680,100800,0,0,488,10244,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,249:9:0	0,24,223:8:0	0,33,255:11:0
+X	1172	.	T	<*>	0	.	DP=28;I16=17,11,0,0,1086,42598,0,0,1680,100800,0,0,486,10206,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,235:9:0	0,24,228:8:0	0,33,255:11:0
+X	1173	.	T	<*>	0	.	DP=29;I16=18,11,0,0,1126,44348,0,0,1740,104400,0,0,483,10153,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,241:9:0	0,27,241:9:0	0,33,255:11:0
+X	1174	.	T	<*>	0	.	DP=29;I16=18,11,0,0,1098,42352,0,0,1740,104400,0,0,481,10135,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,230:9:0	0,27,238:9:0	0,33,255:11:0
+X	1175	.	G	<*>	0	.	DP=28;I16=18,10,0,0,1063,40975,0,0,1680,100800,0,0,480,10152,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,234:8:0	0,27,234:9:0	0,33,255:11:0
+X	1176	.	T	<*>	0	.	DP=28;I16=18,10,0,0,1045,39823,0,0,1680,100800,0,0,479,10203,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,221:8:0	0,27,233:9:0	0,33,255:11:0
+X	1177	.	A	<*>	0	.	DP=28;I16=18,10,0,0,1040,39006,0,0,1680,100800,0,0,478,10288,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,220:8:0	0,27,228:9:0	0,33,255:11:0
+X	1178	.	A	<*>	0	.	DP=27;I16=17,10,0,0,1006,38238,0,0,1620,97200,0,0,477,10355,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,221:8:0	0,27,227:9:0	0,30,255:10:0
+X	1179	.	T	<*>	0	.	DP=27;I16=17,10,0,0,1012,38396,0,0,1620,97200,0,0,475,10403,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,223:8:0	0,27,224:9:0	0,30,255:10:0
+X	1180	.	C	<*>	0	.	DP=27;I16=16,10,0,0,1006,39508,0,0,1560,93600,0,0,469,10423,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,222:7:0	0,27,224:9:0	0,30,255:10:0
+X	1181	.	T	<*>	0	.	DP=26;I16=16,10,0,0,1021,40581,0,0,1560,93600,0,0,469,10441,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,236:8:0	0,24,229:8:0	0,30,255:10:0
+X	1182	.	T	<*>	0	.	DP=26;I16=14,11,0,0,939,35915,0,0,1500,90000,0,0,457,10347,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,236:9:0	0,21,209:7:0	0,27,255:9:0
+X	1183	.	T	<*>	0	.	DP=25;I16=13,11,0,0,899,34555,0,0,1440,86400,0,0,455,10341,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,239:9:0	0,18,192:6:0	0,27,255:9:0
+X	1184	.	G	<*>	0	.	DP=24;I16=13,11,0,0,916,35398,0,0,1440,86400,0,0,465,10479,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,234:8:0	0,21,201:7:0	0,27,255:9:0
+X	1185	.	C	<*>	0	.	DP=24;I16=13,11,0,0,908,35014,0,0,1440,86400,0,0,465,10541,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,246:8:0	0,21,191:7:0	0,27,250:9:0
+X	1186	.	A	<*>	0	.	DP=24;I16=13,11,0,0,946,37648,0,0,1440,86400,0,0,463,10525,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,240:8:0	0,21,205:7:0	0,27,255:9:0
+X	1187	.	G	<*>	0	.	DP=25;I16=14,11,0,0,908,33870,0,0,1500,90000,0,0,461,10529,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,240:9:0	0,21,205:7:0	0,27,240:9:0
+X	1188	.	T	<*>	0	.	DP=25;I16=14,11,0,0,886,32138,0,0,1500,90000,0,0,461,10553,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,248:10:0	0,21,196:7:0	0,24,216:8:0
+X	1189	.	A	<*>	0	.	DP=25;I16=14,11,0,0,920,34392,0,0,1500,90000,0,0,461,10497,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,174:6:0	0,27,252:9:0
+X	1190	.	T	<*>	0	.	DP=26;I16=14,12,0,0,960,35876,0,0,1560,93600,0,0,462,10462,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,185:6:0	0,27,252:9:0
+X	1191	.	A	<*>	0	.	DP=26;I16=14,12,0,0,928,33922,0,0,1560,93600,0,0,464,10450,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,173:6:0	0,27,245:9:0
+X	1192	.	T	<*>	0	.	DP=26;I16=14,12,0,0,981,37505,0,0,1560,93600,0,0,465,10413,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,191:6:0	0,27,255:9:0
+X	1193	.	T	<*>	0	.	DP=26;I16=14,12,0,0,976,37054,0,0,1560,93600,0,0,466,10402,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,191:6:0	0,27,255:9:0
+X	1194	.	T	<*>	0	.	DP=26;I16=14,12,0,0,951,35219,0,0,1560,93600,0,0,466,10368,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,178:6:0	0,27,249:9:0
+X	1195	.	A	<*>	0	.	DP=26;I16=14,12,0,0,917,33253,0,0,1560,93600,0,0,466,10362,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,177:6:0	0,27,235:9:0
+X	1196	.	C	<*>	0	.	DP=25;I16=13,12,0,0,921,34209,0,0,1500,90000,0,0,466,10334,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,187:6:0	0,27,236:9:0
+X	1197	.	C	<*>	0	.	DP=24;I16=12,12,0,0,906,34862,0,0,1440,86400,0,0,464,10184,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,186:6:0	0,24,233:8:0
+X	1198	.	A	<*>	0	.	DP=24;I16=12,12,0,0,937,36815,0,0,1440,86400,0,0,461,10013,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,190:6:0	0,24,245:8:0
+X	1199	.	G	<*>	0	.	DP=24;I16=12,12,0,0,879,33035,0,0,1440,86400,0,0,457,9821,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,163:6:0	0,24,221:8:0
+X	1200	.	T	<*>	0	.	DP=24;I16=11,12,0,0,895,35141,0,0,1380,82800,0,0,428,9032,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,176:5:0	0,24,247:8:0
+X	1201	.	T	<*>	0	.	DP=24;I16=12,12,0,0,889,33727,0,0,1440,86400,0,0,449,9521,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,177:6:0	0,24,238:8:0
+X	1202	.	C	<*>	0	.	DP=25;I16=13,12,0,0,929,35121,0,0,1500,90000,0,0,445,9413,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,175:6:0	0,24,230:8:0
+X	1203	.	A	<*>	0	.	DP=25;I16=13,12,0,0,943,36107,0,0,1500,90000,0,0,442,9334,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,184:6:0	0,24,241:8:0
+X	1204	.	G	<*>	0	.	DP=24;I16=13,11,0,0,876,33106,0,0,1440,86400,0,0,439,9235,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,174:6:0	0,21,218:7:0
+X	1205	.	C	<*>	0	.	DP=24;I16=13,11,0,0,891,33869,0,0,1440,86400,0,0,436,9166,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,176:6:0	0,21,217:7:0
+X	1206	.	A	<*>	0	.	DP=23;I16=13,10,0,0,846,31744,0,0,1380,82800,0,0,434,9126,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,179:6:0	0,21,212:7:0
+X	1207	.	T	<*>	0	.	DP=23;I16=13,9,0,0,819,30877,0,0,1320,79200,0,0,407,8489,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,254:10:0	0,18,189:6:0	0,18,194:6:0
+X	1208	.	C	<*>	0	.	DP=24;I16=14,10,0,0,910,35236,0,0,1440,86400,0,0,429,9079,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,190:7:0	0,21,217:7:0
+X	1209	.	C	T,<*>	0	.	DP=24;I16=14,9,0,1,869,33481,21,441,1380,82800,60,3600,408,8710,19,361;QS=2.91393,0.0860656,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=1;BQB=1;MQ0F=0	PL:DP:DV	0,30,255,30,255,255:10:0	0,0,153,18,156,166:7:1	0,21,209,21,209,209:7:0
+X	1210	.	C	<*>	0	.	DP=24;I16=14,10,0,0,915,35713,0,0,1440,86400,0,0,425,9091,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,199:7:0	0,21,209:7:0
+X	1211	.	T	<*>	0	.	DP=24;I16=14,10,0,0,905,34669,0,0,1440,86400,0,0,423,9139,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,213:7:0	0,21,214:7:0
+X	1212	.	A	<*>	0	.	DP=24;I16=14,10,0,0,850,30690,0,0,1440,86400,0,0,421,9215,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,246:10:0	0,21,190:7:0	0,21,204:7:0
+X	1213	.	A	<*>	0	.	DP=24;I16=14,10,0,0,852,31192,0,0,1440,86400,0,0,418,9268,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,21,197:7:0	0,21,195:7:0
+X	1214	.	C	<*>	0	.	DP=23;I16=13,10,0,0,851,32099,0,0,1380,82800,0,0,415,9295,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,186:7:0	0,18,184:6:0
+X	1215	.	T	<*>	0	.	DP=23;I16=13,9,0,0,839,32475,0,0,1320,79200,0,0,386,8668,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,211:7:0	0,15,172:5:0
+X	1216	.	C	<*>	0	.	DP=23;I16=13,10,0,0,863,32923,0,0,1380,82800,0,0,406,9260,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,196:7:0	0,18,172:6:0
+X	1217	.	A	<*>	0	.	DP=22;I16=12,10,0,0,820,30926,0,0,1320,79200,0,0,402,9244,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,172:6:0	0,18,191:6:0
+X	1218	.	A	<*>	0	.	DP=22;I16=12,10,0,0,764,27286,0,0,1320,79200,0,0,398,9244,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,145:6:0	0,18,184:6:0
+X	1219	.	A	<*>	0	.	DP=21;I16=12,9,0,0,803,31119,0,0,1260,75600,0,0,395,9259,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,175:6:0	0,15,173:5:0
+X	1220	.	A	<*>	0	.	DP=21;I16=12,9,0,0,752,27700,0,0,1260,75600,0,0,392,9288,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,18,167:6:0	0,15,167:5:0
+X	1221	.	A	<*>	0	.	DP=20;I16=12,8,0,0,722,26564,0,0,1200,72000,0,0,390,9330,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,147:5:0	0,15,157:5:0
+X	1222	.	T	<*>	0	.	DP=18;I16=10,8,0,0,666,25034,0,0,1080,64800,0,0,389,9333,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,245:9:0	0,15,143:5:0	0,12,142:4:0
+X	1223	.	T	<*>	0	.	DP=17;I16=9,7,0,0,574,21262,0,0,960,57600,0,0,364,8720,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,232:9:0	0,12,122:4:0	0,9,120:3:0
+X	1224	.	C	<*>	0	.	DP=19;I16=10,7,0,0,639,24429,0,0,1020,61200,0,0,364,8740,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,128:4:0	0,9,112:3:0
+X	1225	.	A	<*>	0	.	DP=19;I16=10,9,0,0,713,27139,0,0,1109,65641,0,0,395,9419,0,0;QS=3,0;MQSB=0.920044;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,137:5:0	0,12,145:4:0
+X	1226	.	A	<*>	0	.	DP=19;I16=10,9,0,0,688,25468,0,0,1109,65641,0,0,397,9469,0,0;QS=3,0;MQSB=0.920044;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,127:5:0	0,12,147:4:0
+X	1227	.	A	<*>	0	.	DP=19;I16=10,9,0,0,698,26104,0,0,1109,65641,0,0,399,9531,0,0;QS=3,0;MQSB=0.920044;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,133:5:0	0,12,146:4:0
+X	1228	.	A	<*>	0	.	DP=19;I16=10,9,0,0,705,26721,0,0,1109,65641,0,0,399,9505,0,0;QS=3,0;MQSB=0.920044;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,143:5:0	0,12,145:4:0
+X	1229	.	A	<*>	0	.	DP=18;I16=10,8,0,0,693,26891,0,0,1049,62041,0,0,400,9490,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,123:4:0	0,12,138:4:0
+X	1230	.	T	<*>	0	.	DP=18;I16=10,8,0,0,643,23601,0,0,1049,62041,0,0,401,9485,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,30,245:10:0	0,12,115:4:0	0,12,144:4:0
+X	1231	.	C	<*>	0	.	DP=18;I16=10,7,0,0,663,26041,0,0,1020,61200,0,0,390,9320,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,98:3:0	0,12,138:4:0
+X	1232	.	T	<*>	0	.	DP=18;I16=10,8,0,0,683,26261,0,0,1049,62041,0,0,401,9409,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,133:4:0	0,12,129:4:0
+X	1233	.	G	<*>	0	.	DP=18;I16=10,8,0,0,657,24509,0,0,1049,62041,0,0,401,9389,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,124:4:0	0,12,129:4:0
+X	1234	.	A	<*>	0	.	DP=19;I16=10,8,0,0,677,26177,0,0,1080,64800,0,0,386,9134,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,101:3:0	0,12,144:4:0
+X	1235	.	A	<*>	0	.	DP=19;I16=10,9,0,0,697,26363,0,0,1109,65641,0,0,400,9282,0,0;QS=3,0;MQSB=0.920044;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,129:4:0	0,12,140:4:0
+X	1236	.	A	<*>	0	.	DP=19;I16=10,9,0,0,671,24693,0,0,1109,65641,0,0,398,9148,0,0;QS=3,0;MQSB=0.920044;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,103:4:0	0,12,136:4:0
+X	1237	.	T	<*>	0	.	DP=19;I16=9,9,0,0,649,24061,0,0,1049,62041,0,0,370,8356,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,98:3:0	0,12,135:4:0
+X	1238	.	C	<*>	0	.	DP=20;I16=11,9,0,0,733,27709,0,0,1169,69241,0,0,391,8783,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,104:4:0	0,12,145:4:0
+X	1239	.	C	<*>	0	.	DP=20;I16=10,9,0,0,672,24596,0,0,1109,65641,0,0,363,7981,0,0;QS=3,0;MQSB=0.920044;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,76:3:0	0,12,124:4:0
+X	1240	.	C	<*>	0	.	DP=20;I16=11,9,0,0,723,26895,0,0,1169,69241,0,0,385,8451,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,118:4:0	0,12,129:4:0
+X	1241	.	A	<*>	0	.	DP=20;I16=11,9,0,0,719,26575,0,0,1169,69241,0,0,382,8318,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,104:4:0	0,12,141:4:0
+X	1242	.	A	<*>	0	.	DP=21;I16=12,9,0,0,749,27599,0,0,1229,72841,0,0,379,8207,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,109:4:0	0,15,153:5:0
+X	1243	.	A	<*>	0	.	DP=21;I16=12,9,0,0,738,26862,0,0,1229,72841,0,0,377,8119,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,110:4:0	0,15,158:5:0
+X	1244	.	C	<*>	0	.	DP=21;I16=12,8,0,0,670,22952,0,0,1169,69241,0,0,365,7955,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,101:4:0	0,15,148:5:0
+X	1245	.	G	<*>	0	.	DP=21;I16=12,9,0,0,657,21627,0,0,1229,72841,0,0,373,8015,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,36,245:12:0	0,12,95:4:0	0,15,158:5:0
+X	1246	.	C	<*>	0	.	DP=21;I16=12,9,0,0,652,21348,0,0,1229,72841,0,0,370,7948,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,36,252:12:0	0,12,95:4:0	0,15,146:5:0
+X	1247	.	G	<*>	0	.	DP=20;I16=11,9,0,0,655,22291,0,0,1169,69241,0,0,367,7853,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,87:4:0	0,15,150:5:0
+X	1248	.	C	<*>	0	.	DP=20;I16=10,8,0,0,659,25037,0,0,1080,64800,0,0,314,6530,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,90:3:0	0,15,156:5:0
+X	1249	.	C	<*>	0	.	DP=21;I16=12,9,0,0,772,28954,0,0,1229,72841,0,0,360,7680,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,111:4:0	0,15,166:5:0
+X	1250	.	A	<*>	0	.	DP=21;I16=12,9,0,0,757,27599,0,0,1229,72841,0,0,356,7554,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,114:4:0	0,15,161:5:0
+X	1251	.	A	<*>	0	.	DP=21;I16=12,9,0,0,758,27890,0,0,1229,72841,0,0,352,7452,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,115:4:0	0,15,174:5:0
+X	1252	.	T	<*>	0	.	DP=21;I16=12,9,0,0,758,27574,0,0,1229,72841,0,0,348,7374,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,124:4:0	0,15,159:5:0
+X	1253	.	A	<*>	0	.	DP=20;I16=12,8,0,0,718,26292,0,0,1169,69241,0,0,345,7319,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,127:4:0	0,12,144:4:0
+X	1254	.	A	<*>	0	.	DP=20;I16=12,8,0,0,781,30817,0,0,1169,69241,0,0,342,7286,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,134:4:0	0,12,156:4:0
+X	1255	.	G	<*>	0	.	DP=21;I16=12,9,0,0,785,30039,0,0,1229,72841,0,0,339,7275,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,128:4:0	0,15,169:5:0
+X	1256	.	C	<*>	0	.	DP=20;I16=12,8,0,0,742,27910,0,0,1169,69241,0,0,338,7286,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,116:4:0	0,15,165:5:0
+X	1257	.	A	<*>	0	.	DP=20;I16=12,8,0,0,745,28017,0,0,1169,69241,0,0,337,7319,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,132:4:0	0,15,167:5:0
+X	1258	.	T	<*>	0	.	DP=20;I16=12,8,0,0,753,28507,0,0,1169,69241,0,0,336,7374,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,126:4:0	0,15,170:5:0
+X	1259	.	T	<*>	0	.	DP=20;I16=12,8,0,0,690,24762,0,0,1169,69241,0,0,335,7451,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,33,236:11:0	0,12,128:4:0	0,15,170:5:0
+X	1260	.	C	<*>	0	.	DP=20;I16=12,8,0,0,719,26541,0,0,1169,69241,0,0,333,7499,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,127:4:0	0,15,155:5:0
+X	1261	.	C	<*>	0	.	DP=18;I16=11,6,0,0,602,22374,0,0,989,58441,0,0,308,6940,0,0;QS=3,0;MQSB=0.85832;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,117:4:0	0,9,109:3:0
+X	1262	.	C	<*>	0	.	DP=18;I16=12,6,0,0,653,24345,0,0,1049,62041,0,0,333,7597,0,0;QS=3,0;MQSB=0.85394;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,15,145:5:0	0,9,114:3:0
+X	1263	.	T	<*>	0	.	DP=17;I16=12,5,0,0,654,25656,0,0,989,58441,0,0,335,7645,0,0;QS=3,0;MQSB=0.818731;MQ0F=0	PL:DP:DV	0,27,238:9:0	0,15,158:5:0	0,9,118:3:0
+X	1264	.	T	<*>	0	.	DP=17;I16=12,5,0,0,615,22855,0,0,989,58441,0,0,336,7658,0,0;QS=3,0;MQSB=0.818731;MQ0F=0	PL:DP:DV	0,27,226:9:0	0,15,149:5:0	0,9,114:3:0
+X	1265	.	T	<*>	0	.	DP=17;I16=12,5,0,0,620,23176,0,0,989,58441,0,0,334,7538,0,0;QS=3,0;MQSB=0.818731;MQ0F=0	PL:DP:DV	0,27,232:9:0	0,15,144:5:0	0,9,114:3:0
+X	1266	.	G	<*>	0	.	DP=18;I16=13,5,0,0,675,25765,0,0,1049,62041,0,0,332,7438,0,0;QS=3,0;MQSB=0.814433;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,145:5:0	0,9,114:3:0
+X	1267	.	A	<*>	0	.	DP=18;I16=13,5,0,0,663,24799,0,0,1049,62041,0,0,331,7359,0,0;QS=3,0;MQSB=0.814433;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,15,138:5:0	0,9,114:3:0
+X	1268	.	G	<*>	0	.	DP=18;I16=13,5,0,0,638,23584,0,0,1049,62041,0,0,329,7251,0,0;QS=3,0;MQSB=0.814433;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,112:5:0	0,9,108:3:0
+X	1269	.	C	<*>	0	.	DP=18;I16=13,5,0,0,592,20458,0,0,1049,62041,0,0,327,7163,0,0;QS=3,0;MQSB=0.814433;MQ0F=0	PL:DP:DV	0,30,224:10:0	0,15,130:5:0	0,9,107:3:0
+X	1270	.	G	<*>	0	.	DP=18;I16=13,5,0,0,537,16775,0,0,1049,62041,0,0,325,7095,0,0;QS=3,0;MQSB=0.814433;MQ0F=0	PL:DP:DV	0,30,206:10:0	0,15,104:5:0	0,9,98:3:0
+X	1271	.	T	<*>	0	.	DP=18;I16=12,5,0,0,620,22824,0,0,989,58441,0,0,298,6422,0,0;QS=3,0;MQSB=0.818731;MQ0F=0	PL:DP:DV	0,27,240:9:0	0,15,138:5:0	0,9,109:3:0
+X	1272	.	C	<*>	0	.	DP=17;I16=11,5,0,0,597,22587,0,0,929,54841,0,0,297,6393,0,0;QS=3,0;MQSB=0.823561;MQ0F=0	PL:DP:DV	0,27,251:9:0	0,12,113:4:0	0,9,110:3:0
+X	1273	.	A	<*>	0	.	DP=18;I16=12,6,0,0,633,23063,0,0,1049,62041,0,0,318,6866,0,0;QS=3,0;MQSB=0.85394;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,109:4:0	0,9,113:3:0
+X	1274	.	T	<*>	0	.	DP=17;I16=10,6,0,0,609,23335,0,0,929,54841,0,0,293,6205,0,0;QS=3,0;MQSB=0.863243;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,67:2:0	0,9,115:3:0
+X	1275	.	G	<*>	0	.	DP=17;I16=11,6,0,0,602,21976,0,0,989,58441,0,0,317,6763,0,0;QS=3,0;MQSB=0.85832;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,87:3:0	0,9,112:3:0
+X	1276	.	T	<*>	0	.	DP=17;I16=11,6,0,0,587,20925,0,0,989,58441,0,0,316,6714,0,0;QS=3,0;MQSB=0.85832;MQ0F=0	PL:DP:DV	0,33,248:11:0	0,9,94:3:0	0,9,110:3:0
+X	1277	.	C	<*>	0	.	DP=18;I16=11,7,0,0,590,20126,0,0,1049,62041,0,0,314,6634,0,0;QS=3,0;MQSB=0.883327;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,85:3:0	0,9,106:3:0
+X	1278	.	G	<*>	0	.	DP=18;I16=11,7,0,0,603,20675,0,0,1049,62041,0,0,313,6575,0,0;QS=3,0;MQSB=0.883327;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,77:3:0	0,9,96:3:0
+X	1279	.	G	<*>	0	.	DP=18;I16=11,7,0,0,646,23662,0,0,1049,62041,0,0,312,6538,0,0;QS=3,0;MQSB=0.883327;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,85:3:0	0,9,113:3:0
+X	1280	.	T	<*>	0	.	DP=18;I16=10,7,0,0,558,19192,0,0,989,58441,0,0,296,6298,0,0;QS=3,0;MQSB=0.887766;MQ0F=0	PL:DP:DV	0,33,249:11:0	0,9,86:3:0	0,9,97:3:0
+X	1281	.	G	<*>	0	.	DP=17;I16=10,6,0,0,564,21244,0,0,929,54841,0,0,270,5658,0,0;QS=3,0;MQSB=0.863243;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,85:3:0	0,9,103:3:0
+X	1282	.	C	<*>	0	.	DP=18;I16=10,8,0,0,654,24308,0,0,1049,62041,0,0,294,6286,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,94:3:0	0,12,131:4:0
+X	1283	.	T	<*>	0	.	DP=18;I16=10,8,0,0,677,26313,0,0,1049,62041,0,0,294,6308,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,83:3:0	0,12,154:4:0
+X	1284	.	T	<*>	0	.	DP=18;I16=10,8,0,0,631,22949,0,0,1049,62041,0,0,293,6301,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,33,254:11:0	0,9,92:3:0	0,12,145:4:0
+X	1285	.	G	<*>	0	.	DP=18;I16=10,7,0,0,657,25545,0,0,989,58441,0,0,267,5691,0,0;QS=3,0;MQSB=0.887766;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,94:3:0	0,12,145:4:0
+X	1286	.	G	<*>	0	.	DP=18;I16=10,8,0,0,650,24684,0,0,1049,62041,0,0,291,6353,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,78:3:0	0,12,148:4:0
+X	1287	.	A	<*>	0	.	DP=17;I16=9,8,0,0,609,22229,0,0,989,58441,0,0,291,6411,0,0;QS=3,0;MQSB=0.91051;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,91:3:0	0,12,137:4:0
+X	1288	.	A	<*>	0	.	DP=17;I16=9,8,0,0,605,22315,0,0,989,58441,0,0,290,6438,0,0;QS=3,0;MQSB=0.91051;MQ0F=0	PL:DP:DV	0,30,245:10:0	0,9,103:3:0	0,12,140:4:0
+X	1289	.	T	<*>	0	.	DP=18;I16=10,8,0,0,637,23207,0,0,1049,62041,0,0,289,6483,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,99:3:0	0,12,141:4:0
+X	1290	.	G	<*>	0	.	DP=15;I16=9,6,0,0,559,21163,0,0,869,51241,0,0,292,6544,0,0;QS=3,0;MQSB=0.868815;MQ0F=0	PL:DP:DV	0,27,242:9:0	0,9,97:3:0	0,9,106:3:0
+X	1291	.	T	<*>	0	.	DP=15;I16=9,6,0,0,547,20303,0,0,869,51241,0,0,295,6619,0,0;QS=3,0;MQSB=0.868815;MQ0F=0	PL:DP:DV	0,27,225:9:0	0,9,91:3:0	0,9,117:3:0
+X	1292	.	T	<*>	0	.	DP=15;I16=9,6,0,0,559,21121,0,0,869,51241,0,0,297,6657,0,0;QS=3,0;MQSB=0.868815;MQ0F=0	PL:DP:DV	0,27,236:9:0	0,9,95:3:0	0,9,113:3:0
+X	1293	.	T	<*>	0	.	DP=15;I16=9,6,0,0,578,22428,0,0,869,51241,0,0,299,6707,0,0;QS=3,0;MQSB=0.868815;MQ0F=0	PL:DP:DV	0,27,242:9:0	0,9,100:3:0	0,9,116:3:0
+X	1294	.	G	<*>	0	.	DP=16;I16=9,7,0,0,606,23572,0,0,929,54841,0,0,301,6769,0,0;QS=3,0;MQSB=0.892753;MQ0F=0	PL:DP:DV	0,27,254:9:0	0,12,110:4:0	0,9,119:3:0
+X	1295	.	G	<*>	0	.	DP=16;I16=9,7,0,0,567,21419,0,0,929,54841,0,0,304,6844,0,0;QS=3,0;MQSB=0.892753;MQ0F=0	PL:DP:DV	0,27,244:9:0	0,12,102:4:0	0,9,114:3:0
+X	1296	.	G	<*>	0	.	DP=16;I16=8,7,0,0,518,19300,0,0,869,51241,0,0,294,6740,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,27,227:9:0	0,9,89:3:0	0,9,114:3:0
+X	1297	.	G	<*>	0	.	DP=18;I16=9,8,0,0,551,19323,0,0,958,55682,0,0,322,7444,0,0;QS=3,0;MQSB=0.998843;MQ0F=0	PL:DP:DV	0,30,219:10:0	0,9,86:3:0	0,12,133:4:0
+X	1298	.	T	<*>	0	.	DP=18;I16=10,8,0,0,615,22371,0,0,1018,59282,0,0,336,7638,0,0;QS=3,0;MQSB=0.99606;MQ0F=0	PL:DP:DV	0,30,233:10:0	0,12,105:4:0	0,12,138:4:0
+X	1299	.	T	<*>	0	.	DP=18;I16=9,8,0,0,619,23135,0,0,958,55682,0,0,328,7548,0,0;QS=3,0;MQSB=0.998843;MQ0F=0	PL:DP:DV	0,30,242:10:0	0,9,97:3:0	0,12,136:4:0
+X	1300	.	T	<*>	0	.	DP=18;I16=10,8,0,0,631,23107,0,0,1018,59282,0,0,338,7638,0,0;QS=3,0;MQSB=0.99606;MQ0F=0	PL:DP:DV	0,30,235:10:0	0,12,121:4:0	0,12,136:4:0
+X	1301	.	T	G,<*>	0	.	DP=18;I16=8,8,1,0,599,22623,18,324,929,54841,29,841,314,7040,25,625;QS=2.9434,0.0566038,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.998843;BQB=1;MQ0F=0	PL:DP:DV	0,9,213,24,216,222:9:1	0,12,126,12,126,126:4:0	0,12,135,12,135,135:4:0
+X	1302	.	G	<*>	0	.	DP=17;I16=9,8,0,0,624,23544,0,0,958,55682,0,0,341,7709,0,0;QS=3,0;MQSB=0.998843;MQ0F=0	PL:DP:DV	0,27,240:9:0	0,12,127:4:0	0,12,140:4:0
+X	1303	.	G	<*>	0	.	DP=17;I16=9,8,0,0,582,21200,0,0,958,55682,0,0,342,7718,0,0;QS=3,0;MQSB=0.998843;MQ0F=0	PL:DP:DV	0,27,217:9:0	0,12,125:4:0	0,12,138:4:0
+X	1304	.	A	<*>	0	.	DP=18;I16=10,8,0,0,652,24124,0,0,1018,59282,0,0,343,7741,0,0;QS=3,0;MQSB=0.99606;MQ0F=0	PL:DP:DV	0,27,218:9:0	0,12,131:4:0	0,15,169:5:0
+X	1305	.	T	<*>	0	.	DP=18;I16=10,8,0,0,685,26381,0,0,1018,59282,0,0,345,7779,0,0;QS=3,0;MQSB=0.99606;MQ0F=0	PL:DP:DV	0,27,241:9:0	0,12,122:4:0	0,15,174:5:0
+X	1306	.	T	<*>	0	.	DP=18;I16=9,8,0,0,644,24628,0,0,958,55682,0,0,345,7829,0,0;QS=3,0;MQSB=0.998843;MQ0F=0	PL:DP:DV	0,27,236:9:0	0,9,106:3:0	0,15,168:5:0
+X	1307	.	T	<*>	0	.	DP=17;I16=9,8,0,0,628,23746,0,0,958,55682,0,0,348,7902,0,0;QS=3,0;MQSB=0.998843;MQ0F=0	PL:DP:DV	0,27,226:9:0	0,9,104:3:0	0,15,167:5:0
+X	1308	.	A	<*>	0	.	DP=19;I16=9,10,0,0,690,25500,0,0,1078,62882,0,0,350,7938,0,0;QS=3,0;MQSB=0.999167;MQ0F=0	PL:DP:DV	0,30,236:10:0	0,12,127:4:0	0,15,173:5:0
+X	1309	.	C	<*>	0	.	DP=19;I16=9,9,0,0,698,27148,0,0,1049,62041,0,0,342,7818,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,106:3:0	0,15,169:5:0
+X	1310	.	A	<*>	0	.	DP=19;I16=9,10,0,0,751,29953,0,0,1078,62882,0,0,356,7958,0,0;QS=3,0;MQSB=0.999167;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,132:4:0	0,15,183:5:0
+X	1311	.	G	<*>	0	.	DP=19;I16=9,10,0,0,742,29384,0,0,1078,62882,0,0,359,7995,0,0;QS=3,0;MQSB=0.999167;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,128:4:0	0,15,174:5:0
+X	1312	.	C	<*>	0	.	DP=19;I16=9,10,0,0,717,27783,0,0,1078,62882,0,0,362,8050,0,0;QS=3,0;MQSB=0.999167;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,115:4:0	0,15,166:5:0
+X	1313	.	T	<*>	0	.	DP=19;I16=9,10,0,0,751,30061,0,0,1078,62882,0,0,364,8074,0,0;QS=3,0;MQSB=0.999167;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,135:4:0	0,15,175:5:0
+X	1314	.	T	<*>	0	.	DP=19;I16=9,10,0,0,707,26983,0,0,1078,62882,0,0,366,8118,0,0;QS=3,0;MQSB=0.999167;MQ0F=0	PL:DP:DV	0,30,245:10:0	0,12,134:4:0	0,15,174:5:0
+X	1315	.	T	<*>	0	.	DP=19;I16=9,10,0,0,717,27491,0,0,1078,62882,0,0,367,8131,0,0;QS=3,0;MQSB=0.999167;MQ0F=0	PL:DP:DV	0,30,250:10:0	0,12,132:4:0	0,15,174:5:0
+X	1316	.	G	<*>	0	.	DP=21;I16=10,11,0,0,776,29502,0,0,1198,70082,0,0,368,8162,0,0;QS=3,0;MQSB=0.99938;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,128:4:0	0,18,188:6:0
+X	1317	.	G	<*>	0	.	DP=21;I16=10,11,0,0,751,27855,0,0,1198,70082,0,0,371,8213,0,0;QS=3,0;MQSB=0.99938;MQ0F=0	PL:DP:DV	0,33,253:11:0	0,12,130:4:0	0,18,179:6:0
+X	1318	.	G	<*>	0	.	DP=21;I16=10,11,0,0,749,27663,0,0,1198,70082,0,0,372,8188,0,0;QS=3,0;MQSB=0.99938;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,130:4:0	0,18,184:6:0
+X	1319	.	A	<*>	0	.	DP=21;I16=10,11,0,0,768,28390,0,0,1198,70082,0,0,373,8189,0,0;QS=3,0;MQSB=0.99938;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,124:4:0	0,18,186:6:0
+X	1320	.	C	<*>	0	.	DP=21;I16=10,11,0,0,728,25496,0,0,1198,70082,0,0,373,8165,0,0;QS=3,0;MQSB=0.99938;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,113:4:0	0,18,161:6:0
+X	1321	.	G	<*>	0	.	DP=22;I16=10,12,0,0,762,27412,0,0,1289,76441,0,0,374,8164,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,33,244:11:0	0,9,104:3:0	0,24,208:8:0
+X	1322	.	C	<*>	0	.	DP=22;I16=10,12,0,0,852,33528,0,0,1289,76441,0,0,377,8187,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,111:3:0	0,24,225:8:0
+X	1323	.	T	<*>	0	.	DP=22;I16=10,12,0,0,874,35152,0,0,1289,76441,0,0,379,8185,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,112:3:0	0,24,237:8:0
+X	1324	.	C	<*>	0	.	DP=21;I16=9,12,0,0,793,30585,0,0,1229,72841,0,0,381,8157,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,109:3:0	0,24,218:8:0
+X	1325	.	A	<*>	0	.	DP=21;I16=9,12,0,0,782,29430,0,0,1229,72841,0,0,383,8153,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,105:3:0	0,24,218:8:0
+X	1326	.	A	<*>	0	.	DP=21;I16=9,12,0,0,791,30479,0,0,1229,72841,0,0,385,8173,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,30,249:10:0	0,9,108:3:0	0,24,230:8:0
+X	1327	.	C	<*>	0	.	DP=23;I16=11,12,0,0,834,31048,0,0,1349,80041,0,0,387,8217,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,99:3:0	0,27,237:9:0
+X	1328	.	C	<*>	0	.	DP=23;I16=11,12,0,0,878,33972,0,0,1349,80041,0,0,391,8287,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,105:3:0	0,27,254:9:0
+X	1329	.	T	<*>	0	.	DP=23;I16=11,12,0,0,882,34756,0,0,1349,80041,0,0,395,8385,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,112:3:0	0,27,255:9:0
+X	1330	.	G	<*>	0	.	DP=23;I16=11,12,0,0,856,32638,0,0,1349,80041,0,0,398,8460,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,101:3:0	0,27,241:9:0
+X	1331	.	T	<*>	0	.	DP=23;I16=11,12,0,0,847,31785,0,0,1349,80041,0,0,400,8512,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,106:3:0	0,27,247:9:0
+X	1332	.	A	<*>	0	.	DP=23;I16=11,12,0,0,826,30264,0,0,1349,80041,0,0,402,8592,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,33,252:11:0	0,9,104:3:0	0,27,238:9:0
+X	1333	.	C	<*>	0	.	DP=23;I16=11,12,0,0,836,30928,0,0,1349,80041,0,0,404,8700,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,101:3:0	0,27,236:9:0
+X	1334	.	C	<*>	0	.	DP=22;I16=11,11,0,0,830,32380,0,0,1289,76441,0,0,405,8733,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,107:3:0	0,27,238:9:0
+X	1335	.	T	<*>	0	.	DP=22;I16=11,11,0,0,877,35371,0,0,1289,76441,0,0,406,8788,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,113:3:0	0,27,253:9:0
+X	1336	.	C	<*>	0	.	DP=25;I16=12,12,0,0,890,33648,0,0,1378,80882,0,0,398,8784,0,0;QS=3,0;MQSB=0.786628;MQ0F=0	PL:DP:DV	0,33,250:11:0	0,12,131:4:0	0,27,237:9:0
+X	1337	.	A	<*>	0	.	DP=26;I16=13,13,0,0,941,34611,0,0,1498,88082,0,0,411,8967,0,0;QS=3,0;MQSB=0.800737;MQ0F=0	PL:DP:DV	0,33,249:11:0	0,15,152:5:0	0,30,247:10:0
+X	1338	.	A	<*>	0	.	DP=26;I16=12,14,0,0,982,37358,0,0,1498,88082,0,0,416,9048,0,0;QS=3,0;MQSB=0.771623;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,153:5:0	0,30,255:10:0
+X	1339	.	T	<*>	0	.	DP=27;I16=12,15,0,0,989,36855,0,0,1558,91682,0,0,422,9160,0,0;QS=3,0;MQSB=0.765017;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,151:5:0	0,33,255:11:0
+X	1340	.	A	<*>	0	.	DP=27;I16=11,15,0,0,937,34141,0,0,1498,88082,0,0,425,9289,0,0;QS=3,0;MQSB=0.738577;MQ0F=0	PL:DP:DV	0,30,250:10:0	0,15,149:5:0	0,33,254:11:0
+X	1341	.	A	<*>	0	.	DP=27;I16=12,14,0,0,929,33961,0,0,1498,88082,0,0,410,8810,0,0;QS=3,0;MQSB=0.771623;MQ0F=0	PL:DP:DV	0,30,245:10:0	0,15,141:5:0	0,33,255:11:0
+X	1342	.	A	<*>	0	.	DP=27;I16=12,15,0,0,951,34575,0,0,1558,91682,0,0,439,9499,0,0;QS=3,0;MQSB=0.765017;MQ0F=0	PL:DP:DV	0,33,254:11:0	0,15,159:5:0	0,33,249:11:0
+X	1343	.	C	<*>	0	.	DP=25;I16=10,15,0,0,902,33364,0,0,1469,87241,0,0,445,9593,0,0;QS=3,0;MQSB=0.9171;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,140:5:0	0,30,233:10:0
+X	1344	.	C	<*>	0	.	DP=26;I16=10,16,0,0,985,37915,0,0,1529,90841,0,0,451,9715,0,0;QS=3,0;MQSB=0.914947;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,163:6:0	0,30,238:10:0
+X	1345	.	T	<*>	0	.	DP=26;I16=10,16,0,0,1004,39262,0,0,1529,90841,0,0,458,9866,0,0;QS=3,0;MQSB=0.914947;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,182:6:0	0,30,242:10:0
+X	1346	.	G	<*>	0	.	DP=26;I16=10,16,0,0,1003,38983,0,0,1529,90841,0,0,465,10047,0,0;QS=3,0;MQSB=0.914947;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,172:6:0	0,30,239:10:0
+X	1347	.	A	<*>	0	.	DP=26;I16=10,16,0,0,995,38409,0,0,1529,90841,0,0,470,10156,0,0;QS=3,0;MQSB=0.914947;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,177:6:0	0,30,243:10:0
+X	1348	.	T	<*>	0	.	DP=26;I16=10,16,0,0,988,38126,0,0,1529,90841,0,0,474,10242,0,0;QS=3,0;MQSB=0.914947;MQ0F=0	PL:DP:DV	0,30,252:10:0	0,18,185:6:0	0,30,251:10:0
+X	1349	.	T	<*>	0	.	DP=26;I16=9,15,0,0,905,34409,0,0,1409,83641,0,0,454,9730,0,0;QS=3,0;MQSB=0.904837;MQ0F=0	PL:DP:DV	0,24,225:8:0	0,18,176:6:0	0,30,248:10:0
+X	1350	.	T	<*>	0	.	DP=26;I16=10,16,0,0,975,36909,0,0,1498,88082,0,0,485,10495,0,0;QS=3,0;MQSB=0.700784;MQ0F=0	PL:DP:DV	0,27,242:9:0	0,21,195:7:0	0,30,249:10:0
+X	1351	.	T	<*>	0	.	DP=26;I16=10,16,0,0,956,35602,0,0,1498,88082,0,0,491,10663,0,0;QS=3,0;MQSB=0.700784;MQ0F=0	PL:DP:DV	0,27,238:9:0	0,21,193:7:0	0,30,240:10:0
+X	1352	.	A	<*>	0	.	DP=26;I16=10,16,0,0,901,31965,0,0,1498,88082,0,0,496,10810,0,0;QS=3,0;MQSB=0.700784;MQ0F=0	PL:DP:DV	0,27,250:9:0	0,21,180:7:0	0,30,211:10:0
+X	1353	.	A	<*>	0	.	DP=26;I16=10,16,0,0,927,33583,0,0,1498,88082,0,0,499,10885,0,0;QS=3,0;MQSB=0.700784;MQ0F=0	PL:DP:DV	0,27,240:9:0	0,21,187:7:0	0,30,224:10:0
+X	1354	.	A	<*>	0	.	DP=26;I16=10,16,0,0,927,33621,0,0,1498,88082,0,0,502,10986,0,0;QS=3,0;MQSB=0.700784;MQ0F=0	PL:DP:DV	0,27,237:9:0	0,21,190:7:0	0,30,223:10:0
+X	1355	.	A	<*>	0	.	DP=26;I16=10,16,0,0,924,33736,0,0,1498,88082,0,0,505,11113,0,0;QS=3,0;MQSB=0.700784;MQ0F=0	PL:DP:DV	0,27,239:9:0	0,21,186:7:0	0,30,227:10:0
+X	1356	.	A	<*>	0	.	DP=25;I16=10,15,0,0,916,34050,0,0,1438,84482,0,0,509,11265,0,0;QS=3,0;MQSB=0.707404;MQ0F=0	PL:DP:DV	0,27,249:9:0	0,21,178:7:0	0,27,226:9:0
+X	1357	.	A	<*>	0	.	DP=25;I16=9,15,0,0,949,38007,0,0,1378,80882,0,0,488,10816,0,0;QS=3,0;MQSB=0.67032;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,21,193:7:0	0,24,217:8:0
+X	1358	.	G	<*>	0	.	DP=25;I16=9,15,0,0,873,32435,0,0,1378,80882,0,0,491,10967,0,0;QS=3,0;MQSB=0.67032;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,21,172:7:0	0,24,188:8:0
+X	1359	.	T	<*>	0	.	DP=25;I16=9,15,0,0,857,31139,0,0,1378,80882,0,0,494,11144,0,0;QS=3,0;MQSB=0.67032;MQ0F=0	PL:DP:DV	0,27,232:9:0	0,21,184:7:0	0,24,196:8:0
+X	1360	.	T	<*>	0	.	DP=25;I16=9,15,0,0,879,32419,0,0,1378,80882,0,0,497,11347,0,0;QS=3,0;MQSB=0.67032;MQ0F=0	PL:DP:DV	0,27,248:9:0	0,21,184:7:0	0,24,192:8:0
+X	1361	.	T	<*>	0	.	DP=27;I16=9,17,0,0,936,34238,0,0,1498,88082,0,0,500,11576,0,0;QS=3,0;MQSB=0.657209;MQ0F=0	PL:DP:DV	0,27,234:9:0	0,24,201:8:0	0,27,206:9:0
+X	1362	.	G	<*>	0	.	DP=26;I16=9,17,0,0,973,36785,0,0,1498,88082,0,0,502,11680,0,0;QS=3,0;MQSB=0.657209;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,24,202:8:0	0,27,207:9:0
+X	1363	.	G	<*>	0	.	DP=25;I16=8,17,0,0,936,35390,0,0,1438,84482,0,0,504,11756,0,0;QS=3,0;MQSB=0.612391;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,21,181:7:0	0,27,202:9:0
+X	1364	.	G	<*>	0	.	DP=25;I16=8,17,0,0,902,32840,0,0,1438,84482,0,0,504,11752,0,0;QS=3,0;MQSB=0.612391;MQ0F=0	PL:DP:DV	0,27,233:9:0	0,21,184:7:0	0,27,200:9:0
+X	1365	.	G	<*>	0	.	DP=26;I16=9,17,0,0,946,35224,0,0,1498,88082,0,0,503,11717,0,0;QS=3,0;MQSB=0.657209;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,24,190:8:0	0,27,202:9:0
+X	1366	.	G	<*>	0	.	DP=25;I16=8,15,0,0,840,31058,0,0,1318,77282,0,0,454,10450,0,0;QS=3,0;MQSB=0.625784;MQ0F=0	PL:DP:DV	0,21,215:7:0	0,21,181:7:0	0,27,199:9:0
+X	1367	.	G	C,<*>	0	.	DP=25;I16=7,16,0,1,836,30888,27,729,1349,80041,60,3600,472,11152,15,225;QS=2.91641,0.0835913,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.864405;BQB=1;MQ0F=0	PL:DP:DV	0,24,236,24,236,236:8:0	0,21,179,21,179,179:7:0	0,0,171,24,174,189:9:1
+X	1368	.	A	<*>	0	.	DP=26;I16=8,17,0,0,869,30839,0,0,1438,84482,0,0,481,11095,0,0;QS=3,0;MQSB=0.612391;MQ0F=0	PL:DP:DV	0,27,240:9:0	0,21,180:7:0	0,27,197:9:0
+X	1369	.	T	<*>	0	.	DP=26;I16=8,18,0,0,902,32160,0,0,1498,88082,0,0,508,11758,0,0;QS=3,0;MQSB=0.606531;MQ0F=0	PL:DP:DV	0,27,242:9:0	0,24,197:8:0	0,27,194:9:0
+X	1370	.	T	<*>	0	.	DP=27;I16=8,17,0,0,926,34736,0,0,1438,84482,0,0,458,10466,0,0;QS=3,0;MQSB=0.612391;MQ0F=0	PL:DP:DV	0,27,238:9:0	0,21,195:7:0	0,27,215:9:0
+X	1371	.	C	<*>	0	.	DP=27;I16=8,19,0,0,929,33255,0,0,1558,91682,0,0,509,11695,0,0;QS=3,0;MQSB=0.601139;MQ0F=0	PL:DP:DV	0,27,241:9:0	0,24,196:8:0	0,30,196:10:0
+X	1372	.	C	<*>	0	.	DP=27;I16=8,19,0,0,954,34882,0,0,1558,91682,0,0,510,11696,0,0;QS=3,0;MQSB=0.601139;MQ0F=0	PL:DP:DV	0,27,251:9:0	0,24,198:8:0	0,30,200:10:0
+X	1373	.	C	<*>	0	.	DP=26;I16=8,17,0,0,892,32692,0,0,1438,84482,0,0,486,11044,0,0;QS=3,0;MQSB=0.612391;MQ0F=0	PL:DP:DV	0,24,243:8:0	0,21,186:7:0	0,30,195:10:0
+X	1374	.	C	<*>	0	.	DP=26;I16=8,17,0,0,953,36553,0,0,1438,84482,0,0,487,11039,0,0;QS=3,0;MQSB=0.612391;MQ0F=0	PL:DP:DV	0,24,249:8:0	0,21,193:7:0	0,30,211:10:0
+X	1375	.	T	<*>	0	.	DP=27;I16=9,18,0,0,1011,38377,0,0,1558,91682,0,0,512,11630,0,0;QS=3,0;MQSB=0.651439;MQ0F=0	PL:DP:DV	0,27,243:9:0	0,24,215:8:0	0,30,215:10:0
+X	1376	.	A	<*>	0	.	DP=27;I16=9,17,0,0,912,32444,0,0,1498,88082,0,0,488,10992,0,0;QS=3,0;MQSB=0.657209;MQ0F=0	PL:DP:DV	0,27,234:9:0	0,21,198:7:0	0,30,195:10:0
+X	1377	.	A	<*>	0	.	DP=26;I16=9,17,0,0,994,38518,0,0,1498,88082,0,0,515,11625,0,0;QS=3,0;MQSB=0.657209;MQ0F=0	PL:DP:DV	0,24,228:8:0	0,24,221:8:0	0,30,228:10:0
+X	1378	.	G	<*>	0	.	DP=26;I16=9,17,0,0,910,33180,0,0,1498,88082,0,0,517,11653,0,0;QS=3,0;MQSB=0.657209;MQ0F=0	PL:DP:DV	0,24,234:8:0	0,24,199:8:0	0,30,197:10:0
+X	1379	.	C	<*>	0	.	DP=26;I16=9,17,0,0,891,31779,0,0,1498,88082,0,0,519,11701,0,0;QS=3,0;MQSB=0.657209;MQ0F=0	PL:DP:DV	0,24,228:8:0	0,24,198:8:0	0,30,193:10:0
+X	1380	.	C	<*>	0	.	DP=26;I16=9,17,0,0,925,33925,0,0,1498,88082,0,0,520,11720,0,0;QS=3,0;MQSB=0.657209;MQ0F=0	PL:DP:DV	0,24,226:8:0	0,24,202:8:0	0,30,209:10:0
+X	1381	.	C	<*>	0	.	DP=28;I16=10,18,0,0,878,28560,0,0,1618,95282,0,0,521,11761,0,0;QS=3,0;MQSB=0.689069;MQ0F=0	PL:DP:DV	0,24,211:8:0	0,24,177:8:0	0,36,208:12:0
+X	1382	.	G	<*>	0	.	DP=28;I16=8,18,0,0,905,32553,0,0,1529,90841,0,0,482,10912,0,0;QS=3,0;MQSB=0.882497;MQ0F=0	PL:DP:DV	0,24,213:8:0	0,18,152:6:0	0,36,243:12:0
+X	1383	.	C	<*>	0	.	DP=27;I16=10,16,0,0,897,32373,0,0,1498,88082,0,0,502,11242,0,0;QS=3,0;MQSB=0.700784;MQ0F=0	PL:DP:DV	0,24,225:8:0	0,21,163:7:0	0,33,241:11:0
+X	1384	.	C	<*>	0	.	DP=28;I16=11,17,0,0,980,35558,0,0,1618,95282,0,0,529,11885,0,0;QS=3,0;MQSB=0.726331;MQ0F=0	PL:DP:DV	0,27,248:9:0	0,24,184:8:0	0,33,239:11:0
+X	1385	.	A	<*>	0	.	DP=30;I16=11,18,0,0,949,33215,0,0,1678,98882,0,0,508,11356,0,0;QS=3,0;MQSB=0.720887;MQ0F=0	PL:DP:DV	0,30,232:10:0	0,27,185:9:0	0,30,234:10:0
+X	1386	.	C	<*>	0	.	DP=30;I16=11,19,0,0,1088,39938,0,0,1738,102482,0,0,537,12011,0,0;QS=3,0;MQSB=0.715831;MQ0F=0	PL:DP:DV	0,30,248:10:0	0,27,218:9:0	0,33,255:11:0
+X	1387	.	C	<*>	0	.	DP=31;I16=12,19,0,0,1101,40297,0,0,1798,106082,0,0,540,12022,0,0;QS=3,0;MQSB=0.743137;MQ0F=0	PL:DP:DV	0,33,250:11:0	0,27,219:9:0	0,33,252:11:0
+X	1388	.	C	<*>	0	.	DP=31;I16=11,19,0,0,999,34081,0,0,1769,105241,0,0,519,11439,0,0;QS=3,0;MQSB=0.91982;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,185:8:0	0,33,211:11:0
+X	1389	.	G	<*>	0	.	DP=31;I16=11,19,0,0,1065,39119,0,0,1738,102482,0,0,535,11941,0,0;QS=3,0;MQSB=0.715831;MQ0F=0	PL:DP:DV	0,27,234:9:0	0,30,234:10:0	0,33,255:11:0
+X	1390	.	G	<*>	0	.	DP=31;I16=12,19,0,0,1152,43744,0,0,1798,106082,0,0,555,12241,0,0;QS=3,0;MQSB=0.743137;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,30,245:10:0	0,33,255:11:0
+X	1391	.	A	<*>	0	.	DP=31;I16=12,19,0,0,1241,50255,0,0,1798,106082,0,0,560,12326,0,0;QS=3,0;MQSB=0.743137;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,30,255:10:0	0,33,255:11:0
+X	1392	.	G	<*>	0	.	DP=31;I16=12,19,0,0,1160,44364,0,0,1798,106082,0,0,564,12392,0,0;QS=3,0;MQSB=0.743137;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,30,250:10:0	0,33,255:11:0
+X	1393	.	A	<*>	0	.	DP=31;I16=12,19,0,0,1123,41811,0,0,1798,106082,0,0,568,12490,0,0;QS=3,0;MQSB=0.743137;MQ0F=0	PL:DP:DV	0,30,228:10:0	0,30,255:10:0	0,33,255:11:0
+X	1394	.	C	<*>	0	.	DP=31;I16=12,19,0,0,1139,42555,0,0,1798,106082,0,0,571,12569,0,0;QS=3,0;MQSB=0.743137;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,30,244:10:0	0,33,255:11:0
+X	1395	.	A	<*>	0	.	DP=31;I16=12,19,0,0,1206,48048,0,0,1798,106082,0,0,575,12677,0,0;QS=3,0;MQSB=0.743137;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,240:9:0	0,33,255:11:0
+X	1396	.	G	<*>	0	.	DP=31;I16=12,19,0,0,1196,46882,0,0,1798,106082,0,0,579,12763,0,0;QS=3,0;MQSB=0.743137;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,249:9:0	0,33,255:11:0
+X	1397	.	C	<*>	0	.	DP=31;I16=12,18,0,0,993,33339,0,0,1738,102482,0,0,579,12775,0,0;QS=3,0;MQSB=0.748022;MQ0F=0	PL:DP:DV	0,30,231:10:0	0,27,205:9:0	0,33,217:11:0
+X	1398	.	G	<*>	0	.	DP=30;I16=12,18,0,0,1055,38309,0,0,1738,102482,0,0,584,12826,0,0;QS=3,0;MQSB=0.748022;MQ0F=0	PL:DP:DV	0,33,250:11:0	0,27,229:9:0	0,30,244:10:0
+X	1399	.	G	<*>	0	.	DP=30;I16=12,18,0,0,1132,43666,0,0,1738,102482,0,0,586,12854,0,0;QS=3,0;MQSB=0.748022;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,239:9:0	0,30,255:10:0
+X	1400	.	A	<*>	0	.	DP=30;I16=11,18,0,0,1101,42271,0,0,1678,98882,0,0,563,12289,0,0;QS=3,0;MQSB=0.720887;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,27,239:9:0	0,30,246:10:0
+X	1401	.	T	<*>	0	.	DP=30;I16=12,18,0,0,1130,44170,0,0,1738,102482,0,0,589,12955,0,0;QS=3,0;MQSB=0.748022;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,251:9:0	0,30,255:10:0
+X	1402	.	T	<*>	0	.	DP=31;I16=13,18,0,0,1152,44058,0,0,1798,106082,0,0,589,12977,0,0;QS=3,0;MQSB=0.771348;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,244:9:0	0,30,255:10:0
+X	1403	.	T	<*>	0	.	DP=31;I16=13,18,0,0,1178,45296,0,0,1798,106082,0,0,590,13032,0,0;QS=3,0;MQSB=0.771348;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,249:9:0	0,30,255:10:0
+X	1404	.	C	<*>	0	.	DP=31;I16=13,18,0,0,1102,40838,0,0,1798,106082,0,0,591,13121,0,0;QS=3,0;MQSB=0.771348;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,236:9:0	0,30,244:10:0
+X	1405	.	C	<*>	0	.	DP=30;I16=12,18,0,0,1154,45216,0,0,1738,102482,0,0,593,13243,0,0;QS=3,0;MQSB=0.748022;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,241:9:0	0,27,229:9:0
+X	1406	.	T	<*>	0	.	DP=30;I16=12,18,0,0,1153,44919,0,0,1738,102482,0,0,595,13397,0,0;QS=3,0;MQSB=0.748022;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,248:9:0	0,27,223:9:0
+X	1407	.	T	<*>	0	.	DP=30;I16=11,18,0,0,1074,40182,0,0,1678,98882,0,0,570,12856,0,0;QS=3,0;MQSB=0.720887;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,231:9:0	0,27,215:9:0
+X	1408	.	A	<*>	0	.	DP=30;I16=12,18,0,0,1131,43363,0,0,1738,102482,0,0,596,13592,0,0;QS=3,0;MQSB=0.748022;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,30,244:10:0	0,27,234:9:0
+X	1409	.	G	<*>	0	.	DP=29;I16=12,17,0,0,1082,40752,0,0,1678,98882,0,0,599,13729,0,0;QS=3,0;MQSB=0.753269;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,237:9:0	0,27,204:9:0
+X	1410	.	T	<*>	0	.	DP=29;I16=12,17,0,0,1084,41030,0,0,1678,98882,0,0,601,13841,0,0;QS=3,0;MQSB=0.753269;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,239:9:0	0,27,218:9:0
+X	1411	.	T	<*>	0	.	DP=29;I16=12,17,0,0,958,32550,0,0,1678,98882,0,0,600,13826,0,0;QS=3,0;MQSB=0.753269;MQ0F=0	PL:DP:DV	0,33,250:11:0	0,27,206:9:0	0,27,194:9:0
+X	1412	.	A	T,<*>	0	.	DP=29;I16=11,17,1,0,924,31586,25,625,1649,98041,29,841,573,13159,24,576;QS=2.90842,0.0915751,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.753269;BQB=1;MQ0F=0	PL:DP:DV	0,33,245,33,245,245:11:0	0,2,171,24,174,187:9:1	0,27,192,27,192,192:9:0
+X	1413	.	C	<*>	0	.	DP=29;I16=12,17,0,0,1067,39941,0,0,1678,98882,0,0,591,13521,0,0;QS=3,0;MQSB=0.753269;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,230:9:0	0,27,209:9:0
+X	1414	.	T	<*>	0	.	DP=29;I16=12,17,0,0,1123,44271,0,0,1678,98882,0,0,585,13335,0,0;QS=3,0;MQSB=0.753269;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,236:9:0	0,27,221:9:0
+X	1415	.	T	<*>	0	.	DP=29;I16=12,17,0,0,1000,35254,0,0,1678,98882,0,0,577,13077,0,0;QS=3,0;MQSB=0.753269;MQ0F=0	PL:DP:DV	0,33,246:11:0	0,27,216:9:0	0,27,208:9:0
+X	1416	.	A	<*>	0	.	DP=30;I16=13,17,0,0,1026,36124,0,0,1738,102482,0,0,569,12847,0,0;QS=3,0;MQSB=0.776389;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,208:9:0	0,27,199:9:0
+X	1417	.	C	<*>	0	.	DP=29;I16=13,16,0,0,1111,42941,0,0,1678,98882,0,0,563,12645,0,0;QS=3,0;MQSB=0.781802;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,235:9:0	0,24,211:8:0
+X	1418	.	T	<*>	0	.	DP=29;I16=13,16,0,0,1111,43021,0,0,1678,98882,0,0,557,12471,0,0;QS=3,0;MQSB=0.781802;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,231:9:0	0,24,207:8:0
+X	1419	.	A	<*>	0	.	DP=29;I16=13,16,0,0,1039,38191,0,0,1678,98882,0,0,551,12325,0,0;QS=3,0;MQSB=0.781802;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,222:9:0	0,24,199:8:0
+X	1420	.	T	<*>	0	.	DP=29;I16=13,16,0,0,1039,37885,0,0,1678,98882,0,0,544,12158,0,0;QS=3,0;MQSB=0.781802;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,234:9:0	0,24,185:8:0
+X	1421	.	G	<*>	0	.	DP=31;I16=13,18,0,0,1129,41649,0,0,1798,106082,0,0,536,11970,0,0;QS=3,0;MQSB=0.771348;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,30,247:10:0	0,24,191:8:0
+X	1422	.	C	<*>	0	.	DP=29;I16=13,16,0,0,1075,40645,0,0,1678,98882,0,0,532,11810,0,0;QS=3,0;MQSB=0.781802;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,30,239:10:0	0,18,180:6:0
+X	1423	.	T	<*>	0	.	DP=31;I16=14,17,0,0,1179,45767,0,0,1798,106082,0,0,528,11678,0,0;QS=3,0;MQSB=0.79638;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,36,255:12:0	0,18,183:6:0
+X	1424	.	C	<*>	0	.	DP=30;I16=13,17,0,0,1086,40448,0,0,1738,102482,0,0,527,11575,0,0;QS=3,0;MQSB=0.776389;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,36,255:12:0	0,18,174:6:0
+X	1425	.	C	<*>	0	.	DP=30;I16=13,17,0,0,1124,42974,0,0,1738,102482,0,0,525,11453,0,0;QS=3,0;MQSB=0.776389;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,36,255:12:0	0,18,180:6:0
+X	1426	.	T	<*>	0	.	DP=32;I16=15,17,0,0,1218,47130,0,0,1858,109682,0,0,523,11363,0,0;QS=3,0;MQSB=0.813784;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,36,255:12:0	0,18,188:6:0
+X	1427	.	T	<*>	0	.	DP=32;I16=14,18,0,0,1126,40772,0,0,1827,106923,0,0,524,11306,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,36,255:12:0	0,18,176:6:0
+X	1428	.	G	<*>	0	.	DP=33;I16=15,18,0,0,1188,43596,0,0,1887,110523,0,0,525,11233,0,0;QS=3,0;MQSB=0.930476;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,36,255:12:0	0,18,166:6:0
+X	1429	.	G	<*>	0	.	DP=33;I16=14,18,0,0,1070,37720,0,0,1858,109682,0,0,507,10795,0,0;QS=3,0;MQSB=0.997118;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,33,243:11:0	0,18,148:6:0
+X	1430	.	C	<*>	0	.	DP=33;I16=15,18,0,0,1145,40795,0,0,1887,110523,0,0,529,11193,0,0;QS=3,0;MQSB=0.930476;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,36,247:12:0	0,18,157:6:0
+X	1431	.	C	<*>	0	.	DP=33;I16=15,18,0,0,1160,41686,0,0,1887,110523,0,0,531,11227,0,0;QS=3,0;MQSB=0.930476;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,36,253:12:0	0,18,167:6:0
+X	1432	.	A	<*>	0	.	DP=33;I16=15,18,0,0,1118,39032,0,0,1887,110523,0,0,533,11297,0,0;QS=3,0;MQSB=0.930476;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,36,255:12:0	0,18,169:6:0
+X	1433	.	T	<*>	0	.	DP=34;I16=15,19,0,0,1238,45602,0,0,1947,114123,0,0,535,11403,0,0;QS=3,0;MQSB=0.923533;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,36,255:12:0	0,18,174:6:0
+X	1434	.	T	<*>	0	.	DP=35;I16=15,20,0,0,1269,46757,0,0,2007,117723,0,0,537,11495,0,0;QS=3,0;MQSB=0.916855;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,36,255:12:0	0,18,179:6:0
+X	1435	.	T	<*>	0	.	DP=35;I16=14,20,0,0,1256,46868,0,0,1947,114123,0,0,515,10999,0,0;QS=3,0;MQSB=0.901704;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,36,255:12:0	0,18,180:6:0
+X	1436	.	C	<*>	0	.	DP=34;I16=14,20,0,0,1250,46978,0,0,1947,114123,0,0,544,11790,0,0;QS=3,0;MQSB=0.901704;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,36,255:12:0	0,18,165:6:0
+X	1437	.	T	<*>	0	.	DP=32;I16=13,19,0,0,1222,47206,0,0,1858,109682,0,0,548,11892,0,0;QS=3,0;MQSB=0.993397;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,33,255:11:0	0,15,161:5:0
+X	1438	.	C	<*>	0	.	DP=30;I16=13,17,0,0,1132,43284,0,0,1738,102482,0,0,554,12028,0,0;QS=3,0;MQSB=0.996503;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,30,251:10:0	0,15,159:5:0
+X	1439	.	T	<*>	0	.	DP=30;I16=13,17,0,0,1110,41602,0,0,1738,102482,0,0,560,12196,0,0;QS=3,0;MQSB=0.996503;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,30,255:10:0	0,15,156:5:0
+X	1440	.	A	<*>	0	.	DP=30;I16=12,16,0,0,1062,41028,0,0,1618,95282,0,0,550,12106,0,0;QS=3,0;MQSB=0.995699;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,27,255:9:0	0,12,144:4:0
+X	1441	.	G	<*>	0	.	DP=30;I16=13,17,0,0,1138,44104,0,0,1738,102482,0,0,574,12576,0,0;QS=3,0;MQSB=0.996503;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,30,244:10:0	0,12,137:4:0
+X	1442	.	G	<*>	0	.	DP=30;I16=13,17,0,0,1064,38534,0,0,1738,102482,0,0,580,12740,0,0;QS=3,0;MQSB=0.996503;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,30,242:10:0	0,12,128:4:0
+X	1443	.	T	<*>	0	.	DP=30;I16=12,17,0,0,1013,36225,0,0,1678,98882,0,0,568,12598,0,0;QS=3,0;MQSB=0.993891;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,30,230:10:0	0,12,133:4:0
+X	1444	.	A	<*>	0	.	DP=30;I16=12,17,0,0,968,33936,0,0,1678,98882,0,0,569,12627,0,0;QS=3,0;MQSB=0.993891;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,27,205:9:0	0,12,132:4:0
+X	1445	.	T	<*>	0	.	DP=30;I16=14,15,0,0,1053,39129,0,0,1678,98882,0,0,585,13161,0,0;QS=3,0;MQSB=0.999762;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,27,237:9:0	0,15,169:5:0
+X	1446	.	T	<*>	0	.	DP=30;I16=13,16,0,0,1051,38675,0,0,1678,98882,0,0,579,12951,0,0;QS=3,0;MQSB=0.997839;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,229:8:0	0,15,164:5:0
+X	1447	.	G	<*>	0	.	DP=30;I16=14,16,0,0,1110,42692,0,0,1738,102482,0,0,606,13612,0,0;QS=3,0;MQSB=0.999136;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,27,229:9:0	0,15,157:5:0
+X	1448	.	G	<*>	0	.	DP=30;I16=13,16,0,0,1037,37759,0,0,1678,98882,0,0,585,13151,0,0;QS=3,0;MQSB=0.997839;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,217:8:0	0,15,150:5:0
+X	1449	.	T	<*>	0	.	DP=30;I16=14,16,0,0,1051,37869,0,0,1738,102482,0,0,612,13870,0,0;QS=3,0;MQSB=0.999136;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,27,230:9:0	0,15,152:5:0
+X	1450	.	A	<*>	0	.	DP=29;I16=13,15,0,0,1039,38785,0,0,1649,98041,0,0,604,13842,0,0;QS=3,0;MQSB=0.956162;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,224:8:0	0,15,165:5:0
+X	1451	.	T	<*>	0	.	DP=29;I16=13,16,0,0,1046,38586,0,0,1709,101641,0,0,616,14042,0,0;QS=3,0;MQSB=0.960189;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,228:8:0	0,15,158:5:0
+X	1452	.	A	<*>	0	.	DP=31;I16=14,16,0,0,1066,38696,0,0,1769,105241,0,0,604,13924,0,0;QS=3,0;MQSB=0.958545;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,218:8:0	0,15,147:5:0
+X	1453	.	T	<*>	0	.	DP=31;I16=13,17,0,0,1107,42059,0,0,1769,105241,0,0,592,13444,0,0;QS=3,0;MQSB=0.963674;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,199:7:0	0,15,165:5:0
+X	1454	.	T	<*>	0	.	DP=31;I16=14,17,0,0,1139,42711,0,0,1829,108841,0,0,617,14045,0,0;QS=3,0;MQSB=0.962133;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,24,234:8:0	0,15,166:5:0
+X	1455	.	G	<*>	0	.	DP=31;I16=13,17,0,0,1107,41765,0,0,1769,105241,0,0,592,13420,0,0;QS=3,0;MQSB=0.963674;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,197:7:0	0,15,148:5:0
+X	1456	.	T	<*>	0	.	DP=31;I16=14,17,0,0,1139,42717,0,0,1829,108841,0,0,617,14069,0,0;QS=3,0;MQSB=0.962133;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,24,215:8:0	0,15,170:5:0
+X	1457	.	G	<*>	0	.	DP=31;I16=14,17,0,0,1129,42071,0,0,1829,108841,0,0,615,14019,0,0;QS=3,0;MQSB=0.962133;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,24,212:8:0	0,15,164:5:0
+X	1458	.	T	<*>	0	.	DP=31;I16=14,17,0,0,1101,40243,0,0,1829,108841,0,0,613,13997,0,0;QS=3,0;MQSB=0.962133;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,24,220:8:0	0,15,165:5:0
+X	1459	.	C	A,<*>	0	.	DP=31;I16=14,16,0,1,1164,45842,24,576,1769,105241,60,3600,608,13948,2,4;QS=2.87234,0.12766,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.962133;BQB=1;MQ0F=0	PL:DP:DV	0,54,255,54,255,255:18:0	0,24,224,24,224,224:8:0	9,0,135,21,138,152:5:1
+X	1460	.	T	<*>	0	.	DP=32;I16=15,17,0,0,1243,48813,0,0,1889,112441,0,0,605,13833,0,0;QS=3,0;MQSB=0.960687;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,24,240:8:0	0,15,170:5:0
+X	1461	.	G	<*>	0	.	DP=32;I16=15,17,0,0,1171,44033,0,0,1889,112441,0,0,600,13692,0,0;QS=3,0;MQSB=0.960687;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,24,224:8:0	0,15,157:5:0
+X	1462	.	C	<*>	0	.	DP=30;I16=14,15,0,0,1102,42216,0,0,1709,101641,0,0,579,13241,0,0;QS=3,0;MQSB=0.954405;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,202:7:0	0,9,112:3:0
+X	1463	.	T	<*>	0	.	DP=30;I16=15,15,0,0,1128,43348,0,0,1769,105241,0,0,592,13396,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,209:7:0	0,12,139:4:0
+X	1464	.	G	<*>	0	.	DP=31;I16=14,16,0,0,1095,40557,0,0,1769,105241,0,0,563,12665,0,0;QS=3,0;MQSB=0.958545;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,18,186:6:0	0,15,144:5:0
+X	1465	.	T	<*>	0	.	DP=31;I16=15,16,0,0,1143,42557,0,0,1829,108841,0,0,584,13164,0,0;QS=3,0;MQSB=0.957006;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,204:7:0	0,15,166:5:0
+X	1466	.	G	<*>	0	.	DP=31;I16=15,16,0,0,1122,42294,0,0,1829,108841,0,0,580,13018,0,0;QS=3,0;MQSB=0.957006;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,206:7:0	0,15,163:5:0
+X	1467	.	A	<*>	0	.	DP=31;I16=14,16,0,0,1031,36341,0,0,1769,105241,0,0,569,12803,0,0;QS=3,0;MQSB=0.958545;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,195:7:0	0,15,155:5:0
+X	1468	.	A	<*>	0	.	DP=30;I16=15,15,0,0,991,34477,0,0,1769,105241,0,0,573,12717,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,177:7:0	0,15,158:5:0
+X	1469	.	C	T,<*>	0	.	DP=31;I16=13,15,1,0,1013,37887,38,1444,1649,98041,60,3600,536,12106,9,81;QS=2.94025,0.0597484,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.954405;BQB=1;MQ0F=0	PL:DP:DV	0,16,255,51,255,255:18:1	0,18,178,18,178,178:6:0	0,15,160,15,160,160:5:0
+X	1470	.	T	<*>	0	.	DP=31;I16=16,15,0,0,1110,41070,0,0,1829,108841,0,0,567,12489,0,0;QS=3,0;MQSB=0.951229;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,210:7:0	0,15,165:5:0
+X	1471	.	G	<*>	0	.	DP=30;I16=16,14,0,0,1051,38425,0,0,1769,105241,0,0,564,12348,0,0;QS=3,0;MQSB=0.946202;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,192:7:0	0,12,128:4:0
+X	1472	.	T	<*>	0	.	DP=30;I16=16,14,0,0,1049,38097,0,0,1769,105241,0,0,561,12237,0,0;QS=3,0;MQSB=0.946202;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,200:7:0	0,12,134:4:0
+X	1473	.	C	<*>	0	.	DP=30;I16=16,14,0,0,1058,38526,0,0,1769,105241,0,0,558,12156,0,0;QS=3,0;MQSB=0.946202;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,175:7:0	0,12,140:4:0
+X	1474	.	C	<*>	0	.	DP=30;I16=16,14,0,0,1120,42756,0,0,1769,105241,0,0,555,12105,0,0;QS=3,0;MQSB=0.946202;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,202:7:0	0,12,141:4:0
+X	1475	.	T	<*>	0	.	DP=29;I16=14,14,0,0,1047,40395,0,0,1649,98041,0,0,537,11827,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,208:7:0	0,12,155:4:0
+X	1476	.	T	G,<*>	0	.	DP=31;I16=15,15,1,0,1056,37884,14,196,1769,105241,60,3600,566,12614,10,100;QS=2.944,0.056,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.951229;BQB=1;MQ0F=0	PL:DP:DV	0,57,255,57,255,255:19:0	0,9,177,21,180,183:8:1	0,12,140,12,140,140:4:0
+X	1477	.	G	<*>	0	.	DP=31;I16=16,15,0,0,1150,43390,0,0,1829,108841,0,0,574,12700,0,0;QS=3,0;MQSB=0.951229;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,24,217:8:0	0,12,138:4:0
+X	1478	.	G	<*>	0	.	DP=31;I16=14,15,0,0,1008,36638,0,0,1709,101641,0,0,542,11982,0,0;QS=3,0;MQSB=0.954405;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,24,208:8:0	0,9,109:3:0
+X	1479	.	C	<*>	0	.	DP=30;I16=15,15,0,0,1061,38671,0,0,1769,105241,0,0,564,12556,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,24,211:8:0	0,9,106:3:0
+X	1480	.	C	<*>	0	.	DP=30;I16=15,15,0,0,1083,40355,0,0,1769,105241,0,0,561,12531,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,24,220:8:0	0,9,103:3:0
+X	1481	.	T	<*>	0	.	DP=30;I16=15,15,0,0,1102,41308,0,0,1769,105241,0,0,558,12532,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,24,235:8:0	0,9,105:3:0
+X	1482	.	G	<*>	0	.	DP=29;I16=15,14,0,0,1044,38550,0,0,1709,101641,0,0,556,12558,0,0;QS=3,0;MQSB=0.947838;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,24,210:8:0	0,6,75:2:0
+X	1483	.	T	<*>	0	.	DP=31;I16=14,16,0,0,1042,37190,0,0,1769,105241,0,0,521,11919,0,0;QS=3,0;MQSB=0.958545;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,21,215:7:0	0,9,100:3:0
+X	1484	.	T	<*>	0	.	DP=31;I16=15,16,0,0,1067,37837,0,0,1829,108841,0,0,547,12587,0,0;QS=3,0;MQSB=0.957006;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,24,216:8:0	0,9,106:3:0
+X	1485	.	T	<*>	0	.	DP=30;I16=15,15,0,0,1027,35863,0,0,1769,105241,0,0,549,12659,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,24,209:8:0	0,9,93:3:0
+X	1486	.	G	<*>	0	.	DP=29;I16=15,14,0,0,1089,41679,0,0,1709,101641,0,0,551,12707,0,0;QS=3,0;MQSB=0.947838;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,198:7:0	0,9,108:3:0
+X	1487	.	G	<*>	0	.	DP=28;I16=14,14,0,0,973,34723,0,0,1649,98041,0,0,554,12778,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,196:7:0	0,9,97:3:0
+X	1488	.	T	<*>	0	.	DP=28;I16=13,14,0,0,928,32432,0,0,1589,94441,0,0,532,12246,0,0;QS=3,0;MQSB=0.951472;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,176:6:0	0,9,102:3:0
+X	1489	.	G	<*>	0	.	DP=27;I16=13,14,0,0,958,35292,0,0,1589,94441,0,0,535,12361,0,0;QS=3,0;MQSB=0.951472;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,174:6:0	0,9,93:3:0
+X	1490	.	A	<*>	0	.	DP=27;I16=13,14,0,0,928,33108,0,0,1589,94441,0,0,538,12446,0,0;QS=3,0;MQSB=0.951472;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,160:5:0	0,9,94:3:0
+X	1491	.	C	<*>	0	.	DP=27;I16=12,13,0,0,798,26812,0,0,1469,87241,0,0,499,11587,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,12,108:4:0	0,9,79:3:0
+X	1492	.	G	<*>	0	.	DP=27;I16=13,14,0,0,893,30927,0,0,1589,94441,0,0,543,12527,0,0;QS=3,0;MQSB=0.951472;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,136:5:0	0,9,100:3:0
+X	1493	.	G	<*>	0	.	DP=27;I16=13,13,0,0,907,32761,0,0,1529,90841,0,0,520,11948,0,0;QS=3,0;MQSB=0.945959;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,155:5:0	0,9,106:3:0
+X	1494	.	G	<*>	0	.	DP=27;I16=13,14,0,0,939,33599,0,0,1589,94441,0,0,547,12639,0,0;QS=3,0;MQSB=0.951472;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,156:5:0	0,9,107:3:0
+X	1495	.	T	<*>	0	.	DP=26;I16=12,13,0,0,814,27700,0,0,1469,87241,0,0,524,12048,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,143:5:0	0,9,105:3:0
+X	1496	.	G	<*>	0	.	DP=26;I16=13,13,0,0,969,36751,0,0,1529,90841,0,0,550,12674,0,0;QS=3,0;MQSB=0.945959;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,157:5:0	0,9,107:3:0
+X	1497	.	A	<*>	0	.	DP=27;I16=12,14,0,0,904,32740,0,0,1529,90841,0,0,525,12019,0,0;QS=3,0;MQSB=0.953497;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,166:5:0	0,9,113:3:0
+X	1498	.	G	<*>	0	.	DP=27;I16=13,14,0,0,1002,37852,0,0,1589,94441,0,0,551,12635,0,0;QS=3,0;MQSB=0.951472;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,153:5:0	0,9,112:3:0
+X	1499	.	G	<*>	0	.	DP=28;I16=14,14,0,0,973,34891,0,0,1649,98041,0,0,551,12599,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,15,146:5:0	0,9,108:3:0
+X	1500	.	A	<*>	0	.	DP=28;I16=14,14,0,0,1023,38115,0,0,1649,98041,0,0,552,12588,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,15,165:5:0	0,9,115:3:0
+X	1501	.	G	<*>	0	.	DP=28;I16=14,14,0,0,1051,40105,0,0,1649,98041,0,0,551,12505,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,15,163:5:0	0,9,100:3:0
+X	1502	.	C	<*>	0	.	DP=27;I16=13,14,0,0,963,35241,0,0,1589,94441,0,0,549,12351,0,0;QS=3,0;MQSB=0.951472;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,140:5:0	0,9,105:3:0
+X	1503	.	A	<*>	0	.	DP=28;I16=14,14,0,0,1026,38252,0,0,1649,98041,0,0,546,12176,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,15,171:5:0	0,9,109:3:0
+X	1504	.	G	<*>	0	.	DP=28;I16=13,14,0,0,1052,41226,0,0,1589,94441,0,0,523,11591,0,0;QS=3,0;MQSB=0.951472;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,163:5:0	0,9,111:3:0
+X	1505	.	G	<*>	0	.	DP=28;I16=14,13,0,0,959,35545,0,0,1589,94441,0,0,517,11295,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,155:5:0	0,9,114:3:0
+X	1506	.	G	<*>	0	.	DP=28;I16=14,14,0,0,1013,37355,0,0,1649,98041,0,0,540,11840,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,15,139:5:0	0,9,112:3:0
+X	1507	.	A	<*>	0	.	DP=28;I16=14,14,0,0,987,35217,0,0,1649,98041,0,0,538,11792,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,15,162:5:0	0,9,114:3:0
+X	1508	.	C	<*>	0	.	DP=28;I16=14,14,0,0,1033,38663,0,0,1649,98041,0,0,535,11727,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,15,137:5:0	0,9,112:3:0
+X	1509	.	A	<*>	0	.	DP=28;I16=15,13,0,0,1028,38610,0,0,1649,98041,0,0,529,11493,0,0;QS=3,0;MQSB=0.942064;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,12,128:4:0	0,9,122:3:0
+X	1510	.	G	<*>	0	.	DP=28;I16=15,13,0,0,1064,40824,0,0,1649,98041,0,0,524,11288,0,0;QS=3,0;MQSB=0.942064;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,12,132:4:0	0,9,111:3:0
+X	1511	.	A	<*>	0	.	DP=28;I16=15,13,0,0,976,34794,0,0,1649,98041,0,0,519,11113,0,0;QS=3,0;MQSB=0.942064;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,12,136:4:0	0,9,110:3:0
+X	1512	.	A	<*>	0	.	DP=28;I16=15,12,0,0,998,37460,0,0,1589,94441,0,0,489,10343,0,0;QS=3,0;MQSB=0.935229;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,12,142:4:0	0,9,110:3:0
+X	1513	.	G	<*>	0	.	DP=28;I16=14,13,0,0,1014,38940,0,0,1589,94441,0,0,497,10709,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,12,134:4:0	0,9,108:3:0
+X	1514	.	G	<*>	0	.	DP=28;I16=15,13,0,0,1054,39954,0,0,1649,98041,0,0,504,10768,0,0;QS=3,0;MQSB=0.942064;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,12,134:4:0	0,9,108:3:0
+X	1515	.	G	<*>	0	.	DP=28;I16=14,13,0,0,948,34152,0,0,1589,94441,0,0,488,10564,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,12,133:4:0	0,9,101:3:0
+X	1516	.	T	<*>	0	.	DP=27;I16=12,13,0,0,811,27385,0,0,1469,87241,0,0,472,10338,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,12,117:4:0	0,9,106:3:0
+X	1517	.	C	<*>	0	.	DP=27;I16=13,13,0,0,943,35153,0,0,1529,90841,0,0,478,10380,0,0;QS=3,0;MQSB=0.945959;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,12,134:4:0	0,9,97:3:0
+X	1518	.	C	<*>	0	.	DP=28;I16=13,12,0,0,908,33852,0,0,1469,87241,0,0,427,9261,0,0;QS=3,0;MQSB=0.939413;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,12,132:4:0	0,9,96:3:0
+X	1519	.	T	<*>	0	.	DP=28;I16=15,13,0,0,988,35808,0,0,1649,98041,0,0,475,10337,0,0;QS=3,0;MQSB=0.942064;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,15,154:5:0	0,9,110:3:0
+X	1520	.	G	<*>	0	.	DP=29;I16=16,13,0,0,1005,36307,0,0,1709,101641,0,0,470,10328,0,0;QS=3,0;MQSB=0.940317;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,18,150:6:0	0,9,104:3:0
+X	1521	.	C	<*>	0	.	DP=28;I16=16,12,0,0,900,30324,0,0,1649,98041,0,0,466,10300,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,18,164:6:0	0,9,88:3:0
+X	1522	.	G	<*>	0	.	DP=27;I16=15,10,0,0,784,25144,0,0,1469,87241,0,0,442,9956,0,0;QS=3,0;MQSB=0.9171;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,110:5:0	0,9,91:3:0
+X	1523	.	T	<*>	0	.	DP=27;I16=16,11,0,0,921,32001,0,0,1589,94441,0,0,457,10189,0,0;QS=3,0;MQSB=0.925036;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,136:5:0	0,9,108:3:0
+X	1524	.	G	<*>	0	.	DP=27;I16=16,10,0,0,932,34140,0,0,1529,90841,0,0,453,10153,0,0;QS=3,0;MQSB=0.914947;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,12,108:4:0	0,9,103:3:0
+X	1525	.	C	<*>	0	.	DP=27;I16=16,11,0,0,972,35704,0,0,1589,94441,0,0,473,10719,0,0;QS=3,0;MQSB=0.925036;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,12,113:4:0	0,9,112:3:0
+X	1526	.	C	<*>	0	.	DP=25;I16=14,11,0,0,883,31843,0,0,1469,87241,0,0,470,10684,0,0;QS=3,0;MQSB=0.929204;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,12,109:4:0	0,9,106:3:0
+X	1527	.	C	<*>	0	.	DP=24;I16=14,10,0,0,867,31999,0,0,1440,86400,0,0,466,10572,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,107:4:0	0,9,112:3:0
+X	1528	.	T	<*>	0	.	DP=23;I16=13,10,0,0,869,33133,0,0,1380,82800,0,0,463,10483,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,114:4:0	0,9,113:3:0
+X	1529	.	G	<*>	0	.	DP=23;I16=13,10,0,0,812,29432,0,0,1380,82800,0,0,459,10365,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,108:4:0	0,9,104:3:0
+X	1530	.	C	<*>	0	.	DP=24;I16=13,10,0,0,819,30073,0,0,1380,82800,0,0,446,10186,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,137:5:0	0,9,106:3:0
+X	1531	.	C	<*>	0	.	DP=24;I16=13,11,0,0,877,32969,0,0,1440,86400,0,0,452,10190,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,144:5:0	0,9,105:3:0
+X	1532	.	T	<*>	0	.	DP=24;I16=13,11,0,0,887,33721,0,0,1440,86400,0,0,449,10135,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,165:5:0	0,9,120:3:0
+X	1533	.	T	<*>	0	.	DP=23;I16=13,10,0,0,793,27987,0,0,1380,82800,0,0,447,10101,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,146:5:0	0,9,107:3:0
+X	1534	.	C	<*>	0	.	DP=23;I16=14,9,0,0,847,31627,0,0,1380,82800,0,0,446,10086,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,153:5:0	0,9,109:3:0
+X	1535	.	A	<*>	0	.	DP=23;I16=14,9,0,0,770,26604,0,0,1380,82800,0,0,444,9990,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,144:5:0	0,9,99:3:0
+X	1536	.	C	<*>	0	.	DP=24;I16=15,9,0,0,826,28984,0,0,1440,86400,0,0,442,9914,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,138:5:0	0,9,110:3:0
+X	1537	.	A	<*>	0	.	DP=24;I16=14,9,0,0,844,31384,0,0,1380,82800,0,0,416,9234,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,149:5:0	0,9,115:3:0
+X	1538	.	A	<*>	0	.	DP=24;I16=15,9,0,0,909,34727,0,0,1440,86400,0,0,440,9826,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,154:5:0	0,9,112:3:0
+X	1539	.	G	<*>	0	.	DP=24;I16=15,9,0,0,913,35327,0,0,1440,86400,0,0,439,9815,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,149:5:0	0,9,117:3:0
+X	1540	.	C	<*>	0	.	DP=23;I16=15,8,0,0,828,30260,0,0,1380,82800,0,0,438,9776,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,146:5:0	0,9,102:3:0
+X	1541	.	C	<*>	0	.	DP=23;I16=15,8,0,0,823,30615,0,0,1380,82800,0,0,437,9759,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,142:5:0	0,9,108:3:0
+X	1542	.	C	<*>	0	.	DP=25;I16=16,8,0,0,893,33843,0,0,1440,86400,0,0,435,9715,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,147:5:0	0,12,131:4:0
+X	1543	.	C	<*>	0	.	DP=25;I16=16,8,0,0,880,33206,0,0,1440,86400,0,0,434,9696,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,141:5:0	0,12,136:4:0
+X	1544	.	T	<*>	0	.	DP=25;I16=16,8,0,0,899,34405,0,0,1440,86400,0,0,431,9603,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,150:5:0	0,12,148:4:0
+X	1545	.	G	<*>	0	.	DP=25;I16=16,8,0,0,874,32636,0,0,1440,86400,0,0,428,9536,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,146:5:0	0,12,129:4:0
+X	1546	.	G	<*>	0	.	DP=24;I16=15,8,0,0,796,28796,0,0,1380,82800,0,0,425,9443,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,130:5:0	0,9,110:3:0
+X	1547	.	A	<*>	0	.	DP=23;I16=15,8,0,0,837,30945,0,0,1380,82800,0,0,448,9996,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,176:6:0	0,9,112:3:0
+X	1548	.	A	<*>	0	.	DP=23;I16=14,8,0,0,812,30830,0,0,1320,79200,0,0,421,9319,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,173:5:0	0,9,115:3:0
+X	1549	.	G	<*>	0	.	DP=23;I16=15,8,0,0,870,33642,0,0,1380,82800,0,0,444,9912,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,174:6:0	0,9,114:3:0
+X	1550	.	G	<*>	0	.	DP=23;I16=15,8,0,0,790,28502,0,0,1380,82800,0,0,442,9900,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,154:6:0	0,9,109:3:0
+X	1551	.	A	<*>	0	.	DP=23;I16=15,8,0,0,802,28596,0,0,1380,82800,0,0,440,9908,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,173:6:0	0,9,107:3:0
+X	1552	.	A	<*>	0	.	DP=21;I16=14,7,0,0,792,30156,0,0,1260,75600,0,0,438,9836,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,196:6:0	0,9,110:3:0
+X	1553	.	A	<*>	0	.	DP=21;I16=13,7,0,0,738,28112,0,0,1200,72000,0,0,411,9159,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,251:11:0	0,18,192:6:0	0,9,115:3:0
+X	1554	.	G	<*>	0	.	DP=21;I16=14,7,0,0,763,28221,0,0,1260,75600,0,0,434,9752,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,171:6:0	0,9,101:3:0
+X	1555	.	T	<*>	0	.	DP=21;I16=14,7,0,0,726,26234,0,0,1260,75600,0,0,432,9740,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,252:12:0	0,18,169:6:0	0,9,108:3:0
+X	1556	.	T	<*>	0	.	DP=21;I16=14,7,0,0,745,26971,0,0,1260,75600,0,0,429,9697,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,253:12:0	0,18,177:6:0	0,9,110:3:0
+X	1557	.	G	<*>	0	.	DP=22;I16=15,7,0,0,801,29689,0,0,1320,79200,0,0,426,9672,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,166:6:0	0,9,101:3:0
+X	1558	.	T	<*>	0	.	DP=22;I16=15,6,0,0,720,25620,0,0,1260,75600,0,0,404,9244,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,131:5:0	0,9,112:3:0
+X	1559	.	T	<*>	0	.	DP=22;I16=15,7,0,0,712,24690,0,0,1320,79200,0,0,417,9439,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,248:13:0	0,18,158:6:0	0,9,103:3:0
+X	1560	.	T	<*>	0	.	DP=21;I16=14,7,0,0,736,26560,0,0,1260,75600,0,0,412,9284,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,251:12:0	0,18,170:6:0	0,9,112:3:0
+X	1561	.	T	<*>	0	.	DP=21;I16=14,7,0,0,706,24776,0,0,1260,75600,0,0,406,9102,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,241:12:0	0,18,174:6:0	0,9,106:3:0
+X	1562	.	G	<*>	0	.	DP=21;I16=14,7,0,0,765,28655,0,0,1260,75600,0,0,399,8893,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,181:6:0	0,9,108:3:0
+X	1563	.	G	<*>	0	.	DP=22;I16=13,7,0,0,713,26255,0,0,1200,72000,0,0,360,8176,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,147:5:0	0,9,108:3:0
+X	1564	.	G	<*>	0	.	DP=22;I16=13,8,0,0,721,25457,0,0,1260,75600,0,0,368,8218,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,173:6:0	0,9,95:3:0
+X	1565	.	A	<*>	0	.	DP=21;I16=14,7,0,0,724,25888,0,0,1260,75600,0,0,380,8352,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,162:6:0	0,6,71:2:0
+X	1566	.	T	<*>	0	.	DP=21;I16=13,7,0,0,698,25286,0,0,1200,72000,0,0,364,8086,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,143:5:0	0,6,78:2:0
+X	1567	.	C	<*>	0	.	DP=20;I16=12,6,0,0,652,24422,0,0,1080,64800,0,0,351,7881,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,104:3:0	0,6,72:2:0
+X	1568	.	T	<*>	0	.	DP=20;I16=13,7,0,0,711,26125,0,0,1200,72000,0,0,363,7871,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,157:5:0	0,6,74:2:0
+X	1569	.	C	<*>	0	.	DP=19;I16=12,6,0,0,676,25850,0,0,1080,64800,0,0,351,7669,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,128:4:0	0,6,76:2:0
+X	1570	.	T	<*>	0	.	DP=19;I16=12,7,0,0,700,26750,0,0,1140,68400,0,0,353,7583,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,149:5:0	0,6,71:2:0
+X	1571	.	G	<*>	0	.	DP=19;I16=12,6,0,0,639,23361,0,0,1080,64800,0,0,343,7441,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,125:4:0	0,6,70:2:0
+X	1572	.	C	<*>	0	.	DP=19;I16=11,6,0,0,640,24568,0,0,1020,61200,0,0,328,7202,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,125:4:0	0,6,70:2:0
+X	1573	.	A	<*>	0	.	DP=19;I16=11,4,0,0,565,21475,0,0,900,54000,0,0,304,6900,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,132:4:0	0,3,40:1:0
+X	1574	.	C	<*>	0	.	DP=19;I16=12,5,0,0,636,24076,0,0,1020,61200,0,0,318,6948,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,128:4:0	0,3,38:1:0
+X	1575	.	C	<*>	0	.	DP=19;I16=11,6,0,0,610,22742,0,0,1020,61200,0,0,296,6272,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,125:4:0	0,6,71:2:0
+X	1576	.	C	<*>	0	.	DP=19;I16=12,6,0,0,675,25821,0,0,1080,64800,0,0,315,6785,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,133:4:0	0,6,78:2:0
+X	1577	.	T	<*>	0	.	DP=17;I16=11,6,0,0,650,25330,0,0,1020,61200,0,0,310,6692,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,118:3:0	0,6,77:2:0
+X	1578	.	C	<*>	0	.	DP=17;I16=10,6,0,0,622,24364,0,0,960,57600,0,0,279,5943,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,84:2:0	0,6,77:2:0
+X	1579	.	A	<*>	0	.	DP=17;I16=11,6,0,0,596,22326,0,0,1020,61200,0,0,298,6464,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,116:3:0	0,6,80:2:0
+X	1580	.	G	<*>	0	.	DP=17;I16=11,6,0,0,651,25195,0,0,1020,61200,0,0,292,6380,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,109:3:0	0,6,77:2:0
+X	1581	.	C	<*>	0	.	DP=17;I16=11,6,0,0,586,21418,0,0,1020,61200,0,0,286,6316,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,103:3:0	0,6,71:2:0
+X	1582	.	C	<*>	0	.	DP=18;I16=11,7,0,0,639,23491,0,0,1080,64800,0,0,280,6272,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,109:3:0	0,6,75:2:0
+X	1583	.	T	<*>	0	.	DP=16;I16=10,6,0,0,591,22349,0,0,960,57600,0,0,276,6196,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,112:3:0	0,6,74:2:0
+X	1584	.	G	<*>	0	.	DP=15;I16=10,5,0,0,563,21283,0,0,900,54000,0,0,272,6086,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,105:3:0	0,3,39:1:0
+X	1585	.	G	<*>	0	.	DP=16;I16=10,5,0,0,494,17160,0,0,900,54000,0,0,251,5703,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,244:11:0	0,9,103:3:0	0,3,30:1:0
+X	1586	.	A	<*>	0	.	DP=15;I16=10,3,0,0,470,17200,0,0,780,46800,0,0,237,5273,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,223:10:0	0,6,79:2:0	0,3,42:1:0
+X	1587	.	C	<*>	0	.	DP=15;I16=11,4,0,0,508,17900,0,0,900,54000,0,0,264,5852,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,247:11:0	0,9,94:3:0	0,3,31:1:0
+X	1588	.	A	<*>	0	.	DP=15;I16=11,4,0,0,511,17939,0,0,900,54000,0,0,262,5806,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,232:11:0	0,9,105:3:0	0,3,41:1:0
+X	1589	.	A	<*>	0	.	DP=15;I16=11,4,0,0,536,19584,0,0,900,54000,0,0,259,5725,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,249:11:0	0,9,106:3:0	0,3,42:1:0
+X	1590	.	C	<*>	0	.	DP=15;I16=10,5,0,0,514,18228,0,0,900,54000,0,0,257,5657,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,231:10:0	0,9,104:3:0	0,6,71:2:0
+X	1591	.	T	<*>	0	.	DP=15;I16=10,5,0,0,515,18559,0,0,900,54000,0,0,256,5602,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,241:10:0	0,9,85:3:0	0,6,73:2:0
+X	1592	.	T	<*>	0	.	DP=15;I16=10,5,0,0,503,17345,0,0,900,54000,0,0,255,5561,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,225:10:0	0,9,107:3:0	0,6,62:2:0
+X	1593	.	G	<*>	0	.	DP=15;I16=10,5,0,0,540,19930,0,0,900,54000,0,0,254,5534,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,250:10:0	0,9,106:3:0	0,6,60:2:0
+X	1594	.	T	<*>	0	.	DP=15;I16=10,5,0,0,535,19445,0,0,900,54000,0,0,252,5472,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,234:10:0	0,9,106:3:0	0,6,80:2:0
+X	1595	.	G	<*>	0	.	DP=15;I16=10,4,0,0,494,17940,0,0,840,50400,0,0,225,4801,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,213:9:0	0,9,105:3:0	0,6,69:2:0
+X	1596	.	C	<*>	0	.	DP=15;I16=10,4,0,0,479,17011,0,0,840,50400,0,0,233,5151,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,200:9:0	0,9,111:3:0	0,6,74:2:0
+X	1597	.	C	<*>	0	.	DP=15;I16=10,5,0,0,489,16941,0,0,900,54000,0,0,245,5285,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,195:9:0	0,12,127:4:0	0,6,73:2:0
+X	1598	.	C	<*>	0	.	DP=15;I16=10,5,0,0,514,18282,0,0,900,54000,0,0,244,5240,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,207:9:0	0,12,133:4:0	0,6,68:2:0
+X	1599	.	A	<*>	0	.	DP=14;I16=8,5,0,0,436,15330,0,0,780,46800,0,0,225,4851,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,182:8:0	0,9,103:3:0	0,6,76:2:0
+X	1600	.	T	<*>	0	.	DP=13;I16=8,5,0,0,456,16430,0,0,780,46800,0,0,226,4876,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,193:8:0	0,9,105:3:0	0,6,79:2:0
+X	1601	.	C	<*>	0	.	DP=13;I16=8,4,0,0,431,15861,0,0,720,43200,0,0,208,4554,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,171:7:0	0,9,108:3:0	0,6,78:2:0
+X	1602	.	T	<*>	0	.	DP=13;I16=7,5,0,0,439,16867,0,0,720,43200,0,0,228,4968,0,0;QS=3,0;MQSB=0.95494;MQ0F=0	PL:DP:DV	0,21,179:7:0	0,9,115:3:0	0,6,85:2:0
+X	1603	.	G	<*>	0	.	DP=12;I16=7,5,0,0,455,17407,0,0,720,43200,0,0,230,5034,0,0;QS=3,0;MQSB=0.95494;MQ0F=0	PL:DP:DV	0,21,202:7:0	0,9,111:3:0	0,6,75:2:0
+X	1604	.	G	<*>	0	.	DP=12;I16=7,5,0,0,362,11620,0,0,720,43200,0,0,232,5112,0,0;QS=3,0;MQSB=0.95494;MQ0F=0	PL:DP:DV	0,21,163:7:0	0,9,84:3:0	0,6,66:2:0
+X	1605	.	T	<*>	0	.	DP=12;I16=7,5,0,0,410,14230,0,0,720,43200,0,0,234,5202,0,0;QS=3,0;MQSB=0.95494;MQ0F=0	PL:DP:DV	0,21,190:7:0	0,9,97:3:0	0,6,61:2:0
+X	1606	.	G	<*>	0	.	DP=12;I16=7,4,0,0,370,12738,0,0,660,39600,0,0,211,4679,0,0;QS=3,0;MQSB=0.964642;MQ0F=0	PL:DP:DV	0,18,165:6:0	0,9,91:3:0	0,6,56:2:0
+X	1607	.	A	<*>	0	.	DP=12;I16=7,4,0,0,337,11369,0,0,660,39600,0,0,226,5222,0,0;QS=3,0;MQSB=0.964642;MQ0F=0	PL:DP:DV	0,21,161:7:0	0,6,70:2:0	0,6,55:2:0
+X	1608	.	C	<*>	0	.	DP=12;I16=7,4,0,0,366,12898,0,0,660,39600,0,0,211,4727,0,0;QS=3,0;MQSB=0.964642;MQ0F=0	PL:DP:DV	0,18,141:6:0	0,9,111:3:0	0,6,62:2:0
+X	1609	.	C	<*>	0	.	DP=11;I16=6,5,0,0,365,12889,0,0,660,39600,0,0,237,5393,0,0;QS=3,0;MQSB=0.950952;MQ0F=0	PL:DP:DV	0,18,149:6:0	0,9,110:3:0	0,6,71:2:0
+X	1610	.	C	<*>	0	.	DP=11;I16=5,5,0,0,313,10713,0,0,600,36000,0,0,213,4819,0,0;QS=3,0;MQSB=0.952347;MQ0F=0	PL:DP:DV	0,15,127:5:0	0,9,106:3:0	0,6,57:2:0
+X	1611	.	C	<*>	0	.	DP=11;I16=6,5,0,0,398,14904,0,0,660,39600,0,0,238,5454,0,0;QS=3,0;MQSB=0.950952;MQ0F=0	PL:DP:DV	0,18,180:6:0	0,9,110:3:0	0,6,67:2:0
+X	1612	.	T	<*>	0	.	DP=11;I16=6,5,0,0,409,15421,0,0,660,39600,0,0,238,5472,0,0;QS=3,0;MQSB=0.950952;MQ0F=0	PL:DP:DV	0,18,174:6:0	0,9,107:3:0	0,6,83:2:0
+X	1613	.	C	<*>	0	.	DP=11;I16=6,5,0,0,372,12904,0,0,660,39600,0,0,238,5498,0,0;QS=3,0;MQSB=0.950952;MQ0F=0	PL:DP:DV	0,18,169:6:0	0,9,99:3:0	0,6,63:2:0
+X	1614	.	A	<*>	0	.	DP=11;I16=6,5,0,0,353,12139,0,0,660,39600,0,0,238,5532,0,0;QS=3,0;MQSB=0.950952;MQ0F=0	PL:DP:DV	0,18,147:6:0	0,9,98:3:0	0,6,69:2:0
+X	1615	.	C	<*>	0	.	DP=11;I16=6,5,0,0,366,13080,0,0,660,39600,0,0,238,5574,0,0;QS=3,0;MQSB=0.950952;MQ0F=0	PL:DP:DV	0,18,171:6:0	0,9,105:3:0	0,6,51:2:0
+X	1616	.	T	<*>	0	.	DP=11;I16=6,3,0,0,348,13606,0,0,540,32400,0,0,187,4323,0,0;QS=3,0;MQSB=0.924584;MQ0F=0	PL:DP:DV	0,15,159:5:0	0,9,105:3:0	0,3,42:1:0
+X	1617	.	C	<*>	0	.	DP=12;I16=6,3,0,0,330,12316,0,0,540,32400,0,0,185,4279,0,0;QS=3,0;MQSB=0.924584;MQ0F=0	PL:DP:DV	0,15,146:5:0	0,9,105:3:0	0,3,42:1:0
+X	1618	.	A	<*>	0	.	DP=12;I16=5,6,0,0,385,14199,0,0,629,36841,0,0,244,5636,0,0;QS=3,0;MQSB=0.891517;MQ0F=0	PL:DP:DV	0,18,151:6:0	0,9,93:3:0	0,6,81:2:0
+X	1619	.	G	<*>	0	.	DP=11;I16=5,6,0,0,377,13119,0,0,629,36841,0,0,242,5544,0,0;QS=3,0;MQSB=0.891517;MQ0F=0	PL:DP:DV	0,18,166:6:0	0,9,84:3:0	0,6,67:2:0
+X	1620	.	C	<*>	0	.	DP=11;I16=5,5,0,0,323,10965,0,0,569,33241,0,0,215,4839,0,0;QS=3,0;MQSB=0.857112;MQ0F=0	PL:DP:DV	0,15,142:5:0	0,9,78:3:0	0,6,56:2:0
+X	1621	.	C	<*>	0	.	DP=12;I16=5,7,0,0,363,11779,0,0,689,40441,0,0,263,6021,0,0;QS=3,0;MQSB=0.896474;MQ0F=0	PL:DP:DV	0,21,174:7:0	0,9,80:3:0	0,6,56:2:0
+X	1622	.	A	<*>	0	.	DP=12;I16=5,7,0,0,365,12105,0,0,689,40441,0,0,261,5965,0,0;QS=3,0;MQSB=0.896474;MQ0F=0	PL:DP:DV	0,21,176:7:0	0,9,81:3:0	0,6,52:2:0
+X	1623	.	C	<*>	0	.	DP=12;I16=5,5,0,0,325,10979,0,0,569,33241,0,0,208,4620,0,0;QS=3,0;MQSB=0.857112;MQ0F=0	PL:DP:DV	0,18,155:6:0	0,9,84:3:0	0,3,37:1:0
+X	1624	.	C	<*>	0	.	DP=12;I16=4,6,0,0,336,11718,0,0,569,33241,0,0,211,4799,0,0;QS=3,0;MQSB=0.895781;MQ0F=0	PL:DP:DV	0,18,162:6:0	0,9,88:3:0	0,3,39:1:0
+X	1625	.	A	<*>	0	.	DP=12;I16=4,7,0,0,375,13503,0,0,629,36841,0,0,234,5386,0,0;QS=3,0;MQSB=0.924449;MQ0F=0	PL:DP:DV	0,18,158:6:0	0,9,93:3:0	0,6,80:2:0
+X	1626	.	G	<*>	0	.	DP=12;I16=5,7,0,0,358,11490,0,0,689,40441,0,0,249,5645,0,0;QS=3,0;MQSB=0.896474;MQ0F=0	PL:DP:DV	0,21,158:7:0	0,9,83:3:0	0,6,63:2:0
+X	1627	.	A	<*>	0	.	DP=12;I16=5,7,0,0,363,11609,0,0,689,40441,0,0,246,5590,0,0;QS=3,0;MQSB=0.896474;MQ0F=0	PL:DP:DV	0,21,165:7:0	0,9,75:3:0	0,6,72:2:0
+X	1628	.	C	<*>	0	.	DP=12;I16=5,7,0,0,357,11583,0,0,689,40441,0,0,243,5545,0,0;QS=3,0;MQSB=0.896474;MQ0F=0	PL:DP:DV	0,21,165:7:0	0,9,80:3:0	0,6,57:2:0
+X	1629	.	T	<*>	0	.	DP=13;I16=6,7,0,0,451,16079,0,0,749,44041,0,0,240,5510,0,0;QS=3,0;MQSB=0.899815;MQ0F=0	PL:DP:DV	0,21,187:7:0	0,12,120:4:0	0,6,79:2:0
+X	1630	.	T	<*>	0	.	DP=13;I16=6,7,0,0,403,13323,0,0,749,44041,0,0,237,5435,0,0;QS=3,0;MQSB=0.899815;MQ0F=0	PL:DP:DV	0,21,169:7:0	0,12,111:4:0	0,6,73:2:0
+X	1631	.	C	<*>	0	.	DP=12;I16=6,5,0,0,354,12046,0,0,660,39600,0,0,210,4744,0,0;QS=3,0;MQSB=0.950952;MQ0F=0	PL:DP:DV	0,21,184:7:0	0,6,67:2:0	0,6,61:2:0
+X	1632	.	C	<*>	0	.	DP=13;I16=6,7,0,0,387,12175,0,0,749,44041,0,0,232,5262,0,0;QS=3,0;MQSB=0.899815;MQ0F=0	PL:DP:DV	0,24,188:8:0	0,9,82:3:0	0,6,61:2:0
+X	1633	.	A	<*>	0	.	DP=13;I16=6,7,0,0,404,13272,0,0,749,44041,0,0,230,5166,0,0;QS=3,0;MQSB=0.899815;MQ0F=0	PL:DP:DV	0,24,183:8:0	0,9,86:3:0	0,6,73:2:0
+X	1634	.	C	<*>	0	.	DP=13;I16=6,6,0,0,328,9716,0,0,689,40441,0,0,203,4457,0,0;QS=3,0;MQSB=0.864013;MQ0F=0	PL:DP:DV	0,21,151:7:0	0,9,80:3:0	0,6,59:2:0
+X	1635	.	G	<*>	0	.	DP=14;I16=6,8,0,0,419,12831,0,0,809,47641,0,0,226,5010,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,24,180:8:0	0,12,108:4:0	0,6,59:2:0
+X	1636	.	A	<*>	0	.	DP=14;I16=6,8,0,0,418,13400,0,0,809,47641,0,0,225,4951,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,24,179:8:0	0,12,110:4:0	0,6,66:2:0
+X	1637	.	C	<*>	0	.	DP=14;I16=6,8,0,0,422,13498,0,0,809,47641,0,0,224,4906,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,24,185:8:0	0,12,110:4:0	0,6,60:2:0
+X	1638	.	A	<*>	0	.	DP=17;I16=9,7,0,0,513,17167,0,0,929,54841,0,0,216,4790,0,0;QS=3,0;MQSB=0.892753;MQ0F=0	PL:DP:DV	0,24,191:8:0	0,18,149:6:0	0,6,78:2:0
+X	1639	.	G	<*>	0	.	DP=17;I16=9,8,0,0,552,18844,0,0,989,58441,0,0,223,4765,0,0;QS=3,0;MQSB=0.91051;MQ0F=0	PL:DP:DV	0,27,228:9:0	0,18,150:6:0	0,6,68:2:0
+X	1640	.	G	<*>	0	.	DP=17;I16=8,6,0,0,414,13296,0,0,809,47641,0,0,171,3467,0,0;QS=3,0;MQSB=0.875173;MQ0F=0	PL:DP:DV	0,18,150:6:0	0,18,151:6:0	0,6,51:2:0
+X	1641	.	C	<*>	0	.	DP=18;I16=9,8,0,0,511,16289,0,0,989,58441,0,0,225,4709,0,0;QS=3,0;MQSB=0.91051;MQ0F=0	PL:DP:DV	0,27,188:9:0	0,18,167:6:0	0,6,65:2:0
+X	1642	.	T	<*>	0	.	DP=17;I16=8,7,0,0,519,18513,0,0,869,51241,0,0,217,4613,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,18,170:6:0	0,18,168:6:0	0,9,102:3:0
+X	1643	.	C	<*>	0	.	DP=16;I16=7,9,0,0,508,16910,0,0,929,54841,0,0,255,5361,0,0;QS=3,0;MQSB=0.933674;MQ0F=0	PL:DP:DV	0,24,193:8:0	0,18,169:6:0	0,6,56:2:0
+X	1644	.	C	<*>	0	.	DP=15;I16=6,9,0,0,514,18056,0,0,869,51241,0,0,259,5401,0,0;QS=3,0;MQSB=0.939413;MQ0F=0	PL:DP:DV	0,21,209:7:0	0,18,165:6:0	0,6,54:2:0
+X	1645	.	A	<*>	0	.	DP=15;I16=6,9,0,0,520,18852,0,0,869,51241,0,0,263,5457,0,0;QS=3,0;MQSB=0.939413;MQ0F=0	PL:DP:DV	0,21,213:7:0	0,18,173:6:0	0,6,49:2:0
+X	1646	.	G	<*>	0	.	DP=15;I16=6,7,0,0,440,15526,0,0,780,46800,0,0,217,4279,0,0;QS=3,0;MQSB=0.961166;MQ0F=0	PL:DP:DV	0,18,185:6:0	0,15,148:5:0	0,6,48:2:0
+X	1647	.	C	<*>	0	.	DP=15;I16=6,9,0,0,433,13883,0,0,869,51241,0,0,271,5617,0,0;QS=3,0;MQSB=0.939413;MQ0F=0	PL:DP:DV	0,21,190:7:0	0,18,139:6:0	0,6,35:2:0
+X	1648	.	C	<*>	0	.	DP=15;I16=6,9,0,0,495,16965,0,0,869,51241,0,0,275,5721,0,0;QS=3,0;MQSB=0.939413;MQ0F=0	PL:DP:DV	0,21,203:7:0	0,18,159:6:0	0,6,44:2:0
+X	1649	.	T	<*>	0	.	DP=15;I16=6,9,0,0,516,18122,0,0,869,51241,0,0,279,5841,0,0;QS=3,0;MQSB=0.939413;MQ0F=0	PL:DP:DV	0,21,187:7:0	0,18,182:6:0	0,6,56:2:0
+X	1650	.	C	<*>	0	.	DP=15;I16=6,7,0,0,405,13551,0,0,749,44041,0,0,240,5028,0,0;QS=3,0;MQSB=0.899815;MQ0F=0	PL:DP:DV	0,18,161:6:0	0,18,169:6:0	0,3,13:1:0
+X	1651	.	G	<*>	0	.	DP=17;I16=5,9,0,0,424,13328,0,0,778,44882,0,0,249,5335,0,0;QS=3,0;MQSB=0.965069;MQ0F=0	PL:DP:DV	0,18,150:6:0	0,15,128:5:0	0,9,86:3:0
+X	1652	.	G	<*>	0	.	DP=18;I16=7,9,0,0,532,18602,0,0,898,52082,0,0,267,5673,0,0;QS=3,0;MQSB=0.994413;MQ0F=0	PL:DP:DV	0,24,212:8:0	0,18,168:6:0	0,6,54:2:0
+X	1653	.	C	<*>	0	.	DP=18;I16=8,10,0,0,581,19565,0,0,1018,59282,0,0,300,6490,0,0;QS=3,0;MQSB=0.99606;MQ0F=0	PL:DP:DV	0,24,208:8:0	0,21,175:7:0	0,9,82:3:0
+X	1654	.	A	T,<*>	0	.	DP=18;I16=8,9,0,1,516,16718,15,225,958,55682,60,3600,285,6219,22,484;QS=2.93213,0.0678733,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.99606;BQB=1;MQ0F=0	PL:DP:DV	0,9,155,21,158,162:8:1	0,21,179,21,179,179:7:0	0,9,78,9,78,78:3:0
+X	1655	.	C	<*>	0	.	DP=18;I16=8,10,0,0,565,19017,0,0,1018,59282,0,0,313,6887,0,0;QS=3,0;MQSB=0.99606;MQ0F=0	PL:DP:DV	0,24,198:8:0	0,21,180:7:0	0,9,79:3:0
+X	1656	.	C	<*>	0	.	DP=19;I16=9,9,0,0,557,18013,0,0,1018,59282,0,0,295,6515,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,202:8:0	0,21,165:7:0	0,9,80:3:0
+X	1657	.	T	A,<*>	0	.	DP=18;I16=8,9,0,1,580,20362,15,225,989,58441,29,841,301,6641,25,625;QS=2.93243,0.0675676,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.99606;BQB=1;MQ0F=0	PL:DP:DV	0,24,206,24,206,206:8:0	0,6,158,18,161,165:7:1	0,9,85,9,85,85:3:0
+X	1658	.	T	<*>	0	.	DP=19;I16=8,10,0,0,573,19127,0,0,1018,59282,0,0,332,7412,0,0;QS=3,0;MQSB=0.99606;MQ0F=0	PL:DP:DV	0,24,187:8:0	0,21,189:7:0	0,9,91:3:0
+X	1659	.	C	<*>	0	.	DP=20;I16=8,10,0,0,609,21517,0,0,1049,62041,0,0,338,7578,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,24,219:8:0	0,21,189:7:0	0,9,80:3:0
+X	1660	.	A	<*>	0	.	DP=21;I16=8,11,0,0,641,23219,0,0,1078,62882,0,0,385,8901,0,0;QS=3,0;MQSB=0.992359;MQ0F=0	PL:DP:DV	0,21,172:7:0	0,24,219:8:0	0,12,127:4:0
+X	1661	.	G	<*>	0	.	DP=21;I16=7,13,0,0,639,21739,0,0,1107,63723,0,0,412,9598,0,0;QS=3,0;MQSB=0.999215;MQ0F=0	PL:DP:DV	0,24,209:8:0	0,24,193:8:0	0,12,98:4:0
+X	1662	.	C	<*>	0	.	DP=21;I16=8,12,0,0,641,21423,0,0,1107,63723,0,0,407,9465,0,0;QS=3,0;MQSB=0.988166;MQ0F=0	PL:DP:DV	0,21,192:7:0	0,27,211:9:0	0,12,100:4:0
+X	1663	.	C	<*>	0	.	DP=20;I16=7,11,0,0,577,19507,0,0,1018,59282,0,0,394,9204,0,0;QS=3,0;MQSB=0.983729;MQ0F=0	PL:DP:DV	0,21,178:7:0	0,21,192:7:0	0,12,101:4:0
+X	1664	.	A	C,<*>	0	.	DP=20;I16=6,10,0,1,530,17982,13,169,898,52082,29,841,358,8422,25,625;QS=2.93953,0.0604651,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.998738;BQB=1;MQ0F=0	PL:DP:DV	0,18,167,18,167,167:6:0	0,7,154,18,157,159:7:1	0,12,109,12,109,109:4:0
+X	1665	.	T	C,<*>	0	.	DP=20;I16=7,11,1,1,592,20170,58,1924,1018,59282,89,4441,396,9188,39,821;QS=2.5913,0.408696,0;VDB=0.1;SGB=0.346553;RPB=0.222222;MQB=0.611111;MQSB=0.988166;BQB=0.944444;MQ0F=0	PL:DP:DV	0,21,185,21,185,185:7:0	0,27,222,27,222,222:9:0	35,0,51,41,57,90:4:2
+X	1666	.	G	<*>	0	.	DP=20;I16=8,12,0,0,614,19760,0,0,1107,63723,0,0,435,9947,0,0;QS=3,0;MQSB=0.988166;MQ0F=0	PL:DP:DV	0,21,173:7:0	0,27,206:9:0	0,12,111:4:0
+X	1667	.	G	<*>	0	.	DP=20;I16=8,11,0,0,617,21033,0,0,1078,62882,0,0,410,9276,0,0;QS=3,0;MQSB=0.992359;MQ0F=0	PL:DP:DV	0,21,183:7:0	0,24,195:8:0	0,12,115:4:0
+X	1668	.	A	<*>	0	.	DP=20;I16=7,10,0,0,570,19908,0,0,958,55682,0,0,369,8365,0,0;QS=3,0;MQSB=0.989343;MQ0F=0	PL:DP:DV	0,18,158:6:0	0,21,186:7:0	0,12,124:4:0
+X	1669	.	C	<*>	0	.	DP=20;I16=8,12,0,0,640,21336,0,0,1107,63723,0,0,435,9857,0,0;QS=3,0;MQSB=0.988166;MQ0F=0	PL:DP:DV	0,21,172:7:0	0,27,216:9:0	0,12,115:4:0
+X	1670	.	A	<*>	0	.	DP=23;I16=9,13,0,0,765,27363,0,0,1258,73682,0,0,410,9234,0,0;QS=3,0;MQSB=0.991121;MQ0F=0	PL:DP:DV	0,27,215:9:0	0,27,233:9:0	0,12,129:4:0
+X	1671	.	G	<*>	0	.	DP=23;I16=9,13,0,0,703,23631,0,0,1258,73682,0,0,412,9206,0,0;QS=3,0;MQSB=0.991121;MQ0F=0	PL:DP:DV	0,27,214:9:0	0,27,210:9:0	0,12,106:4:0
+X	1672	.	T	<*>	0	.	DP=23;I16=9,13,0,0,724,24700,0,0,1258,73682,0,0,414,9202,0,0;QS=3,0;MQSB=0.991121;MQ0F=0	PL:DP:DV	0,27,203:9:0	0,27,232:9:0	0,12,111:4:0
+X	1673	.	T	<*>	0	.	DP=25;I16=8,13,0,0,719,25183,0,0,1198,70082,0,0,372,8248,0,0;QS=3,0;MQSB=0.983744;MQ0F=0	PL:DP:DV	0,27,221:9:0	0,24,212:8:0	0,12,112:4:0
+X	1674	.	C	<*>	0	.	DP=25;I16=8,14,0,0,755,26561,0,0,1289,76441,0,0,389,8417,0,0;QS=3,0;MQSB=0.892142;MQ0F=0	PL:DP:DV	0,33,244:11:0	0,21,206:7:0	0,12,96:4:0
+X	1675	.	C	<*>	0	.	DP=25;I16=9,15,0,0,705,22355,0,0,1347,78123,0,0,447,9897,0,0;QS=3,0;MQSB=0.996008;MQ0F=0	PL:DP:DV	0,33,222:11:0	0,30,212:10:0	0,9,65:3:0
+X	1676	.	G	<*>	0	.	DP=25;I16=6,15,0,0,660,21708,0,0,1167,67323,0,0,383,8265,0,0;QS=3,0;MQSB=0.993205;MQ0F=0	PL:DP:DV	0,33,222:11:0	0,21,170:7:0	0,9,96:3:0
+X	1677	.	C	<*>	0	.	DP=25;I16=9,13,0,0,681,22869,0,0,1289,76441,0,0,394,8510,0,0;QS=3,0;MQSB=0.910098;MQ0F=0	PL:DP:DV	0,33,225:11:0	0,24,198:8:0	0,9,74:3:0
+X	1678	.	C	<*>	0	.	DP=25;I16=9,15,0,0,775,26785,0,0,1347,78123,0,0,438,9496,0,0;QS=3,0;MQSB=0.996008;MQ0F=0	PL:DP:DV	0,33,235:11:0	0,30,231:10:0	0,9,83:3:0
+X	1679	.	A	<*>	0	.	DP=25;I16=8,15,0,0,762,27552,0,0,1287,74523,0,0,412,8858,0,0;QS=3,0;MQSB=0.999479;MQ0F=0	PL:DP:DV	0,33,235:11:0	0,27,219:9:0	0,9,106:3:0
+X	1680	.	G	<*>	0	.	DP=26;I16=9,17,0,0,843,29213,0,0,1467,85323,0,0,459,10021,0,0;QS=3,0;MQSB=0.999637;MQ0F=0	PL:DP:DV	0,33,253:11:0	0,33,232:11:0	0,12,108:4:0
+X	1681	.	C	<*>	0	.	DP=26;I16=8,15,0,0,681,21293,0,0,1318,77282,0,0,407,8999,0,0;QS=3,0;MQSB=0.974802;MQ0F=0	PL:DP:DV	0,33,223:11:0	0,27,191:9:0	0,9,69:3:0
+X	1682	.	G	<*>	0	.	DP=25;I16=9,16,0,0,728,22560,0,0,1407,81723,0,0,455,9877,0,0;QS=3,0;MQSB=0.998399;MQ0F=0	PL:DP:DV	0,30,222:10:0	0,33,208:11:0	0,12,98:4:0
+X	1683	.	T	<*>	0	.	DP=25;I16=8,15,0,0,807,29159,0,0,1287,74523,0,0,403,8567,0,0;QS=3,0;MQSB=0.999479;MQ0F=0	PL:DP:DV	0,30,250:10:0	0,30,235:10:0	0,9,91:3:0
+X	1684	.	T	<*>	0	.	DP=25;I16=8,15,0,0,802,28774,0,0,1318,77282,0,0,438,9612,0,0;QS=3,0;MQSB=0.974802;MQ0F=0	PL:DP:DV	0,27,227:9:0	0,30,237:10:0	0,12,107:4:0
+X	1685	.	G	<*>	0	.	DP=24;I16=8,14,0,0,759,27319,0,0,1258,73682,0,0,413,8999,0,0;QS=3,0;MQSB=0.979255;MQ0F=0	PL:DP:DV	0,24,216:8:0	0,30,242:10:0	0,12,110:4:0
+X	1686	.	C	<*>	0	.	DP=24;I16=8,15,0,0,793,28073,0,0,1318,77282,0,0,438,9656,0,0;QS=3,0;MQSB=0.974802;MQ0F=0	PL:DP:DV	0,27,225:9:0	0,30,241:10:0	0,12,103:4:0
+X	1687	.	C	<*>	0	.	DP=24;I16=7,14,0,0,741,26765,0,0,1198,70082,0,0,388,8458,0,0;QS=3,0;MQSB=0.966484;MQ0F=0	PL:DP:DV	0,24,221:8:0	0,27,229:9:0	0,12,106:4:0
+X	1688	.	C	<*>	0	.	DP=24;I16=8,15,0,0,794,28736,0,0,1318,77282,0,0,431,9605,0,0;QS=3,0;MQSB=0.974802;MQ0F=0	PL:DP:DV	0,27,239:9:0	0,30,221:10:0	0,12,120:4:0
+X	1689	.	T	A,<*>	0	.	DP=24;I16=8,15,0,1,805,29443,33,1089,1287,74523,60,3600,421,9311,25,625;QS=2.74419,0.255814,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=1;BQB=1;MQ0F=0	PL:DP:DV	0,27,224,27,224,224:9:0	0,33,255,33,255,255:11:0	21,0,79,30,82,106:4:1
+X	1690	.	C	<*>	0	.	DP=24;I16=8,16,0,0,864,32420,0,0,1347,78123,0,0,445,10033,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,242:9:0	0,33,255:11:0	0,12,95:4:0
+X	1691	.	T	<*>	0	.	DP=22;I16=7,14,0,0,734,27150,0,0,1167,67323,0,0,421,9525,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,225:9:0	0,30,242:10:0	0,6,57:2:0
+X	1692	.	G	<*>	0	.	DP=22;I16=7,13,0,0,678,24110,0,0,1107,63723,0,0,400,9176,0,0;QS=3,0;MQSB=0.999215;MQ0F=0	PL:DP:DV	0,24,218:8:0	0,30,218:10:0	0,6,61:2:0
+X	1693	.	T	<*>	0	.	DP=24;I16=10,13,0,0,795,28363,0,0,1318,77282,0,0,444,10422,0,0;QS=3,0;MQSB=0.995682;MQ0F=0	PL:DP:DV	0,27,227:9:0	0,30,235:10:0	0,12,104:4:0
+X	1694	.	T	<*>	0	.	DP=24;I16=10,13,0,0,771,26775,0,0,1318,77282,0,0,448,10602,0,0;QS=3,0;MQSB=0.995682;MQ0F=0	PL:DP:DV	0,27,221:9:0	0,30,232:10:0	0,12,114:4:0
+X	1695	.	C	<*>	0	.	DP=24;I16=10,14,0,0,811,28517,0,0,1347,78123,0,0,454,10806,0,0;QS=3,0;MQSB=0.98469;MQ0F=0	PL:DP:DV	0,27,227:9:0	0,33,239:11:0	0,12,121:4:0
+X	1696	.	T	<*>	0	.	DP=23;I16=10,13,0,0,825,30819,0,0,1287,74523,0,0,455,10869,0,0;QS=3,0;MQSB=0.976718;MQ0F=0	PL:DP:DV	0,24,219:8:0	0,33,255:11:0	0,12,108:4:0
+X	1697	.	G	<*>	0	.	DP=23;I16=10,13,0,0,767,26757,0,0,1287,74523,0,0,455,10897,0,0;QS=3,0;MQSB=0.976718;MQ0F=0	PL:DP:DV	0,24,208:8:0	0,33,246:11:0	0,12,112:4:0
+X	1698	.	C	A,<*>	0	.	DP=21;I16=10,10,0,1,726,27088,27,729,1169,69241,29,841,451,10903,6,36;QS=2.91148,0.0885246,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.99938;BQB=1;MQ0F=0	PL:DP:DV	0,24,229,24,229,229:8:0	0,0,190,24,193,207:9:1	0,12,111,12,111,111:4:0
+X	1699	.	T	<*>	0	.	DP=21;I16=9,10,0,0,698,25826,0,0,1078,62882,0,0,408,9692,0,0;QS=3,0;MQSB=0.999167;MQ0F=0	PL:DP:DV	0,21,203:7:0	0,24,219:8:0	0,12,115:4:0
+X	1700	.	G	<*>	0	.	DP=20;I16=9,10,0,0,696,25850,0,0,1078,62882,0,0,409,9705,0,0;QS=3,0;MQSB=0.999167;MQ0F=0	PL:DP:DV	0,21,216:7:0	0,24,215:8:0	0,12,110:4:0
+X	1701	.	T	<*>	0	.	DP=20;I16=9,11,0,0,711,25539,0,0,1138,66482,0,0,435,10353,0,0;QS=3,0;MQSB=0.997118;MQ0F=0	PL:DP:DV	0,24,207:8:0	0,24,210:8:0	0,12,125:4:0
+X	1702	.	T	<*>	0	.	DP=20;I16=8,11,0,0,671,24367,0,0,1078,62882,0,0,410,9712,0,0;QS=3,0;MQSB=0.992359;MQ0F=0	PL:DP:DV	0,24,214:8:0	0,21,193:7:0	0,12,115:4:0
+X	1703	.	T	<*>	0	.	DP=20;I16=9,10,0,0,648,22696,0,0,1078,62882,0,0,410,9708,0,0;QS=3,0;MQSB=0.999167;MQ0F=0	PL:DP:DV	0,21,197:7:0	0,24,195:8:0	0,12,114:4:0
+X	1704	.	T	<*>	0	.	DP=20;I16=10,10,0,0,711,25771,0,0,1169,69241,0,0,435,10341,0,0;QS=3,0;MQSB=0.931063;MQ0F=0	PL:DP:DV	0,24,208:8:0	0,21,208:7:0	0,15,128:5:0
+X	1705	.	C	<*>	0	.	DP=20;I16=10,10,0,0,744,28388,0,0,1169,69241,0,0,436,10312,0,0;QS=3,0;MQSB=0.931063;MQ0F=0	PL:DP:DV	0,24,232:8:0	0,21,213:7:0	0,15,120:5:0
+X	1706	.	T	<*>	0	.	DP=20;I16=10,10,0,0,775,30329,0,0,1169,69241,0,0,436,10246,0,0;QS=3,0;MQSB=0.931063;MQ0F=0	PL:DP:DV	0,24,221:8:0	0,21,219:7:0	0,15,145:5:0
+X	1707	.	C	<*>	0	.	DP=21;I16=9,11,0,0,724,26998,0,0,1169,69241,0,0,410,9518,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,27,235:9:0	0,18,180:6:0	0,15,134:5:0
+X	1708	.	T	<*>	0	.	DP=21;I16=9,12,0,0,740,27282,0,0,1229,72841,0,0,410,9430,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,30,229:10:0	0,18,187:6:0	0,15,132:5:0
+X	1709	.	A	<*>	0	.	DP=21;I16=9,11,0,0,675,23509,0,0,1169,69241,0,0,386,8734,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,27,210:9:0	0,18,166:6:0	0,15,131:5:0
+X	1710	.	C	<*>	0	.	DP=22;I16=9,13,0,0,755,26817,0,0,1289,76441,0,0,412,9306,0,0;QS=3,0;MQSB=0.910098;MQ0F=0	PL:DP:DV	0,33,236:11:0	0,18,181:6:0	0,15,128:5:0
+X	1711	.	C	<*>	0	.	DP=22;I16=9,13,0,0,786,28790,0,0,1289,76441,0,0,413,9223,0,0;QS=3,0;MQSB=0.910098;MQ0F=0	PL:DP:DV	0,33,250:11:0	0,18,169:6:0	0,15,138:5:0
+X	1712	.	A	<*>	0	.	DP=22;I16=9,13,0,0,824,31342,0,0,1289,76441,0,0,414,9162,0,0;QS=3,0;MQSB=0.910098;MQ0F=0	PL:DP:DV	0,33,252:11:0	0,18,198:6:0	0,15,136:5:0
+X	1713	.	G	<*>	0	.	DP=23;I16=8,14,0,0,823,31285,0,0,1289,76441,0,0,405,8993,0,0;QS=3,0;MQSB=0.892142;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,189:6:0	0,12,118:4:0
+X	1714	.	A	<*>	0	.	DP=23;I16=9,13,0,0,763,27439,0,0,1289,76441,0,0,402,8818,0,0;QS=3,0;MQSB=0.910098;MQ0F=0	PL:DP:DV	0,36,234:12:0	0,18,190:6:0	0,12,101:4:0
+X	1715	.	A	<*>	0	.	DP=23;I16=9,14,0,0,900,35416,0,0,1349,80041,0,0,414,8878,0,0;QS=3,0;MQSB=0.907354;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,206:6:0	0,15,145:5:0
+X	1716	.	G	<*>	0	.	DP=23;I16=9,14,0,0,844,31500,0,0,1349,80041,0,0,414,8822,0,0;QS=3,0;MQSB=0.907354;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,188:6:0	0,15,129:5:0
+X	1717	.	T	<*>	0	.	DP=24;I16=9,15,0,0,854,30878,0,0,1409,83641,0,0,414,8794,0,0;QS=3,0;MQSB=0.904837;MQ0F=0	PL:DP:DV	0,39,253:13:0	0,18,185:6:0	0,15,122:5:0
+X	1718	.	G	<*>	0	.	DP=24;I16=9,14,0,0,806,29332,0,0,1349,80041,0,0,390,8170,0,0;QS=3,0;MQSB=0.907354;MQ0F=0	PL:DP:DV	0,36,249:12:0	0,18,188:6:0	0,15,124:5:0
+X	1719	.	C	<*>	0	.	DP=26;I16=11,14,0,0,857,30717,0,0,1469,87241,0,0,407,8675,0,0;QS=3,0;MQSB=0.929204;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,173:6:0	0,12,98:4:0
+X	1720	.	C	<*>	0	.	DP=26;I16=11,14,0,0,898,33274,0,0,1469,87241,0,0,409,8645,0,0;QS=3,0;MQSB=0.929204;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,166:6:0	0,12,99:4:0
+X	1721	.	C	<*>	0	.	DP=26;I16=10,14,0,0,846,30642,0,0,1409,83641,0,0,388,8258,0,0;QS=3,0;MQSB=0.919431;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,187:6:0	0,12,119:4:0
+X	1722	.	T	<*>	0	.	DP=25;I16=11,13,0,0,876,33054,0,0,1409,83641,0,0,406,8540,0,0;QS=3,0;MQSB=0.931547;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,174:5:0	0,15,123:5:0
+X	1723	.	T	<*>	0	.	DP=25;I16=11,14,0,0,835,28861,0,0,1469,87241,0,0,420,8728,0,0;QS=3,0;MQSB=0.929204;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,167:5:0	0,15,130:5:0
+X	1724	.	C	<*>	0	.	DP=25;I16=11,14,0,0,903,33735,0,0,1469,87241,0,0,422,8800,0,0;QS=3,0;MQSB=0.929204;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,164:5:0	0,15,139:5:0
+X	1725	.	C	G,<*>	0	.	DP=25;I16=11,13,0,1,835,29699,25,625,1409,83641,60,3600,406,8576,18,324;QS=2.95164,0.0483559,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.929204;BQB=1;MQ0F=0	PL:DP:DV	0,20,255,42,255,255:15:1	0,15,153,15,153,153:5:0	0,15,132,15,132,132:5:0
+X	1726	.	C	<*>	0	.	DP=25;I16=11,14,0,0,932,35588,0,0,1469,87241,0,0,426,9028,0,0;QS=3,0;MQSB=0.929204;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,165:5:0	0,15,122:5:0
+X	1727	.	T	<*>	0	.	DP=25;I16=10,14,0,0,862,32080,0,0,1409,83641,0,0,404,8556,0,0;QS=3,0;MQSB=0.919431;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,167:5:0	0,12,120:4:0
+X	1728	.	C	<*>	0	.	DP=25;I16=11,14,0,0,915,33845,0,0,1469,87241,0,0,429,9173,0,0;QS=3,0;MQSB=0.929204;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,156:5:0	0,15,144:5:0
+X	1729	.	C	<*>	0	.	DP=25;I16=10,14,0,0,919,35797,0,0,1409,83641,0,0,406,8668,0,0;QS=3,0;MQSB=0.919431;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,142:5:0	0,12,128:4:0
+X	1730	.	T	<*>	0	.	DP=24;I16=10,14,0,0,849,30711,0,0,1409,83641,0,0,433,9393,0,0;QS=3,0;MQSB=0.919431;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,138:4:0	0,15,148:5:0
+X	1731	.	C	<*>	0	.	DP=24;I16=10,14,0,0,907,34875,0,0,1409,83641,0,0,434,9472,0,0;QS=3,0;MQSB=0.919431;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,123:4:0	0,15,140:5:0
+X	1732	.	A	<*>	0	.	DP=24;I16=11,13,0,0,816,28582,0,0,1409,83641,0,0,436,9580,0,0;QS=3,0;MQSB=0.931547;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,123:4:0	0,15,143:5:0
+X	1733	.	C	<*>	0	.	DP=25;I16=12,13,0,0,869,31451,0,0,1469,87241,0,0,438,9666,0,0;QS=3,0;MQSB=0.939413;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,116:4:0	0,15,136:5:0
+X	1734	.	C	<*>	0	.	DP=25;I16=12,13,0,0,926,35482,0,0,1469,87241,0,0,440,9730,0,0;QS=3,0;MQSB=0.939413;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,122:4:0	0,15,141:5:0
+X	1735	.	T	<*>	0	.	DP=26;I16=13,13,0,0,935,35169,0,0,1529,90841,0,0,442,9822,0,0;QS=3,0;MQSB=0.945959;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,112:4:0	0,15,148:5:0
+X	1736	.	G	<*>	0	.	DP=25;I16=11,11,0,0,829,31469,0,0,1289,76441,0,0,380,8416,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,72:2:0	0,12,118:4:0
+X	1737	.	A	<*>	0	.	DP=25;I16=12,12,0,0,842,30606,0,0,1409,83641,0,0,422,9312,0,0;QS=3,0;MQSB=0.941765;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,76:2:0	0,15,131:5:0
+X	1738	.	C	<*>	0	.	DP=24;I16=12,12,0,0,835,30251,0,0,1409,83641,0,0,450,10010,0,0;QS=3,0;MQSB=0.941765;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,78:3:0	0,15,130:5:0
+X	1739	.	C	<*>	0	.	DP=23;I16=10,12,0,0,831,32123,0,0,1289,76441,0,0,428,9432,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,55:2:0	0,12,135:4:0
+X	1740	.	A	<*>	0	.	DP=23;I16=11,12,0,0,774,27126,0,0,1349,80041,0,0,456,10126,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,56:2:0	0,15,139:5:0
+X	1741	.	C	<*>	0	.	DP=23;I16=11,12,0,0,850,32314,0,0,1349,80041,0,0,459,10217,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,70:2:0	0,15,136:5:0
+X	1742	.	T	<*>	0	.	DP=23;I16=11,12,0,0,866,33204,0,0,1349,80041,0,0,462,10330,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,72:2:0	0,15,144:5:0
+X	1743	.	C	<*>	0	.	DP=23;I16=11,12,0,0,894,35176,0,0,1349,80041,0,0,464,10414,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,74:2:0	0,15,138:5:0
+X	1744	.	T	<*>	0	.	DP=23;I16=11,11,0,0,857,33579,0,0,1289,76441,0,0,459,10469,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,80:2:0	0,15,156:5:0
+X	1745	.	G	<*>	0	.	DP=23;I16=11,12,0,0,882,34572,0,0,1349,80041,0,0,464,10442,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,78:2:0	0,15,142:5:0
+X	1746	.	G	<*>	0	.	DP=24;I16=12,11,0,0,836,31102,0,0,1349,80041,0,0,456,10312,0,0;QS=3,0;MQSB=0.944319;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,69:2:0	0,18,151:6:0
+X	1747	.	G	<*>	0	.	DP=24;I16=12,11,0,0,839,31729,0,0,1349,80041,0,0,455,10239,0,0;QS=3,0;MQSB=0.944319;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,75:2:0	0,18,154:6:0
+X	1748	.	G	<*>	0	.	DP=24;I16=11,12,0,0,843,31857,0,0,1349,80041,0,0,434,9664,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,3,42:1:0	0,18,154:6:0
+X	1749	.	A	<*>	0	.	DP=25;I16=13,11,0,0,864,31748,0,0,1409,83641,0,0,451,10063,0,0;QS=3,0;MQSB=0.950498;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,72:2:0	0,21,172:7:0
+X	1750	.	A	<*>	0	.	DP=25;I16=13,12,0,0,905,33667,0,0,1469,87241,0,0,451,10013,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,56:2:0	0,21,187:7:0
+X	1751	.	A	<*>	0	.	DP=25;I16=13,12,0,0,908,33658,0,0,1469,87241,0,0,449,9987,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,67:2:0	0,21,183:7:0
+X	1752	.	T	<*>	0	.	DP=23;I16=12,11,0,0,838,31088,0,0,1380,82800,0,0,449,9987,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,71:2:0	0,18,170:6:0
+X	1753	.	C	<*>	0	.	DP=23;I16=12,11,0,0,869,33595,0,0,1380,82800,0,0,448,9960,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,77:2:0	0,18,163:6:0
+X	1754	.	C	<*>	0	.	DP=23;I16=11,11,0,0,830,31628,0,0,1320,79200,0,0,431,9699,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,3,42:1:0	0,18,163:6:0
+X	1755	.	C	<*>	0	.	DP=23;I16=12,11,0,0,856,33082,0,0,1380,82800,0,0,446,9972,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,61:2:0	0,18,165:6:0
+X	1756	.	T	<*>	0	.	DP=22;I16=11,11,0,0,858,33720,0,0,1320,79200,0,0,445,9961,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,77:2:0	0,18,179:6:0
+X	1757	.	C	<*>	0	.	DP=22;I16=11,11,0,0,869,34651,0,0,1320,79200,0,0,444,9972,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,78:2:0	0,18,176:6:0
+X	1758	.	A	<*>	0	.	DP=22;I16=11,11,0,0,865,34205,0,0,1320,79200,0,0,442,9954,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,81:2:0	0,18,177:6:0
+X	1759	.	G	<*>	0	.	DP=22;I16=11,11,0,0,833,31965,0,0,1320,79200,0,0,439,9905,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,77:2:0	0,18,159:6:0
+X	1760	.	C	<*>	0	.	DP=22;I16=11,11,0,0,849,33441,0,0,1320,79200,0,0,436,9874,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,79:2:0	0,18,159:6:0
+X	1761	.	A	<*>	0	.	DP=22;I16=11,11,0,0,730,25766,0,0,1320,79200,0,0,432,9810,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,75:2:0	0,18,153:6:0
+X	1762	.	C	<*>	0	.	DP=21;I16=11,10,0,0,767,28667,0,0,1260,75600,0,0,429,9761,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,76:2:0	0,18,160:6:0
+X	1763	.	C	<*>	0	.	DP=21;I16=11,10,0,0,789,30115,0,0,1260,75600,0,0,426,9726,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,72:2:0	0,18,162:6:0
+X	1764	.	C	<*>	0	.	DP=21;I16=11,10,0,0,821,32443,0,0,1260,75600,0,0,423,9705,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,72:2:0	0,18,167:6:0
+X	1765	.	T	<*>	0	.	DP=21;I16=11,10,0,0,814,31746,0,0,1260,75600,0,0,420,9698,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,83:2:0	0,18,179:6:0
+X	1766	.	C	<*>	0	.	DP=21;I16=11,10,0,0,796,30564,0,0,1260,75600,0,0,417,9705,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,71:2:0	0,18,162:6:0
+X	1767	.	C	<*>	0	.	DP=21;I16=11,10,0,0,779,29559,0,0,1260,75600,0,0,414,9726,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,73:2:0	0,18,163:6:0
+X	1768	.	C	<*>	0	.	DP=21;I16=11,10,0,0,798,30670,0,0,1260,75600,0,0,411,9761,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,68:2:0	0,18,160:6:0
+X	1769	.	T	<*>	0	.	DP=21;I16=11,10,0,0,819,32179,0,0,1260,75600,0,0,406,9712,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,77:2:0	0,18,184:6:0
+X	1770	.	G	<*>	0	.	DP=19;I16=11,8,0,0,699,26453,0,0,1140,68400,0,0,403,9679,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,68:2:0	0,18,158:6:0
+X	1771	.	A	<*>	0	.	DP=18;I16=10,8,0,0,707,27853,0,0,1080,64800,0,0,401,9659,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,42:1:0	0,18,177:6:0
+X	1772	.	G	<*>	0	.	DP=18;I16=10,8,0,0,669,25513,0,0,1080,64800,0,0,398,9600,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,38:1:0	0,18,159:6:0
+X	1773	.	C	<*>	0	.	DP=17;I16=10,7,0,0,675,26897,0,0,1020,61200,0,0,396,9550,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,3,39:1:0	0,18,172:6:0
+X	1774	.	A	<*>	0	.	DP=17;I16=10,7,0,0,653,25153,0,0,1020,61200,0,0,394,9508,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,3,39:1:0	0,18,172:6:0
+X	1775	.	T	<*>	0	.	DP=17;I16=10,7,0,0,605,22253,0,0,1020,61200,0,0,391,9423,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,3,38:1:0	0,18,156:6:0
+X	1776	.	A	<*>	0	.	DP=17;I16=10,7,0,0,610,22124,0,0,1020,61200,0,0,388,9344,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,254:10:0	0,3,35:1:0	0,18,166:6:0
+X	1777	.	C	<*>	0	.	DP=18;I16=11,7,0,0,661,24975,0,0,1080,64800,0,0,385,9271,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,35:1:0	0,18,158:6:0
+X	1778	.	C	<*>	0	.	DP=18;I16=11,7,0,0,680,25970,0,0,1080,64800,0,0,383,9205,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,31:1:0	0,18,172:6:0
+X	1779	.	C	<*>	0	.	DP=18;I16=11,7,0,0,703,27663,0,0,1080,64800,0,0,381,9147,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,34:1:0	0,18,174:6:0
+X	1780	.	T	<*>	0	.	DP=18;I16=11,7,0,0,672,26000,0,0,1080,64800,0,0,378,9048,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,33:1:0	0,18,177:6:0
+X	1781	.	A	<*>	0	.	DP=19;I16=10,6,0,0,579,21377,0,0,960,57600,0,0,328,7804,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,0,0:0:0	0,15,160:5:0
+X	1782	.	C	<*>	0	.	DP=20;I16=11,9,0,0,715,26603,0,0,1200,72000,0,0,382,8892,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,47:2:0	0,18,156:6:0
+X	1783	.	T	<*>	0	.	DP=20;I16=11,9,0,0,755,29057,0,0,1200,72000,0,0,381,8743,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,68:2:0	0,18,184:6:0
+X	1784	.	C	<*>	0	.	DP=20;I16=10,9,0,0,723,28017,0,0,1140,68400,0,0,360,8212,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,62:2:0	0,15,151:5:0
+X	1785	.	T	<*>	0	.	DP=20;I16=10,10,0,0,766,29878,0,0,1200,72000,0,0,359,8089,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,66:2:0	0,15,168:5:0
+X	1786	.	G	<*>	0	.	DP=22;I16=11,11,0,0,841,32323,0,0,1320,79200,0,0,359,7985,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,68:2:0	0,15,158:5:0
+X	1787	.	G	<*>	0	.	DP=22;I16=11,11,0,0,806,30294,0,0,1320,79200,0,0,361,7903,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,68:2:0	0,15,148:5:0
+X	1788	.	C	<*>	0	.	DP=22;I16=11,11,0,0,858,33674,0,0,1320,79200,0,0,362,7796,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,67:2:0	0,15,158:5:0
+X	1789	.	A	<*>	0	.	DP=23;I16=11,12,0,0,797,28705,0,0,1380,82800,0,0,363,7715,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,69:2:0	0,15,157:5:0
+X	1790	.	C	<*>	0	.	DP=23;I16=11,12,0,0,852,31816,0,0,1380,82800,0,0,365,7661,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,63:2:0	0,15,153:5:0
+X	1791	.	A	<*>	0	.	DP=23;I16=11,12,0,0,830,30484,0,0,1380,82800,0,0,367,7635,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,61:2:0	0,15,155:5:0
+X	1792	.	A	<*>	0	.	DP=23;I16=11,12,0,0,862,32760,0,0,1380,82800,0,0,368,7588,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,67:2:0	0,15,161:5:0
+X	1793	.	G	<*>	0	.	DP=23;I16=11,12,0,0,813,29603,0,0,1380,82800,0,0,369,7571,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,61:2:0	0,15,126:5:0
+X	1794	.	C	<*>	0	.	DP=21;I16=9,12,0,0,736,26472,0,0,1260,75600,0,0,370,7484,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,48:2:0	0,9,96:3:0
+X	1795	.	C	<*>	0	.	DP=21;I16=9,12,0,0,763,28807,0,0,1260,75600,0,0,371,7427,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,45:2:0	0,9,100:3:0
+X	1796	.	C	<*>	0	.	DP=21;I16=9,12,0,0,782,29718,0,0,1260,75600,0,0,372,7400,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,52:2:0	0,9,102:3:0
+X	1797	.	A	<*>	0	.	DP=21;I16=9,12,0,0,704,25190,0,0,1260,75600,0,0,373,7403,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,59:2:0	0,9,92:3:0
+X	1798	.	C	<*>	0	.	DP=21;I16=9,12,0,0,759,28119,0,0,1260,75600,0,0,374,7436,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,49:2:0	0,9,99:3:0
+X	1799	.	C	<*>	0	.	DP=22;I16=9,13,0,0,796,29520,0,0,1320,79200,0,0,375,7499,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,56:2:0	0,12,131:4:0
+X	1800	.	C	<*>	0	.	DP=22;I16=9,13,0,0,866,34352,0,0,1320,79200,0,0,376,7542,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,63:2:0	0,12,138:4:0
+X	1801	.	T	<*>	0	.	DP=22;I16=9,13,0,0,838,32282,0,0,1320,79200,0,0,377,7615,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,63:2:0	0,12,150:4:0
+X	1802	.	G	<*>	0	.	DP=22;I16=9,13,0,0,844,32894,0,0,1320,79200,0,0,378,7718,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,60:2:0	0,12,137:4:0
+X	1803	.	C	<*>	0	.	DP=22;I16=9,13,0,0,837,32691,0,0,1320,79200,0,0,377,7751,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,60:2:0	0,12,143:4:0
+X	1804	.	A	<*>	0	.	DP=23;I16=9,14,0,0,793,28517,0,0,1380,82800,0,0,376,7814,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,54:2:0	0,12,144:4:0
+X	1805	.	A	<*>	0	.	DP=23;I16=9,14,0,0,810,29148,0,0,1380,82800,0,0,376,7908,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,67:2:0	0,12,138:4:0
+X	1806	.	A	<*>	0	.	DP=23;I16=9,14,0,0,816,29932,0,0,1380,82800,0,0,376,8034,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,61:2:0	0,12,139:4:0
+X	1807	.	G	<*>	0	.	DP=22;I16=9,13,0,0,837,32299,0,0,1320,79200,0,0,375,8091,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,67:2:0	0,12,142:4:0
+X	1808	.	C	<*>	0	.	DP=21;I16=9,11,0,0,705,25519,0,0,1200,72000,0,0,354,7716,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,53:2:0	0,12,140:4:0
+X	1809	.	C	<*>	0	.	DP=22;I16=10,12,0,0,789,29123,0,0,1320,79200,0,0,371,8091,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,55:2:0	0,12,143:4:0
+X	1810	.	C	<*>	0	.	DP=21;I16=10,11,0,0,754,27902,0,0,1260,75600,0,0,370,8084,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,51:2:0	0,12,145:4:0
+X	1811	.	C	<*>	0	.	DP=22;I16=11,11,0,0,837,32353,0,0,1320,79200,0,0,368,8056,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,61:2:0	0,12,146:4:0
+X	1812	.	T	<*>	0	.	DP=22;I16=11,11,0,0,830,31782,0,0,1320,79200,0,0,365,7955,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,60:2:0	0,12,151:4:0
+X	1813	.	G	<*>	0	.	DP=21;I16=11,10,0,0,789,29971,0,0,1260,75600,0,0,363,7879,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,63:2:0	0,12,135:4:0
+X	1814	.	A	<*>	0	.	DP=21;I16=11,10,0,0,780,29356,0,0,1260,75600,0,0,361,7827,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,63:2:0	0,12,148:4:0
+X	1815	.	G	<*>	0	.	DP=21;I16=11,10,0,0,742,27064,0,0,1260,75600,0,0,358,7748,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,56:2:0	0,12,135:4:0
+X	1816	.	G	<*>	0	.	DP=21;I16=11,10,0,0,702,24670,0,0,1260,75600,0,0,355,7691,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,49:2:0	0,12,124:4:0
+X	1817	.	C	<*>	0	.	DP=20;I16=11,9,0,0,701,25263,0,0,1200,72000,0,0,353,7655,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,58:2:0	0,12,134:4:0
+X	1818	.	C	<*>	0	.	DP=20;I16=11,8,0,0,665,23987,0,0,1140,68400,0,0,326,7014,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,53:2:0	0,12,132:4:0
+X	1819	.	C	<*>	0	.	DP=18;I16=9,9,0,0,580,20092,0,0,1080,64800,0,0,351,7641,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,38:2:0	0,12,124:4:0
+X	1820	.	G	<*>	0	.	DP=18;I16=9,9,0,0,589,19883,0,0,1080,64800,0,0,351,7659,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,58:2:0	0,12,117:4:0
+X	1821	.	C	<*>	0	.	DP=18;I16=9,9,0,0,619,22131,0,0,1080,64800,0,0,351,7693,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,60:2:0	0,12,131:4:0
+X	1822	.	C	<*>	0	.	DP=18;I16=9,9,0,0,655,24177,0,0,1080,64800,0,0,350,7694,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,58:2:0	0,12,131:4:0
+X	1823	.	C	<*>	0	.	DP=19;I16=10,9,0,0,703,26765,0,0,1140,68400,0,0,349,7713,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,62:2:0	0,12,138:4:0
+X	1824	.	T	<*>	0	.	DP=19;I16=10,9,0,0,714,27628,0,0,1140,68400,0,0,349,7751,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,69:2:0	0,12,149:4:0
+X	1825	.	G	<*>	0	.	DP=19;I16=10,9,0,0,682,24804,0,0,1140,68400,0,0,347,7709,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,61:2:0	0,12,129:4:0
+X	1826	.	T	<*>	0	.	DP=19;I16=10,9,0,0,643,22525,0,0,1140,68400,0,0,345,7687,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,62:2:0	0,12,141:4:0
+X	1827	.	G	<*>	0	.	DP=19;I16=10,9,0,0,722,27844,0,0,1140,68400,0,0,343,7685,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,66:2:0	0,12,134:4:0
+X	1828	.	G	<*>	0	.	DP=18;I16=10,8,0,0,619,21719,0,0,1080,64800,0,0,342,7702,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,61:2:0	0,9,100:3:0
+X	1829	.	C	<*>	0	.	DP=19;I16=9,9,0,0,576,19228,0,0,1080,64800,0,0,323,7413,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,59:3:0	0,9,103:3:0
+X	1830	.	G	<*>	0	.	DP=19;I16=9,9,0,0,582,19586,0,0,1080,64800,0,0,321,7379,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,82:3:0	0,9,80:3:0
+X	1831	.	T	<*>	0	.	DP=20;I16=10,8,0,0,605,21015,0,0,1080,64800,0,0,294,6736,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,106:4:0	0,9,101:3:0
+X	1832	.	C	<*>	0	.	DP=19;I16=9,9,0,0,675,25747,0,0,1080,64800,0,0,319,7359,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,110:4:0	0,9,105:3:0
+X	1833	.	T	<*>	0	.	DP=18;I16=8,8,0,0,565,20733,0,0,960,57600,0,0,295,6747,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,248:10:0	0,9,105:3:0	0,9,106:3:0
+X	1834	.	C	<*>	0	.	DP=19;I16=9,9,0,0,654,24424,0,0,1037,61489,0,0,321,7399,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,104:4:0	0,9,107:3:0
+X	1835	.	T	<*>	0	.	DP=18;I16=9,9,0,0,641,23505,0,0,1037,61489,0,0,347,7965,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,123:4:0	0,9,115:3:0
+X	1836	.	C	<*>	0	.	DP=18;I16=9,9,0,0,657,24427,0,0,1037,61489,0,0,350,8016,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,127:4:0	0,9,108:3:0
+X	1837	.	C	<*>	0	.	DP=18;I16=9,9,0,0,586,20044,0,0,1037,61489,0,0,352,8030,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,233:11:0	0,12,114:4:0	0,9,108:3:0
+X	1838	.	C	<*>	0	.	DP=18;I16=9,9,0,0,655,24607,0,0,1037,61489,0,0,354,8056,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,120:4:0	0,9,107:3:0
+X	1839	.	T	<*>	0	.	DP=18;I16=9,7,0,0,557,20543,0,0,917,54289,0,0,321,7369,0,0;QS=3,0;MQSB=0.933674;MQ0F=0	PL:DP:DV	0,30,231:10:0	0,9,103:3:0	0,9,119:3:0
+X	1840	.	C	<*>	0	.	DP=18;I16=9,9,0,0,637,23295,0,0,1037,61489,0,0,358,8144,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,116:4:0	0,9,109:3:0
+X	1841	.	C	<*>	0	.	DP=18;I16=9,9,0,0,622,22458,0,0,1037,61489,0,0,360,8206,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,252:11:0	0,12,121:4:0	0,9,108:3:0
+X	1842	.	C	<*>	0	.	DP=18;I16=9,9,0,0,672,26064,0,0,1037,61489,0,0,362,8280,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,124:4:0	0,9,108:3:0
+X	1843	.	T	<*>	0	.	DP=18;I16=9,9,0,0,630,22746,0,0,1037,61489,0,0,364,8366,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,243:11:0	0,12,131:4:0	0,9,107:3:0
+X	1844	.	T	<*>	0	.	DP=18;I16=9,9,0,0,618,21618,0,0,1037,61489,0,0,366,8464,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,240:11:0	0,12,137:4:0	0,9,98:3:0
+X	1845	.	G	<*>	0	.	DP=18;I16=9,9,0,0,644,23976,0,0,1037,61489,0,0,368,8574,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,138:4:0	0,9,82:3:0
+X	1846	.	C	<*>	0	.	DP=18;I16=9,9,0,0,687,26809,0,0,1037,61489,0,0,370,8696,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,129:4:0	0,9,100:3:0
+X	1847	.	T	<*>	0	.	DP=18;I16=9,9,0,0,675,25529,0,0,1037,61489,0,0,373,8829,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,132:4:0	0,6,76:2:0
+X	1848	.	G	<*>	0	.	DP=18;I16=9,9,0,0,597,20845,0,0,1037,61489,0,0,377,8973,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,118:4:0	0,6,64:2:0
+X	1849	.	T	<*>	0	.	DP=20;I16=9,10,0,0,614,20770,0,0,1097,65089,0,0,380,9078,0,0;QS=3,0;MQSB=0.920044;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,119:4:0	0,6,71:2:0
+X	1850	.	C	<*>	0	.	DP=19;I16=8,11,0,0,684,25154,0,0,1097,65089,0,0,409,9769,0,0;QS=3,0;MQSB=0.902014;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,120:4:0	0,3,37:1:0
+X	1851	.	A	<*>	0	.	DP=20;I16=9,11,0,0,738,27838,0,0,1157,68689,0,0,413,9847,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,143:4:0	0,3,41:1:0
+X	1852	.	G	<*>	0	.	DP=19;I16=8,11,0,0,639,22239,0,0,1097,65089,0,0,392,9264,0,0;QS=3,0;MQSB=0.902014;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,117:4:0	0,3,36:1:0
+X	1853	.	G	<*>	0	.	DP=20;I16=9,11,0,0,627,20873,0,0,1157,68689,0,0,396,9322,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,127:5:0	0,3,38:1:0
+X	1854	.	A	<*>	0	.	DP=22;I16=10,11,0,0,674,22428,0,0,1217,72289,0,0,401,9397,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,145:5:0	0,3,38:1:0
+X	1855	.	C	<*>	0	.	DP=22;I16=10,12,0,0,771,27949,0,0,1277,75889,0,0,407,9441,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,132:5:0	0,3,37:1:0
+X	1856	.	A	<*>	0	.	DP=22;I16=10,12,0,0,806,30230,0,0,1277,75889,0,0,412,9456,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,146:5:0	0,3,41:1:0
+X	1857	.	G	<*>	0	.	DP=22;I16=10,12,0,0,699,23919,0,0,1277,75889,0,0,416,9442,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,134:5:0	0,3,35:1:0
+X	1858	.	T	<*>	0	.	DP=23;I16=10,13,0,0,773,26797,0,0,1337,79489,0,0,419,9399,0,0;QS=3,0;MQSB=0.921963;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,148:5:0	0,3,37:1:0
+X	1859	.	G	<*>	0	.	DP=23;I16=10,13,0,0,798,28594,0,0,1337,79489,0,0,423,9379,0,0;QS=3,0;MQSB=0.921963;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,146:5:0	0,3,36:1:0
+X	1860	.	G	<*>	0	.	DP=23;I16=10,13,0,0,726,23842,0,0,1337,79489,0,0,425,9283,0,0;QS=3,0;MQSB=0.921963;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,126:5:0	0,3,33:1:0
+X	1861	.	T	<*>	0	.	DP=23;I16=10,13,0,0,741,24793,0,0,1337,79489,0,0,425,9113,0,0;QS=3,0;MQSB=0.921963;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,143:5:0	0,3,39:1:0
+X	1862	.	C	<*>	0	.	DP=23;I16=10,12,0,0,738,25732,0,0,1277,75889,0,0,403,8487,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,135:5:0	0,3,34:1:0
+X	1863	.	C	<*>	0	.	DP=24;I16=10,13,0,0,804,29186,0,0,1337,79489,0,0,400,8232,0,0;QS=3,0;MQSB=0.921963;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,133:5:0	0,3,36:1:0
+X	1864	.	T	<*>	0	.	DP=24;I16=11,11,0,0,766,27572,0,0,1277,75889,0,0,392,8174,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,125:4:0	0,3,37:1:0
+X	1865	.	G	<*>	0	.	DP=24;I16=11,13,0,0,860,31394,0,0,1397,83089,0,0,425,8621,0,0;QS=3,0;MQSB=0.931547;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,154:5:0	0,3,38:1:0
+X	1866	.	G	<*>	0	.	DP=24;I16=11,13,0,0,795,27503,0,0,1397,83089,0,0,425,8551,0,0;QS=3,0;MQSB=0.931547;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,152:5:0	0,3,36:1:0
+X	1867	.	C	<*>	0	.	DP=24;I16=9,13,0,0,726,24886,0,0,1320,79200,0,0,375,7263,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,122:5:0	0,3,38:1:0
+X	1868	.	C	<*>	0	.	DP=24;I16=11,12,0,0,857,32293,0,0,1337,79489,0,0,411,8311,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,12,118:4:0	0,3,41:1:0
+X	1869	.	A	T,<*>	0	.	DP=24;I16=6,9,5,4,531,19001,268,8660,857,50689,540,32400,273,5667,152,2866;QS=1.4724,1.5276,0;VDB=0.928022;SGB=-11.9537;RPB=0.984127;MQB=0.96464;MQSB=0.931547;BQB=0.359155;MQ0F=0	PL:DP:DV	115,0,224,148,245,255:18:7	16,0,104,28,107,128:5:1	42,3,0,42,3,42:1:1
+X	1870	.	C	<*>	0	.	DP=25;I16=11,13,0,0,804,27826,0,0,1397,83089,0,0,425,8591,0,0;QS=3,0;MQSB=0.931547;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,127:5:0	0,3,36:1:0
+X	1871	.	C	<*>	0	.	DP=25;I16=11,14,0,0,761,24187,0,0,1457,86689,0,0,428,8690,0,0;QS=3,0;MQSB=0.929204;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,128:6:0	0,3,29:1:0
+X	1872	.	G	<*>	0	.	DP=25;I16=10,14,0,0,763,25437,0,0,1397,83089,0,0,425,8803,0,0;QS=3,0;MQSB=0.919431;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,132:6:0	0,3,43:1:0
+X	1873	.	G	<*>	0	.	DP=26;I16=11,15,0,0,790,25548,0,0,1517,90289,0,0,429,8931,0,0;QS=3,0;MQSB=0.927041;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,151:7:0	0,3,43:1:0
+X	1874	.	G	<*>	0	.	DP=27;I16=11,16,0,0,861,29013,0,0,1577,93889,0,0,430,9076,0,0;QS=3,0;MQSB=0.925036;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,24,172:8:0	0,3,43:1:0
+X	1875	.	G	<*>	0	.	DP=26;I16=11,15,0,0,800,26216,0,0,1517,90289,0,0,431,9155,0,0;QS=3,0;MQSB=0.927041;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,168:7:0	0,3,42:1:0
+X	1876	.	C	<*>	0	.	DP=26;I16=10,15,0,0,894,32714,0,0,1457,86689,0,0,432,9268,0,0;QS=3,0;MQSB=0.9171;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,171:7:0	0,3,41:1:0
+X	1877	.	T	<*>	0	.	DP=25;I16=9,15,0,0,848,30804,0,0,1397,83089,0,0,409,8787,0,0;QS=3,0;MQSB=0.904837;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,163:6:0	0,3,42:1:0
+X	1878	.	C	<*>	0	.	DP=25;I16=10,15,0,0,906,33478,0,0,1457,86689,0,0,434,9488,0,0;QS=3,0;MQSB=0.9171;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,166:7:0	0,3,40:1:0
+X	1879	.	A	<*>	0	.	DP=26;I16=10,16,0,0,911,32761,0,0,1517,90289,0,0,433,9543,0,0;QS=3,0;MQSB=0.914947;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,191:8:0	0,3,40:1:0
+X	1880	.	C	<*>	0	.	DP=26;I16=10,16,0,0,790,24876,0,0,1517,90289,0,0,431,9527,0,0;QS=3,0;MQSB=0.914947;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,152:8:0	0,3,31:1:0
+X	1881	.	G	<*>	0	.	DP=27;I16=10,15,0,0,782,25352,0,0,1500,90000,0,0,380,8288,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,144:7:0	0,3,42:1:0
+X	1882	.	G	<*>	0	.	DP=28;I16=12,15,0,0,937,33215,0,0,1577,93889,0,0,406,8952,0,0;QS=3,0;MQSB=0.935229;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,164:7:0	0,3,42:1:0
+X	1883	.	A	<*>	0	.	DP=29;I16=14,15,0,0,998,35394,0,0,1697,101089,0,0,434,9646,0,0;QS=3,0;MQSB=0.947838;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,24,180:8:0	0,3,43:1:0
+X	1884	.	G	<*>	0	.	DP=29;I16=14,15,0,0,1036,37926,0,0,1697,101089,0,0,437,9647,0,0;QS=3,0;MQSB=0.947838;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,24,202:8:0	0,3,42:1:0
+X	1885	.	C	<*>	0	.	DP=28;I16=14,13,0,0,925,32305,0,0,1577,93889,0,0,430,9560,0,0;QS=3,0;MQSB=0.951472;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,182:7:0	0,3,42:1:0
+X	1886	.	C	<*>	0	.	DP=26;I16=13,13,0,0,826,27194,0,0,1517,90289,0,0,447,9745,0,0;QS=3,0;MQSB=0.945959;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,166:8:0	0,3,32:1:0
+X	1887	.	G	<*>	0	.	DP=26;I16=12,13,0,0,798,26554,0,0,1500,90000,0,0,428,9212,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,185:8:0	0,3,40:1:0
+X	1888	.	C	<*>	0	.	DP=26;I16=13,13,0,0,901,32343,0,0,1517,90289,0,0,459,9957,0,0;QS=3,0;MQSB=0.945959;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,178:8:0	0,3,39:1:0
+X	1889	.	C	<*>	0	.	DP=25;I16=13,11,0,0,825,29127,0,0,1397,83089,0,0,444,9612,0,0;QS=3,0;MQSB=0.950498;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,187:7:0	0,3,37:1:0
+X	1890	.	C	<*>	0	.	DP=25;I16=13,12,0,0,913,34029,0,0,1457,86689,0,0,471,10173,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,198:8:0	0,3,40:1:0
+X	1891	.	T	<*>	0	.	DP=25;I16=13,12,0,0,912,34028,0,0,1457,86689,0,0,477,10317,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,212:8:0	0,3,39:1:0
+X	1892	.	G	<*>	0	.	DP=25;I16=12,12,0,0,885,33149,0,0,1397,83089,0,0,458,9860,0,0;QS=3,0;MQSB=0.941765;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,166:7:0	0,3,37:1:0
+X	1893	.	T	<*>	0	.	DP=26;I16=14,12,0,0,920,33494,0,0,1517,90289,0,0,489,10677,0,0;QS=3,0;MQSB=0.953497;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,205:8:0	0,6,72:2:0
+X	1894	.	G	<*>	0	.	DP=26;I16=14,12,0,0,934,35048,0,0,1517,90289,0,0,495,10843,0,0;QS=3,0;MQSB=0.953497;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,188:8:0	0,6,75:2:0
+X	1895	.	C	<*>	0	.	DP=26;I16=13,12,0,0,882,31980,0,0,1500,90000,0,0,476,10408,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,180:8:0	0,6,73:2:0
+X	1896	.	C	<*>	0	.	DP=26;I16=14,11,0,0,827,28179,0,0,1457,86689,0,0,482,10622,0,0;QS=3,0;MQSB=0.955682;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,154:7:0	0,6,72:2:0
+X	1897	.	G	<*>	0	.	DP=26;I16=13,11,0,0,763,25169,0,0,1397,83089,0,0,486,10856,0,0;QS=3,0;MQSB=0.950498;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,164:7:0	0,3,27:1:0
+X	1898	.	T	<*>	0	.	DP=27;I16=14,11,0,0,846,29526,0,0,1500,90000,0,0,492,11072,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,187:8:0	0,6,62:2:0
+X	1899	.	G	<*>	0	.	DP=27;I16=14,11,0,0,875,32007,0,0,1500,90000,0,0,497,11213,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,188:8:0	0,6,61:2:0
+X	1900	.	T	<*>	0	.	DP=26;I16=14,11,0,0,850,29882,0,0,1500,90000,0,0,501,11329,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,185:8:0	0,6,69:2:0
+X	1901	.	A	<*>	0	.	DP=27;I16=15,10,0,0,842,29298,0,0,1457,86689,0,0,505,11469,0,0;QS=3,0;MQSB=0.962269;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,190:7:0	0,6,68:2:0
+X	1902	.	C	<*>	0	.	DP=27;I16=15,12,0,0,912,31970,0,0,1577,93889,0,0,537,12267,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,184:8:0	0,6,60:2:0
+X	1903	.	C	<*>	0	.	DP=27;I16=15,12,0,0,959,34645,0,0,1577,93889,0,0,542,12462,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,201:8:0	0,6,63:2:0
+X	1904	.	T	<*>	0	.	DP=27;I16=16,11,0,0,1017,38757,0,0,1577,93889,0,0,548,12682,0,0;QS=3,0;MQSB=0.96384;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,221:8:0	0,6,77:2:0
+X	1905	.	C	<*>	0	.	DP=27;I16=16,11,0,0,985,36561,0,0,1577,93889,0,0,553,12827,0,0;QS=3,0;MQSB=0.96384;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,211:8:0	0,6,69:2:0
+X	1906	.	T	<*>	0	.	DP=27;I16=16,11,0,0,1018,39242,0,0,1577,93889,0,0,558,12998,0,0;QS=3,0;MQSB=0.96384;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,207:8:0	0,6,75:2:0
+X	1907	.	G	<*>	0	.	DP=27;I16=15,11,0,0,935,34679,0,0,1517,90289,0,0,535,12419,0,0;QS=3,0;MQSB=0.960078;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,187:7:0	0,6,68:2:0
+X	1908	.	A	<*>	0	.	DP=28;I16=16,12,0,0,1023,38221,0,0,1637,97489,0,0,561,13063,0,0;QS=3,0;MQSB=0.96195;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,24,215:8:0	0,6,67:2:0
+X	1909	.	G	<*>	0	.	DP=27;I16=15,12,0,0,1002,38398,0,0,1577,93889,0,0,561,12953,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,206:8:0	0,6,73:2:0
+X	1910	.	C	<*>	0	.	DP=27;I16=14,10,0,0,855,31251,0,0,1440,86400,0,0,502,11588,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,179:7:0	0,6,71:2:0
+X	1911	.	C	<*>	0	.	DP=27;I16=15,12,0,0,967,35429,0,0,1577,93889,0,0,561,12793,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,206:8:0	0,6,71:2:0
+X	1912	.	C	<*>	0	.	DP=27;I16=15,12,0,0,1024,39272,0,0,1577,93889,0,0,561,12743,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,217:8:0	0,6,73:2:0
+X	1913	.	T	<*>	0	.	DP=27;I16=15,12,0,0,1028,39768,0,0,1577,93889,0,0,561,12713,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,228:8:0	0,6,77:2:0
+X	1914	.	C	<*>	0	.	DP=27;I16=15,12,0,0,1010,38762,0,0,1577,93889,0,0,561,12703,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,221:8:0	0,6,75:2:0
+X	1915	.	T	C,<*>	0	.	DP=27;I16=14,12,1,0,974,37184,16,256,1560,93600,17,289,543,12389,18,324;QS=2.97351,0.0264901,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.958048;BQB=1;MQ0F=0	PL:DP:DV	0,34,255,48,255,255:17:1	0,24,231,24,231,231:8:0	0,6,60,6,60,60:2:0
+X	1916	.	G	T,<*>	0	.	DP=27;I16=14,12,1,0,991,38291,15,225,1560,93600,17,289,544,12454,17,289;QS=2.97581,0.0241935,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.958048;BQB=1;MQ0F=0	PL:DP:DV	0,35,255,48,255,255:17:1	0,24,226,24,226,226:8:0	0,6,69,6,69,69:2:0
+X	1917	.	C	<*>	0	.	DP=27;I16=15,12,0,0,1030,39740,0,0,1577,93889,0,0,561,12793,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,214:8:0	0,6,73:2:0
+X	1918	.	A	<*>	0	.	DP=27;I16=15,11,0,0,963,36201,0,0,1517,90289,0,0,542,12502,0,0;QS=3,0;MQSB=0.960078;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,217:8:0	0,6,72:2:0
+X	1919	.	C	<*>	0	.	DP=27;I16=15,12,0,0,987,36651,0,0,1577,93889,0,0,560,12902,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,214:8:0	0,6,72:2:0
+X	1920	.	A	T,<*>	0	.	DP=29;I16=15,12,0,1,1007,38337,14,196,1546,91130,60,3600,538,12518,21,441;QS=2.97647,0.0235294,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.999735;BQB=1;MQ0F=0	PL:DP:DV	0,36,255,48,255,255:17:1	0,24,225,24,225,225:8:0	0,9,101,9,101,101:3:0
+X	1921	.	G	<*>	0	.	DP=30;I16=15,14,0,0,1059,39815,0,0,1666,98330,0,0,542,12474,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,182:7:0	0,12,132:4:0
+X	1922	.	T	<*>	0	.	DP=29;I16=14,14,0,0,1013,37513,0,0,1649,98041,0,0,532,12418,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,197:7:0	0,12,134:4:0
+X	1923	.	G	<*>	0	.	DP=28;I16=14,14,0,0,1034,38974,0,0,1606,94730,0,0,545,12629,0,0;QS=3,0;MQSB=0.999736;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,188:7:0	0,12,126:4:0
+X	1924	.	C	<*>	0	.	DP=27;I16=13,13,0,0,965,36587,0,0,1486,87530,0,0,521,12017,0,0;QS=3,0;MQSB=0.999671;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,183:7:0	0,12,116:4:0
+X	1925	.	C	<*>	0	.	DP=27;I16=14,13,0,0,987,37021,0,0,1546,91130,0,0,546,12626,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,187:7:0	0,12,124:4:0
+X	1926	.	T	<*>	0	.	DP=27;I16=14,13,0,0,1031,40057,0,0,1546,91130,0,0,545,12581,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,197:7:0	0,12,141:4:0
+X	1927	.	T	<*>	0	.	DP=27;I16=13,13,0,0,959,35773,0,0,1529,90841,0,0,538,12522,0,0;QS=3,0;MQSB=0.945959;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,191:7:0	0,12,133:4:0
+X	1928	.	C	<*>	0	.	DP=27;I16=13,13,0,0,986,38264,0,0,1529,90841,0,0,538,12532,0,0;QS=3,0;MQSB=0.945959;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,189:7:0	0,12,125:4:0
+X	1929	.	T	<*>	0	.	DP=27;I16=13,13,0,0,990,38630,0,0,1529,90841,0,0,538,12562,0,0;QS=3,0;MQSB=0.945959;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,189:7:0	0,12,139:4:0
+X	1930	.	G	<*>	0	.	DP=26;I16=13,11,0,0,905,34865,0,0,1409,83641,0,0,521,12271,0,0;QS=3,0;MQSB=0.931547;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,179:6:0	0,9,99:3:0
+X	1931	.	C	<*>	0	.	DP=27;I16=15,12,0,0,967,36293,0,0,1546,91130,0,0,540,12578,0,0;QS=3,0;MQSB=0.99881;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,165:6:0	0,12,121:4:0
+X	1932	.	T	<*>	0	.	DP=27;I16=14,13,0,0,998,38154,0,0,1546,91130,0,0,541,12605,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,143:5:0	0,15,146:5:0
+X	1933	.	T	<*>	0	.	DP=27;I16=14,13,0,0,962,35344,0,0,1546,91130,0,0,542,12602,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,142:5:0	0,15,158:5:0
+X	1934	.	G	<*>	0	.	DP=27;I16=13,13,0,0,987,38219,0,0,1529,90841,0,0,543,12569,0,0;QS=3,0;MQSB=0.945959;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,134:5:0	0,15,143:5:0
+X	1935	.	C	<*>	0	.	DP=27;I16=14,12,0,0,963,36627,0,0,1529,90841,0,0,520,11930,0,0;QS=3,0;MQSB=0.937241;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,162:6:0	0,15,154:5:0
+X	1936	.	C	<*>	0	.	DP=27;I16=14,13,0,0,1018,39406,0,0,1589,94441,0,0,547,12561,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,177:6:0	0,15,159:5:0
+X	1937	.	T	<*>	0	.	DP=27;I16=14,13,0,0,1036,40636,0,0,1589,94441,0,0,547,12489,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,182:6:0	0,15,170:5:0
+X	1938	.	G	<*>	0	.	DP=27;I16=14,13,0,0,1001,38377,0,0,1589,94441,0,0,546,12392,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,166:6:0	0,15,155:5:0
+X	1939	.	T	<*>	0	.	DP=27;I16=14,12,0,0,964,36430,0,0,1560,93600,0,0,525,11909,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,167:6:0	0,12,144:4:0
+X	1940	.	G	<*>	0	.	DP=27;I16=14,13,0,0,1003,37937,0,0,1589,94441,0,0,542,12172,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,159:6:0	0,15,155:5:0
+X	1941	.	G	<*>	0	.	DP=27;I16=14,13,0,0,1004,38072,0,0,1589,94441,0,0,540,12098,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,176:6:0	0,15,156:5:0
+X	1942	.	C	<*>	0	.	DP=27;I16=14,12,0,0,996,38790,0,0,1560,93600,0,0,516,11564,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,174:6:0	0,12,140:4:0
+X	1943	.	T	<*>	0	.	DP=27;I16=14,13,0,0,1044,40952,0,0,1589,94441,0,0,536,12022,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,184:6:0	0,15,167:5:0
+X	1944	.	T	<*>	0	.	DP=27;I16=14,13,0,0,987,37237,0,0,1589,94441,0,0,533,11971,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,175:6:0	0,15,170:5:0
+X	1945	.	T	<*>	0	.	DP=27;I16=14,13,0,0,993,37067,0,0,1589,94441,0,0,530,11946,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,174:6:0	0,15,171:5:0
+X	1946	.	G	<*>	0	.	DP=27;I16=14,13,0,0,1013,38617,0,0,1589,94441,0,0,526,11896,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,162:6:0	0,15,162:5:0
+X	1947	.	A	<*>	0	.	DP=26;I16=13,13,0,0,950,35522,0,0,1529,90841,0,0,522,11818,0,0;QS=3,0;MQSB=0.945959;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,167:6:0	0,15,160:5:0
+X	1948	.	G	C,<*>	0	.	DP=27;I16=14,12,0,1,966,36912,16,256,1560,93600,29,841,493,11135,25,625;QS=2.90361,0.0963855,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.94394;BQB=1;MQ0F=0	PL:DP:DV	0,45,255,45,255,255:15:0	0,21,190,21,190,190:7:0	1,0,123,13,126,132:5:1
+X	1949	.	A	<*>	0	.	DP=26;I16=14,11,0,0,871,31325,0,0,1469,87241,0,0,490,11048,0,0;QS=3,0;MQSB=0.929204;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,174:7:0	0,15,155:5:0
+X	1950	.	A	<*>	0	.	DP=27;I16=14,13,0,0,1007,38049,0,0,1589,94441,0,0,511,11559,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,21,205:7:0	0,18,176:6:0
+X	1951	.	G	<*>	0	.	DP=27;I16=14,13,0,0,960,35536,0,0,1589,94441,0,0,509,11469,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,21,180:7:0	0,18,181:6:0
+X	1952	.	A	<*>	0	.	DP=27;I16=14,12,0,0,924,33366,0,0,1529,90841,0,0,483,10779,0,0;QS=3,0;MQSB=0.937241;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,184:7:0	0,18,182:6:0
+X	1953	.	A	<*>	0	.	DP=28;I16=15,12,0,0,925,32719,0,0,1589,94441,0,0,482,10740,0,0;QS=3,0;MQSB=0.935229;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,21,189:7:0	0,18,168:6:0
+X	1954	.	A	C,<*>	0	.	DP=29;I16=14,13,0,1,929,33219,18,324,1620,97200,29,841,475,10679,25,625;QS=2.90217,0.0978261,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.949591;BQB=1;MQ0F=0	PL:DP:DV	0,45,255,45,255,255:15:0	0,21,198,21,198,198:7:0	0,0,130,15,133,141:6:1
+X	1955	.	C	<*>	0	.	DP=29;I16=14,12,0,0,961,36067,0,0,1560,93600,0,0,451,10035,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,21,206:7:0	0,15,165:5:0
+X	1956	.	C	<*>	0	.	DP=29;I16=14,13,0,0,964,35402,0,0,1620,97200,0,0,475,10573,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,196:7:0	0,15,164:5:0
+X	1957	.	C	<*>	0	.	DP=29;I16=14,13,0,0,980,36212,0,0,1620,97200,0,0,472,10420,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,183:7:0	0,15,167:5:0
+X	1958	.	C	<*>	0	.	DP=29;I16=15,13,0,0,1003,37293,0,0,1649,98041,0,0,493,10825,0,0;QS=3,0;MQSB=0.942064;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,191:7:0	0,18,190:6:0
+X	1959	.	T	<*>	0	.	DP=29;I16=16,13,0,0,1112,43258,0,0,1709,101641,0,0,491,10593,0,0;QS=3,0;MQSB=0.940317;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,213:7:0	0,18,193:6:0
+X	1960	.	T	<*>	0	.	DP=30;I16=17,13,0,0,1053,37939,0,0,1769,105241,0,0,485,10339,0,0;QS=3,0;MQSB=0.938685;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,196:7:0	0,18,186:6:0
+X	1961	.	C	<*>	0	.	DP=30;I16=17,13,0,0,1101,41737,0,0,1769,105241,0,0,480,10122,0,0;QS=3,0;MQSB=0.938685;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,195:7:0	0,18,183:6:0
+X	1962	.	T	<*>	0	.	DP=29;I16=17,12,0,0,1134,44582,0,0,1709,101641,0,0,477,9941,0,0;QS=3,0;MQSB=0.931617;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,208:7:0	0,18,198:6:0
+X	1963	.	G	<*>	0	.	DP=28;I16=16,12,0,0,1066,41050,0,0,1649,98041,0,0,476,9794,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,192:7:0	0,18,188:6:0
+X	1964	.	G	<*>	0	.	DP=28;I16=16,12,0,0,970,34764,0,0,1649,98041,0,0,475,9681,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,178:7:0	0,18,169:6:0
+X	1965	.	T	<*>	0	.	DP=29;I16=16,12,0,0,964,34772,0,0,1649,98041,0,0,449,8977,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,196:7:0	0,18,171:6:0
+X	1966	.	T	<*>	0	.	DP=29;I16=16,13,0,0,1029,37027,0,0,1709,101641,0,0,474,9558,0,0;QS=3,0;MQSB=0.940317;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,191:7:0	0,18,181:6:0
+X	1967	.	A	<*>	0	.	DP=29;I16=16,13,0,0,1030,37234,0,0,1709,101641,0,0,474,9550,0,0;QS=3,0;MQSB=0.940317;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,187:7:0	0,18,182:6:0
+X	1968	.	T	<*>	0	.	DP=29;I16=16,13,0,0,1075,40173,0,0,1709,101641,0,0,474,9578,0,0;QS=3,0;MQSB=0.940317;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,195:7:0	0,18,190:6:0
+X	1969	.	A	<*>	0	.	DP=28;I16=16,12,0,0,992,35828,0,0,1649,98041,0,0,474,9592,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,175:6:0	0,18,186:6:0
+X	1970	.	C	<*>	0	.	DP=28;I16=16,12,0,0,1015,37503,0,0,1649,98041,0,0,474,9642,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,170:6:0	0,18,180:6:0
+X	1971	.	A	<*>	0	.	DP=29;I16=16,13,0,0,1073,40273,0,0,1709,101641,0,0,474,9728,0,0;QS=3,0;MQSB=0.940317;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,178:6:0	0,21,206:7:0
+X	1972	.	T	<*>	0	.	DP=30;I16=16,14,0,0,1068,38978,0,0,1769,105241,0,0,475,9851,0,0;QS=3,0;MQSB=0.946202;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,176:6:0	0,21,203:7:0
+X	1973	.	A	<*>	0	.	DP=30;I16=16,13,0,0,1046,38070,0,0,1740,104400,0,0,452,9388,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,172:6:0	0,18,196:6:0
+X	1974	.	A	<*>	0	.	DP=29;I16=16,13,0,0,1086,41474,0,0,1709,101641,0,0,477,10065,0,0;QS=3,0;MQSB=0.940317;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,157:5:0	0,21,214:7:0
+X	1975	.	G	<*>	0	.	DP=28;I16=16,12,0,0,1067,41171,0,0,1649,98041,0,0,478,10156,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,133:4:0	0,21,195:7:0
+X	1976	.	A	<*>	0	.	DP=28;I16=16,12,0,0,981,34839,0,0,1649,98041,0,0,478,10234,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,125:4:0	0,21,199:7:0
+X	1977	.	C	<*>	0	.	DP=28;I16=16,12,0,0,1009,37471,0,0,1649,98041,0,0,477,10297,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,132:4:0	0,21,194:7:0
+X	1978	.	A	<*>	0	.	DP=28;I16=16,12,0,0,1082,42132,0,0,1649,98041,0,0,476,10394,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,144:4:0	0,21,220:7:0
+X	1979	.	G	<*>	0	.	DP=28;I16=16,11,0,0,1019,38927,0,0,1589,94441,0,0,454,10064,0,0;QS=3,0;MQSB=0.925036;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,122:4:0	0,21,208:7:0
+X	1980	.	C	<*>	0	.	DP=27;I16=16,10,0,0,932,34456,0,0,1529,90841,0,0,452,10114,0,0;QS=3,0;MQSB=0.914947;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,107:3:0	0,21,197:7:0
+X	1981	.	C	<*>	0	.	DP=28;I16=16,12,0,0,998,36510,0,0,1649,98041,0,0,469,10479,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,9,101:3:0	0,24,219:8:0
+X	1982	.	A	<*>	0	.	DP=29;I16=16,12,0,0,1035,38815,0,0,1649,98041,0,0,472,10548,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,110:3:0	0,27,254:9:0
+X	1983	.	G	<*>	0	.	DP=28;I16=16,12,0,0,1048,40322,0,0,1649,98041,0,0,477,10599,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,96:3:0	0,27,249:9:0
+X	1984	.	A	<*>	0	.	DP=27;I16=16,11,0,0,1024,39232,0,0,1589,94441,0,0,482,10632,0,0;QS=3,0;MQSB=0.925036;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,70:2:0	0,27,255:9:0
+X	1985	.	G	<*>	0	.	DP=27;I16=16,11,0,0,1009,38449,0,0,1589,94441,0,0,487,10695,0,0;QS=3,0;MQSB=0.925036;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,66:2:0	0,27,231:9:0
+X	1986	.	A	<*>	0	.	DP=27;I16=16,10,0,0,926,33696,0,0,1560,93600,0,0,466,10112,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,76:2:0	0,24,223:8:0
+X	1987	.	A	<*>	0	.	DP=28;I16=17,11,0,0,1034,39088,0,0,1649,98041,0,0,495,10807,0,0;QS=3,0;MQSB=0.923174;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,78:2:0	0,27,247:9:0
+X	1988	.	G	<*>	0	.	DP=28;I16=17,11,0,0,1050,39980,0,0,1649,98041,0,0,499,10855,0,0;QS=3,0;MQSB=0.923174;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,63:2:0	0,27,239:9:0
+X	1989	.	G	<*>	0	.	DP=28;I16=17,10,0,0,994,37610,0,0,1589,94441,0,0,493,10801,0,0;QS=3,0;MQSB=0.912952;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,73:2:0	0,27,237:9:0
+X	1990	.	G	T,<*>	0	.	DP=28;I16=17,9,0,1,965,36359,33,1089,1560,93600,29,841,472,10250,25,625;QS=2.90675,0.0932476,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.912952;BQB=1;MQ0F=0	PL:DP:DV	0,48,255,48,255,255:16:0	0,6,71,6,71,71:2:0	2,0,195,26,198,215:9:1
+X	1991	.	A	<*>	0	.	DP=28;I16=17,11,0,0,1017,38203,0,0,1649,98041,0,0,507,10975,0,0;QS=3,0;MQSB=0.923174;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,60:2:0	0,27,250:9:0
+X	1992	.	G	<*>	0	.	DP=28;I16=17,11,0,0,1028,38852,0,0,1649,98041,0,0,509,11039,0,0;QS=3,0;MQSB=0.923174;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,62:2:0	0,27,231:9:0
+X	1993	.	T	<*>	0	.	DP=28;I16=17,11,0,0,1015,37325,0,0,1649,98041,0,0,511,11131,0,0;QS=3,0;MQSB=0.923174;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,59:2:0	0,27,243:9:0
+X	1994	.	T	<*>	0	.	DP=27;I16=16,11,0,0,942,33698,0,0,1589,94441,0,0,514,11250,0,0;QS=3,0;MQSB=0.925036;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,54:2:0	0,24,216:8:0
+X	1995	.	G	<*>	0	.	DP=28;I16=16,11,0,0,960,35432,0,0,1620,97200,0,0,492,10770,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,66:2:0	0,21,188:7:0
+X	1996	.	C	<*>	0	.	DP=29;I16=17,12,0,0,1022,37426,0,0,1709,101641,0,0,519,11469,0,0;QS=3,0;MQSB=0.931617;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,64:2:0	0,24,192:8:0
+X	1997	.	C	<*>	0	.	DP=29;I16=17,11,0,0,934,32858,0,0,1649,98041,0,0,520,11524,0,0;QS=3,0;MQSB=0.923174;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,70:2:0	0,24,193:8:0
+X	1998	.	C	<*>	0	.	DP=29;I16=17,12,0,0,1027,37843,0,0,1709,101641,0,0,522,11562,0,0;QS=3,0;MQSB=0.931617;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,69:2:0	0,24,222:8:0
+X	1999	.	A	<*>	0	.	DP=28;I16=17,11,0,0,1073,41493,0,0,1649,98041,0,0,525,11627,0,0;QS=3,0;MQSB=0.923174;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,72:2:0	0,21,206:7:0
+X	2000	.	G	<*>	0	.	DP=28;I16=16,11,0,0,1036,40576,0,0,1589,94441,0,0,511,11395,0,0;QS=3,0;MQSB=0.925036;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,72:2:0	0,18,168:6:0
+X	2001	.	G	<*>	0	.	DP=28;I16=15,11,0,0,955,35661,0,0,1529,90841,0,0,489,10853,0,0;QS=3,0;MQSB=0.927041;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,62:2:0	0,18,172:6:0
+X	2002	.	G	<*>	0	.	DP=28;I16=17,10,0,0,907,32227,0,0,1620,97200,0,0,519,11663,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,53:2:0	0,18,163:6:0
+X	2003	.	T	<*>	0	.	DP=28;I16=17,11,0,0,920,31866,0,0,1649,98041,0,0,541,12163,0,0;QS=3,0;MQSB=0.923174;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,49:2:0	0,21,190:7:0
+X	2004	.	G	<*>	0	.	DP=27;I16=16,10,0,0,970,36928,0,0,1560,93600,0,0,530,12110,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,57:2:0	0,18,178:6:0
+X	2005	.	G	<*>	0	.	DP=27;I16=16,10,0,0,868,30936,0,0,1560,93600,0,0,536,12370,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,59:2:0	0,18,153:6:0
+X	2006	.	C	<*>	0	.	DP=27;I16=16,10,0,0,968,37046,0,0,1560,93600,0,0,541,12605,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,73:2:0	0,18,166:6:0
+X	2007	.	A	<*>	0	.	DP=27;I16=16,11,0,0,1000,37396,0,0,1589,94441,0,0,556,12882,0,0;QS=3,0;MQSB=0.925036;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,76:2:0	0,21,193:7:0
+X	2008	.	C	<*>	0	.	DP=26;I16=16,10,0,0,964,36892,0,0,1529,90841,0,0,555,12833,0,0;QS=3,0;MQSB=0.914947;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,73:2:0	0,21,183:7:0
+X	2009	.	A	<*>	0	.	DP=26;I16=16,10,0,0,997,38955,0,0,1529,90841,0,0,554,12802,0,0;QS=3,0;MQSB=0.914947;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,74:2:0	0,21,210:7:0
+X	2010	.	G	<*>	0	.	DP=26;I16=16,9,0,0,936,36208,0,0,1500,90000,0,0,542,12640,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,73:2:0	0,18,169:6:0
+X	2011	.	C	<*>	0	.	DP=26;I16=16,9,0,0,966,37960,0,0,1500,90000,0,0,541,12617,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,74:2:0	0,18,175:6:0
+X	2012	.	A	<*>	0	.	DP=27;I16=16,11,0,0,956,35018,0,0,1589,94441,0,0,548,12676,0,0;QS=3,0;MQSB=0.925036;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,74:2:0	0,21,189:7:0
+X	2013	.	C	<*>	0	.	DP=27;I16=15,10,0,0,876,31370,0,0,1500,90000,0,0,514,11950,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,69:2:0	0,18,160:6:0
+X	2014	.	G	<*>	0	.	DP=27;I16=17,10,0,0,903,31239,0,0,1589,94441,0,0,545,12591,0,0;QS=3,0;MQSB=0.912952;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,9,80:3:0	0,18,160:6:0
+X	2015	.	T	<*>	0	.	DP=27;I16=17,10,0,0,999,37507,0,0,1589,94441,0,0,545,12577,0,0;QS=3,0;MQSB=0.912952;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,9,95:3:0	0,18,178:6:0
+X	2016	.	T	<*>	0	.	DP=27;I16=17,10,0,0,971,35649,0,0,1589,94441,0,0,545,12583,0,0;QS=3,0;MQSB=0.912952;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,9,93:3:0	0,18,178:6:0
+X	2017	.	G	<*>	0	.	DP=28;I16=17,11,0,0,1013,37849,0,0,1649,98041,0,0,545,12609,0,0;QS=3,0;MQSB=0.923174;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,9,91:3:0	0,18,172:6:0
+X	2018	.	C	<*>	0	.	DP=28;I16=17,11,0,0,1060,41414,0,0,1649,98041,0,0,546,12656,0,0;QS=3,0;MQSB=0.923174;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,9,97:3:0	0,18,169:6:0
+X	2019	.	T	<*>	0	.	DP=28;I16=17,11,0,0,1083,42253,0,0,1649,98041,0,0,547,12725,0,0;QS=3,0;MQSB=0.923174;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,9,106:3:0	0,18,187:6:0
+X	2020	.	G	<*>	0	.	DP=29;I16=18,11,0,0,1095,42063,0,0,1678,98882,0,0,548,12816,0,0;QS=3,0;MQSB=0.987702;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,9,85:3:0	0,18,175:6:0
+X	2021	.	C	<*>	0	.	DP=29;I16=18,11,0,0,1081,41535,0,0,1709,101641,0,0,551,12877,0,0;QS=3,0;MQSB=0.969907;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,9,97:3:0	0,15,167:5:0
+X	2022	.	C	<*>	0	.	DP=30;I16=19,11,0,0,1115,42003,0,0,1769,105241,0,0,555,12907,0,0;QS=3,0;MQSB=0.972375;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,9,92:3:0	0,18,177:6:0
+X	2023	.	A	<*>	0	.	DP=30;I16=19,10,0,0,1063,39991,0,0,1709,101641,0,0,549,12837,0,0;QS=3,0;MQSB=0.974027;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,9,96:3:0	0,18,186:6:0
+X	2024	.	G	<*>	0	.	DP=32;I16=20,12,0,0,1168,43872,0,0,1889,112441,0,0,564,12982,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,9,92:3:0	0,24,203:8:0
+X	2025	.	T	<*>	0	.	DP=32;I16=20,12,0,0,1150,42122,0,0,1889,112441,0,0,569,12981,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,9,87:3:0	0,24,226:8:0
+X	2026	.	T	<*>	0	.	DP=32;I16=20,12,0,0,1130,40724,0,0,1889,112441,0,0,572,12908,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,9,94:3:0	0,24,208:8:0
+X	2027	.	A	<*>	0	.	DP=32;I16=19,12,0,0,1121,40871,0,0,1829,108841,0,0,550,12240,0,0;QS=3,0;MQSB=0.970829;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,9,84:3:0	0,21,207:7:0
+X	2028	.	C	<*>	0	.	DP=32;I16=20,12,0,0,1242,48548,0,0,1889,112441,0,0,577,12803,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,9,94:3:0	0,24,228:8:0
+X	2029	.	T	<*>	0	.	DP=32;I16=20,12,0,0,1229,47605,0,0,1889,112441,0,0,578,12724,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,9,102:3:0	0,24,236:8:0
+X	2030	.	G	<*>	0	.	DP=32;I16=20,12,0,0,1222,47140,0,0,1889,112441,0,0,579,12679,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,9,93:3:0	0,24,216:8:0
+X	2031	.	C	<*>	0	.	DP=31;I16=19,12,0,0,1150,43656,0,0,1829,108841,0,0,581,12667,0,0;QS=3,0;MQSB=0.970829;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,9,96:3:0	0,24,204:8:0
+X	2032	.	C	<*>	0	.	DP=31;I16=19,12,0,0,1157,44035,0,0,1829,108841,0,0,583,12687,0,0;QS=3,0;MQSB=0.970829;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,9,90:3:0	0,24,210:8:0
+X	2033	.	A	<*>	0	.	DP=30;I16=19,11,0,0,1091,40223,0,0,1769,105241,0,0,585,12689,0,0;QS=3,0;MQSB=0.972375;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,9,93:3:0	0,21,203:7:0
+X	2034	.	T	<*>	0	.	DP=30;I16=19,11,0,0,1104,41498,0,0,1769,105241,0,0,587,12723,0,0;QS=3,0;MQSB=0.972375;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,9,91:3:0	0,21,208:7:0
+X	2035	.	T	<*>	0	.	DP=29;I16=18,11,0,0,1084,41024,0,0,1709,101641,0,0,589,12739,0,0;QS=3,0;MQSB=0.969907;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,6,69:2:0	0,21,211:7:0
+X	2036	.	T	<*>	0	.	DP=29;I16=18,11,0,0,1080,40612,0,0,1709,101641,0,0,591,12787,0,0;QS=3,0;MQSB=0.969907;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,6,67:2:0	0,21,216:7:0
+X	2037	.	T	<*>	0	.	DP=29;I16=18,11,0,0,1082,40956,0,0,1709,101641,0,0,592,12818,0,0;QS=3,0;MQSB=0.969907;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,6,69:2:0	0,21,217:7:0
+X	2038	.	C	<*>	0	.	DP=29;I16=18,11,0,0,1117,43573,0,0,1709,101641,0,0,592,12832,0,0;QS=3,0;MQSB=0.969907;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,6,69:2:0	0,21,211:7:0
+X	2039	.	A	<*>	0	.	DP=29;I16=18,11,0,0,1067,39581,0,0,1709,101641,0,0,592,12878,0,0;QS=3,0;MQSB=0.969907;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,6,72:2:0	0,21,212:7:0
+X	2040	.	C	<*>	0	.	DP=29;I16=18,11,0,0,1077,40469,0,0,1709,101641,0,0,590,12856,0,0;QS=3,0;MQSB=0.969907;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,6,69:2:0	0,21,196:7:0
+X	2041	.	G	A,<*>	0	.	DP=31;I16=6,5,12,7,389,14023,721,28149,660,39600,1109,65641,235,5607,353,7259;QS=0.917304,2.0827,0;VDB=0.816435;SGB=-4.18892;RPB=0.88473;MQB=0.972375;MQSB=0.968257;BQB=0.311275;MQ0F=0	PL:DP:DV	229,0,212,255,245,255:21:11	32,0,24,35,27,59:2:1	223,21,0,223,21,223:7:7
+X	2042	.	G	<*>	0	.	DP=32;I16=18,14,0,0,1189,45617,0,0,1889,112441,0,0,588,12910,0,0;QS=3,0;MQSB=0.965264;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,9,86:3:0	0,21,206:7:0
+X	2043	.	G	<*>	0	.	DP=32;I16=17,14,0,0,1115,41585,0,0,1829,108841,0,0,581,12891,0,0;QS=3,0;MQSB=0.962133;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,9,90:3:0	0,21,197:7:0
+X	2044	.	C	<*>	0	.	DP=32;I16=18,14,0,0,1213,47029,0,0,1889,112441,0,0,588,13006,0,0;QS=3,0;MQSB=0.965264;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,9,85:3:0	0,21,207:7:0
+X	2045	.	A	<*>	0	.	DP=32;I16=18,14,0,0,1181,44527,0,0,1889,112441,0,0,588,13108,0,0;QS=3,0;MQSB=0.965264;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,9,83:3:0	0,21,213:7:0
+X	2046	.	T	<*>	0	.	DP=32;I16=18,14,0,0,1197,45135,0,0,1889,112441,0,0,587,13195,0,0;QS=3,0;MQSB=0.965264;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,9,103:3:0	0,21,216:7:0
+X	2047	.	G	<*>	0	.	DP=34;I16=17,16,0,0,1248,47798,0,0,1949,116041,0,0,557,12491,0,0;QS=3,0;MQSB=0.959328;MQ0F=0	PL:DP:DV	0,72,255:24:0	0,9,88:3:0	0,18,195:6:0
+X	2048	.	A	<*>	0	.	DP=34;I16=18,16,0,0,1230,45184,0,0,2009,119641,0,0,578,13022,0,0;QS=3,0;MQSB=0.962621;MQ0F=0	PL:DP:DV	0,72,255:24:0	0,9,87:3:0	0,21,206:7:0
+X	2049	.	A	<*>	0	.	DP=33;I16=17,16,0,0,1207,44567,0,0,1949,116041,0,0,575,12963,0,0;QS=3,0;MQSB=0.959328;MQ0F=0	PL:DP:DV	0,72,255:24:0	0,6,74:2:0	0,21,208:7:0
+X	2050	.	A	<*>	0	.	DP=33;I16=16,16,0,0,1169,43313,0,0,1889,112441,0,0,545,12211,0,0;QS=3,0;MQSB=0.955563;MQ0F=0	PL:DP:DV	0,72,255:24:0	0,6,77:2:0	0,18,188:6:0
+X	2051	.	T	<*>	0	.	DP=31;I16=16,15,0,0,1134,42164,0,0,1829,108841,0,0,567,12737,0,0;QS=3,0;MQSB=0.957006;MQ0F=0	PL:DP:DV	0,69,255:23:0	0,6,69:2:0	0,18,170:6:0
+X	2052	.	G	<*>	0	.	DP=31;I16=16,15,0,0,1180,45546,0,0,1829,108841,0,0,564,12664,0,0;QS=3,0;MQSB=0.957006;MQ0F=0	PL:DP:DV	0,69,255:23:0	0,6,74:2:0	0,18,175:6:0
+X	2053	.	G	T,<*>	0	.	DP=31;I16=15,15,0,1,1126,42672,23,529,1769,105241,60,3600,537,11991,25,625;QS=2.97307,0.0269321,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.951229;BQB=1;MQ0F=0	PL:DP:DV	0,46,255,66,255,255:23:1	0,6,71,6,71,71:2:0	0,18,180,18,180,180:6:0
+X	2054	.	A	<*>	0	.	DP=30;I16=15,15,0,0,1123,43027,0,0,1769,105241,0,0,562,12592,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,6,78:2:0	0,18,171:6:0
+X	2055	.	G	<*>	0	.	DP=30;I16=15,15,0,0,1156,45206,0,0,1769,105241,0,0,562,12592,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,6,66:2:0	0,18,168:6:0
+X	2056	.	A	<*>	0	.	DP=30;I16=15,15,0,0,1124,42416,0,0,1769,105241,0,0,560,12518,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,6,71:2:0	0,18,179:6:0
+X	2057	.	T	<*>	0	.	DP=30;I16=15,15,0,0,1094,40082,0,0,1769,105241,0,0,556,12374,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,6,72:2:0	0,18,178:6:0
+X	2058	.	A	<*>	0	.	DP=29;I16=14,15,0,0,1035,37517,0,0,1709,101641,0,0,552,12212,0,0;QS=3,0;MQSB=0.947838;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,6,57:2:0	0,18,179:6:0
+X	2059	.	A	<*>	0	.	DP=29;I16=14,15,0,0,1063,39615,0,0,1709,101641,0,0,548,12082,0,0;QS=3,0;MQSB=0.947838;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,6,66:2:0	0,18,188:6:0
+X	2060	.	C	<*>	0	.	DP=28;I16=12,15,0,0,1015,39057,0,0,1589,94441,0,0,523,11499,0,0;QS=3,0;MQSB=0.935229;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,6,62:2:0	0,15,143:5:0
+X	2061	.	A	<*>	0	.	DP=27;I16=12,14,0,0,950,35084,0,0,1529,90841,0,0,501,11073,0,0;QS=3,0;MQSB=0.937241;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,3,41:1:0	0,15,163:5:0
+X	2062	.	A	<*>	0	.	DP=26;I16=11,15,0,0,973,37349,0,0,1529,90841,0,0,519,11425,0,0;QS=3,0;MQSB=0.927041;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,57:2:0	0,15,164:5:0
+X	2063	.	C	<*>	0	.	DP=26;I16=11,15,0,0,1017,40149,0,0,1529,90841,0,0,517,11405,0,0;QS=3,0;MQSB=0.927041;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,74:2:0	0,15,158:5:0
+X	2064	.	A	<*>	0	.	DP=26;I16=11,15,0,0,1002,38980,0,0,1529,90841,0,0,515,11413,0,0;QS=3,0;MQSB=0.927041;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,75:2:0	0,15,164:5:0
+X	2065	.	G	<*>	0	.	DP=26;I16=12,14,0,0,1030,41232,0,0,1529,90841,0,0,514,11448,0,0;QS=3,0;MQSB=0.937241;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,78:2:0	0,18,167:6:0
+X	2066	.	G	<*>	0	.	DP=26;I16=12,14,0,0,973,37055,0,0,1529,90841,0,0,514,11510,0,0;QS=3,0;MQSB=0.937241;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,75:2:0	0,18,152:6:0
+X	2067	.	A	<*>	0	.	DP=26;I16=12,14,0,0,1005,39095,0,0,1529,90841,0,0,512,11498,0,0;QS=3,0;MQSB=0.937241;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,69:2:0	0,18,187:6:0
+X	2068	.	G	<*>	0	.	DP=26;I16=12,14,0,0,993,39005,0,0,1529,90841,0,0,509,11459,0,0;QS=3,0;MQSB=0.937241;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,53:2:0	0,18,167:6:0
+X	2069	.	C	<*>	0	.	DP=26;I16=12,14,0,0,873,29879,0,0,1529,90841,0,0,506,11442,0,0;QS=3,0;MQSB=0.937241;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,59:2:0	0,18,156:6:0
+X	2070	.	G	<*>	0	.	DP=27;I16=13,14,0,0,932,33090,0,0,1589,94441,0,0,502,11398,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,62:2:0	0,18,145:6:0
+X	2071	.	A	<*>	0	.	DP=27;I16=13,14,0,0,946,33884,0,0,1589,94441,0,0,498,11330,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,53:2:0	0,18,177:6:0
+X	2072	.	C	<*>	0	.	DP=25;I16=13,12,0,0,897,32897,0,0,1469,87241,0,0,496,11288,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,59:2:0	0,15,128:5:0
+X	2073	.	C	<*>	0	.	DP=26;I16=14,12,0,0,874,30184,0,0,1529,90841,0,0,492,11168,0,0;QS=3,0;MQSB=0.953497;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,53:2:0	0,15,133:5:0
+X	2074	.	G	<*>	0	.	DP=26;I16=13,12,0,0,835,29219,0,0,1469,87241,0,0,463,10395,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,67:2:0	0,12,83:4:0
+X	2075	.	C	<*>	0	.	DP=27;I16=15,12,0,0,989,37027,0,0,1589,94441,0,0,484,10896,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,6,69:2:0	0,15,115:5:0
+X	2076	.	A	<*>	0	.	DP=27;I16=14,12,0,0,929,33551,0,0,1529,90841,0,0,470,10676,0,0;QS=3,0;MQSB=0.953497;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,6,76:2:0	0,12,114:4:0
+X	2077	.	C	<*>	0	.	DP=27;I16=15,12,0,0,990,37252,0,0,1589,94441,0,0,478,10724,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,6,65:2:0	0,15,125:5:0
+X	2078	.	A	<*>	0	.	DP=27;I16=15,12,0,0,1023,39089,0,0,1589,94441,0,0,475,10677,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,6,72:2:0	0,15,148:5:0
+X	2079	.	G	<*>	0	.	DP=28;I16=15,13,0,0,1042,39694,0,0,1649,98041,0,0,471,10605,0,0;QS=3,0;MQSB=0.956162;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,6,72:2:0	0,15,133:5:0
+X	2080	.	G	<*>	0	.	DP=28;I16=14,13,0,0,968,35328,0,0,1589,94441,0,0,453,10333,0,0;QS=3,0;MQSB=0.951472;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,6,67:2:0	0,12,108:4:0
+X	2081	.	C	<*>	0	.	DP=26;I16=14,12,0,0,937,35303,0,0,1529,90841,0,0,467,10535,0,0;QS=3,0;MQSB=0.953497;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,63:2:0	0,15,110:5:0
+X	2082	.	T	<*>	0	.	DP=24;I16=12,12,0,0,901,34287,0,0,1409,83641,0,0,468,10532,0,0;QS=3,0;MQSB=0.941765;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,71:2:0	0,12,112:4:0
+X	2083	.	G	<*>	0	.	DP=24;I16=12,12,0,0,887,33597,0,0,1409,83641,0,0,469,10547,0,0;QS=3,0;MQSB=0.941765;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,68:2:0	0,12,113:4:0
+X	2084	.	C	<*>	0	.	DP=25;I16=13,12,0,0,938,35868,0,0,1469,87241,0,0,470,10580,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,61:2:0	0,12,115:4:0
+X	2085	.	T	<*>	0	.	DP=25;I16=13,12,0,0,932,35282,0,0,1469,87241,0,0,472,10632,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,64:2:0	0,12,130:4:0
+X	2086	.	G	<*>	0	.	DP=25;I16=13,12,0,0,932,35400,0,0,1469,87241,0,0,474,10704,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,61:2:0	0,12,129:4:0
+X	2087	.	A	<*>	0	.	DP=24;I16=12,12,0,0,903,34391,0,0,1409,83641,0,0,476,10746,0,0;QS=3,0;MQSB=0.941765;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,66:2:0	0,12,126:4:0
+X	2088	.	G	<*>	0	.	DP=24;I16=12,12,0,0,880,33116,0,0,1409,83641,0,0,478,10808,0,0;QS=3,0;MQSB=0.941765;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,70:2:0	0,12,121:4:0
+X	2089	.	C	<*>	0	.	DP=25;I16=13,12,0,0,817,27419,0,0,1469,87241,0,0,480,10890,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,64:2:0	0,15,138:5:0
+X	2090	.	G	<*>	0	.	DP=25;I16=12,12,0,0,802,27940,0,0,1409,83641,0,0,457,10319,0,0;QS=3,0;MQSB=0.941765;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,63:2:0	0,12,99:4:0
+X	2091	.	C	<*>	0	.	DP=25;I16=12,12,0,0,800,27346,0,0,1440,86400,0,0,458,10346,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,61:2:0	0,15,125:5:0
+X	2092	.	G	<*>	0	.	DP=26;I16=13,12,0,0,838,29188,0,0,1469,87241,0,0,461,10487,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,64:2:0	0,18,133:6:0
+X	2093	.	T	G,<*>	0	.	DP=26;I16=13,12,1,0,905,33415,17,289,1500,90000,29,841,459,10371,25,625;QS=2.97424,0.0257576,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.953497;BQB=1;MQ0F=0	PL:DP:DV	0,36,255,51,255,255:18:1	0,6,67,6,67,67:2:0	0,18,153,18,153,153:6:0
+X	2094	.	C	<*>	0	.	DP=26;I16=14,12,0,0,949,35501,0,0,1529,90841,0,0,485,11047,0,0;QS=3,0;MQSB=0.953497;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,69:2:0	0,18,142:6:0
+X	2095	.	A	<*>	0	.	DP=25;I16=14,11,0,0,879,31219,0,0,1469,87241,0,0,487,11123,0,0;QS=3,0;MQSB=0.955682;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,72:2:0	0,18,154:6:0
+X	2096	.	C	<*>	0	.	DP=24;I16=13,11,0,0,878,32734,0,0,1409,83641,0,0,487,11073,0,0;QS=3,0;MQSB=0.950498;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,65:2:0	0,18,161:6:0
+X	2097	.	A	<*>	0	.	DP=24;I16=13,11,0,0,849,30671,0,0,1409,83641,0,0,487,11047,0,0;QS=3,0;MQSB=0.950498;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,56:2:0	0,18,172:6:0
+X	2098	.	C	<*>	0	.	DP=24;I16=13,11,0,0,781,26113,0,0,1409,83641,0,0,486,10996,0,0;QS=3,0;MQSB=0.950498;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,58:2:0	0,18,139:6:0
+X	2099	.	G	<*>	0	.	DP=23;I16=12,10,0,0,719,25109,0,0,1289,76441,0,0,460,10294,0,0;QS=3,0;MQSB=0.947103;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,3,24:1:0	0,18,129:6:0
+X	2100	.	C	<*>	0	.	DP=25;I16=13,11,0,0,873,32759,0,0,1409,83641,0,0,457,10141,0,0;QS=3,0;MQSB=0.950498;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,87:3:0	0,18,160:6:0
+X	2101	.	A	<*>	0	.	DP=25;I16=12,12,0,0,907,34671,0,0,1440,86400,0,0,455,9965,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,135:4:0	0,18,161:6:0
+X	2102	.	G	<*>	0	.	DP=25;I16=13,12,0,0,930,35596,0,0,1469,87241,0,0,478,10442,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,118:4:0	0,18,151:6:0
+X	2103	.	C	<*>	0	.	DP=25;I16=11,12,0,0,842,31630,0,0,1380,82800,0,0,432,9336,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,106:4:0	0,15,146:5:0
+X	2104	.	C	<*>	0	.	DP=24;I16=12,12,0,0,869,32463,0,0,1409,83641,0,0,454,9810,0,0;QS=3,0;MQSB=0.941765;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,126:4:0	0,15,147:5:0
+X	2105	.	A	<*>	0	.	DP=25;I16=11,12,0,0,836,30696,0,0,1380,82800,0,0,429,9201,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,138:4:0	0,15,130:5:0
+X	2106	.	T	<*>	0	.	DP=25;I16=12,13,0,0,897,33087,0,0,1469,87241,0,0,473,10211,0,0;QS=3,0;MQSB=0.939413;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,129:4:0	0,15,146:5:0
+X	2107	.	C	<*>	0	.	DP=25;I16=11,12,0,0,783,27185,0,0,1380,82800,0,0,425,9113,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,100:3:0	0,15,133:5:0
+X	2108	.	G	<*>	0	.	DP=25;I16=11,13,0,0,829,29703,0,0,1440,86400,0,0,448,9730,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,122:4:0	0,15,111:5:0
+X	2109	.	C	<*>	0	.	DP=25;I16=11,13,0,0,781,26717,0,0,1440,86400,0,0,446,9746,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,109:4:0	0,15,125:5:0
+X	2110	.	G	<*>	0	.	DP=25;I16=12,12,0,0,804,28134,0,0,1440,86400,0,0,418,9110,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,92:3:0	0,15,117:5:0
+X	2111	.	C	<*>	0	.	DP=25;I16=12,13,0,0,925,35081,0,0,1500,90000,0,0,441,9747,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,134:4:0	0,15,140:5:0
+X	2112	.	A	<*>	0	.	DP=24;I16=12,12,0,0,885,33445,0,0,1440,86400,0,0,440,9782,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,129:4:0	0,15,140:5:0
+X	2113	.	G	<*>	0	.	DP=24;I16=12,12,0,0,871,32641,0,0,1440,86400,0,0,439,9839,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,128:4:0	0,15,134:5:0
+X	2114	.	C	<*>	0	.	DP=24;I16=12,11,0,0,844,32052,0,0,1380,82800,0,0,413,9293,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,103:3:0	0,15,126:5:0
+X	2115	.	T	<*>	0	.	DP=23;I16=11,11,0,0,821,30869,0,0,1320,79200,0,0,412,9342,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,78:2:0	0,15,143:5:0
+X	2116	.	C	<*>	0	.	DP=23;I16=11,12,0,0,890,34892,0,0,1380,82800,0,0,435,9985,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,102:3:0	0,15,152:5:0
+X	2117	.	A	<*>	0	.	DP=23;I16=11,11,0,0,833,32121,0,0,1320,79200,0,0,432,9924,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,118:3:0	0,15,156:5:0
+X	2118	.	G	<*>	0	.	DP=23;I16=12,11,0,0,842,31502,0,0,1380,82800,0,0,429,9835,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,125:4:0	0,15,147:5:0
+X	2119	.	G	<*>	0	.	DP=23;I16=12,11,0,0,823,30553,0,0,1380,82800,0,0,426,9768,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,135:4:0	0,15,137:5:0
+X	2120	.	G	<*>	0	.	DP=24;I16=13,11,0,0,864,32028,0,0,1440,86400,0,0,423,9723,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,137:4:0	0,15,140:5:0
+X	2121	.	A	<*>	0	.	DP=22;I16=11,10,0,0,734,26712,0,0,1260,75600,0,0,398,9074,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,135:4:0	0,12,122:4:0
+X	2122	.	T	<*>	0	.	DP=22;I16=11,10,0,0,752,27278,0,0,1260,75600,0,0,396,8972,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,136:4:0	0,12,123:4:0
+X	2123	.	A	<*>	0	.	DP=22;I16=12,10,0,0,758,27024,0,0,1320,79200,0,0,419,9519,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,120:4:0	0,15,137:5:0
+X	2124	.	T	<*>	0	.	DP=22;I16=12,10,0,0,789,28741,0,0,1320,79200,0,0,417,9465,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,128:4:0	0,15,136:5:0
+X	2125	.	T	<*>	0	.	DP=20;I16=11,8,0,0,696,25704,0,0,1140,68400,0,0,401,9177,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,106:3:0	0,9,93:3:0
+X	2126	.	A	<*>	0	.	DP=20;I16=11,9,0,0,717,25979,0,0,1200,72000,0,0,415,9319,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,133:4:0	0,9,95:3:0
+X	2127	.	C	<*>	0	.	DP=21;I16=11,10,0,0,706,24426,0,0,1260,75600,0,0,413,9221,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,107:4:0	0,9,95:3:0
+X	2128	.	G	<*>	0	.	DP=21;I16=11,10,0,0,677,22633,0,0,1260,75600,0,0,411,9091,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,116:4:0	0,9,72:3:0
+X	2129	.	T	<*>	0	.	DP=21;I16=11,10,0,0,782,29386,0,0,1260,75600,0,0,409,8981,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,140:4:0	0,9,83:3:0
+X	2130	.	G	<*>	0	.	DP=21;I16=11,10,0,0,766,28562,0,0,1260,75600,0,0,407,8891,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,135:4:0	0,9,87:3:0
+X	2131	.	T	<*>	0	.	DP=21;I16=11,10,0,0,732,26216,0,0,1260,75600,0,0,405,8821,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,136:4:0	0,9,79:3:0
+X	2132	.	A	<*>	0	.	DP=21;I16=11,10,0,0,743,26733,0,0,1260,75600,0,0,403,8771,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,135:4:0	0,9,88:3:0
+X	2133	.	A	<*>	0	.	DP=21;I16=11,10,0,0,787,29651,0,0,1260,75600,0,0,401,8741,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,141:4:0	0,9,96:3:0
+X	2134	.	C	<*>	0	.	DP=21;I16=11,10,0,0,804,31100,0,0,1260,75600,0,0,399,8731,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,138:4:0	0,9,86:3:0
+X	2135	.	T	<*>	0	.	DP=22;I16=11,11,0,0,831,32197,0,0,1320,79200,0,0,397,8741,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,153:4:0	0,12,119:4:0
+X	2136	.	C	<*>	0	.	DP=22;I16=11,11,0,0,760,26892,0,0,1320,79200,0,0,395,8721,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,124:4:0	0,12,127:4:0
+X	2137	.	G	<*>	0	.	DP=22;I16=11,11,0,0,745,26047,0,0,1320,79200,0,0,393,8721,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,121:4:0	0,12,102:4:0
+X	2138	.	A	<*>	0	.	DP=22;I16=11,11,0,0,816,30934,0,0,1320,79200,0,0,391,8741,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,128:4:0	0,12,139:4:0
+X	2139	.	C	<*>	0	.	DP=22;I16=11,11,0,0,839,32237,0,0,1320,79200,0,0,389,8781,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,138:4:0	0,12,125:4:0
+X	2140	.	A	<*>	0	.	DP=22;I16=11,11,0,0,826,31300,0,0,1320,79200,0,0,387,8841,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,140:4:0	0,12,138:4:0
+X	2141	.	T	<*>	0	.	DP=21;I16=11,10,0,0,792,30156,0,0,1260,75600,0,0,385,8871,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,137:4:0	0,12,137:4:0
+X	2142	.	G	<*>	0	.	DP=19;I16=11,8,0,0,724,27784,0,0,1140,68400,0,0,385,8919,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,113:3:0	0,12,129:4:0
+X	2143	.	T	<*>	0	.	DP=19;I16=11,8,0,0,650,23454,0,0,1140,68400,0,0,384,8932,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,113:3:0	0,12,120:4:0
+X	2144	.	C	<*>	0	.	DP=19;I16=11,8,0,0,739,29003,0,0,1140,68400,0,0,383,8959,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,108:3:0	0,12,125:4:0
+X	2145	.	A	<*>	0	.	DP=20;I16=12,8,0,0,760,29304,0,0,1200,72000,0,0,381,8951,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,133:4:0	0,12,139:4:0
+X	2146	.	G	<*>	0	.	DP=20;I16=12,8,0,0,745,28105,0,0,1200,72000,0,0,379,8909,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,139:4:0	0,12,127:4:0
+X	2147	.	C	<*>	0	.	DP=20;I16=13,6,0,0,674,24296,0,0,1140,68400,0,0,379,8881,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,127:4:0	0,12,130:4:0
+X	2148	.	G	<*>	0	.	DP=20;I16=12,7,0,0,630,21274,0,0,1140,68400,0,0,365,8537,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,250:11:0	0,12,112:4:0	0,12,120:4:0
+X	2149	.	A	<*>	0	.	DP=20;I16=12,7,0,0,702,26212,0,0,1140,68400,0,0,367,8529,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,138:4:0	0,12,127:4:0
+X	2150	.	T	<*>	0	.	DP=20;I16=13,7,0,0,675,23943,0,0,1200,72000,0,0,383,8713,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,247:11:0	0,12,138:4:0	0,15,139:5:0
+X	2151	.	T	<*>	0	.	DP=20;I16=13,7,0,0,690,24274,0,0,1200,72000,0,0,383,8661,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,251:11:0	0,12,133:4:0	0,15,142:5:0
+X	2152	.	G	<*>	0	.	DP=20;I16=13,7,0,0,693,24713,0,0,1200,72000,0,0,383,8629,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,131:4:0	0,15,146:5:0
+X	2153	.	T	<*>	0	.	DP=19;I16=13,6,0,0,671,24571,0,0,1140,68400,0,0,383,8565,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,230:10:0	0,12,134:4:0	0,15,162:5:0
+X	2154	.	C	<*>	0	.	DP=19;I16=13,6,0,0,703,26955,0,0,1140,68400,0,0,382,8468,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,251:10:0	0,12,131:4:0	0,15,159:5:0
+X	2155	.	A	<*>	0	.	DP=19;I16=13,6,0,0,693,25727,0,0,1140,68400,0,0,381,8389,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,245:10:0	0,12,135:4:0	0,15,156:5:0
+X	2156	.	C	<*>	0	.	DP=19;I16=13,6,0,0,702,26214,0,0,1140,68400,0,0,380,8328,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,125:4:0	0,15,154:5:0
+X	2157	.	A	<*>	0	.	DP=19;I16=13,6,0,0,722,28058,0,0,1140,68400,0,0,379,8285,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,250:10:0	0,12,141:4:0	0,15,173:5:0
+X	2158	.	G	<*>	0	.	DP=19;I16=13,6,0,0,713,27567,0,0,1140,68400,0,0,378,8260,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,136:4:0	0,15,144:5:0
+X	2159	.	G	<*>	0	.	DP=19;I16=12,6,0,0,662,24744,0,0,1080,64800,0,0,366,8104,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,247:9:0	0,12,126:4:0	0,15,153:5:0
+X	2160	.	C	<*>	0	.	DP=19;I16=12,6,0,0,651,24005,0,0,1080,64800,0,0,364,8038,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,244:9:0	0,12,119:4:0	0,15,154:5:0
+X	2161	.	A	<*>	0	.	DP=19;I16=13,6,0,0,695,25883,0,0,1140,68400,0,0,369,8005,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,248:10:0	0,12,121:4:0	0,15,164:5:0
+X	2162	.	C	<*>	0	.	DP=20;I16=13,7,0,0,742,27834,0,0,1200,72000,0,0,365,7911,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,127:4:0	0,15,155:5:0
+X	2163	.	T	<*>	0	.	DP=20;I16=13,7,0,0,763,29517,0,0,1200,72000,0,0,362,7838,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,131:4:0	0,15,175:5:0
+X	2164	.	G	<*>	0	.	DP=20;I16=13,7,0,0,715,26301,0,0,1200,72000,0,0,359,7787,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,116:4:0	0,15,156:5:0
+X	2165	.	C	<*>	0	.	DP=20;I16=13,7,0,0,753,28781,0,0,1200,72000,0,0,355,7709,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,136:4:0	0,15,151:5:0
+X	2166	.	T	<*>	0	.	DP=19;I16=12,7,0,0,711,27211,0,0,1140,68400,0,0,352,7654,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,142:4:0	0,12,140:4:0
+X	2167	.	A	<*>	0	.	DP=19;I16=12,6,0,0,650,23760,0,0,1080,64800,0,0,327,7137,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,254:11:0	0,12,133:4:0	0,9,111:3:0
+X	2168	.	C	<*>	0	.	DP=19;I16=12,7,0,0,685,25039,0,0,1140,68400,0,0,345,7561,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,130:4:0	0,12,124:4:0
+X	2169	.	T	<*>	0	.	DP=19;I16=12,7,0,0,702,26940,0,0,1140,68400,0,0,341,7525,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,140:4:0	0,12,142:4:0
+X	2170	.	C	<*>	0	.	DP=18;I16=11,7,0,0,665,24861,0,0,1080,64800,0,0,338,7512,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,132:4:0	0,12,135:4:0
+X	2171	.	C	<*>	0	.	DP=20;I16=11,9,0,0,750,28368,0,0,1200,72000,0,0,333,7419,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,136:4:0	0,12,138:4:0
+X	2172	.	T	<*>	0	.	DP=20;I16=11,9,0,0,732,27540,0,0,1200,72000,0,0,330,7346,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,149:4:0	0,12,147:4:0
+X	2173	.	G	<*>	0	.	DP=19;I16=10,9,0,0,704,26534,0,0,1140,68400,0,0,327,7243,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,142:4:0	0,12,133:4:0
+X	2174	.	G	<*>	0	.	DP=19;I16=10,9,0,0,674,24372,0,0,1140,68400,0,0,324,7158,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,126:4:0	0,12,129:4:0
+X	2175	.	G	<*>	0	.	DP=18;I16=9,9,0,0,639,23059,0,0,1080,64800,0,0,322,7090,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,123:4:0	0,12,126:4:0
+X	2176	.	G	<*>	0	.	DP=18;I16=9,9,0,0,621,21815,0,0,1080,64800,0,0,318,6940,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,247:10:0	0,12,121:4:0	0,12,123:4:0
+X	2177	.	T	<*>	0	.	DP=18;I16=9,9,0,0,547,18051,0,0,1080,64800,0,0,314,6810,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,239:10:0	0,12,83:4:0	0,12,108:4:0
+X	2178	.	T	<*>	0	.	DP=18;I16=9,9,0,0,579,19659,0,0,1080,64800,0,0,310,6700,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,234:10:0	0,12,110:4:0	0,12,118:4:0
+X	2179	.	T	<*>	0	.	DP=18;I16=9,9,0,0,591,20403,0,0,1080,64800,0,0,307,6609,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,239:10:0	0,12,97:4:0	0,12,135:4:0
+X	2180	.	T	<*>	0	.	DP=18;I16=9,9,0,0,616,21524,0,0,1080,64800,0,0,305,6537,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,236:10:0	0,12,122:4:0	0,12,133:4:0
+X	2181	.	C	<*>	0	.	DP=18;I16=9,8,0,0,611,22485,0,0,1020,61200,0,0,293,6385,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,224:9:0	0,12,129:4:0	0,12,150:4:0
+X	2182	.	C	<*>	0	.	DP=18;I16=9,9,0,0,665,24877,0,0,1080,64800,0,0,301,6453,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,125:4:0	0,12,145:4:0
+X	2183	.	A	<*>	0	.	DP=18;I16=9,9,0,0,646,23624,0,0,1080,64800,0,0,299,6441,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,247:10:0	0,12,123:4:0	0,12,144:4:0
+X	2184	.	T	<*>	0	.	DP=17;I16=8,9,0,0,610,22250,0,0,1020,61200,0,0,298,6448,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,224:9:0	0,12,134:4:0	0,12,136:4:0
+X	2185	.	C	<*>	0	.	DP=16;I16=8,8,0,0,569,20761,0,0,960,57600,0,0,297,6423,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,211:8:0	0,12,128:4:0	0,12,137:4:0
+X	2186	.	A	<*>	0	.	DP=16;I16=8,8,0,0,576,21314,0,0,960,57600,0,0,296,6416,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,204:8:0	0,12,134:4:0	0,12,145:4:0
+X	2187	.	A	<*>	0	.	DP=16;I16=8,8,0,0,562,20396,0,0,960,57600,0,0,295,6427,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,201:8:0	0,12,136:4:0	0,12,135:4:0
+X	2188	.	A	<*>	0	.	DP=17;I16=9,8,0,0,569,19925,0,0,1020,61200,0,0,293,6405,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,214:9:0	0,12,133:4:0	0,12,123:4:0
+X	2189	.	C	<*>	0	.	DP=19;I16=9,10,0,0,645,22647,0,0,1097,65089,0,0,292,6400,0,0;QS=3,0;MQSB=0.934728;MQ0F=0	PL:DP:DV	0,30,230:10:0	0,12,133:4:0	0,15,142:5:0
+X	2190	.	C	<*>	0	.	DP=19;I16=9,10,0,0,604,20072,0,0,1097,65089,0,0,294,6414,0,0;QS=3,0;MQSB=0.934728;MQ0F=0	PL:DP:DV	0,33,238:11:0	0,12,119:4:0	0,12,107:4:0
+X	2191	.	C	<*>	0	.	DP=19;I16=9,10,0,0,647,23007,0,0,1097,65089,0,0,297,6449,0,0;QS=3,0;MQSB=0.934728;MQ0F=0	PL:DP:DV	0,33,251:11:0	0,12,129:4:0	0,12,119:4:0
+X	2192	.	T	<*>	0	.	DP=19;I16=9,10,0,0,659,23723,0,0,1097,65089,0,0,300,6506,0,0;QS=3,0;MQSB=0.934728;MQ0F=0	PL:DP:DV	0,33,253:11:0	0,12,136:4:0	0,12,120:4:0
+X	2193	.	C	<*>	0	.	DP=18;I16=8,10,0,0,642,23934,0,0,1037,61489,0,0,303,6535,0,0;QS=3,0;MQSB=0.938795;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,128:4:0	0,9,87:3:0
+X	2194	.	A	<*>	0	.	DP=18;I16=8,9,0,0,617,22683,0,0,1020,61200,0,0,301,6561,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,247:10:0	0,12,134:4:0	0,9,98:3:0
+X	2195	.	A	<*>	0	.	DP=18;I16=8,10,0,0,635,23271,0,0,1037,61489,0,0,309,6659,0,0;QS=3,0;MQSB=0.938795;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,128:4:0	0,9,101:3:0
+X	2196	.	G	<*>	0	.	DP=19;I16=8,11,0,0,703,26383,0,0,1097,65089,0,0,312,6754,0,0;QS=3,0;MQSB=0.946915;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,117:4:0	0,12,120:4:0
+X	2197	.	A	<*>	0	.	DP=19;I16=8,11,0,0,735,28599,0,0,1097,65089,0,0,314,6770,0,0;QS=3,0;MQSB=0.946915;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,141:4:0	0,12,125:4:0
+X	2198	.	G	<*>	0	.	DP=19;I16=8,10,0,0,650,24206,0,0,1080,64800,0,0,307,6725,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,129:4:0	0,12,107:4:0
+X	2199	.	C	<*>	0	.	DP=19;I16=8,11,0,0,701,26735,0,0,1097,65089,0,0,318,6862,0,0;QS=3,0;MQSB=0.946915;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,128:4:0	0,12,116:4:0
+X	2200	.	T	<*>	0	.	DP=19;I16=8,11,0,0,710,26768,0,0,1097,65089,0,0,320,6938,0,0;QS=3,0;MQSB=0.946915;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,129:4:0	0,12,114:4:0
+X	2201	.	G	<*>	0	.	DP=17;I16=7,10,0,0,628,23764,0,0,977,57889,0,0,324,7032,0,0;QS=3,0;MQSB=0.943335;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,66:2:0	0,12,119:4:0
+X	2202	.	G	<*>	0	.	DP=17;I16=7,10,0,0,557,19249,0,0,977,57889,0,0,327,7093,0,0;QS=3,0;MQSB=0.943335;MQ0F=0	PL:DP:DV	0,33,245:11:0	0,6,57:2:0	0,12,115:4:0
+X	2203	.	G	<*>	0	.	DP=17;I16=7,10,0,0,588,21184,0,0,977,57889,0,0,329,7123,0,0;QS=3,0;MQSB=0.943335;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,47:2:0	0,12,116:4:0
+X	2204	.	C	<*>	0	.	DP=17;I16=7,10,0,0,538,18568,0,0,977,57889,0,0,331,7173,0,0;QS=3,0;MQSB=0.943335;MQ0F=0	PL:DP:DV	0,33,246:11:0	0,6,61:2:0	0,12,99:4:0
+X	2205	.	C	<*>	0	.	DP=18;I16=7,11,0,0,628,22918,0,0,1037,61489,0,0,332,7192,0,0;QS=3,0;MQSB=0.951002;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,68:2:0	0,12,109:4:0
+X	2206	.	T	<*>	0	.	DP=19;I16=7,12,0,0,677,25237,0,0,1097,65089,0,0,334,7230,0,0;QS=3,0;MQSB=0.957193;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,77:2:0	0,12,115:4:0
+X	2207	.	G	<*>	0	.	DP=19;I16=7,11,0,0,663,24717,0,0,1080,64800,0,0,319,6965,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,67:2:0	0,12,110:4:0
+X	2208	.	G	<*>	0	.	DP=21;I16=7,14,0,0,726,26038,0,0,1217,72289,0,0,340,7370,0,0;QS=3,0;MQSB=0.966484;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,110:4:0	0,12,122:4:0
+X	2209	.	G	<*>	0	.	DP=22;I16=8,13,0,0,715,25133,0,0,1237,73369,0,0,325,7075,0,0;QS=3,0;MQSB=0.895122;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,128:5:0	0,12,117:4:0
+X	2210	.	G	C,<*>	0	.	DP=21;I16=7,13,0,1,648,22186,25,625,1177,69769,17,289,331,7165,21,441;QS=2.95442,0.0455764,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.975265;BQB=1;MQ0F=0	PL:DP:DV	0,19,234,33,237,241:12:1	0,15,127,15,127,127:5:0	0,12,113,12,113,113:4:0
+X	2211	.	T	<*>	0	.	DP=21;I16=7,13,0,0,724,27000,0,0,1177,69769,0,0,336,7230,0,0;QS=3,0;MQSB=0.875769;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,141:5:0	0,12,124:4:0
+X	2212	.	C	<*>	0	.	DP=22;I16=8,14,0,0,791,29201,0,0,1254,73658,0,0,364,7850,0,0;QS=3,0;MQSB=0.985548;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,148:5:0	0,12,111:4:0
+X	2213	.	A	<*>	0	.	DP=22;I16=8,14,0,0,767,27327,0,0,1254,73658,0,0,371,8015,0,0;QS=3,0;MQSB=0.985548;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,153:5:0	0,12,112:4:0
+X	2214	.	A	<*>	0	.	DP=22;I16=8,14,0,0,756,26836,0,0,1254,73658,0,0,377,8159,0,0;QS=3,0;MQSB=0.985548;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,153:5:0	0,12,117:4:0
+X	2215	.	C	<*>	0	.	DP=22;I16=8,14,0,0,815,31121,0,0,1254,73658,0,0,381,8229,0,0;QS=3,0;MQSB=0.985548;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,162:5:0	0,12,124:4:0
+X	2216	.	T	<*>	0	.	DP=22;I16=8,14,0,0,815,31233,0,0,1254,73658,0,0,384,8272,0,0;QS=3,0;MQSB=0.985548;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,166:5:0	0,12,124:4:0
+X	2217	.	T	<*>	0	.	DP=22;I16=8,13,0,0,741,26855,0,0,1237,73369,0,0,362,7712,0,0;QS=3,0;MQSB=0.895122;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,155:5:0	0,12,118:4:0
+X	2218	.	C	<*>	0	.	DP=21;I16=7,14,0,0,753,27973,0,0,1194,70058,0,0,391,8423,0,0;QS=3,0;MQSB=0.975265;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,138:4:0	0,12,119:4:0
+X	2219	.	C	<*>	0	.	DP=21;I16=7,13,0,0,757,29125,0,0,1177,69769,0,0,370,7904,0,0;QS=3,0;MQSB=0.875769;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,141:4:0	0,12,122:4:0
+X	2220	.	G	A,<*>	0	.	DP=21;I16=6,2,1,11,256,8364,474,19128,457,26569,720,43200,141,2959,233,5071;QS=0.886504,2.1135,0;VDB=0.532753;SGB=-3.51597;RPB=0.964198;MQB=0.898397;MQSB=0.875769;BQB=0.0354359;MQ0F=0	PL:DP:DV	139,0,130,157,148,255:12:6	69,0,46,75,52,119:4:2	131,12,0,131,12,131:4:4
+X	2221	.	G	<*>	0	.	DP=21;I16=7,13,0,0,738,27922,0,0,1177,69769,0,0,376,8078,0,0;QS=3,0;MQSB=0.875769;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,132:4:0	0,12,120:4:0
+X	2222	.	C	<*>	0	.	DP=21;I16=7,14,0,0,746,28098,0,0,1194,70058,0,0,401,8675,0,0;QS=3,0;MQSB=0.975265;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,135:4:0	0,12,107:4:0
+X	2223	.	C	<*>	0	.	DP=21;I16=7,14,0,0,796,30632,0,0,1194,70058,0,0,401,8671,0,0;QS=3,0;MQSB=0.975265;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,135:4:0	0,12,122:4:0
+X	2224	.	T	<*>	0	.	DP=21;I16=7,14,0,0,811,31599,0,0,1194,70058,0,0,401,8691,0,0;QS=3,0;MQSB=0.975265;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,144:4:0	0,12,123:4:0
+X	2225	.	G	<*>	0	.	DP=21;I16=7,14,0,0,778,29396,0,0,1194,70058,0,0,401,8735,0,0;QS=3,0;MQSB=0.975265;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,133:4:0	0,12,121:4:0
+X	2226	.	G	<*>	0	.	DP=21;I16=7,14,0,0,727,26485,0,0,1194,70058,0,0,401,8803,0,0;QS=3,0;MQSB=0.975265;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,128:4:0	0,12,113:4:0
+X	2227	.	G	<*>	0	.	DP=20;I16=7,12,0,0,663,23985,0,0,1117,66169,0,0,377,8269,0,0;QS=3,0;MQSB=0.879351;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,123:4:0	0,12,114:4:0
+X	2228	.	G	C,<*>	0	.	DP=19;I16=5,12,0,1,643,24791,16,256,1020,61200,17,289,360,8020,25,625;QS=2.9603,0.0397022,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.970092;BQB=1;MQ0F=0	PL:DP:DV	0,17,255,30,255,255:11:1	0,9,95,9,95,95:3:0	0,12,121,12,121,121:4:0
+X	2229	.	A	<*>	0	.	DP=20;I16=6,14,0,0,757,28857,0,0,1134,66458,0,0,406,9138,0,0;QS=3,0;MQSB=0.959189;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,138:4:0	0,12,122:4:0
+X	2230	.	A	<*>	0	.	DP=20;I16=6,14,0,0,729,26985,0,0,1134,66458,0,0,409,9291,0,0;QS=3,0;MQSB=0.959189;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,141:4:0	0,12,119:4:0
+X	2231	.	A	<*>	0	.	DP=20;I16=6,13,0,0,712,26990,0,0,1117,66169,0,0,386,8790,0,0;QS=3,0;MQSB=0.850016;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,144:4:0	0,12,124:4:0
+X	2232	.	C	<*>	0	.	DP=20;I16=6,14,0,0,751,28657,0,0,1134,66458,0,0,412,9508,0,0;QS=3,0;MQSB=0.959189;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,130:4:0	0,12,107:4:0
+X	2233	.	T	<*>	0	.	DP=20;I16=6,14,0,0,774,30432,0,0,1134,66458,0,0,413,9619,0,0;QS=3,0;MQSB=0.959189;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,150:4:0	0,12,117:4:0
+X	2234	.	G	<*>	0	.	DP=20;I16=6,14,0,0,719,26621,0,0,1134,66458,0,0,412,9646,0,0;QS=3,0;MQSB=0.959189;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,145:4:0	0,12,107:4:0
+X	2235	.	G	<*>	0	.	DP=20;I16=6,14,0,0,728,27036,0,0,1134,66458,0,0,410,9636,0,0;QS=3,0;MQSB=0.959189;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,139:4:0	0,12,104:4:0
+X	2236	.	G	<*>	0	.	DP=19;I16=6,13,0,0,705,26985,0,0,1074,62858,0,0,409,9637,0,0;QS=3,0;MQSB=0.965977;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,142:4:0	0,9,84:3:0
+X	2237	.	G	<*>	0	.	DP=19;I16=6,12,0,0,684,26576,0,0,1057,62569,0,0,383,9023,0,0;QS=3,0;MQSB=0.85394;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,141:4:0	0,9,86:3:0
+X	2238	.	C	<*>	0	.	DP=19;I16=5,13,0,0,648,24496,0,0,1037,61489,0,0,381,8993,0,0;QS=3,0;MQSB=0.970092;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,108:3:0	0,9,78:3:0
+X	2239	.	A	<*>	0	.	DP=19;I16=6,11,0,0,634,24178,0,0,997,58969,0,0,373,8935,0,0;QS=3,0;MQSB=0.85832;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,133:4:0	0,6,77:2:0
+X	2240	.	A	<*>	0	.	DP=19;I16=6,13,0,0,731,28595,0,0,1074,62858,0,0,402,9582,0,0;QS=3,0;MQSB=0.965977;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,135:4:0	0,9,101:3:0
+X	2241	.	G	<*>	0	.	DP=19;I16=6,12,0,0,683,26433,0,0,1057,62569,0,0,375,8951,0,0;QS=3,0;MQSB=0.85394;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,126:4:0	0,9,88:3:0
+X	2242	.	T	<*>	0	.	DP=20;I16=5,13,0,0,635,22949,0,0,1057,62569,0,0,370,8944,0,0;QS=3,0;MQSB=0.814433;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,91:3:0	0,9,95:3:0
+X	2243	.	A	<*>	0	.	DP=19;I16=5,14,0,0,704,26274,0,0,1074,62858,0,0,395,9585,0,0;QS=3,0;MQSB=0.933727;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,107:3:0	0,9,99:3:0
+X	2244	.	T	<*>	0	.	DP=19;I16=5,14,0,0,681,25263,0,0,1074,62858,0,0,395,9609,0,0;QS=3,0;MQSB=0.933727;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,89:3:0	0,9,98:3:0
+X	2245	.	C	<*>	0	.	DP=19;I16=5,14,0,0,722,27846,0,0,1074,62858,0,0,394,9592,0,0;QS=3,0;MQSB=0.933727;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,98:3:0	0,9,88:3:0
+X	2246	.	A	<*>	0	.	DP=18;I16=5,12,0,0,597,21693,0,0,997,58969,0,0,367,8861,0,0;QS=3,0;MQSB=0.818731;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,95:3:0	0,6,72:2:0
+X	2247	.	C	<*>	0	.	DP=17;I16=4,13,0,0,639,24373,0,0,954,55658,0,0,391,9391,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,105:3:0	0,6,71:2:0
+X	2248	.	C	<*>	0	.	DP=17;I16=4,13,0,0,669,26863,0,0,954,55658,0,0,390,9306,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,90:3:0	0,6,75:2:0
+X	2249	.	A	<*>	0	.	DP=17;I16=4,13,0,0,677,27371,0,0,954,55658,0,0,389,9231,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,116:3:0	0,6,80:2:0
+X	2250	.	G	<*>	0	.	DP=17;I16=4,13,0,0,654,25800,0,0,954,55658,0,0,388,9166,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,100:3:0	0,6,78:2:0
+X	2251	.	A	<*>	0	.	DP=17;I16=4,13,0,0,673,27327,0,0,954,55658,0,0,387,9111,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,112:3:0	0,6,80:2:0
+X	2252	.	G	<*>	0	.	DP=17;I16=4,12,0,0,647,26249,0,0,937,55369,0,0,361,8441,0,0;QS=3,0;MQSB=0.767432;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,113:3:0	0,6,73:2:0
+X	2253	.	A	<*>	0	.	DP=17;I16=4,13,0,0,641,24643,0,0,954,55658,0,0,385,9031,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,111:3:0	0,6,73:2:0
+X	2254	.	T	<*>	0	.	DP=17;I16=4,12,0,0,615,23821,0,0,937,55369,0,0,358,8332,0,0;QS=3,0;MQSB=0.767432;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,112:3:0	0,6,73:2:0
+X	2255	.	G	<*>	0	.	DP=17;I16=4,13,0,0,677,27243,0,0,954,55658,0,0,380,8844,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,115:3:0	0,6,71:2:0
+X	2256	.	A	<*>	0	.	DP=17;I16=4,13,0,0,656,26088,0,0,954,55658,0,0,377,8741,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,110:3:0	0,6,78:2:0
+X	2257	.	G	<*>	0	.	DP=17;I16=4,12,0,0,627,24863,0,0,937,55369,0,0,349,8023,0,0;QS=3,0;MQSB=0.767432;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,115:3:0	0,6,74:2:0
+X	2258	.	C	<*>	0	.	DP=17;I16=4,13,0,0,667,26403,0,0,954,55658,0,0,371,8565,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,109:3:0	0,6,70:2:0
+X	2259	.	T	<*>	0	.	DP=17;I16=4,13,0,0,646,25334,0,0,954,55658,0,0,368,8492,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,116:3:0	0,6,79:2:0
+X	2260	.	T	<*>	0	.	DP=17;I16=4,13,0,0,638,24178,0,0,954,55658,0,0,365,8429,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,115:3:0	0,6,72:2:0
+X	2261	.	T	<*>	0	.	DP=17;I16=4,13,0,0,633,23799,0,0,954,55658,0,0,362,8376,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,105:3:0	0,6,73:2:0
+X	2262	.	A	<*>	0	.	DP=17;I16=4,13,0,0,628,23438,0,0,954,55658,0,0,359,8333,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,253:12:0	0,9,112:3:0	0,6,74:2:0
+X	2263	.	T	<*>	0	.	DP=17;I16=4,13,0,0,631,23673,0,0,954,55658,0,0,355,8251,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,112:3:0	0,6,74:2:0
+X	2264	.	A	<*>	0	.	DP=17;I16=4,12,0,0,623,24371,0,0,937,55369,0,0,326,7556,0,0;QS=3,0;MQSB=0.767432;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,114:3:0	0,6,75:2:0
+X	2265	.	A	<*>	0	.	DP=18;I16=4,13,0,0,642,24718,0,0,997,58969,0,0,320,7400,0,0;QS=3,0;MQSB=0.762744;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,113:3:0	0,6,75:2:0
+X	2266	.	A	<*>	0	.	DP=19;I16=5,14,0,0,656,23962,0,0,1074,62858,0,0,337,7745,0,0;QS=3,0;MQSB=0.933727;MQ0F=0	PL:DP:DV	0,39,252:13:0	0,12,128:4:0	0,6,75:2:0
+X	2267	.	A	<*>	0	.	DP=20;I16=6,14,0,0,712,26052,0,0,1134,66458,0,0,332,7582,0,0;QS=3,0;MQSB=0.959189;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,134:4:0	0,9,102:3:0
+X	2268	.	A	<*>	0	.	DP=20;I16=6,14,0,0,741,27841,0,0,1134,66458,0,0,327,7391,0,0;QS=3,0;MQSB=0.959189;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,135:4:0	0,9,100:3:0
+X	2269	.	T	<*>	0	.	DP=20;I16=6,13,0,0,681,24751,0,0,1074,62858,0,0,318,7206,0,0;QS=3,0;MQSB=0.965977;MQ0F=0	PL:DP:DV	0,36,246:12:0	0,12,137:4:0	0,9,111:3:0
+X	2270	.	A	<*>	0	.	DP=19;I16=6,12,0,0,652,24154,0,0,1057,62569,0,0,300,6750,0,0;QS=3,0;MQSB=0.85394;MQ0F=0	PL:DP:DV	0,33,244:11:0	0,12,134:4:0	0,9,112:3:0
+X	2271	.	A	<*>	0	.	DP=17;I16=6,11,0,0,654,25406,0,0,954,55658,0,0,316,6944,0,0;QS=3,0;MQSB=0.980001;MQ0F=0	PL:DP:DV	0,30,243:10:0	0,12,142:4:0	0,9,111:3:0
+X	2272	.	T	<*>	0	.	DP=17;I16=6,10,0,0,604,22908,0,0,937,55369,0,0,297,6525,0,0;QS=3,0;MQSB=0.863243;MQ0F=0	PL:DP:DV	0,27,238:9:0	0,12,137:4:0	0,9,111:3:0
+X	2273	.	G	<*>	0	.	DP=17;I16=6,10,0,0,581,22129,0,0,937,55369,0,0,295,6411,0,0;QS=3,0;MQSB=0.863243;MQ0F=0	PL:DP:DV	0,27,240:9:0	0,12,123:4:0	0,9,115:3:0
+X	2274	.	G	<*>	0	.	DP=18;I16=6,11,0,0,621,23109,0,0,997,58969,0,0,293,6313,0,0;QS=3,0;MQSB=0.85832;MQ0F=0	PL:DP:DV	0,30,248:10:0	0,12,132:4:0	0,9,110:3:0
+X	2275	.	T	<*>	0	.	DP=18;I16=6,11,0,0,624,23152,0,0,997,58969,0,0,292,6232,0,0;QS=3,0;MQSB=0.85832;MQ0F=0	PL:DP:DV	0,30,249:10:0	0,12,126:4:0	0,9,113:3:0
+X	2276	.	G	<*>	0	.	DP=20;I16=7,12,0,0,710,26848,0,0,1074,62858,0,0,303,6313,0,0;QS=3,0;MQSB=0.985816;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,129:4:0	0,9,110:3:0
+X	2277	.	C	<*>	0	.	DP=21;I16=8,13,0,0,797,30699,0,0,1194,70058,0,0,303,6247,0,0;QS=3,0;MQSB=0.989565;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,151:5:0	0,12,143:4:0
+X	2278	.	T	<*>	0	.	DP=21;I16=7,13,0,0,736,27790,0,0,1157,68689,0,0,279,5581,0,0;QS=3,0;MQSB=0.962269;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,133:4:0	0,12,148:4:0
+X	2279	.	A	<*>	0	.	DP=20;I16=8,12,0,0,723,27047,0,0,1134,66458,0,0,306,6190,0,0;QS=3,0;MQSB=0.993326;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,155:5:0	0,12,144:4:0
+X	2280	.	G	<*>	0	.	DP=21;I16=8,12,0,0,766,29776,0,0,1177,69769,0,0,299,6085,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,166:5:0	0,12,144:4:0
+X	2281	.	C	<*>	0	.	DP=22;I16=8,13,0,0,784,29748,0,0,1237,73369,0,0,301,6037,0,0;QS=3,0;MQSB=0.895122;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,165:5:0	0,12,140:4:0
+X	2282	.	T	<*>	0	.	DP=22;I16=8,14,0,0,789,29699,0,0,1254,73658,0,0,310,6054,0,0;QS=3,0;MQSB=0.985548;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,162:5:0	0,12,150:4:0
+X	2283	.	G	<*>	0	.	DP=22;I16=8,14,0,0,798,29774,0,0,1254,73658,0,0,312,6054,0,0;QS=3,0;MQSB=0.985548;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,158:5:0	0,12,142:4:0
+X	2284	.	G	<*>	0	.	DP=22;I16=7,14,0,0,760,28408,0,0,1194,70058,0,0,294,5664,0,0;QS=3,0;MQSB=0.975265;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,130:4:0	0,12,141:4:0
+X	2285	.	G	<*>	0	.	DP=23;I16=9,14,0,0,844,31592,0,0,1314,77258,0,0,311,5909,0,0;QS=3,0;MQSB=0.992095;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,152:5:0	0,12,144:4:0
+X	2286	.	C	<*>	0	.	DP=23;I16=9,14,0,0,854,32244,0,0,1314,77258,0,0,311,5869,0,0;QS=3,0;MQSB=0.992095;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,155:5:0	0,12,130:4:0
+X	2287	.	A	<*>	0	.	DP=23;I16=9,14,0,0,818,30288,0,0,1314,77258,0,0,311,5869,0,0;QS=3,0;MQSB=0.992095;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,166:5:0	0,12,143:4:0
+X	2288	.	T	<*>	0	.	DP=22;I16=8,14,0,0,794,29190,0,0,1254,73658,0,0,312,5908,0,0;QS=3,0;MQSB=0.985548;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,158:5:0	0,12,142:4:0
+X	2289	.	G	<*>	0	.	DP=21;I16=8,13,0,0,723,25835,0,0,1237,73369,0,0,314,5984,0,0;QS=3,0;MQSB=0.895122;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,154:5:0	0,12,126:4:0
+X	2290	.	G	<*>	0	.	DP=20;I16=7,13,0,0,748,28318,0,0,1177,69769,0,0,318,6094,0,0;QS=3,0;MQSB=0.875769;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,149:5:0	0,9,114:3:0
+X	2291	.	T	<*>	0	.	DP=20;I16=7,13,0,0,731,27165,0,0,1177,69769,0,0,322,6186,0,0;QS=3,0;MQSB=0.875769;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,151:5:0	0,9,112:3:0
+X	2292	.	G	<*>	0	.	DP=20;I16=7,13,0,0,749,28747,0,0,1177,69769,0,0,325,6259,0,0;QS=3,0;MQSB=0.875769;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,156:5:0	0,9,109:3:0
+X	2293	.	G	<*>	0	.	DP=20;I16=7,13,0,0,739,27903,0,0,1177,69769,0,0,327,6311,0,0;QS=3,0;MQSB=0.875769;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,156:5:0	0,9,112:3:0
+X	2294	.	C	<*>	0	.	DP=21;I16=7,14,0,0,775,29453,0,0,1237,73369,0,0,329,6391,0,0;QS=3,0;MQSB=0.872525;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,169:5:0	0,9,114:3:0
+X	2295	.	T	<*>	0	.	DP=21;I16=7,14,0,0,773,29209,0,0,1237,73369,0,0,331,6451,0,0;QS=3,0;MQSB=0.872525;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,164:5:0	0,9,115:3:0
+X	2296	.	T	<*>	0	.	DP=21;I16=7,14,0,0,756,27780,0,0,1237,73369,0,0,333,6543,0,0;QS=3,0;MQSB=0.872525;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,160:5:0	0,9,106:3:0
+X	2297	.	G	<*>	0	.	DP=20;I16=7,13,0,0,736,27692,0,0,1177,69769,0,0,336,6666,0,0;QS=3,0;MQSB=0.875769;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,165:5:0	0,6,74:2:0
+X	2298	.	C	<*>	0	.	DP=21;I16=7,14,0,0,778,29300,0,0,1237,73369,0,0,339,6819,0,0;QS=3,0;MQSB=0.872525;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,139:5:0	0,9,106:3:0
+X	2299	.	A	<*>	0	.	DP=21;I16=7,14,0,0,714,25282,0,0,1237,73369,0,0,343,7003,0,0;QS=3,0;MQSB=0.872525;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,128:5:0	0,9,110:3:0
+X	2300	.	C	<*>	0	.	DP=21;I16=7,13,0,0,687,24749,0,0,1177,69769,0,0,326,6768,0,0;QS=3,0;MQSB=0.875769;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,148:5:0	0,9,109:3:0
+X	2301	.	C	<*>	0	.	DP=23;I16=7,15,0,0,802,30292,0,0,1266,74210,0,0,349,7363,0,0;QS=3,0;MQSB=0.970024;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,147:5:0	0,9,116:3:0
+X	2302	.	T	<*>	0	.	DP=23;I16=7,16,0,0,860,32956,0,0,1326,77810,0,0,354,7496,0,0;QS=3,0;MQSB=0.964916;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,166:5:0	0,12,150:4:0
+X	2303	.	G	<*>	0	.	DP=23;I16=7,16,0,0,817,29823,0,0,1326,77810,0,0,356,7604,0,0;QS=3,0;MQSB=0.964916;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,151:5:0	0,12,139:4:0
+X	2304	.	T	<*>	0	.	DP=23;I16=7,16,0,0,802,28628,0,0,1326,77810,0,0,357,7691,0,0;QS=3,0;MQSB=0.964916;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,148:5:0	0,12,140:4:0
+X	2305	.	A	<*>	0	.	DP=22;I16=7,14,0,0,725,25585,0,0,1237,73369,0,0,355,7791,0,0;QS=3,0;MQSB=0.872525;MQ0F=0	PL:DP:DV	0,36,248:12:0	0,15,155:5:0	0,12,129:4:0
+X	2306	.	A	<*>	0	.	DP=21;I16=7,14,0,0,727,26841,0,0,1206,70610,0,0,361,7899,0,0;QS=3,0;MQSB=0.975265;MQ0F=0	PL:DP:DV	0,36,246:12:0	0,15,168:5:0	0,12,130:4:0
+X	2307	.	T	<*>	0	.	DP=21;I16=7,14,0,0,751,27427,0,0,1206,70610,0,0,362,7964,0,0;QS=3,0;MQSB=0.975265;MQ0F=0	PL:DP:DV	0,36,251:12:0	0,15,165:5:0	0,12,141:4:0
+X	2308	.	C	<*>	0	.	DP=21;I16=7,14,0,0,735,26675,0,0,1206,70610,0,0,363,8051,0,0;QS=3,0;MQSB=0.975265;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,144:5:0	0,12,146:4:0
+X	2309	.	C	A,<*>	0	.	DP=19;I16=7,11,0,1,604,21364,16,256,1057,62569,29,841,358,8094,8,64;QS=2.95676,0.0432432,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.985816;BQB=1;MQ0F=0	PL:DP:DV	0,20,224,33,227,230:12:1	0,9,94,9,94,94:3:0	0,12,138,12,138,138:4:0
+X	2310	.	C	<*>	0	.	DP=18;I16=6,12,0,0,668,25392,0,0,1049,62041,0,0,370,8282,0,0;QS=3,0;MQSB=0.961295;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,80:2:0	0,12,139:4:0
+X	2311	.	A	<*>	0	.	DP=19;I16=7,12,0,0,707,26855,0,0,1109,65641,0,0,373,8371,0,0;QS=3,0;MQSB=0.957193;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,78:2:0	0,12,137:4:0
+X	2312	.	G	<*>	0	.	DP=20;I16=7,12,0,0,736,29118,0,0,1109,65641,0,0,364,8306,0,0;QS=3,0;MQSB=0.957193;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,82:2:0	0,9,122:3:0
+X	2313	.	C	<*>	0	.	DP=20;I16=7,13,0,0,723,27231,0,0,1169,69241,0,0,382,8596,0,0;QS=3,0;MQSB=0.962269;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,76:2:0	0,12,130:4:0
+X	2314	.	A	<*>	0	.	DP=21;I16=7,12,0,0,630,22184,0,0,1109,65641,0,0,372,8510,0,0;QS=3,0;MQSB=0.957193;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,78:2:0	0,9,115:3:0
+X	2315	.	C	<*>	0	.	DP=23;I16=7,14,0,0,739,26861,0,0,1229,72841,0,0,392,8892,0,0;QS=3,0;MQSB=0.966484;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,71:2:0	0,12,135:4:0
+X	2316	.	T	<*>	0	.	DP=23;I16=8,15,0,0,826,30690,0,0,1349,80041,0,0,408,9102,0,0;QS=3,0;MQSB=0.967216;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,105:3:0	0,15,170:5:0
+X	2317	.	T	<*>	0	.	DP=24;I16=7,16,0,0,766,27014,0,0,1349,80041,0,0,411,9211,0,0;QS=3,0;MQSB=0.973027;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,78:2:0	0,15,170:5:0
+X	2318	.	T	<*>	0	.	DP=24;I16=8,14,0,0,757,27433,0,0,1320,79200,0,0,379,8449,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,91:3:0	0,15,165:5:0
+X	2319	.	G	<*>	0	.	DP=24;I16=6,16,0,0,827,31577,0,0,1289,76441,0,0,398,8882,0,0;QS=3,0;MQSB=0.97584;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,3,43:1:0	0,15,167:5:0
+X	2320	.	G	<*>	0	.	DP=23;I16=7,16,0,0,803,29077,0,0,1349,80041,0,0,435,9675,0,0;QS=3,0;MQSB=0.973027;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,87:3:0	0,15,157:5:0
+X	2321	.	G	<*>	0	.	DP=23;I16=7,16,0,0,804,29368,0,0,1349,80041,0,0,442,9840,0,0;QS=3,0;MQSB=0.973027;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,79:3:0	0,15,169:5:0
+X	2322	.	A	<*>	0	.	DP=24;I16=7,17,0,0,860,32116,0,0,1409,83641,0,0,449,10027,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,95:3:0	0,15,178:5:0
+X	2323	.	G	<*>	0	.	DP=24;I16=7,17,0,0,863,31887,0,0,1409,83641,0,0,457,10237,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,88:3:0	0,15,153:5:0
+X	2324	.	G	<*>	0	.	DP=24;I16=7,16,0,0,786,27932,0,0,1349,80041,0,0,462,10416,0,0;QS=3,0;MQSB=0.973027;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,88:3:0	0,15,161:5:0
+X	2325	.	C	<*>	0	.	DP=24;I16=7,15,0,0,730,25576,0,0,1289,76441,0,0,427,9625,0,0;QS=3,0;MQSB=0.970024;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,102:3:0	0,12,130:4:0
+X	2326	.	C	<*>	0	.	DP=24;I16=7,15,0,0,709,23523,0,0,1320,79200,0,0,426,9498,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,241:15:0	0,9,95:3:0	0,12,133:4:0
+X	2327	.	G	<*>	0	.	DP=24;I16=7,17,0,0,817,29275,0,0,1409,83641,0,0,481,10891,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,81:3:0	0,15,158:5:0
+X	2328	.	A	<*>	0	.	DP=24;I16=6,17,0,0,814,29804,0,0,1349,80041,0,0,461,10427,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,82:3:0	0,15,172:5:0
+X	2329	.	G	<*>	0	.	DP=23;I16=6,16,0,0,755,27641,0,0,1289,76441,0,0,477,11005,0,0;QS=3,0;MQSB=0.97584;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,63:2:0	0,15,160:5:0
+X	2330	.	C	<*>	0	.	DP=24;I16=7,17,0,0,875,33131,0,0,1409,83641,0,0,498,11424,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,87:3:0	0,18,181:6:0
+X	2331	.	T	<*>	0	.	DP=24;I16=7,17,0,0,862,31882,0,0,1409,83641,0,0,505,11635,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,106:3:0	0,18,200:6:0
+X	2332	.	A	<*>	0	.	DP=25;I16=8,17,0,0,926,35412,0,0,1469,87241,0,0,512,11864,0,0;QS=3,0;MQSB=0.973216;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,97:3:0	0,18,204:6:0
+X	2333	.	G	<*>	0	.	DP=26;I16=8,17,0,0,923,35129,0,0,1469,87241,0,0,494,11436,0,0;QS=3,0;MQSB=0.973216;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,97:3:0	0,18,189:6:0
+X	2334	.	G	<*>	0	.	DP=26;I16=8,18,0,0,928,34574,0,0,1529,90841,0,0,527,12277,0,0;QS=3,0;MQSB=0.975611;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,93:3:0	0,21,202:7:0
+X	2335	.	A	<*>	0	.	DP=26;I16=8,18,0,0,967,36793,0,0,1529,90841,0,0,535,12513,0,0;QS=3,0;MQSB=0.975611;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,105:3:0	0,21,214:7:0
+X	2336	.	G	<*>	0	.	DP=26;I16=8,18,0,0,962,36346,0,0,1529,90841,0,0,543,12769,0,0;QS=3,0;MQSB=0.975611;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,92:3:0	0,21,204:7:0
+X	2337	.	G	<*>	0	.	DP=26;I16=7,18,0,0,895,32981,0,0,1469,87241,0,0,527,12465,0,0;QS=3,0;MQSB=0.977814;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,74:2:0	0,21,204:7:0
+X	2338	.	A	<*>	0	.	DP=26;I16=8,18,0,0,892,31758,0,0,1529,90841,0,0,556,13186,0,0;QS=3,0;MQSB=0.975611;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,87:3:0	0,21,194:7:0
+X	2339	.	T	<*>	0	.	DP=26;I16=7,18,0,0,827,28921,0,0,1469,87241,0,0,537,12769,0,0;QS=3,0;MQSB=0.977814;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,55:2:0	0,21,200:7:0
+X	2340	.	C	<*>	0	.	DP=25;I16=7,18,0,0,792,25816,0,0,1469,87241,0,0,541,12893,0,0;QS=3,0;MQSB=0.977814;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,57:2:0	0,21,173:7:0
+X	2341	.	G	<*>	0	.	DP=25;I16=6,17,0,0,771,26477,0,0,1349,80041,0,0,494,11732,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,3,41:1:0	0,21,186:7:0
+X	2342	.	T	<*>	0	.	DP=24;I16=6,17,0,0,863,32711,0,0,1349,80041,0,0,523,12459,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,3,43:1:0	0,21,214:7:0
+X	2343	.	T	<*>	0	.	DP=24;I16=6,16,0,0,770,28230,0,0,1289,76441,0,0,504,12032,0,0;QS=3,0;MQSB=0.97584;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,3,44:1:0	0,21,213:7:0
+X	2344	.	T	<*>	0	.	DP=24;I16=7,17,0,0,843,30483,0,0,1409,83641,0,0,552,13124,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,56:2:0	0,21,202:7:0
+X	2345	.	G	<*>	0	.	DP=24;I16=7,17,0,0,897,34121,0,0,1409,83641,0,0,554,13162,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,77:2:0	0,21,206:7:0
+X	2346	.	A	<*>	0	.	DP=24;I16=7,17,0,0,908,34818,0,0,1409,83641,0,0,556,13212,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,68:2:0	0,21,220:7:0
+X	2347	.	G	<*>	0	.	DP=24;I16=6,17,0,0,824,30406,0,0,1349,80041,0,0,533,12649,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,3,39:1:0	0,21,190:7:0
+X	2348	.	T	<*>	0	.	DP=24;I16=7,16,0,0,745,25653,0,0,1349,80041,0,0,544,13072,0,0;QS=3,0;MQSB=0.973027;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,64:2:0	0,18,183:6:0
+X	2349	.	C	<*>	0	.	DP=24;I16=6,17,0,0,804,29224,0,0,1349,80041,0,0,534,12656,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,3,36:1:0	0,21,200:7:0
+X	2350	.	C	<*>	0	.	DP=25;I16=7,17,0,0,869,31905,0,0,1409,83641,0,0,534,12652,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,63:2:0	0,21,198:7:0
+X	2351	.	A	<*>	0	.	DP=25;I16=8,17,0,0,945,36169,0,0,1469,87241,0,0,559,13237,0,0;QS=3,0;MQSB=0.973216;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,74:2:0	0,21,222:7:0
+X	2352	.	G	<*>	0	.	DP=25;I16=7,17,0,0,893,34005,0,0,1409,83641,0,0,533,12539,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,3,41:1:0	0,21,207:7:0
+X	2353	.	C	<*>	0	.	DP=24;I16=7,17,0,0,866,31864,0,0,1409,83641,0,0,531,12435,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,3,41:1:0	0,21,205:7:0
+X	2354	.	A	<*>	0	.	DP=24;I16=7,17,0,0,880,33206,0,0,1409,83641,0,0,529,12351,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,3,43:1:0	0,21,214:7:0
+X	2355	.	G	<*>	0	.	DP=24;I16=7,17,0,0,871,32261,0,0,1409,83641,0,0,526,12238,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,3,39:1:0	0,21,195:7:0
+X	2356	.	T	<*>	0	.	DP=24;I16=7,17,0,0,887,33305,0,0,1409,83641,0,0,521,12047,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,3,43:1:0	0,21,219:7:0
+X	2357	.	T	<*>	0	.	DP=24;I16=7,17,0,0,899,34225,0,0,1409,83641,0,0,516,11878,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,3,43:1:0	0,21,220:7:0
+X	2358	.	T	<*>	0	.	DP=24;I16=7,17,0,0,913,34891,0,0,1409,83641,0,0,510,11680,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,3,40:1:0	0,21,218:7:0
+X	2359	.	G	<*>	0	.	DP=25;I16=7,17,0,0,898,34048,0,0,1409,83641,0,0,503,11451,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,3,39:1:0	0,21,209:7:0
+X	2360	.	A	<*>	0	.	DP=25;I16=7,18,0,0,959,37113,0,0,1469,87241,0,0,514,11552,0,0;QS=3,0;MQSB=0.977814;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,72:2:0	0,21,222:7:0
+X	2361	.	G	<*>	0	.	DP=25;I16=7,17,0,0,850,30946,0,0,1409,83641,0,0,482,10726,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,67:2:0	0,18,168:6:0
+X	2362	.	A	<*>	0	.	DP=25;I16=7,17,0,0,762,25482,0,0,1409,83641,0,0,475,10547,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,51:2:0	0,18,159:6:0
+X	2363	.	C	<*>	0	.	DP=25;I16=7,18,0,0,875,31837,0,0,1469,87241,0,0,493,11015,0,0;QS=3,0;MQSB=0.977814;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,65:2:0	0,21,187:7:0
+X	2364	.	C	<*>	0	.	DP=25;I16=7,18,0,0,927,34965,0,0,1469,87241,0,0,486,10880,0,0;QS=3,0;MQSB=0.977814;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,64:2:0	0,21,201:7:0
+X	2365	.	A	<*>	0	.	DP=24;I16=7,17,0,0,908,34754,0,0,1409,83641,0,0,479,10717,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,65:2:0	0,21,221:7:0
+X	2366	.	G	<*>	0	.	DP=25;I16=7,17,0,0,912,35074,0,0,1440,86400,0,0,447,9951,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,58:2:0	0,21,206:7:0
+X	2367	.	C	<*>	0	.	DP=25;I16=7,17,0,0,872,32088,0,0,1409,83641,0,0,440,9782,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,3,36:1:0	0,21,197:7:0
+X	2368	.	C	<*>	0	.	DP=24;I16=6,17,0,0,871,33801,0,0,1349,80041,0,0,434,9634,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,3,39:1:0	0,18,180:6:0
+X	2369	.	T	<*>	0	.	DP=24;I16=6,18,0,0,877,33009,0,0,1409,83641,0,0,452,10082,0,0;QS=3,0;MQSB=0.980199;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,49:2:0	0,18,179:6:0
+X	2370	.	G	<*>	0	.	DP=24;I16=6,18,0,0,899,34289,0,0,1409,83641,0,0,445,9927,0,0;QS=3,0;MQSB=0.980199;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,56:2:0	0,18,179:6:0
+X	2371	.	G	<*>	0	.	DP=24;I16=6,18,0,0,880,33088,0,0,1409,83641,0,0,438,9794,0,0;QS=3,0;MQSB=0.980199;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,51:2:0	0,18,177:6:0
+X	2372	.	C	<*>	0	.	DP=24;I16=6,18,0,0,827,29615,0,0,1409,83641,0,0,431,9683,0,0;QS=3,0;MQSB=0.980199;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,47:2:0	0,18,163:6:0
+X	2373	.	C	<*>	0	.	DP=24;I16=6,18,0,0,886,33212,0,0,1409,83641,0,0,424,9594,0,0;QS=3,0;MQSB=0.980199;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,58:2:0	0,18,166:6:0
+X	2374	.	A	<*>	0	.	DP=23;I16=6,17,0,0,844,31230,0,0,1349,80041,0,0,417,9477,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,66:2:0	0,18,177:6:0
+X	2375	.	A	<*>	0	.	DP=23;I16=5,17,0,0,788,28340,0,0,1289,76441,0,0,409,9333,0,0;QS=3,0;MQSB=0.981001;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,64:2:0	0,18,171:6:0
+X	2376	.	T	<*>	0	.	DP=22;I16=5,17,0,0,778,27804,0,0,1289,76441,0,0,401,9161,0,0;QS=3,0;MQSB=0.981001;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,62:2:0	0,18,162:6:0
+X	2377	.	A	<*>	0	.	DP=21;I16=4,17,0,0,704,24488,0,0,1229,72841,0,0,394,9008,0,0;QS=3,0;MQSB=0.984085;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,49:2:0	0,15,135:5:0
+X	2378	.	C	<*>	0	.	DP=20;I16=4,16,0,0,626,20138,0,0,1169,69241,0,0,388,8872,0,0;QS=3,0;MQSB=0.982301;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,3,15:1:0	0,15,108:5:0
+X	2379	.	G	<*>	0	.	DP=20;I16=4,16,0,0,714,25924,0,0,1169,69241,0,0,382,8752,0,0;QS=3,0;MQSB=0.982301;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,3,34:1:0	0,15,140:5:0
+X	2380	.	G	<*>	0	.	DP=19;I16=4,14,0,0,672,25672,0,0,1049,62041,0,0,352,8022,0,0;QS=3,0;MQSB=0.977696;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,18:1:0	0,15,134:5:0
+X	2381	.	C	<*>	0	.	DP=18;I16=4,14,0,0,676,25626,0,0,1049,62041,0,0,373,8555,0,0;QS=3,0;MQSB=0.977696;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,28:1:0	0,15,133:5:0
+X	2382	.	A	<*>	0	.	DP=19;I16=5,14,0,0,669,23995,0,0,1109,65641,0,0,369,8475,0,0;QS=3,0;MQSB=0.97357;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,3,28:1:0	0,15,131:5:0
+X	2383	.	A	<*>	0	.	DP=19;I16=5,14,0,0,686,25162,0,0,1109,65641,0,0,365,8359,0,0;QS=3,0;MQSB=0.97357;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,3,26:1:0	0,15,140:5:0
+X	2384	.	A	<*>	0	.	DP=19;I16=5,14,0,0,649,22943,0,0,1109,65641,0,0,360,8210,0,0;QS=3,0;MQSB=0.97357;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,3,13:1:0	0,15,132:5:0
+X	2385	.	A	<*>	0	.	DP=18;I16=4,14,0,0,643,23235,0,0,1049,62041,0,0,356,8078,0,0;QS=3,0;MQSB=0.977696;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,38:1:0	0,15,134:5:0
+X	2386	.	C	<*>	0	.	DP=18;I16=4,14,0,0,652,24008,0,0,1049,62041,0,0,351,7913,0,0;QS=3,0;MQSB=0.977696;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,25:1:0	0,15,130:5:0
+X	2387	.	C	<*>	0	.	DP=18;I16=4,14,0,0,667,25007,0,0,1049,62041,0,0,345,7717,0,0;QS=3,0;MQSB=0.977696;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,25:1:0	0,15,128:5:0
+X	2388	.	C	<*>	0	.	DP=18;I16=4,14,0,0,691,26659,0,0,1049,62041,0,0,339,7541,0,0;QS=3,0;MQSB=0.977696;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,39:1:0	0,15,134:5:0
+X	2389	.	A	<*>	0	.	DP=19;I16=5,14,0,0,682,24912,0,0,1109,65641,0,0,333,7385,0,0;QS=3,0;MQSB=0.97357;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,3,35:1:0	0,15,140:5:0
+X	2390	.	G	<*>	0	.	DP=18;I16=5,13,0,0,642,23418,0,0,1049,62041,0,0,328,7200,0,0;QS=3,0;MQSB=0.970092;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,27:1:0	0,15,126:5:0
+X	2391	.	T	<*>	0	.	DP=18;I16=5,12,0,0,624,23122,0,0,989,58441,0,0,298,6412,0,0;QS=2,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,0,0:0:0	0,15,140:5:0
+X	2392	.	C	<*>	0	.	DP=18;I16=5,12,0,0,660,25910,0,0,989,58441,0,0,291,6171,0,0;QS=2,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,0,0:0:0	0,15,131:5:0
+X	2393	.	T	<*>	0	.	DP=18;I16=5,13,0,0,669,25099,0,0,1049,62041,0,0,309,6577,0,0;QS=3,0;MQSB=0.970092;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,38:1:0	0,15,134:5:0
+X	2394	.	C	<*>	0	.	DP=17;I16=5,12,0,0,653,25323,0,0,989,58441,0,0,303,6379,0,0;QS=3,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,29:1:0	0,15,133:5:0
+X	2395	.	T	<*>	0	.	DP=17;I16=5,12,0,0,613,22621,0,0,989,58441,0,0,297,6201,0,0;QS=3,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,19:1:0	0,15,128:5:0
+X	2396	.	A	<*>	0	.	DP=17;I16=5,11,0,0,584,21426,0,0,929,54841,0,0,266,5418,0,0;QS=2,0;MQSB=0.960687;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,0,0:0:0	0,15,130:5:0
+X	2397	.	C	<*>	0	.	DP=18;I16=5,13,0,0,650,24046,0,0,1049,62041,0,0,284,5856,0,0;QS=3,0;MQSB=0.970092;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,18:1:0	0,15,129:5:0
+X	2398	.	A	<*>	0	.	DP=18;I16=5,13,0,0,617,21907,0,0,1049,62041,0,0,278,5692,0,0;QS=3,0;MQSB=0.970092;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,19:1:0	0,15,128:5:0
+X	2399	.	A	<*>	0	.	DP=17;I16=5,11,0,0,592,22176,0,0,929,54841,0,0,248,4926,0,0;QS=2,0;MQSB=0.960687;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,0,0:0:0	0,12,115:4:0
+X	2400	.	A	<*>	0	.	DP=16;I16=5,11,0,0,576,21010,0,0,929,54841,0,0,269,5431,0,0;QS=3,0;MQSB=0.960687;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,26:1:0	0,9,99:3:0
+X	2401	.	A	<*>	0	.	DP=17;I16=6,11,0,0,594,21126,0,0,989,58441,0,0,265,5331,0,0;QS=3,0;MQSB=0.955563;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,3,23:1:0	0,9,98:3:0
+X	2402	.	A	<*>	0	.	DP=17;I16=6,11,0,0,606,21986,0,0,989,58441,0,0,262,5252,0,0;QS=3,0;MQSB=0.955563;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,3,27:1:0	0,9,99:3:0
+X	2403	.	A	<*>	0	.	DP=17;I16=6,11,0,0,608,22130,0,0,989,58441,0,0,259,5195,0,0;QS=3,0;MQSB=0.955563;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,3,21:1:0	0,9,97:3:0
+X	2404	.	T	<*>	0	.	DP=17;I16=6,11,0,0,567,19449,0,0,989,58441,0,0,256,5160,0,0;QS=3,0;MQSB=0.955563;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,3,14:1:0	0,9,87:3:0
+X	2405	.	A	<*>	0	.	DP=18;I16=7,11,0,0,618,21666,0,0,1049,62041,0,0,253,5147,0,0;QS=3,0;MQSB=0.951002;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,3,17:1:0	0,9,88:3:0
+X	2406	.	C	<*>	0	.	DP=18;I16=7,11,0,0,676,25664,0,0,1049,62041,0,0,250,5108,0,0;QS=3,0;MQSB=0.951002;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,3,27:1:0	0,9,90:3:0
+X	2407	.	A	<*>	0	.	DP=19;I16=8,11,0,0,673,24197,0,0,1109,65641,0,0,246,5046,0,0;QS=3,0;MQSB=0.946915;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,3,34:1:0	0,9,89:3:0
+X	2408	.	A	<*>	0	.	DP=18;I16=8,10,0,0,619,21951,0,0,1049,62041,0,0,243,4961,0,0;QS=3,0;MQSB=0.938795;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,3,22:1:0	0,6,73:2:0
+X	2409	.	A	<*>	0	.	DP=17;I16=8,9,0,0,615,22687,0,0,1020,61200,0,0,240,4852,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,3,39:1:0	0,6,74:2:0
+X	2410	.	A	<*>	0	.	DP=17;I16=8,9,0,0,604,21938,0,0,1020,61200,0,0,237,4769,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,3,39:1:0	0,6,73:2:0
+X	2411	.	A	<*>	0	.	DP=16;I16=7,9,0,0,567,20551,0,0,960,57600,0,0,235,4711,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,3,25:1:0	0,6,70:2:0
+X	2412	.	A	<*>	0	.	DP=15;I16=7,8,0,0,527,18903,0,0,900,54000,0,0,234,4676,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,21:1:0	0,6,70:2:0
+X	2413	.	C	<*>	0	.	DP=15;I16=7,8,0,0,559,21161,0,0,900,54000,0,0,233,4663,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,22:1:0	0,6,72:2:0
+X	2414	.	A	<*>	0	.	DP=16;I16=8,8,0,0,570,20822,0,0,929,54841,0,0,232,4672,0,0;QS=3,0;MQSB=0.915545;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,3,25:1:0	0,6,73:2:0
+X	2415	.	A	<*>	0	.	DP=16;I16=9,7,0,0,574,20768,0,0,929,54841,0,0,232,4652,0,0;QS=3,0;MQSB=0.933674;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,3,30:1:0	0,6,64:2:0
+X	2416	.	C	<*>	0	.	DP=17;I16=8,8,0,0,576,21424,0,0,960,57600,0,0,231,4649,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,42:2:0	0,6,68:2:0
+X	2417	.	T	<*>	0	.	DP=17;I16=10,7,0,0,612,22740,0,0,958,55682,0,0,235,4627,0,0;QS=3,0;MQSB=0.79189;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,57:2:0	0,9,92:3:0
+X	2418	.	A	<*>	0	.	DP=17;I16=10,7,0,0,624,23210,0,0,958,55682,0,0,238,4626,0,0;QS=3,0;MQSB=0.79189;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,62:2:0	0,9,105:3:0
+X	2419	.	G	<*>	0	.	DP=19;I16=11,7,0,0,651,24113,0,0,1018,59282,0,0,241,4651,0,0;QS=3,0;MQSB=0.817948;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,51:2:0	0,12,126:4:0
+X	2420	.	C	<*>	0	.	DP=19;I16=11,8,0,0,663,23999,0,0,1078,62882,0,0,246,4704,0,0;QS=3,0;MQSB=0.803979;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,44:2:0	0,12,127:4:0
+X	2421	.	C	<*>	0	.	DP=19;I16=10,8,0,0,657,24779,0,0,1049,62041,0,0,244,4738,0,0;QS=3,0;MQSB=0.938795;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,45:2:0	0,12,126:4:0
+X	2422	.	A	<*>	0	.	DP=18;I16=11,6,0,0,647,24747,0,0,958,55682,0,0,238,4538,0,0;QS=3,0;MQSB=0.833753;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,33:1:0	0,12,137:4:0
+X	2423	.	G	<*>	0	.	DP=18;I16=11,6,0,0,634,24250,0,0,958,55682,0,0,258,4972,0,0;QS=3,0;MQSB=0.833753;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,54:2:0	0,12,126:4:0
+X	2424	.	G	<*>	0	.	DP=18;I16=10,6,0,0,595,22361,0,0,929,54841,0,0,240,4714,0,0;QS=3,0;MQSB=0.948436;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,36:1:0	0,12,126:4:0
+X	2425	.	C	<*>	0	.	DP=18;I16=10,7,0,0,596,21716,0,0,989,58441,0,0,260,5074,0,0;QS=3,0;MQSB=0.943335;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,45:2:0	0,12,114:4:0
+X	2426	.	G	<*>	0	.	DP=18;I16=10,7,0,0,550,18088,0,0,989,58441,0,0,263,5171,0,0;QS=3,0;MQSB=0.943335;MQ0F=0	PL:DP:DV	0,33,232:11:0	0,6,59:2:0	0,12,113:4:0
+X	2427	.	T	<*>	0	.	DP=18;I16=11,6,0,0,618,22654,0,0,958,55682,0,0,275,5403,0,0;QS=3,0;MQSB=0.833753;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,62:2:0	0,9,99:3:0
+X	2428	.	G	<*>	0	.	DP=18;I16=11,7,0,0,649,24633,0,0,1018,59282,0,0,281,5535,0,0;QS=3,0;MQSB=0.817948;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,48:2:0	0,12,128:4:0
+X	2429	.	G	<*>	0	.	DP=18;I16=10,7,0,0,553,19057,0,0,989,58441,0,0,269,5459,0,0;QS=3,0;MQSB=0.943335;MQ0F=0	PL:DP:DV	0,33,241:11:0	0,6,55:2:0	0,12,117:4:0
+X	2430	.	T	A,<*>	0	.	DP=18;I16=10,7,1,0,552,18556,21,441,989,58441,29,841,271,5603,16,256;QS=2.94278,0.0572207,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.817948;BQB=1;MQ0F=0	PL:DP:DV	0,15,212,33,215,222:12:1	0,6,60,6,60,60:2:0	0,12,125,12,125,125:4:0
+X	2431	.	G	<*>	0	.	DP=18;I16=11,5,0,0,580,21766,0,0,898,52082,0,0,268,5764,0,0;QS=3,0;MQSB=0.851779;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,37:1:0	0,9,98:3:0
+X	2432	.	G	<*>	0	.	DP=17;I16=10,7,0,0,593,21479,0,0,958,55682,0,0,295,6179,0,0;QS=3,0;MQSB=0.79189;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,53:2:0	0,9,97:3:0
+X	2433	.	T	<*>	0	.	DP=17;I16=10,7,0,0,577,20425,0,0,958,55682,0,0,299,6321,0,0;QS=3,0;MQSB=0.79189;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,57:2:0	0,9,94:3:0
+X	2434	.	G	<*>	0	.	DP=17;I16=10,6,0,0,546,19340,0,0,929,54841,0,0,284,6082,0,0;QS=3,0;MQSB=0.948436;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,46:2:0	0,6,62:2:0
+X	2435	.	C	<*>	0	.	DP=18;I16=12,5,0,0,597,21843,0,0,958,55682,0,0,304,6626,0,0;QS=3,0;MQSB=0.870325;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,58:2:0	0,6,60:2:0
+X	2436	.	A	<*>	0	.	DP=18;I16=11,6,0,0,545,18599,0,0,989,58441,0,0,295,6379,0,0;QS=3,0;MQSB=0.955563;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,64:3:0	0,6,61:2:0
+X	2437	.	C	<*>	0	.	DP=18;I16=11,5,0,0,573,21195,0,0,929,54841,0,0,297,6541,0,0;QS=3,0;MQSB=0.960687;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,63:2:0	0,6,63:2:0
+X	2438	.	A	<*>	0	.	DP=19;I16=12,6,0,0,583,20111,0,0,1018,59282,0,0,328,7322,0,0;QS=3,0;MQSB=0.85394;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,65:2:0	0,6,65:2:0
+X	2439	.	C	<*>	0	.	DP=19;I16=11,7,0,0,635,22997,0,0,1049,62041,0,0,314,6974,0,0;QS=3,0;MQSB=0.951002;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,91:3:0	0,6,57:2:0
+X	2440	.	C	<*>	0	.	DP=21;I16=13,7,0,0,701,26195,0,0,1138,66482,0,0,346,7840,0,0;QS=3,0;MQSB=0.857404;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,114:4:0	0,6,66:2:0
+X	2441	.	T	<*>	0	.	DP=21;I16=13,8,0,0,788,29910,0,0,1198,70082,0,0,360,8068,0,0;QS=3,0;MQSB=0.845496;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,164:5:0	0,6,67:2:0
+X	2442	.	G	<*>	0	.	DP=20;I16=12,7,0,0,695,25957,0,0,1109,65641,0,0,342,7596,0,0;QS=3,0;MQSB=0.957193;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,128:4:0	0,6,66:2:0
+X	2443	.	T	<*>	0	.	DP=20;I16=13,7,0,0,697,24685,0,0,1138,66482,0,0,373,8345,0,0;QS=3,0;MQSB=0.857404;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,130:4:0	0,6,64:2:0
+X	2444	.	A	<*>	0	.	DP=21;I16=13,8,0,0,755,27981,0,0,1198,70082,0,0,379,8489,0,0;QS=3,0;MQSB=0.845496;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,140:4:0	0,6,64:2:0
+X	2445	.	G	<*>	0	.	DP=21;I16=12,8,0,0,731,27427,0,0,1169,69241,0,0,359,7927,0,0;QS=3,0;MQSB=0.953497;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,130:4:0	0,6,65:2:0
+X	2446	.	T	<*>	0	.	DP=21;I16=13,8,0,0,723,25707,0,0,1198,70082,0,0,389,8633,0,0;QS=3,0;MQSB=0.845496;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,128:4:0	0,6,65:2:0
+X	2447	.	C	<*>	0	.	DP=22;I16=14,8,0,0,770,27950,0,0,1258,73682,0,0,394,8732,0,0;QS=3,0;MQSB=0.86151;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,127:4:0	0,6,64:2:0
+X	2448	.	C	<*>	0	.	DP=23;I16=14,7,0,0,727,26165,0,0,1167,67323,0,0,388,8674,0,0;QS=3,0;MQSB=0.735784;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,129:5:0	0,6,66:2:0
+X	2449	.	C	<*>	0	.	DP=23;I16=13,8,0,0,727,26415,0,0,1198,70082,0,0,363,7787,0,0;QS=3,0;MQSB=0.845496;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,128:5:0	0,6,62:2:0
+X	2450	.	A	<*>	0	.	DP=22;I16=12,8,0,0,673,24267,0,0,1138,66482,0,0,371,7959,0,0;QS=3,0;MQSB=0.826565;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,143:5:0	0,6,65:2:0
+X	2451	.	G	<*>	0	.	DP=22;I16=14,8,0,0,821,31595,0,0,1227,70923,0,0,429,9401,0,0;QS=3,0;MQSB=0.715049;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,151:5:0	0,6,67:2:0
+X	2452	.	C	<*>	0	.	DP=22;I16=14,8,0,0,743,26557,0,0,1227,70923,0,0,437,9613,0,0;QS=3,0;MQSB=0.715049;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,137:5:0	0,6,66:2:0
+X	2453	.	T	<*>	0	.	DP=22;I16=14,8,0,0,775,28215,0,0,1227,70923,0,0,445,9845,0,0;QS=3,0;MQSB=0.715049;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,143:5:0	0,6,68:2:0
+X	2454	.	A	<*>	0	.	DP=22;I16=14,8,0,0,721,24545,0,0,1227,70923,0,0,453,10097,0,0;QS=3,0;MQSB=0.715049;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,145:5:0	0,6,64:2:0
+X	2455	.	C	<*>	0	.	DP=22;I16=14,8,0,0,776,28212,0,0,1227,70923,0,0,461,10369,0,0;QS=3,0;MQSB=0.715049;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,138:5:0	0,6,65:2:0
+X	2456	.	T	<*>	0	.	DP=24;I16=14,9,0,0,834,30902,0,0,1318,77282,0,0,444,10036,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,168:6:0	0,6,60:2:0
+X	2457	.	C	<*>	0	.	DP=24;I16=15,9,0,0,816,29244,0,0,1347,78123,0,0,478,10924,0,0;QS=3,0;MQSB=0.72325;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,159:6:0	0,6,65:2:0
+X	2458	.	A	<*>	0	.	DP=24;I16=15,9,0,0,869,32555,0,0,1347,78123,0,0,487,11209,0,0;QS=3,0;MQSB=0.72325;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,166:6:0	0,6,65:2:0
+X	2459	.	G	T,<*>	0	.	DP=24;I16=13,9,1,0,822,31186,13,169,1289,76441,29,841,453,10551,17,289;QS=2.92973,0.0702703,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.851535;BQB=1;MQ0F=0	PL:DP:DV	0,45,255,45,255,255:15:0	0,5,138,15,141,144:6:1	0,6,64,6,64,64:2:0
+X	2460	.	G	<*>	0	.	DP=24;I16=14,9,0,0,834,31432,0,0,1318,77282,0,0,477,11065,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,160:6:0	0,6,65:2:0
+X	2461	.	A	G,<*>	0	.	DP=24;I16=14,9,1,0,839,31487,13,169,1318,77282,29,841,489,11521,19,361;QS=2.93401,0.0659898,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.72325;BQB=1;MQ0F=0	PL:DP:DV	0,48,255,48,255,255:16:0	0,5,148,15,151,154:6:1	0,6,67,6,67,67:2:0
+X	2462	.	G	<*>	0	.	DP=25;I16=15,10,0,0,893,33155,0,0,1407,81723,0,0,514,12090,0,0;QS=3,0;MQSB=0.707404;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,165:6:0	0,6,66:2:0
+X	2463	.	G	T,<*>	0	.	DP=25;I16=12,10,1,0,777,28525,14,196,1289,76441,29,841,452,10720,25,625;QS=2.975,0.025,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.825053;BQB=1;MQ0F=0	PL:DP:DV	0,36,255,48,255,255:17:1	0,12,133,12,133,133:4:0	0,6,68,6,68,68:2:0
+X	2464	.	C	<*>	0	.	DP=25;I16=15,10,0,0,904,34194,0,0,1407,81723,0,0,526,12458,0,0;QS=3,0;MQSB=0.707404;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,149:6:0	0,6,67:2:0
+X	2465	.	T	<*>	0	.	DP=25;I16=14,10,0,0,857,32235,0,0,1347,78123,0,0,506,11994,0,0;QS=3,0;MQSB=0.679965;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,163:6:0	0,6,69:2:0
+X	2466	.	G	<*>	0	.	DP=24;I16=14,9,0,0,852,32336,0,0,1318,77282,0,0,509,12025,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,157:6:0	0,6,63:2:0
+X	2467	.	A	<*>	0	.	DP=24;I16=14,9,0,0,829,30725,0,0,1318,77282,0,0,513,12121,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,168:6:0	0,6,67:2:0
+X	2468	.	G	<*>	0	.	DP=24;I16=15,9,0,0,890,34034,0,0,1347,78123,0,0,541,12807,0,0;QS=3,0;MQSB=0.72325;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,169:6:0	0,6,64:2:0
+X	2469	.	G	<*>	0	.	DP=24;I16=15,9,0,0,865,32303,0,0,1347,78123,0,0,544,12882,0,0;QS=3,0;MQSB=0.72325;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,174:6:0	0,6,58:2:0
+X	2470	.	G	<*>	0	.	DP=24;I16=14,9,0,0,829,30785,0,0,1318,77282,0,0,521,12295,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,178:6:0	0,6,58:2:0
+X	2471	.	G	<*>	0	.	DP=24;I16=14,9,0,0,833,31429,0,0,1318,77282,0,0,523,12345,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,170:5:0	0,6,64:2:0
+X	2472	.	G	<*>	0	.	DP=24;I16=13,9,0,0,774,28428,0,0,1289,76441,0,0,499,11733,0,0;QS=3,0;MQSB=0.955854;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,154:5:0	0,6,56:2:0
+X	2473	.	A	<*>	0	.	DP=24;I16=13,9,0,0,775,28137,0,0,1258,73682,0,0,508,12078,0,0;QS=3,0;MQSB=0.834768;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,160:5:0	0,6,63:2:0
+X	2474	.	A	<*>	0	.	DP=25;I16=15,9,0,0,851,31665,0,0,1378,80882,0,0,524,12322,0,0;QS=3,0;MQSB=0.865888;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,160:5:0	0,9,80:3:0
+X	2475	.	G	<*>	0	.	DP=25;I16=15,9,0,0,913,35239,0,0,1378,80882,0,0,525,12323,0,0;QS=3,0;MQSB=0.865888;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,167:5:0	0,9,84:3:0
+X	2476	.	G	<*>	0	.	DP=25;I16=13,9,0,0,776,28584,0,0,1289,76441,0,0,488,11544,0,0;QS=3,0;MQSB=0.955854;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,138:5:0	0,9,82:3:0
+X	2477	.	A	<*>	0	.	DP=25;I16=14,9,0,0,867,34329,0,0,1318,77282,0,0,515,12223,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,178:5:0	0,9,91:3:0
+X	2478	.	C	<*>	0	.	DP=25;I16=14,9,0,0,897,36911,0,0,1318,77282,0,0,517,12289,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,175:5:0	0,9,87:3:0
+X	2479	.	T	<*>	0	.	DP=25;I16=15,9,0,0,921,37957,0,0,1378,80882,0,0,529,12467,0,0;QS=3,0;MQSB=0.865888;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,176:5:0	0,9,97:3:0
+X	2480	.	G	<*>	0	.	DP=25;I16=14,9,0,0,877,35485,0,0,1349,80041,0,0,504,11864,0,0;QS=3,0;MQSB=0.960618;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,176:5:0	0,9,88:3:0
+X	2481	.	C	<*>	0	.	DP=25;I16=13,9,0,0,848,34542,0,0,1289,76441,0,0,496,11838,0,0;QS=3,0;MQSB=0.955854;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,183:5:0	0,9,88:3:0
+X	2482	.	T	<*>	0	.	DP=25;I16=15,9,0,0,905,37331,0,0,1378,80882,0,0,526,12430,0,0;QS=3,0;MQSB=0.865888;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,178:5:0	0,9,96:3:0
+X	2483	.	T	<*>	0	.	DP=25;I16=14,9,0,0,879,36187,0,0,1318,77282,0,0,517,12311,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,180:5:0	0,9,89:3:0
+X	2484	.	G	<*>	0	.	DP=25;I16=14,9,0,0,884,35142,0,0,1349,80041,0,0,494,11604,0,0;QS=3,0;MQSB=0.960618;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,174:5:0	0,9,84:3:0
+X	2485	.	A	T,<*>	0	.	DP=25;I16=14,9,1,0,891,36757,17,289,1349,80041,29,841,490,11502,25,625;QS=2.96926,0.0307414,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.865888;BQB=1;MQ0F=0	PL:DP:DV	0,31,255,45,255,255:16:1	0,15,193,15,193,193:5:0	0,9,93,9,93,93:3:0
+X	2486	.	G	<*>	0	.	DP=25;I16=15,9,0,0,898,36230,0,0,1378,80882,0,0,511,12041,0,0;QS=3,0;MQSB=0.865888;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,153:5:0	0,9,90:3:0
+X	2487	.	C	<*>	0	.	DP=25;I16=14,9,0,0,793,30695,0,0,1349,80041,0,0,482,11346,0,0;QS=3,0;MQSB=0.960618;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,175:5:0	0,9,91:3:0
+X	2488	.	C	<*>	0	.	DP=25;I16=13,9,0,0,841,34597,0,0,1289,76441,0,0,457,10841,0,0;QS=3,0;MQSB=0.955854;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,174:5:0	0,9,93:3:0
+X	2489	.	C	<*>	0	.	DP=23;I16=11,9,0,0,801,34227,0,0,1169,69241,0,0,454,10788,0,0;QS=3,0;MQSB=0.943233;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,187:5:0	0,9,93:3:0
+X	2490	.	A	<*>	0	.	DP=23;I16=11,10,0,0,818,34642,0,0,1229,72841,0,0,451,10695,0,0;QS=3,0;MQSB=0.939898;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,175:5:0	0,12,128:4:0
+X	2491	.	G	<*>	0	.	DP=23;I16=12,10,0,0,845,35143,0,0,1258,73682,0,0,471,11097,0,0;QS=3,0;MQSB=0.804615;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,178:5:0	0,12,121:4:0
+X	2492	.	G	A,<*>	0	.	DP=23;I16=11,10,1,0,845,36207,16,256,1229,72841,29,841,446,10494,21,441;QS=2.96708,0.0329218,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.804615;BQB=1;MQ0F=0	PL:DP:DV	0,22,255,36,255,255:13:1	0,15,187,15,187,187:5:0	0,12,124,12,124,124:4:0
+X	2493	.	A	G,<*>	0	.	DP=23;I16=11,10,1,0,855,37007,13,169,1229,72841,29,841,442,10340,20,400;QS=2.97269,0.0273109,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.804615;BQB=1;MQ0F=0	PL:DP:DV	0,25,255,36,255,255:13:1	0,15,191,15,191,191:5:0	0,12,127,12,127,127:4:0
+X	2494	.	G	<*>	0	.	DP=23;I16=11,10,0,0,802,32720,0,0,1229,72841,0,0,437,10153,0,0;QS=3,0;MQSB=0.939898;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,179:5:0	0,12,118:4:0
+X	2495	.	T	<*>	0	.	DP=23;I16=10,10,0,0,737,29861,0,0,1138,66482,0,0,413,9513,0,0;QS=3,0;MQSB=0.751477;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,172:5:0	0,12,113:4:0
+X	2496	.	T	<*>	0	.	DP=23;I16=12,10,0,0,815,32793,0,0,1258,73682,0,0,442,10026,0,0;QS=3,0;MQSB=0.804615;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,183:5:0	0,12,123:4:0
+X	2497	.	T	<*>	0	.	DP=22;I16=12,9,0,0,807,33723,0,0,1198,70082,0,0,436,9814,0,0;QS=3,0;MQSB=0.815018;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,177:5:0	0,12,131:4:0
+X	2498	.	G	<*>	0	.	DP=22;I16=12,9,0,0,808,33264,0,0,1198,70082,0,0,430,9622,0,0;QS=3,0;MQSB=0.815018;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,173:5:0	0,12,127:4:0
+X	2499	.	A	<*>	0	.	DP=22;I16=12,9,0,0,847,36803,0,0,1198,70082,0,0,424,9450,0,0;QS=3,0;MQSB=0.815018;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,185:5:0	0,12,133:4:0
+X	2500	.	G	<*>	0	.	DP=22;I16=11,9,0,0,772,32546,0,0,1169,69241,0,0,404,9078,0,0;QS=3,0;MQSB=0.943233;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,168:5:0	0,12,129:4:0
+X	2501	.	G	<*>	0	.	DP=22;I16=11,8,0,0,768,33120,0,0,1109,65641,0,0,373,8293,0,0;QS=3,0;MQSB=0.946915;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,146:4:0	0,12,118:4:0
+X	2502	.	C	<*>	0	.	DP=22;I16=12,8,0,0,798,33902,0,0,1138,66482,0,0,378,8270,0,0;QS=3,0;MQSB=0.826565;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,155:4:0	0,12,125:4:0
+X	2503	.	T	<*>	0	.	DP=22;I16=12,9,0,0,851,36841,0,0,1198,70082,0,0,396,8746,0,0;QS=3,0;MQSB=0.815018;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,180:5:0	0,12,139:4:0
+X	2504	.	G	<*>	0	.	DP=22;I16=12,9,0,0,787,31955,0,0,1198,70082,0,0,389,8615,0,0;QS=3,0;MQSB=0.815018;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,171:5:0	0,12,129:4:0
+X	2505	.	C	<*>	0	.	DP=21;I16=11,9,0,0,792,33440,0,0,1138,66482,0,0,383,8501,0,0;QS=3,0;MQSB=0.791547;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,169:5:0	0,12,132:4:0
+X	2506	.	T	<*>	0	.	DP=22;I16=11,10,0,0,798,32868,0,0,1198,70082,0,0,376,8354,0,0;QS=3,0;MQSB=0.780412;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,175:5:0	0,15,169:5:0
+X	2507	.	G	<*>	0	.	DP=21;I16=9,10,0,0,716,30074,0,0,1109,65641,0,0,365,8189,0,0;QS=3,0;MQSB=0.920044;MQ0F=0	PL:DP:DV	0,27,241:9:0	0,15,163:5:0	0,15,153:5:0
+X	2508	.	T	<*>	0	.	DP=21;I16=9,10,0,0,724,30396,0,0,1109,65641,0,0,361,8089,0,0;QS=3,0;MQSB=0.920044;MQ0F=0	PL:DP:DV	0,27,241:9:0	0,15,158:5:0	0,15,162:5:0
+X	2509	.	G	T,<*>	0	.	DP=21;I16=8,10,1,0,710,30408,35,1225,1049,62041,60,3600,330,7282,25,625;QS=2.80663,0.19337,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.920044;BQB=1;MQ0F=0	PL:DP:DV	0,27,253,27,253,253:9:0	20,0,122,32,125,150:5:1	0,15,163,15,163,163:5:0
+X	2510	.	A	<*>	0	.	DP=21;I16=10,10,0,0,778,33128,0,0,1138,66482,0,0,352,7754,0,0;QS=3,0;MQSB=0.751477;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,174:5:0	0,15,161:5:0
+X	2511	.	G	<*>	0	.	DP=21;I16=10,10,0,0,771,32165,0,0,1138,66482,0,0,344,7558,0,0;QS=3,0;MQSB=0.751477;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,161:5:0	0,15,159:5:0
+X	2512	.	C	<*>	0	.	DP=21;I16=10,10,0,0,790,33406,0,0,1138,66482,0,0,336,7386,0,0;QS=3,0;MQSB=0.751477;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,175:5:0	0,15,160:5:0
+X	2513	.	T	<*>	0	.	DP=21;I16=10,10,0,0,755,31503,0,0,1138,66482,0,0,327,7189,0,0;QS=3,0;MQSB=0.751477;MQ0F=0	PL:DP:DV	0,30,246:10:0	0,15,180:5:0	0,15,156:5:0
+X	2514	.	G	<*>	0	.	DP=20;I16=9,10,0,0,702,28002,0,0,1109,65641,0,0,319,7017,0,0;QS=3,0;MQSB=0.920044;MQ0F=0	PL:DP:DV	0,27,228:9:0	0,15,171:5:0	0,15,155:5:0
+X	2515	.	T	<*>	0	.	DP=19;I16=8,10,0,0,642,25888,0,0,1049,62041,0,0,312,6868,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,24,182:8:0	0,15,172:5:0	0,15,141:5:0
+X	2516	.	G	<*>	0	.	DP=19;I16=8,10,0,0,685,28155,0,0,1049,62041,0,0,303,6641,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,24,211:8:0	0,15,175:5:0	0,15,147:5:0
+X	2517	.	A	<*>	0	.	DP=18;I16=8,9,0,0,660,27600,0,0,989,58441,0,0,295,6435,0,0;QS=3,0;MQSB=0.91051;MQ0F=0	PL:DP:DV	0,24,215:8:0	0,12,139:4:0	0,15,161:5:0
+X	2518	.	T	<*>	0	.	DP=17;I16=6,9,0,0,611,26911,0,0,900,54000,0,0,273,6023,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,188:7:0	0,12,144:4:0	0,12,146:4:0
+X	2519	.	C	<*>	0	.	DP=16;I16=7,8,0,0,531,20111,0,0,900,54000,0,0,282,6078,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,175:7:0	0,12,141:4:0	0,12,125:4:0
+X	2520	.	G	<*>	0	.	DP=15;I16=6,8,0,0,501,19731,0,0,840,50400,0,0,277,5923,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,187:7:0	0,12,129:4:0	0,9,101:3:0
+X	2521	.	C	<*>	0	.	DP=15;I16=6,8,0,0,583,25777,0,0,840,50400,0,0,272,5782,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,214:7:0	0,12,149:4:0	0,9,111:3:0
+X	2522	.	A	<*>	0	.	DP=16;I16=6,8,0,0,516,20930,0,0,840,50400,0,0,266,5606,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,173:7:0	0,12,139:4:0	0,9,114:3:0
+X	2523	.	T	<*>	0	.	DP=16;I16=6,9,0,0,588,25538,0,0,900,54000,0,0,270,5546,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,207:7:0	0,15,157:5:0	0,9,117:3:0
+X	2524	.	C	<*>	0	.	DP=16;I16=5,9,0,0,548,23502,0,0,840,50400,0,0,256,5342,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,182:6:0	0,15,156:5:0	0,9,112:3:0
+X	2525	.	A	C,<*>	0	.	DP=17;I16=6,9,0,1,550,23138,28,784,900,54000,60,3600,248,5174,12,144;QS=2.86,0.14,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=1;BQB=1;MQ0F=0	PL:DP:DV	0,24,168,24,168,168:8:0	13,0,138,25,141,159:5:1	0,9,117,9,117,117:3:0
+X	2526	.	C	<*>	0	.	DP=18;I16=6,11,0,0,677,28649,0,0,1020,61200,0,0,256,5232,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,229:9:0	0,15,183:5:0	0,9,113:3:0
+X	2527	.	T	<*>	0	.	DP=18;I16=6,11,0,0,674,29286,0,0,1020,61200,0,0,252,5118,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,217:9:0	0,15,183:5:0	0,9,119:3:0
+X	2528	.	G	<*>	0	.	DP=18;I16=6,11,0,0,701,30729,0,0,1020,61200,0,0,248,5028,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,234:9:0	0,15,184:5:0	0,9,119:3:0
+X	2529	.	C	<*>	0	.	DP=18;I16=6,11,0,0,676,28974,0,0,1020,61200,0,0,244,4962,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,228:9:0	0,15,175:5:0	0,9,117:3:0
+X	2530	.	A	<*>	0	.	DP=18;I16=6,10,0,0,624,26620,0,0,960,57600,0,0,223,4631,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,209:9:0	0,12,153:4:0	0,9,116:3:0
+X	2531	.	T	<*>	0	.	DP=17;I16=6,10,0,0,641,27911,0,0,960,57600,0,0,236,4852,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,210:8:0	0,15,175:5:0	0,9,122:3:0
+X	2532	.	T	<*>	0	.	DP=17;I16=6,10,0,0,634,27460,0,0,960,57600,0,0,230,4708,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,212:8:0	0,15,173:5:0	0,9,117:3:0
+X	2533	.	C	<*>	0	.	DP=18;I16=6,11,0,0,614,24196,0,0,1020,61200,0,0,224,4588,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,212:9:0	0,15,159:5:0	0,9,104:3:0
+X	2534	.	C	<*>	0	.	DP=16;I16=5,10,0,0,595,25141,0,0,900,54000,0,0,221,4491,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,202:8:0	0,12,144:4:0	0,9,110:3:0
+X	2535	.	A	<*>	0	.	DP=16;I16=5,10,0,0,617,27711,0,0,900,54000,0,0,218,4416,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,204:8:0	0,12,136:4:0	0,9,123:3:0
+X	2536	.	G	<*>	0	.	DP=15;I16=4,10,0,0,543,23023,0,0,840,50400,0,0,216,4362,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,195:8:0	0,9,102:3:0	0,9,117:3:0
+X	2537	.	C	<*>	0	.	DP=15;I16=4,10,0,0,555,24075,0,0,840,50400,0,0,213,4279,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,195:8:0	0,9,113:3:0	0,9,115:3:0
+X	2538	.	C	<*>	0	.	DP=15;I16=5,9,0,0,510,21070,0,0,840,50400,0,0,211,4217,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,157:7:0	0,9,129:3:0	0,12,126:4:0
+X	2539	.	C	<*>	0	.	DP=15;I16=5,9,0,0,464,16896,0,0,840,50400,0,0,209,4125,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,146:7:0	0,9,122:3:0	0,12,111:4:0
+X	2540	.	G	<*>	0	.	DP=16;I16=6,9,0,0,548,21860,0,0,900,54000,0,0,207,4053,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,189:7:0	0,12,139:4:0	0,12,110:4:0
+X	2541	.	G	<*>	0	.	DP=15;I16=5,9,0,0,535,22527,0,0,840,50400,0,0,207,4001,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,170:7:0	0,9,117:3:0	0,12,140:4:0
+X	2542	.	T	<*>	0	.	DP=15;I16=4,9,0,0,527,23207,0,0,780,46800,0,0,203,3953,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,183:7:0	0,9,125:3:0	0,9,109:3:0
+X	2543	.	G	<*>	0	.	DP=15;I16=5,9,0,0,540,23004,0,0,840,50400,0,0,207,3957,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,196:7:0	0,9,117:3:0	0,12,117:4:0
+X	2544	.	A	<*>	0	.	DP=16;I16=6,9,0,0,569,24139,0,0,900,54000,0,0,207,3965,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,202:8:0	0,9,119:3:0	0,12,132:4:0
+X	2545	.	C	<*>	0	.	DP=16;I16=6,9,0,0,583,24657,0,0,900,54000,0,0,208,3994,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,217:8:0	0,9,118:3:0	0,12,130:4:0
+X	2546	.	A	<*>	0	.	DP=16;I16=6,9,0,0,608,27290,0,0,900,54000,0,0,209,4045,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,206:8:0	0,9,133:3:0	0,12,144:4:0
+X	2547	.	G	<*>	0	.	DP=16;I16=6,9,0,0,597,26215,0,0,900,54000,0,0,211,4117,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,191:7:0	0,9,131:3:0	0,15,150:5:0
+X	2548	.	A	<*>	0	.	DP=16;I16=6,9,0,0,632,28806,0,0,900,54000,0,0,214,4210,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,196:7:0	0,9,131:3:0	0,15,171:5:0
+X	2549	.	G	<*>	0	.	DP=16;I16=6,9,0,0,594,25254,0,0,900,54000,0,0,217,4325,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,180:7:0	0,9,132:3:0	0,15,160:5:0
+X	2550	.	T	<*>	0	.	DP=16;I16=6,9,0,0,572,24134,0,0,900,54000,0,0,219,4413,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,182:7:0	0,9,122:3:0	0,15,148:5:0
+X	2551	.	G	<*>	0	.	DP=16;I16=6,9,0,0,578,24606,0,0,900,54000,0,0,220,4474,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,181:7:0	0,9,131:3:0	0,15,151:5:0
+X	2552	.	A	<*>	0	.	DP=15;I16=6,8,0,0,585,26419,0,0,840,50400,0,0,221,4505,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,178:6:0	0,9,129:3:0	0,15,168:5:0
+X	2553	.	G	<*>	0	.	DP=15;I16=6,8,0,0,528,21944,0,0,840,50400,0,0,222,4554,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,170:6:0	0,9,117:3:0	0,15,142:5:0
+X	2554	.	T	<*>	0	.	DP=15;I16=6,8,0,0,543,23015,0,0,840,50400,0,0,223,4621,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,156:6:0	0,9,129:3:0	0,15,160:5:0
+X	2555	.	C	<*>	0	.	DP=15;I16=6,8,0,0,566,24416,0,0,840,50400,0,0,224,4706,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,173:6:0	0,9,131:3:0	0,15,159:5:0
+X	2556	.	A	<*>	0	.	DP=14;I16=6,7,0,0,487,20095,0,0,780,46800,0,0,226,4808,0,0;QS=3,0;MQSB=0.961166;MQ0F=0	PL:DP:DV	0,15,141:5:0	0,9,125:3:0	0,15,146:5:0
+X	2557	.	C	<*>	0	.	DP=13;I16=5,8,0,0,471,17481,0,0,780,46800,0,0,249,5325,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,15,161:5:0	0,9,96:3:0	0,15,151:5:0
+X	2558	.	T	<*>	0	.	DP=14;I16=5,9,0,0,535,20597,0,0,840,50400,0,0,251,5417,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,173:6:0	0,9,99:3:0	0,15,174:5:0
+X	2559	.	G	<*>	0	.	DP=14;I16=5,9,0,0,509,18693,0,0,840,50400,0,0,253,5475,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,172:6:0	0,9,98:3:0	0,15,156:5:0
+X	2560	.	T	<*>	0	.	DP=14;I16=5,9,0,0,489,17587,0,0,840,50400,0,0,255,5549,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,160:6:0	0,9,106:3:0	0,15,144:5:0
+X	2561	.	C	<*>	0	.	DP=14;I16=5,9,0,0,489,17477,0,0,840,50400,0,0,257,5639,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,164:6:0	0,9,96:3:0	0,15,153:5:0
+X	2562	.	T	<*>	0	.	DP=13;I16=5,8,0,0,460,17016,0,0,780,46800,0,0,260,5744,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,15,139:5:0	0,9,99:3:0	0,15,167:5:0
+X	2563	.	C	<*>	0	.	DP=14;I16=5,8,0,0,433,15133,0,0,780,46800,0,0,263,5863,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,15,149:5:0	0,9,83:3:0	0,15,142:5:0
+X	2564	.	A	G,<*>	0	.	DP=15;I16=1,4,4,5,174,6124,316,11352,300,18000,540,32400,61,1311,184,4034;QS=0.988263,2.01174,0;VDB=0.690812;SGB=-3.20711;RPB=0.197899;MQB=1;MQSB=1;BQB=0.965069;MQ0F=0	PL:DP:DV	88,0,78,98,87,171:6:3	57,0,56,63,62,117:4:2	124,12,0,124,12,124:4:4
+X	2565	.	A	<*>	0	.	DP=15;I16=6,9,0,0,562,21216,0,0,900,54000,0,0,274,6076,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,178:6:0	0,12,134:4:0	0,15,166:5:0
+X	2566	.	A	<*>	0	.	DP=15;I16=6,9,0,0,545,20019,0,0,900,54000,0,0,276,6098,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,181:6:0	0,12,120:4:0	0,15,162:5:0
+X	2567	.	A	<*>	0	.	DP=16;I16=7,9,0,0,580,21342,0,0,960,57600,0,0,278,6136,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,177:6:0	0,15,151:5:0	0,15,166:5:0
+X	2568	.	A	<*>	0	.	DP=16;I16=7,8,0,0,555,20795,0,0,900,54000,0,0,256,5566,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,180:6:0	0,12,132:4:0	0,15,167:5:0
+X	2569	.	A	<*>	0	.	DP=17;I16=7,10,0,0,661,25943,0,0,1020,61200,0,0,284,6264,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,213:7:0	0,15,163:5:0	0,15,172:5:0
+X	2570	.	G	<*>	0	.	DP=18;I16=8,10,0,0,664,24968,0,0,1080,64800,0,0,287,6305,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,213:7:0	0,15,152:5:0	0,18,176:6:0
+X	2571	.	A	<*>	0	.	DP=18;I16=8,10,0,0,618,21870,0,0,1080,64800,0,0,291,6365,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,195:7:0	0,15,155:5:0	0,18,155:6:0
+X	2572	.	A	<*>	0	.	DP=18;I16=8,10,0,0,631,22829,0,0,1080,64800,0,0,295,6445,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,194:7:0	0,15,150:5:0	0,18,173:6:0
+X	2573	.	A	<*>	0	.	DP=18;I16=8,10,0,0,690,26830,0,0,1080,64800,0,0,298,6494,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,210:7:0	0,15,170:5:0	0,18,183:6:0
+X	2574	.	G	<*>	0	.	DP=18;I16=8,10,0,0,664,24884,0,0,1080,64800,0,0,301,6561,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,211:7:0	0,15,152:5:0	0,18,176:6:0
+X	2575	.	G	<*>	0	.	DP=18;I16=8,10,0,0,642,23904,0,0,1080,64800,0,0,305,6645,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,242:8:0	0,15,145:5:0	0,15,140:5:0
+X	2576	.	A	<*>	0	.	DP=18;I16=7,10,0,0,595,21311,0,0,1020,61200,0,0,285,6121,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,210:8:0	0,15,153:5:0	0,12,131:4:0
+X	2577	.	A	<*>	0	.	DP=19;I16=8,10,0,0,682,26398,0,0,1080,64800,0,0,290,6240,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,244:8:0	0,15,161:5:0	0,15,155:5:0
+X	2578	.	G	<*>	0	.	DP=18;I16=9,9,0,0,643,24115,0,0,1080,64800,0,0,322,7002,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,249:8:0	0,12,114:4:0	0,18,161:6:0
+X	2579	.	A	<*>	0	.	DP=18;I16=9,8,0,0,634,23870,0,0,1020,61200,0,0,304,6532,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,229:8:0	0,9,110:3:0	0,18,176:6:0
+X	2580	.	A	<*>	0	.	DP=18;I16=9,9,0,0,629,22593,0,0,1080,64800,0,0,336,7330,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,223:8:0	0,12,117:4:0	0,18,169:6:0
+X	2581	.	A	<*>	0	.	DP=19;I16=10,9,0,0,691,25669,0,0,1140,68400,0,0,343,7521,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,12,133:4:0	0,18,166:6:0
+X	2582	.	T	<*>	0	.	DP=19;I16=10,9,0,0,674,24218,0,0,1140,68400,0,0,350,7682,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,235:9:0	0,12,138:4:0	0,18,168:6:0
+X	2583	.	A	<*>	0	.	DP=19;I16=10,9,0,0,693,25465,0,0,1140,68400,0,0,357,7865,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,247:9:0	0,12,126:4:0	0,18,178:6:0
+X	2584	.	A	<*>	0	.	DP=19;I16=10,9,0,0,702,26340,0,0,1140,68400,0,0,363,8019,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,243:9:0	0,12,134:4:0	0,18,187:6:0
+X	2585	.	A	<*>	0	.	DP=19;I16=9,9,0,0,690,26700,0,0,1080,64800,0,0,350,7818,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,250:9:0	0,9,114:3:0	0,18,190:6:0
+X	2586	.	G	<*>	0	.	DP=19;I16=10,9,0,0,714,27314,0,0,1140,68400,0,0,373,8283,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,12,127:4:0	0,18,176:6:0
+X	2587	.	A	<*>	0	.	DP=20;I16=9,9,0,0,665,24781,0,0,1049,62041,0,0,343,7717,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,137:4:0	0,12,136:4:0
+X	2588	.	A	<*>	0	.	DP=21;I16=12,9,0,0,737,26531,0,0,1229,72841,0,0,384,8620,0,0;QS=3,0;MQSB=0.950149;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,138:4:0	0,18,162:6:0
+X	2589	.	A	<*>	0	.	DP=22;I16=13,9,0,0,780,28412,0,0,1289,76441,0,0,390,8770,0,0;QS=3,0;MQSB=0.955854;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,142:4:0	0,18,170:6:0
+X	2590	.	A	<*>	0	.	DP=22;I16=13,9,0,0,774,28352,0,0,1289,76441,0,0,396,8894,0,0;QS=3,0;MQSB=0.955854;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,135:4:0	0,18,160:6:0
+X	2591	.	C	<*>	0	.	DP=21;I16=13,8,0,0,765,28617,0,0,1229,72841,0,0,403,9041,0,0;QS=3,0;MQSB=0.95891;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,136:4:0	0,15,136:5:0
+X	2592	.	A	<*>	0	.	DP=21;I16=13,8,0,0,763,28325,0,0,1229,72841,0,0,410,9210,0,0;QS=3,0;MQSB=0.95891;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,140:4:0	0,15,139:5:0
+X	2593	.	A	<*>	0	.	DP=21;I16=13,8,0,0,754,27888,0,0,1229,72841,0,0,416,9350,0,0;QS=3,0;MQSB=0.95891;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,141:4:0	0,15,147:5:0
+X	2594	.	A	<*>	0	.	DP=21;I16=13,8,0,0,775,29179,0,0,1229,72841,0,0,422,9510,0,0;QS=3,0;MQSB=0.95891;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,130:4:0	0,15,153:5:0
+X	2595	.	T	<*>	0	.	DP=22;I16=14,8,0,0,766,27472,0,0,1289,76441,0,0,427,9639,0,0;QS=3,0;MQSB=0.963419;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,119:4:0	0,15,143:5:0
+X	2596	.	A	<*>	0	.	DP=22;I16=13,8,0,0,751,27409,0,0,1229,72841,0,0,407,9111,0,0;QS=3,0;MQSB=0.95891;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,123:4:0	0,12,129:4:0
+X	2597	.	A	<*>	0	.	DP=22;I16=14,8,0,0,811,30147,0,0,1289,76441,0,0,437,9851,0,0;QS=3,0;MQSB=0.963419;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,145:4:0	0,15,145:5:0
+X	2598	.	A	<*>	0	.	DP=22;I16=14,8,0,0,817,30915,0,0,1289,76441,0,0,442,9984,0,0;QS=3,0;MQSB=0.963419;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,136:4:0	0,15,159:5:0
+X	2599	.	A	<*>	0	.	DP=22;I16=14,8,0,0,800,29912,0,0,1289,76441,0,0,447,10135,0,0;QS=3,0;MQSB=0.963419;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,126:4:0	0,15,150:5:0
+X	2600	.	A	<*>	0	.	DP=22;I16=14,8,0,0,784,29138,0,0,1289,76441,0,0,451,10255,0,0;QS=3,0;MQSB=0.963419;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,113:4:0	0,15,150:5:0
+X	2601	.	T	<*>	0	.	DP=22;I16=14,8,0,0,770,27820,0,0,1289,76441,0,0,454,10344,0,0;QS=3,0;MQSB=0.963419;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,118:4:0	0,15,142:5:0
+X	2602	.	A	<*>	0	.	DP=23;I16=15,8,0,0,825,29971,0,0,1349,80041,0,0,457,10451,0,0;QS=3,0;MQSB=0.967216;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,143:4:0	0,18,154:6:0
+X	2603	.	A	<*>	0	.	DP=23;I16=15,8,0,0,862,32840,0,0,1349,80041,0,0,460,10526,0,0;QS=3,0;MQSB=0.967216;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,138:4:0	0,18,172:6:0
+X	2604	.	T	<*>	0	.	DP=23;I16=15,8,0,0,822,29902,0,0,1349,80041,0,0,463,10619,0,0;QS=3,0;MQSB=0.967216;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,129:4:0	0,18,154:6:0
+X	2605	.	A	<*>	0	.	DP=23;I16=14,8,0,0,845,32617,0,0,1289,76441,0,0,441,10105,0,0;QS=3,0;MQSB=0.963419;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,143:4:0	0,15,157:5:0
+X	2606	.	G	<*>	0	.	DP=23;I16=14,8,0,0,812,30796,0,0,1289,76441,0,0,444,10234,0,0;QS=3,0;MQSB=0.963419;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,129:4:0	0,15,142:5:0
+X	2607	.	T	<*>	0	.	DP=22;I16=15,7,0,0,782,28440,0,0,1289,76441,0,0,472,10954,0,0;QS=3,0;MQSB=0.970024;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,119:4:0	0,15,132:5:0
+X	2608	.	G	<*>	0	.	DP=22;I16=15,7,0,0,851,33169,0,0,1289,76441,0,0,474,11014,0,0;QS=3,0;MQSB=0.970024;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,132:4:0	0,15,127:5:0
+X	2609	.	C	<*>	0	.	DP=22;I16=15,7,0,0,796,29454,0,0,1289,76441,0,0,475,11041,0,0;QS=3,0;MQSB=0.970024;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,137:4:0	0,15,124:5:0
+X	2610	.	A	<*>	0	.	DP=22;I16=15,7,0,0,830,31684,0,0,1289,76441,0,0,476,11086,0,0;QS=3,0;MQSB=0.970024;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,146:4:0	0,15,121:5:0
+X	2611	.	G	<*>	0	.	DP=22;I16=15,7,0,0,824,32048,0,0,1289,76441,0,0,477,11149,0,0;QS=3,0;MQSB=0.970024;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,129:4:0	0,15,122:5:0
+X	2612	.	A	<*>	0	.	DP=22;I16=14,7,0,0,771,29035,0,0,1229,72841,0,0,453,10605,0,0;QS=3,0;MQSB=0.966484;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,130:4:0	0,12,117:4:0
+X	2613	.	C	<*>	0	.	DP=22;I16=15,7,0,0,832,31926,0,0,1289,76441,0,0,478,11278,0,0;QS=3,0;MQSB=0.970024;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,138:4:0	0,15,120:5:0
+X	2614	.	A	<*>	0	.	DP=21;I16=15,6,0,0,791,30065,0,0,1229,72841,0,0,477,11241,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,110:3:0	0,15,140:5:0
+X	2615	.	A	<*>	0	.	DP=21;I16=15,6,0,0,777,29101,0,0,1229,72841,0,0,475,11167,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,99:3:0	0,15,142:5:0
+X	2616	.	A	<*>	0	.	DP=21;I16=15,6,0,0,734,26922,0,0,1229,72841,0,0,472,11056,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,90:3:0	0,15,144:5:0
+X	2617	.	A	<*>	0	.	DP=21;I16=15,6,0,0,810,31654,0,0,1229,72841,0,0,469,10959,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,95:3:0	0,15,140:5:0
+X	2618	.	G	<*>	0	.	DP=23;I16=16,6,0,0,863,34219,0,0,1289,76441,0,0,441,10251,0,0;QS=3,0;MQSB=0.97584;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,74:2:0	0,15,132:5:0
+X	2619	.	G	<*>	0	.	DP=23;I16=16,6,0,0,807,30109,0,0,1289,76441,0,0,439,10135,0,0;QS=3,0;MQSB=0.97584;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,66:2:0	0,15,127:5:0
+X	2620	.	C	<*>	0	.	DP=23;I16=16,7,0,0,780,28242,0,0,1349,80041,0,0,462,10664,0,0;QS=3,0;MQSB=0.973027;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,87:3:0	0,15,115:5:0
+X	2621	.	C	<*>	0	.	DP=23;I16=16,7,0,0,860,32944,0,0,1349,80041,0,0,459,10537,0,0;QS=3,0;MQSB=0.973027;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,112:3:0	0,15,124:5:0
+X	2622	.	T	<*>	0	.	DP=24;I16=17,7,0,0,908,35474,0,0,1409,83641,0,0,456,10428,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,115:3:0	0,15,134:5:0
+X	2623	.	T	<*>	0	.	DP=24;I16=17,7,0,0,850,30978,0,0,1409,83641,0,0,453,10289,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,114:3:0	0,15,129:5:0
+X	2624	.	G	<*>	0	.	DP=24;I16=17,7,0,0,882,33332,0,0,1409,83641,0,0,450,10172,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,101:3:0	0,15,133:5:0
+X	2625	.	A	<*>	0	.	DP=23;I16=17,6,0,0,855,32593,0,0,1349,80041,0,0,448,10076,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,114:3:0	0,15,135:5:0
+X	2626	.	C	<*>	0	.	DP=23;I16=17,6,0,0,847,31625,0,0,1349,80041,0,0,446,10000,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,100:3:0	0,15,122:5:0
+X	2627	.	C	<*>	0	.	DP=23;I16=17,6,0,0,863,32865,0,0,1349,80041,0,0,444,9944,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,104:3:0	0,15,129:5:0
+X	2628	.	C	<*>	0	.	DP=24;I16=17,6,0,0,793,28559,0,0,1349,80041,0,0,431,9757,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,95:3:0	0,15,127:5:0
+X	2629	.	A	<*>	0	.	DP=24;I16=18,6,0,0,893,33537,0,0,1409,83641,0,0,439,9789,0,0;QS=3,0;MQSB=0.980199;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,101:3:0	0,18,148:6:0
+X	2630	.	T	<*>	0	.	DP=24;I16=17,6,0,0,836,31094,0,0,1380,82800,0,0,412,9116,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,112:3:0	0,18,140:6:0
+X	2631	.	C	<*>	0	.	DP=24;I16=18,6,0,0,900,34378,0,0,1409,83641,0,0,435,9713,0,0;QS=3,0;MQSB=0.980199;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,104:3:0	0,18,142:6:0
+X	2632	.	T	<*>	0	.	DP=24;I16=18,6,0,0,937,37097,0,0,1409,83641,0,0,433,9705,0,0;QS=3,0;MQSB=0.980199;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,113:3:0	0,18,164:6:0
+X	2633	.	A	<*>	0	.	DP=23;I16=18,5,0,0,801,28913,0,0,1349,80041,0,0,431,9667,0,0;QS=3,0;MQSB=0.982789;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,95:3:0	0,18,148:6:0
+X	2634	.	G	<*>	0	.	DP=23;I16=19,3,0,0,861,34125,0,0,1289,76441,0,0,405,9023,0,0;QS=3,0;MQSB=0.989755;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,74:2:0	0,18,149:6:0
+X	2635	.	C	<*>	0	.	DP=23;I16=19,4,0,0,848,32154,0,0,1349,80041,0,0,429,9599,0,0;QS=3,0;MQSB=0.986928;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,107:3:0	0,18,148:6:0
+X	2636	.	T	<*>	0	.	DP=24;I16=19,4,0,0,871,33973,0,0,1349,80041,0,0,428,9572,0,0;QS=3,0;MQSB=0.986928;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,98:3:0	0,18,160:6:0
+X	2637	.	T	<*>	0	.	DP=24;I16=19,5,0,0,871,32073,0,0,1409,83641,0,0,428,9568,0,0;QS=3,0;MQSB=0.984335;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,111:3:0	0,18,144:6:0
+X	2638	.	T	<*>	0	.	DP=24;I16=19,5,0,0,821,28851,0,0,1409,83641,0,0,428,9588,0,0;QS=3,0;MQSB=0.984335;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,103:3:0	0,18,135:6:0
+X	2639	.	G	<*>	0	.	DP=24;I16=18,6,0,0,842,30840,0,0,1409,83641,0,0,428,9582,0,0;QS=3,0;MQSB=0.980199;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,106:3:0	0,15,125:5:0
+X	2640	.	G	<*>	0	.	DP=24;I16=17,6,0,0,749,25957,0,0,1380,82800,0,0,404,8976,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,84:3:0	0,15,117:5:0
+X	2641	.	C	<*>	0	.	DP=23;I16=17,6,0,0,834,31792,0,0,1349,80041,0,0,431,9645,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,61:2:0	0,15,129:5:0
+X	2642	.	C	<*>	0	.	DP=23;I16=17,6,0,0,809,30033,0,0,1349,80041,0,0,433,9713,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,58:2:0	0,15,131:5:0
+X	2643	.	C	<*>	0	.	DP=23;I16=17,6,0,0,856,33004,0,0,1349,80041,0,0,434,9756,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,57:2:0	0,15,133:5:0
+X	2644	.	T	<*>	0	.	DP=22;I16=16,5,0,0,805,31419,0,0,1229,72841,0,0,428,9648,0,0;QS=3,0;MQSB=0.978919;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,73:2:0	0,15,143:5:0
+X	2645	.	C	<*>	0	.	DP=22;I16=15,6,0,0,823,32499,0,0,1229,72841,0,0,415,9323,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,78:2:0	0,12,122:4:0
+X	2646	.	A	<*>	0	.	DP=22;I16=16,6,0,0,826,31566,0,0,1289,76441,0,0,430,9524,0,0;QS=3,0;MQSB=0.97584;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,79:2:0	0,15,129:5:0
+X	2647	.	G	<*>	0	.	DP=22;I16=16,6,0,0,803,30643,0,0,1289,76441,0,0,428,9460,0,0;QS=3,0;MQSB=0.97584;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,77:2:0	0,15,129:5:0
+X	2648	.	C	<*>	0	.	DP=21;I16=15,6,0,0,811,31709,0,0,1229,72841,0,0,426,9368,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,80:2:0	0,12,118:4:0
+X	2649	.	A	<*>	0	.	DP=23;I16=16,6,0,0,789,29215,0,0,1258,73682,0,0,414,9196,0,0;QS=3,0;MQSB=0.934321;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,93:3:0	0,12,105:4:0
+X	2650	.	T	<*>	0	.	DP=23;I16=16,7,0,0,856,32340,0,0,1318,77282,0,0,423,9197,0,0;QS=3,0;MQSB=0.955805;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,103:3:0	0,12,118:4:0
+X	2651	.	C	<*>	0	.	DP=23;I16=16,7,0,0,871,33599,0,0,1318,77282,0,0,422,9124,0,0;QS=3,0;MQSB=0.955805;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,95:3:0	0,12,121:4:0
+X	2652	.	A	<*>	0	.	DP=23;I16=16,7,0,0,820,30324,0,0,1318,77282,0,0,421,9077,0,0;QS=3,0;MQSB=0.955805;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,87:3:0	0,12,126:4:0
+X	2653	.	A	<*>	0	.	DP=23;I16=15,6,0,0,759,28489,0,0,1198,70082,0,0,389,8395,0,0;QS=3,0;MQSB=0.940481;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,73:2:0	0,9,109:3:0
+X	2654	.	C	<*>	0	.	DP=23;I16=16,7,0,0,836,31006,0,0,1318,77282,0,0,393,8385,0,0;QS=3,0;MQSB=0.955805;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,9,88:3:0	0,9,99:3:0
+X	2655	.	C	<*>	0	.	DP=23;I16=16,7,0,0,774,27190,0,0,1318,77282,0,0,392,8364,0,0;QS=3,0;MQSB=0.955805;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,9,83:3:0	0,9,95:3:0
+X	2656	.	G	<*>	0	.	DP=24;I16=17,7,0,0,781,25689,0,0,1378,80882,0,0,390,8320,0,0;QS=3,0;MQSB=0.95083;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,116:4:0	0,9,74:3:0
+X	2657	.	C	<*>	0	.	DP=24;I16=17,6,0,0,871,33435,0,0,1349,80041,0,0,381,8241,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,9,98:3:0	0,9,99:3:0
+X	2658	.	T	<*>	0	.	DP=23;I16=17,6,0,0,897,35255,0,0,1318,77282,0,0,389,8319,0,0;QS=3,0;MQSB=0.92854;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,133:4:0	0,9,107:3:0
+X	2659	.	A	<*>	0	.	DP=23;I16=17,6,0,0,817,29729,0,0,1318,77282,0,0,389,8361,0,0;QS=3,0;MQSB=0.92854;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,120:4:0	0,9,93:3:0
+X	2660	.	G	<*>	0	.	DP=23;I16=17,6,0,0,900,35462,0,0,1318,77282,0,0,389,8379,0,0;QS=3,0;MQSB=0.92854;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,126:4:0	0,9,94:3:0
+X	2661	.	A	<*>	0	.	DP=24;I16=18,6,0,0,871,32185,0,0,1378,80882,0,0,390,8422,0,0;QS=3,0;MQSB=0.923116;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,127:4:0	0,9,104:3:0
+X	2662	.	T	<*>	0	.	DP=24;I16=17,6,0,0,836,30812,0,0,1349,80041,0,0,366,7816,0,0;QS=3,0;MQSB=0.83771;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,122:4:0	0,9,99:3:0
+X	2663	.	A	<*>	0	.	DP=24;I16=17,6,0,0,827,30583,0,0,1318,77282,0,0,389,8341,0,0;QS=3,0;MQSB=0.92854;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,104:4:0	0,9,101:3:0
+X	2664	.	C	<*>	0	.	DP=23;I16=17,6,0,0,787,28083,0,0,1318,77282,0,0,388,8270,0,0;QS=3,0;MQSB=0.92854;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,107:4:0	0,9,91:3:0
+X	2665	.	G	<*>	0	.	DP=23;I16=17,6,0,0,728,23290,0,0,1318,77282,0,0,386,8178,0,0;QS=3,0;MQSB=0.92854;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,112:4:0	0,9,78:3:0
+X	2666	.	T	<*>	0	.	DP=23;I16=17,5,0,0,799,29273,0,0,1289,76441,0,0,367,7825,0,0;QS=3,0;MQSB=0.981001;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,105:3:0	0,9,94:3:0
+X	2667	.	C	<*>	0	.	DP=23;I16=16,5,0,0,792,30190,0,0,1260,75600,0,0,345,7393,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,96:3:0	0,9,98:3:0
+X	2668	.	C	<*>	0	.	DP=24;I16=18,6,0,0,832,29692,0,0,1378,80882,0,0,381,8069,0,0;QS=3,0;MQSB=0.923116;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,107:4:0	0,9,95:3:0
+X	2669	.	C	<*>	0	.	DP=23;I16=18,5,0,0,829,30953,0,0,1318,77282,0,0,383,8087,0,0;QS=3,0;MQSB=0.889264;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,120:4:0	0,9,88:3:0
+X	2670	.	T	<*>	0	.	DP=23;I16=17,5,0,0,841,32669,0,0,1289,76441,0,0,368,7828,0,0;QS=3,0;MQSB=0.801124;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,131:4:0	0,9,100:3:0
+X	2671	.	C	<*>	0	.	DP=22;I16=17,5,0,0,842,32448,0,0,1258,73682,0,0,386,8110,0,0;QS=3,0;MQSB=0.895399;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,128:4:0	0,6,70:2:0
+X	2672	.	C	<*>	0	.	DP=22;I16=17,5,0,0,808,30180,0,0,1258,73682,0,0,388,8164,0,0;QS=3,0;MQSB=0.895399;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,129:4:0	0,6,75:2:0
+X	2673	.	C	<*>	0	.	DP=22;I16=17,5,0,0,842,32528,0,0,1258,73682,0,0,390,8246,0,0;QS=3,0;MQSB=0.895399;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,133:4:0	0,6,75:2:0
+X	2674	.	T	<*>	0	.	DP=23;I16=17,6,0,0,860,33242,0,0,1318,77282,0,0,392,8356,0,0;QS=3,0;MQSB=0.92854;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,142:4:0	0,6,79:2:0
+X	2675	.	T	<*>	0	.	DP=22;I16=16,6,0,0,756,26986,0,0,1258,73682,0,0,394,8392,0,0;QS=3,0;MQSB=0.934321;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,134:4:0	0,6,74:2:0
+X	2676	.	T	<*>	0	.	DP=22;I16=16,6,0,0,774,28022,0,0,1258,73682,0,0,396,8452,0,0;QS=3,0;MQSB=0.934321;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,135:4:0	0,6,75:2:0
+X	2677	.	C	<*>	0	.	DP=22;I16=16,6,0,0,866,34444,0,0,1258,73682,0,0,398,8536,0,0;QS=3,0;MQSB=0.934321;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,131:4:0	0,6,77:2:0
+X	2678	.	T	<*>	0	.	DP=22;I16=16,5,0,0,818,32216,0,0,1229,72841,0,0,374,7970,0,0;QS=3,0;MQSB=0.978919;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,111:3:0	0,6,80:2:0
+X	2679	.	T	<*>	0	.	DP=22;I16=16,6,0,0,808,29912,0,0,1258,73682,0,0,400,8680,0,0;QS=3,0;MQSB=0.934321;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,137:4:0	0,6,75:2:0
+X	2680	.	C	<*>	0	.	DP=23;I16=16,7,0,0,873,33605,0,0,1318,77282,0,0,400,8740,0,0;QS=3,0;MQSB=0.955805;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,131:4:0	0,6,70:2:0
+X	2681	.	T	<*>	0	.	DP=22;I16=15,7,0,0,820,31248,0,0,1258,73682,0,0,402,8824,0,0;QS=3,0;MQSB=0.961028;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,133:4:0	0,6,75:2:0
+X	2682	.	G	<*>	0	.	DP=22;I16=15,7,0,0,831,31865,0,0,1258,73682,0,0,403,8881,0,0;QS=3,0;MQSB=0.961028;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,135:4:0	0,6,64:2:0
+X	2683	.	G	<*>	0	.	DP=22;I16=13,6,0,0,702,26368,0,0,1109,65641,0,0,394,8926,0,0;QS=3,0;MQSB=0.850016;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,136:4:0	0,6,53:2:0
+X	2684	.	G	<*>	0	.	DP=22;I16=14,7,0,0,754,27678,0,0,1229,72841,0,0,403,9057,0,0;QS=3,0;MQSB=0.872525;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,128:4:0	0,6,62:2:0
+X	2685	.	G	<*>	0	.	DP=22;I16=15,7,0,0,736,25916,0,0,1258,73682,0,0,406,9184,0,0;QS=3,0;MQSB=0.961028;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,130:4:0	0,6,45:2:0
+X	2686	.	C	<*>	0	.	DP=22;I16=15,7,0,0,803,29933,0,0,1258,73682,0,0,406,9278,0,0;QS=3,0;MQSB=0.961028;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,134:4:0	0,6,68:2:0
+X	2687	.	A	<*>	0	.	DP=21;I16=13,7,0,0,716,26356,0,0,1169,69241,0,0,406,9340,0,0;QS=3,0;MQSB=0.875769;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,136:4:0	0,6,61:2:0
+X	2688	.	C	<*>	0	.	DP=20;I16=13,7,0,0,750,28308,0,0,1169,69241,0,0,407,9417,0,0;QS=3,0;MQSB=0.875769;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,134:4:0	0,6,66:2:0
+X	2689	.	A	<*>	0	.	DP=19;I16=12,7,0,0,741,29105,0,0,1109,65641,0,0,409,9507,0,0;QS=3,0;MQSB=0.879351;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,140:4:0	0,6,73:2:0
+X	2690	.	G	<*>	0	.	DP=20;I16=12,8,0,0,751,28929,0,0,1169,69241,0,0,411,9609,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,135:4:0	0,6,61:2:0
+X	2691	.	G	<*>	0	.	DP=20;I16=12,7,0,0,682,25006,0,0,1109,65641,0,0,403,9603,0,0;QS=3,0;MQSB=0.879351;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,132:4:0	0,6,63:2:0
+X	2692	.	T	<*>	0	.	DP=20;I16=12,8,0,0,648,21758,0,0,1169,69241,0,0,417,9853,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,125:4:0	0,6,72:2:0
+X	2693	.	C	<*>	0	.	DP=20;I16=12,8,0,0,779,30645,0,0,1169,69241,0,0,418,9898,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,130:4:0	0,6,70:2:0
+X	2694	.	A	<*>	0	.	DP=21;I16=13,8,0,0,723,25649,0,0,1229,72841,0,0,417,9859,0,0;QS=3,0;MQSB=0.895122;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,126:4:0	0,6,73:2:0
+X	2695	.	C	<*>	0	.	DP=20;I16=12,8,0,0,757,28835,0,0,1169,69241,0,0,418,9834,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,130:4:0	0,6,63:2:0
+X	2696	.	A	<*>	0	.	DP=20;I16=12,8,0,0,733,27357,0,0,1169,69241,0,0,419,9823,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,130:4:0	0,6,69:2:0
+X	2697	.	C	<*>	0	.	DP=20;I16=12,8,0,0,738,27604,0,0,1169,69241,0,0,419,9777,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,128:4:0	0,6,66:2:0
+X	2698	.	T	<*>	0	.	DP=21;I16=12,8,0,0,788,31268,0,0,1169,69241,0,0,419,9747,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,144:4:0	0,6,77:2:0
+X	2699	.	C	<*>	0	.	DP=22;I16=13,9,0,0,864,34148,0,0,1258,73682,0,0,443,10309,0,0;QS=3,0;MQSB=0.686045;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,135:4:0	0,9,98:3:0
+X	2700	.	T	<*>	0	.	DP=22;I16=13,9,0,0,850,33296,0,0,1258,73682,0,0,444,10310,0,0;QS=3,0;MQSB=0.686045;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,141:4:0	0,9,105:3:0
+X	2701	.	C	<*>	0	.	DP=22;I16=13,9,0,0,863,34157,0,0,1258,73682,0,0,444,10278,0,0;QS=3,0;MQSB=0.686045;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,140:4:0	0,9,94:3:0
+X	2702	.	T	<*>	0	.	DP=22;I16=13,9,0,0,837,32525,0,0,1258,73682,0,0,444,10262,0,0;QS=3,0;MQSB=0.686045;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,143:4:0	0,9,83:3:0
+X	2703	.	T	<*>	0	.	DP=21;I16=12,8,0,0,717,25881,0,0,1169,69241,0,0,420,9636,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,130:4:0	0,3,32:1:0
+X	2704	.	C	<*>	0	.	DP=21;I16=12,9,0,0,794,30766,0,0,1198,70082,0,0,445,10225,0,0;QS=3,0;MQSB=0.695144;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,137:4:0	0,6,55:2:0
+X	2705	.	C	<*>	0	.	DP=21;I16=12,9,0,0,809,31649,0,0,1198,70082,0,0,445,10205,0,0;QS=3,0;MQSB=0.695144;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,136:4:0	0,6,56:2:0
+X	2706	.	A	<*>	0	.	DP=22;I16=12,10,0,0,820,31386,0,0,1258,73682,0,0,444,10150,0,0;QS=3,0;MQSB=0.731218;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,141:4:0	0,6,70:2:0
+X	2707	.	G	<*>	0	.	DP=22;I16=12,10,0,0,832,32104,0,0,1258,73682,0,0,444,10110,0,0;QS=3,0;MQSB=0.731218;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,139:4:0	0,6,60:2:0
+X	2708	.	G	<*>	0	.	DP=22;I16=12,10,0,0,777,28329,0,0,1258,73682,0,0,444,10086,0,0;QS=3,0;MQSB=0.731218;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,136:4:0	0,6,57:2:0
+X	2709	.	T	<*>	0	.	DP=22;I16=12,9,0,0,761,28341,0,0,1229,72841,0,0,418,9404,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,137:4:0	0,3,39:1:0
+X	2710	.	C	<*>	0	.	DP=23;I16=12,10,0,0,840,32478,0,0,1289,76441,0,0,417,9365,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,134:4:0	0,3,38:1:0
+X	2711	.	T	<*>	0	.	DP=24;I16=13,11,0,0,893,33721,0,0,1378,80882,0,0,442,9970,0,0;QS=3,0;MQSB=0.75304;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,12,138:4:0	0,6,72:2:0
+X	2712	.	A	<*>	0	.	DP=24;I16=13,11,0,0,889,33333,0,0,1378,80882,0,0,443,9971,0,0;QS=3,0;MQSB=0.75304;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,12,141:4:0	0,6,65:2:0
+X	2713	.	G	T,<*>	0	.	DP=25;I16=13,11,0,1,915,35485,14,196,1378,80882,29,841,419,9369,25,625;QS=2.72549,0.27451,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.569783;BQB=1;MQ0F=0	PL:DP:DV	0,57,255,57,255,255:19:0	0,12,131,12,131,131:4:0	8,0,31,11,34,42:2:1
+X	2714	.	G	<*>	0	.	DP=25;I16=13,11,0,0,891,33457,0,0,1378,80882,0,0,444,9990,0,0;QS=3,0;MQSB=0.75304;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,12,132:4:0	0,6,64:2:0
+X	2715	.	A	<*>	0	.	DP=25;I16=13,12,0,0,888,32012,0,0,1407,81723,0,0,446,10014,0,0;QS=3,0;MQSB=0.569783;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,12,135:4:0	0,6,63:2:0
+X	2716	.	T	<*>	0	.	DP=26;I16=13,13,0,0,937,34241,0,0,1467,85323,0,0,446,10012,0,0;QS=3,0;MQSB=0.606531;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,12,134:4:0	0,9,90:3:0
+X	2717	.	G	<*>	0	.	DP=26;I16=13,12,0,0,939,35995,0,0,1438,84482,0,0,422,9410,0,0;QS=3,0;MQSB=0.778801;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,12,134:4:0	0,6,72:2:0
+X	2718	.	C	<*>	0	.	DP=24;I16=12,11,0,0,864,33118,0,0,1318,77282,0,0,425,9457,0,0;QS=3,0;MQSB=0.7613;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,130:4:0	0,6,65:2:0
+X	2719	.	A	<*>	0	.	DP=24;I16=12,12,0,0,911,35371,0,0,1347,78123,0,0,452,10102,0,0;QS=3,0;MQSB=0.582748;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,139:4:0	0,9,99:3:0
+X	2720	.	G	<*>	0	.	DP=24;I16=12,12,0,0,940,37044,0,0,1347,78123,0,0,453,10095,0,0;QS=3,0;MQSB=0.582748;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,136:4:0	0,9,97:3:0
+X	2721	.	C	<*>	0	.	DP=24;I16=12,11,0,0,881,34499,0,0,1318,77282,0,0,429,9485,0,0;QS=3,0;MQSB=0.7613;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,131:4:0	0,6,76:2:0
+X	2722	.	T	<*>	0	.	DP=24;I16=11,13,0,0,898,34310,0,0,1347,78123,0,0,456,10146,0,0;QS=3,0;MQSB=0.633229;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,156:5:0	0,9,98:3:0
+X	2723	.	G	<*>	0	.	DP=25;I16=12,13,0,0,941,36257,0,0,1407,81723,0,0,459,10203,0,0;QS=3,0;MQSB=0.619223;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,184:6:0	0,9,76:3:0
+X	2724	.	A	<*>	0	.	DP=25;I16=12,13,0,0,917,34211,0,0,1407,81723,0,0,462,10234,0,0;QS=3,0;MQSB=0.619223;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,188:6:0	0,9,84:3:0
+X	2725	.	G	<*>	0	.	DP=25;I16=12,12,0,0,916,35656,0,0,1378,80882,0,0,438,9566,0,0;QS=3,0;MQSB=0.786628;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,185:6:0	0,6,67:2:0
+X	2726	.	G	<*>	0	.	DP=25;I16=11,12,0,0,841,31809,0,0,1287,74523,0,0,437,9545,0,0;QS=3,0;MQSB=0.597127;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,186:6:0	0,6,46:2:0
+X	2727	.	G	<*>	0	.	DP=25;I16=12,13,0,0,889,32233,0,0,1407,81723,0,0,464,10182,0,0;QS=3,0;MQSB=0.619223;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,194:7:0	0,6,56:2:0
+X	2728	.	G	<*>	0	.	DP=25;I16=12,13,0,0,883,32287,0,0,1407,81723,0,0,467,10219,0,0;QS=3,0;MQSB=0.619223;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,189:7:0	0,6,50:2:0
+X	2729	.	T	<*>	0	.	DP=25;I16=12,13,0,0,871,31019,0,0,1407,81723,0,0,469,10233,0,0;QS=3,0;MQSB=0.619223;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,189:7:0	0,6,62:2:0
+X	2730	.	G	<*>	0	.	DP=25;I16=12,13,0,0,907,34299,0,0,1407,81723,0,0,471,10275,0,0;QS=3,0;MQSB=0.619223;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,192:7:0	0,6,49:2:0
+X	2731	.	C	<*>	0	.	DP=25;I16=12,13,0,0,893,33027,0,0,1407,81723,0,0,473,10345,0,0;QS=3,0;MQSB=0.619223;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,192:7:0	0,6,52:2:0
+X	2732	.	C	<*>	0	.	DP=25;I16=12,13,0,0,882,32170,0,0,1407,81723,0,0,473,10343,0,0;QS=3,0;MQSB=0.619223;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,195:7:0	0,6,38:2:0
+X	2733	.	C	A,<*>	0	.	DP=25;I16=12,12,0,1,835,30063,13,169,1378,80882,29,841,448,9744,25,625;QS=2.64865,0.351351,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.619223;BQB=1;MQ0F=0	PL:DP:DV	0,48,255,48,255,255:16:0	0,21,187,21,187,187:7:0	7,0,18,10,21,28:2:1
+X	2734	.	C	<*>	0	.	DP=25;I16=12,12,0,0,890,33726,0,0,1378,80882,0,0,449,9797,0,0;QS=3,0;MQSB=0.786628;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,208:8:0	0,3,39:1:0
+X	2735	.	T	<*>	0	.	DP=26;I16=13,12,0,0,955,36875,0,0,1438,84482,0,0,451,9877,0,0;QS=3,0;MQSB=0.778801;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,228:8:0	0,3,41:1:0
+X	2736	.	C	<*>	0	.	DP=26;I16=13,11,0,0,921,35553,0,0,1409,83641,0,0,428,9308,0,0;QS=3,0;MQSB=0.931547;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,220:8:0	0,3,33:1:0
+X	2737	.	T	<*>	0	.	DP=26;I16=13,13,0,0,967,36581,0,0,1467,85323,0,0,475,10403,0,0;QS=3,0;MQSB=0.606531;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,228:8:0	0,6,64:2:0
+X	2738	.	T	<*>	0	.	DP=26;I16=13,13,0,0,895,31873,0,0,1467,85323,0,0,474,10374,0,0;QS=3,0;MQSB=0.606531;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,201:8:0	0,6,47:2:0
+X	2739	.	A	<*>	0	.	DP=26;I16=13,12,0,0,871,31051,0,0,1407,81723,0,0,448,9698,0,0;QS=3,0;MQSB=0.569783;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,224:8:0	0,9,78:3:0
+X	2740	.	C	<*>	0	.	DP=26;I16=14,11,0,0,952,36456,0,0,1438,84482,0,0,448,9674,0,0;QS=3,0;MQSB=0.745495;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,216:8:0	0,6,71:2:0
+X	2741	.	C	<*>	0	.	DP=26;I16=14,11,0,0,945,36141,0,0,1438,84482,0,0,448,9678,0,0;QS=3,0;MQSB=0.745495;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,215:8:0	0,6,75:2:0
+X	2742	.	A	<*>	0	.	DP=27;I16=15,12,0,0,949,34263,0,0,1527,88923,0,0,472,10284,0,0;QS=3,0;MQSB=0.547344;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,27,230:9:0	0,9,92:3:0
+X	2743	.	T	<*>	0	.	DP=27;I16=15,12,0,0,955,34479,0,0,1527,88923,0,0,471,10243,0,0;QS=3,0;MQSB=0.547344;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,27,224:9:0	0,9,99:3:0
+X	2744	.	C	<*>	0	.	DP=26;I16=15,10,0,0,955,36951,0,0,1438,84482,0,0,445,9557,0,0;QS=3,0;MQSB=0.707404;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,234:9:0	0,6,76:2:0
+X	2745	.	T	<*>	0	.	DP=26;I16=15,11,0,0,962,36786,0,0,1467,85323,0,0,469,10151,0,0;QS=3,0;MQSB=0.505697;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,243:9:0	0,9,104:3:0
+X	2746	.	A	<*>	0	.	DP=26;I16=15,10,0,0,912,33536,0,0,1438,84482,0,0,443,9525,0,0;QS=3,0;MQSB=0.707404;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,235:9:0	0,6,78:2:0
+X	2747	.	A	<*>	0	.	DP=26;I16=15,11,0,0,945,35117,0,0,1467,85323,0,0,467,10179,0,0;QS=3,0;MQSB=0.505697;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,238:9:0	0,9,96:3:0
+X	2748	.	T	<*>	0	.	DP=27;I16=15,12,0,0,1005,37901,0,0,1527,88923,0,0,465,10187,0,0;QS=3,0;MQSB=0.547344;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,27,246:9:0	0,9,103:3:0
+X	2749	.	C	<*>	0	.	DP=26;I16=14,12,0,0,975,37353,0,0,1467,85323,0,0,463,10123,0,0;QS=3,0;MQSB=0.558035;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,232:9:0	0,9,98:3:0
+X	2750	.	T	<*>	0	.	DP=26;I16=15,11,0,0,982,37714,0,0,1498,88082,0,0,462,10086,0,0;QS=3,0;MQSB=0.738577;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,227:8:0	0,12,130:4:0
+X	2751	.	G	<*>	0	.	DP=26;I16=15,10,0,0,945,36031,0,0,1469,87241,0,0,437,9451,0,0;QS=3,0;MQSB=0.9171;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,205:8:0	0,9,103:3:0
+X	2752	.	T	<*>	0	.	DP=26;I16=15,11,0,0,870,30288,0,0,1498,88082,0,0,460,9998,0,0;QS=3,0;MQSB=0.738577;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,189:8:0	0,12,119:4:0
+X	2753	.	G	<*>	0	.	DP=26;I16=15,11,0,0,867,30913,0,0,1498,88082,0,0,458,9948,0,0;QS=3,0;MQSB=0.738577;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,202:8:0	0,12,116:4:0
+X	2754	.	C	<*>	0	.	DP=25;I16=14,10,0,0,873,32607,0,0,1409,83641,0,0,436,9484,0,0;QS=3,0;MQSB=0.919431;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,24,205:8:0	0,9,104:3:0
+X	2755	.	C	<*>	0	.	DP=25;I16=14,10,0,0,865,32243,0,0,1409,83641,0,0,436,9528,0,0;QS=3,0;MQSB=0.919431;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,24,209:8:0	0,9,97:3:0
+X	2756	.	C	<*>	0	.	DP=25;I16=14,9,0,0,838,31276,0,0,1380,82800,0,0,411,8971,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,204:8:0	0,9,97:3:0
+X	2757	.	T	<*>	0	.	DP=25;I16=14,11,0,0,904,33980,0,0,1438,84482,0,0,455,10011,0,0;QS=3,0;MQSB=0.745495;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,212:7:0	0,15,147:5:0
+X	2758	.	T	<*>	0	.	DP=25;I16=14,10,0,0,841,30293,0,0,1409,83641,0,0,439,9801,0,0;QS=3,0;MQSB=0.919431;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,195:7:0	0,12,133:4:0
+X	2759	.	A	<*>	0	.	DP=25;I16=14,11,0,0,884,31728,0,0,1438,84482,0,0,457,10195,0,0;QS=3,0;MQSB=0.745495;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,192:7:0	0,15,147:5:0
+X	2760	.	T	<*>	0	.	DP=25;I16=14,11,0,0,907,33965,0,0,1438,84482,0,0,457,10275,0,0;QS=3,0;MQSB=0.745495;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,204:7:0	0,15,150:5:0
+X	2761	.	T	<*>	0	.	DP=23;I16=13,9,0,0,838,32530,0,0,1289,76441,0,0,444,10130,0,0;QS=3,0;MQSB=0.910098;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,185:6:0	0,12,141:4:0
+X	2762	.	T	<*>	0	.	DP=24;I16=13,11,0,0,869,32261,0,0,1378,80882,0,0,459,10395,0,0;QS=3,0;MQSB=0.75304;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,178:6:0	0,18,177:6:0
+X	2763	.	C	A,<*>	0	.	DP=24;I16=13,10,0,1,843,31711,13,169,1349,80041,29,841,448,10290,12,144;QS=2.93333,0.0666667,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.75304;BQB=1;MQ0F=0	PL:DP:DV	0,36,255,36,255,255:12:0	0,18,170,18,170,170:6:0	0,5,147,15,150,153:6:1
+X	2764	.	C	<*>	0	.	DP=24;I16=13,10,0,0,854,32376,0,0,1349,80041,0,0,450,10374,0,0;QS=3,0;MQSB=0.921963;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,163:6:0	0,15,162:5:0
+X	2765	.	T	<*>	0	.	DP=24;I16=12,11,0,0,853,32173,0,0,1318,77282,0,0,457,10469,0,0;QS=3,0;MQSB=0.7613;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,154:5:0	0,18,189:6:0
+X	2766	.	C	<*>	0	.	DP=24;I16=12,11,0,0,887,34485,0,0,1349,80041,0,0,448,10398,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,160:5:0	0,18,186:6:0
+X	2767	.	T	<*>	0	.	DP=24;I16=12,12,0,0,905,34757,0,0,1378,80882,0,0,458,10510,0,0;QS=3,0;MQSB=0.786628;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,153:5:0	0,21,217:7:0
+X	2768	.	G	<*>	0	.	DP=23;I16=11,11,0,0,852,33258,0,0,1289,76441,0,0,452,10462,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,141:5:0	0,18,197:6:0
+X	2769	.	C	<*>	0	.	DP=23;I16=11,12,0,0,832,31390,0,0,1318,77282,0,0,459,10481,0,0;QS=3,0;MQSB=0.795196;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,142:5:0	0,21,202:7:0
+X	2770	.	T	<*>	0	.	DP=23;I16=11,12,0,0,828,30854,0,0,1318,77282,0,0,459,10471,0,0;QS=3,0;MQSB=0.795196;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,152:5:0	0,21,199:7:0
+X	2771	.	T	<*>	0	.	DP=23;I16=11,11,0,0,817,30957,0,0,1258,73682,0,0,454,10456,0,0;QS=3,0;MQSB=0.770381;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,154:5:0	0,18,198:6:0
+X	2772	.	T	<*>	0	.	DP=23;I16=11,12,0,0,856,32206,0,0,1318,77282,0,0,459,10511,0,0;QS=3,0;MQSB=0.795196;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,160:5:0	0,21,210:7:0
+X	2773	.	A	<*>	0	.	DP=23;I16=11,12,0,0,828,30664,0,0,1318,77282,0,0,459,10561,0,0;QS=3,0;MQSB=0.795196;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,140:5:0	0,21,209:7:0
+X	2774	.	G	<*>	0	.	DP=22;I16=11,11,0,0,843,32715,0,0,1258,73682,0,0,458,10530,0,0;QS=3,0;MQSB=0.770381;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,154:5:0	0,21,207:7:0
+X	2775	.	T	<*>	0	.	DP=22;I16=10,11,0,0,748,27720,0,0,1198,70082,0,0,432,9892,0,0;QS=3,0;MQSB=0.780412;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,12,115:4:0	0,21,203:7:0
+X	2776	.	G	<*>	0	.	DP=22;I16=12,10,0,0,803,30251,0,0,1289,76441,0,0,456,10470,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,135:5:0	0,21,210:7:0
+X	2777	.	A	<*>	0	.	DP=22;I16=12,10,0,0,852,33524,0,0,1289,76441,0,0,456,10438,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,148:5:0	0,21,220:7:0
+X	2778	.	G	<*>	0	.	DP=23;I16=12,11,0,0,861,33049,0,0,1349,80041,0,0,456,10422,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,154:5:0	0,21,224:7:0
+X	2779	.	G	<*>	0	.	DP=23;I16=11,11,0,0,834,32014,0,0,1289,76441,0,0,432,9798,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,136:4:0	0,21,219:7:0
+X	2780	.	A	<*>	0	.	DP=23;I16=11,11,0,0,792,29162,0,0,1289,76441,0,0,433,9817,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,33,244:11:0	0,12,133:4:0	0,21,215:7:0
+X	2781	.	A	<*>	0	.	DP=23;I16=11,11,0,0,844,33092,0,0,1289,76441,0,0,441,10141,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,15,151:5:0	0,21,233:7:0
+X	2782	.	G	<*>	0	.	DP=23;I16=12,11,0,0,840,31826,0,0,1349,80041,0,0,458,10438,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,154:5:0	0,21,218:7:0
+X	2783	.	A	<*>	0	.	DP=23;I16=11,11,0,0,860,33888,0,0,1289,76441,0,0,432,9790,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,142:4:0	0,21,230:7:0
+X	2784	.	G	<*>	0	.	DP=23;I16=12,11,0,0,860,33092,0,0,1349,80041,0,0,456,10410,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,143:5:0	0,21,212:7:0
+X	2785	.	G	<*>	0	.	DP=23;I16=11,11,0,0,797,29747,0,0,1289,76441,0,0,429,9749,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,134:4:0	0,21,204:7:0
+X	2786	.	C	<*>	0	.	DP=24;I16=12,12,0,0,831,29497,0,0,1409,83641,0,0,451,10309,0,0;QS=3,0;MQSB=0.941765;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,141:5:0	0,21,199:7:0
+X	2787	.	C	<*>	0	.	DP=24;I16=11,12,0,0,792,28454,0,0,1349,80041,0,0,424,9642,0,0;QS=3,0;MQSB=0.944319;MQ0F=0	PL:DP:DV	0,36,252:12:0	0,12,127:4:0	0,21,200:7:0
+X	2788	.	C	<*>	0	.	DP=23;I16=11,11,0,0,791,29517,0,0,1289,76441,0,0,421,9523,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,125:4:0	0,21,209:7:0
+X	2789	.	C	<*>	0	.	DP=24;I16=13,11,0,0,880,33470,0,0,1409,83641,0,0,443,10051,0,0;QS=3,0;MQSB=0.931547;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,150:5:0	0,21,226:7:0
+X	2790	.	T	<*>	0	.	DP=23;I16=13,10,0,0,886,34738,0,0,1349,80041,0,0,442,9976,0,0;QS=3,0;MQSB=0.921963;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,165:5:0	0,21,227:7:0
+X	2791	.	G	<*>	0	.	DP=23;I16=13,10,0,0,873,34037,0,0,1349,80041,0,0,441,9923,0,0;QS=3,0;MQSB=0.921963;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,155:5:0	0,21,226:7:0
+X	2792	.	G	<*>	0	.	DP=23;I16=13,10,0,0,832,30870,0,0,1349,80041,0,0,438,9792,0,0;QS=3,0;MQSB=0.921963;MQ0F=0	PL:DP:DV	0,33,254:11:0	0,15,146:5:0	0,21,221:7:0
+X	2793	.	T	<*>	0	.	DP=23;I16=13,10,0,0,827,30693,0,0,1349,80041,0,0,435,9683,0,0;QS=3,0;MQSB=0.921963;MQ0F=0	PL:DP:DV	0,33,247:11:0	0,15,157:5:0	0,21,214:7:0
+X	2794	.	C	<*>	0	.	DP=22;I16=12,10,0,0,786,29122,0,0,1289,76441,0,0,433,9595,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,145:5:0	0,21,201:7:0
+X	2795	.	C	<*>	0	.	DP=22;I16=11,10,0,0,814,31804,0,0,1229,72841,0,0,428,9518,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,27,240:9:0	0,15,159:5:0	0,21,222:7:0
+X	2796	.	A	<*>	0	.	DP=22;I16=11,10,0,0,762,28412,0,0,1229,72841,0,0,427,9475,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,27,221:9:0	0,15,156:5:0	0,21,211:7:0
+X	2797	.	T	<*>	0	.	DP=22;I16=12,10,0,0,792,29116,0,0,1289,76441,0,0,427,9451,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,30,243:10:0	0,15,148:5:0	0,21,214:7:0
+X	2798	.	G	<*>	0	.	DP=22;I16=12,10,0,0,817,31105,0,0,1289,76441,0,0,424,9394,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,152:5:0	0,21,205:7:0
+X	2799	.	A	<*>	0	.	DP=21;I16=11,10,0,0,788,30210,0,0,1229,72841,0,0,421,9309,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,27,220:9:0	0,15,167:5:0	0,21,218:7:0
+X	2800	.	A	<*>	0	.	DP=21;I16=11,10,0,0,836,33616,0,0,1229,72841,0,0,418,9246,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,27,237:9:0	0,15,164:5:0	0,21,237:7:0
+X	2801	.	G	<*>	0	.	DP=21;I16=11,10,0,0,792,30182,0,0,1229,72841,0,0,415,9205,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,27,234:9:0	0,15,157:5:0	0,21,214:7:0
+X	2802	.	G	<*>	0	.	DP=21;I16=11,9,0,0,729,27275,0,0,1169,69241,0,0,387,8559,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,24,229:8:0	0,15,135:5:0	0,21,215:7:0
+X	2803	.	G	<*>	0	.	DP=21;I16=11,10,0,0,737,26709,0,0,1229,72841,0,0,406,9036,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,27,233:9:0	0,15,125:5:0	0,21,207:7:0
+X	2804	.	G	<*>	0	.	DP=21;I16=11,10,0,0,727,26103,0,0,1229,72841,0,0,400,8908,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,27,218:9:0	0,15,129:5:0	0,21,210:7:0
+X	2805	.	C	<*>	0	.	DP=21;I16=10,10,0,0,714,26194,0,0,1169,69241,0,0,372,8316,0,0;QS=3,0;MQSB=0.931063;MQ0F=0	PL:DP:DV	0,27,229:9:0	0,12,111:4:0	0,21,205:7:0
+X	2806	.	C	<*>	0	.	DP=20;I16=11,8,0,0,682,25074,0,0,1109,65641,0,0,379,8611,0,0;QS=3,0;MQSB=0.902014;MQ0F=0	PL:DP:DV	0,24,215:8:0	0,15,138:5:0	0,18,191:6:0
+X	2807	.	T	<*>	0	.	DP=20;I16=11,9,0,0,755,29373,0,0,1169,69241,0,0,384,8640,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,24,221:8:0	0,15,152:5:0	0,21,227:7:0
+X	2808	.	T	<*>	0	.	DP=20;I16=11,9,0,0,749,28383,0,0,1169,69241,0,0,379,8587,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,24,209:8:0	0,15,157:5:0	0,21,225:7:0
+X	2809	.	T	<*>	0	.	DP=20;I16=11,8,0,0,697,26019,0,0,1109,65641,0,0,349,7927,0,0;QS=3,0;MQSB=0.902014;MQ0F=0	PL:DP:DV	0,21,189:7:0	0,15,148:5:0	0,21,226:7:0
+X	2810	.	C	<*>	0	.	DP=20;I16=12,8,0,0,754,28900,0,0,1169,69241,0,0,368,8436,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,24,229:8:0	0,15,150:5:0	0,21,215:7:0
+X	2811	.	A	<*>	0	.	DP=19;I16=11,8,0,0,759,30405,0,0,1109,65641,0,0,364,8340,0,0;QS=3,0;MQSB=0.902014;MQ0F=0	PL:DP:DV	0,21,209:7:0	0,15,166:5:0	0,21,228:7:0
+X	2812	.	G	<*>	0	.	DP=20;I16=11,9,0,0,758,29062,0,0,1169,69241,0,0,359,8213,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,24,229:8:0	0,15,150:5:0	0,21,216:7:0
+X	2813	.	A	<*>	0	.	DP=19;I16=11,8,0,0,702,27106,0,0,1140,68400,0,0,356,8104,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,195:7:0	0,15,160:5:0	0,21,217:7:0
+X	2814	.	G	<*>	0	.	DP=19;I16=11,8,0,0,703,26579,0,0,1140,68400,0,0,353,8013,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,217:7:0	0,15,147:5:0	0,21,204:7:0
+X	2815	.	A	<*>	0	.	DP=19;I16=10,7,0,0,597,21979,0,0,1020,61200,0,0,326,7470,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,170:6:0	0,12,122:4:0	0,21,208:7:0
+X	2816	.	C	<*>	0	.	DP=19;I16=11,8,0,0,630,21880,0,0,1140,68400,0,0,343,7685,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,193:7:0	0,15,134:5:0	0,21,180:7:0
+X	2817	.	G	<*>	0	.	DP=20;I16=11,8,0,0,612,20368,0,0,1140,68400,0,0,339,7547,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,200:7:0	0,15,115:5:0	0,21,178:7:0
+X	2818	.	G	<*>	0	.	DP=20;I16=11,8,0,0,688,25280,0,0,1140,68400,0,0,335,7377,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,216:7:0	0,15,132:5:0	0,21,206:7:0
+X	2819	.	G	<*>	0	.	DP=20;I16=11,8,0,0,696,25880,0,0,1140,68400,0,0,331,7227,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,222:7:0	0,15,142:5:0	0,21,195:7:0
+X	2820	.	G	<*>	0	.	DP=20;I16=10,8,0,0,624,22228,0,0,1080,64800,0,0,320,7048,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,205:7:0	0,12,119:4:0	0,21,188:7:0
+X	2821	.	A	<*>	0	.	DP=20;I16=9,7,0,0,496,16222,0,0,960,57600,0,0,279,6157,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,159:6:0	0,9,93:3:0	0,21,171:7:0
+X	2822	.	C	<*>	0	.	DP=19;I16=8,9,0,0,543,18163,0,0,1020,61200,0,0,310,7064,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,203:7:0	0,9,79:3:0	0,21,168:7:0
+X	2823	.	C	<*>	0	.	DP=18;I16=9,7,0,0,550,19506,0,0,960,57600,0,0,300,6640,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,201:7:0	0,6,58:2:0	0,21,192:7:0
+X	2824	.	C	<*>	0	.	DP=18;I16=9,7,0,0,584,21560,0,0,960,57600,0,0,299,6567,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,219:8:0	0,3,37:1:0	0,21,210:7:0
+X	2825	.	C	<*>	0	.	DP=18;I16=9,8,0,0,606,22286,0,0,1020,61200,0,0,324,7134,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,234:8:0	0,3,37:1:0	0,24,208:8:0
+X	2826	.	T	<*>	0	.	DP=18;I16=9,8,0,0,604,21766,0,0,1020,61200,0,0,323,7043,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,222:8:0	0,3,33:1:0	0,24,220:8:0
+X	2827	.	G	<*>	0	.	DP=18;I16=9,8,0,0,597,21643,0,0,1020,61200,0,0,322,6970,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,230:8:0	0,3,28:1:0	0,24,214:8:0
+X	2828	.	A	<*>	0	.	DP=20;I16=9,9,0,0,598,20740,0,0,1080,64800,0,0,321,6915,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,213:9:0	0,3,36:1:0	0,24,219:8:0
+X	2829	.	G	<*>	0	.	DP=20;I16=9,9,0,0,649,23719,0,0,1080,64800,0,0,305,6591,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,239:8:0	0,3,31:1:0	0,27,227:9:0
+X	2830	.	G	<*>	0	.	DP=20;I16=9,10,0,0,661,23841,0,0,1140,68400,0,0,323,6867,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,248:9:0	0,3,34:1:0	0,27,222:9:0
+X	2831	.	A	<*>	0	.	DP=21;I16=10,10,0,0,682,24052,0,0,1200,72000,0,0,324,6876,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,223:9:0	0,3,34:1:0	0,30,254:10:0
+X	2832	.	G	<*>	0	.	DP=21;I16=10,8,0,0,626,22384,0,0,1080,64800,0,0,281,5883,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,230:8:0	0,3,31:1:0	0,27,223:9:0
+X	2833	.	C	<*>	0	.	DP=21;I16=10,10,0,0,712,25708,0,0,1200,72000,0,0,327,6915,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,233:9:0	0,3,37:1:0	0,30,255:10:0
+X	2834	.	C	<*>	0	.	DP=21;I16=10,9,0,0,674,24470,0,0,1140,68400,0,0,306,6464,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,230:8:0	0,3,36:1:0	0,30,243:10:0
+X	2835	.	C	<*>	0	.	DP=20;I16=9,9,0,0,617,21835,0,0,1080,64800,0,0,305,6381,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,202:8:0	0,3,39:1:0	0,27,235:9:0
+X	2836	.	C	<*>	0	.	DP=20;I16=9,9,0,0,580,19624,0,0,1080,64800,0,0,306,6412,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,206:8:0	0,3,39:1:0	0,27,200:9:0
+X	2837	.	G	<*>	0	.	DP=21;I16=9,10,0,0,558,17614,0,0,1140,68400,0,0,330,7086,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,207:9:0	0,3,31:1:0	0,27,193:9:0
+X	2838	.	A	<*>	0	.	DP=20;I16=9,10,0,0,640,22674,0,0,1140,68400,0,0,331,7065,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,245:9:0	0,3,17:1:0	0,27,220:9:0
+X	2839	.	G	<*>	0	.	DP=20;I16=9,8,0,0,623,23267,0,0,1020,61200,0,0,282,5816,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,248:8:0	0,3,26:1:0	0,24,212:8:0
+X	2840	.	C	<*>	0	.	DP=20;I16=9,10,0,0,644,22798,0,0,1140,68400,0,0,333,7089,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,233:9:0	0,3,32:1:0	0,27,227:9:0
+X	2841	.	A	<*>	0	.	DP=20;I16=9,9,0,0,675,25801,0,0,1080,64800,0,0,309,6509,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,252:9:0	0,3,35:1:0	0,24,234:8:0
+X	2842	.	G	<*>	0	.	DP=20;I16=9,10,0,0,688,25554,0,0,1140,68400,0,0,332,7056,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,3,31:1:0	0,27,233:9:0
+X	2843	.	C	<*>	0	.	DP=20;I16=8,10,0,0,651,23969,0,0,1080,64800,0,0,309,6517,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,0,0:0:0	0,24,211:8:0
+X	2844	.	A	<*>	0	.	DP=20;I16=8,11,0,0,685,25399,0,0,1140,68400,0,0,331,6969,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,0,0:0:0	0,27,231:9:0
+X	2845	.	G	<*>	0	.	DP=20;I16=8,10,0,0,673,25399,0,0,1080,64800,0,0,311,6561,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,0,0:0:0	0,24,228:8:0
+X	2846	.	C	<*>	0	.	DP=20;I16=8,10,0,0,617,22007,0,0,1080,64800,0,0,311,6577,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,243:10:0	0,0,0:0:0	0,24,218:8:0
+X	2847	.	C	<*>	0	.	DP=20;I16=7,11,0,0,580,19468,0,0,1080,64800,0,0,321,6917,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,241:10:0	0,0,0:0:0	0,24,187:8:0
+X	2848	.	G	<*>	0	.	DP=19;I16=7,10,0,0,542,17884,0,0,1020,61200,0,0,323,6999,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,218:9:0	0,0,0:0:0	0,24,191:8:0
+X	2849	.	T	<*>	0	.	DP=19;I16=7,11,0,0,609,21717,0,0,1080,64800,0,0,341,7357,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,231:9:0	0,0,0:0:0	0,27,214:9:0
+X	2850	.	C	<*>	0	.	DP=19;I16=7,11,0,0,574,18980,0,0,1080,64800,0,0,343,7461,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,234:9:0	0,0,0:0:0	0,27,188:9:0
+X	2851	.	G	<*>	0	.	DP=17;I16=6,11,0,0,589,20831,0,0,1020,61200,0,0,346,7584,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,239:9:0	0,0,0:0:0	0,24,194:8:0
+X	2852	.	T	<*>	0	.	DP=17;I16=6,11,0,0,625,23241,0,0,1020,61200,0,0,348,7676,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,244:9:0	0,0,0:0:0	0,24,214:8:0
+X	2853	.	G	<*>	0	.	DP=17;I16=6,11,0,0,635,23949,0,0,1020,61200,0,0,349,7739,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,0,0:0:0	0,24,202:8:0
+X	2854	.	T	<*>	0	.	DP=17;I16=6,11,0,0,602,21990,0,0,1020,61200,0,0,348,7722,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,238:9:0	0,0,0:0:0	0,24,207:8:0
+X	2855	.	C	<*>	0	.	DP=17;I16=6,10,0,0,577,21539,0,0,960,57600,0,0,337,7623,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,0,0:0:0	0,21,185:7:0
+X	2856	.	T	<*>	0	.	DP=17;I16=6,8,0,0,530,20570,0,0,840,50400,0,0,289,6507,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,252:9:0	0,0,0:0:0	0,15,167:5:0
+X	2857	.	C	<*>	0	.	DP=18;I16=6,10,0,0,577,21641,0,0,960,57600,0,0,336,7664,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,0,0:0:0	0,21,185:7:0
+X	2858	.	A	<*>	0	.	DP=19;I16=6,12,0,0,634,23006,0,0,1080,64800,0,0,355,8081,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,254:10:0	0,3,39:1:0	0,21,185:7:0
+X	2859	.	C	<*>	0	.	DP=19;I16=6,13,0,0,646,23056,0,0,1140,68400,0,0,361,8139,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,3,26:1:0	0,24,194:8:0
+X	2860	.	C	<*>	0	.	DP=19;I16=6,13,0,0,655,23687,0,0,1140,68400,0,0,360,8166,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,251:10:0	0,3,37:1:0	0,24,200:8:0
+X	2861	.	C	<*>	0	.	DP=20;I16=7,12,0,0,708,26756,0,0,1140,68400,0,0,333,7537,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,38:1:0	0,21,203:7:0
+X	2862	.	A	<*>	0	.	DP=20;I16=6,13,0,0,749,29753,0,0,1140,68400,0,0,332,7554,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,3,43:1:0	0,24,225:8:0
+X	2863	.	G	<*>	0	.	DP=19;I16=7,12,0,0,707,26901,0,0,1140,68400,0,0,356,8166,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,35:1:0	0,21,195:7:0
+X	2864	.	G	<*>	0	.	DP=19;I16=7,11,0,0,677,25833,0,0,1080,64800,0,0,352,8070,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,36:1:0	0,18,185:6:0
+X	2865	.	G	<*>	0	.	DP=19;I16=7,12,0,0,671,24569,0,0,1140,68400,0,0,350,7994,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,27:1:0	0,21,193:7:0
+X	2866	.	T	<*>	0	.	DP=18;I16=6,11,0,0,591,21071,0,0,1020,61200,0,0,338,7834,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,32:1:0	0,15,147:5:0
+X	2867	.	G	<*>	0	.	DP=18;I16=7,11,0,0,655,24279,0,0,1080,64800,0,0,347,7889,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,58:2:0	0,15,150:5:0
+X	2868	.	T	<*>	0	.	DP=18;I16=7,11,0,0,640,23702,0,0,1080,64800,0,0,347,7859,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,68:2:0	0,15,157:5:0
+X	2869	.	C	<*>	0	.	DP=18;I16=7,11,0,0,655,24737,0,0,1080,64800,0,0,346,7794,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,56:2:0	0,15,165:5:0
+X	2870	.	T	<*>	0	.	DP=18;I16=7,11,0,0,700,27480,0,0,1080,64800,0,0,345,7743,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,70:2:0	0,15,176:5:0
+X	2871	.	G	<*>	0	.	DP=18;I16=7,11,0,0,700,27554,0,0,1080,64800,0,0,344,7706,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,68:2:0	0,15,172:5:0
+X	2872	.	A	<*>	0	.	DP=18;I16=7,11,0,0,651,23869,0,0,1080,64800,0,0,343,7683,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,66:2:0	0,15,171:5:0
+X	2873	.	A	<*>	0	.	DP=18;I16=7,11,0,0,664,25000,0,0,1080,64800,0,0,342,7674,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,61:2:0	0,15,159:5:0
+X	2874	.	A	<*>	0	.	DP=18;I16=7,11,0,0,636,23286,0,0,1080,64800,0,0,341,7679,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,57:2:0	0,15,162:5:0
+X	2875	.	C	<*>	0	.	DP=18;I16=7,11,0,0,664,25148,0,0,1080,64800,0,0,340,7698,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,63:2:0	0,15,166:5:0
+X	2876	.	A	<*>	0	.	DP=18;I16=6,11,0,0,666,26684,0,0,1020,61200,0,0,314,7106,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,6,74:2:0	0,15,185:5:0
+X	2877	.	G	<*>	0	.	DP=17;I16=6,11,0,0,659,26009,0,0,1020,61200,0,0,339,7777,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,67:2:0	0,12,148:4:0
+X	2878	.	A	<*>	0	.	DP=17;I16=7,10,0,0,628,23656,0,0,1020,61200,0,0,340,7834,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,6,69:2:0	0,15,166:5:0
+X	2879	.	T	<*>	0	.	DP=18;I16=7,11,0,0,671,25359,0,0,1080,64800,0,0,342,7902,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,9,96:3:0	0,15,175:5:0
+X	2880	.	G	<*>	0	.	DP=19;I16=8,11,0,0,708,26694,0,0,1140,68400,0,0,345,7983,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,118:4:0	0,15,173:5:0
+X	2881	.	T	<*>	0	.	DP=19;I16=6,11,0,0,618,23304,0,0,1020,61200,0,0,299,6829,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,209:8:0	0,12,124:4:0	0,15,178:5:0
+X	2882	.	G	<*>	0	.	DP=19;I16=8,11,0,0,700,26464,0,0,1140,68400,0,0,353,8191,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,118:4:0	0,15,176:5:0
+X	2883	.	G	<*>	0	.	DP=19;I16=8,11,0,0,707,26939,0,0,1140,68400,0,0,357,8319,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,121:4:0	0,15,175:5:0
+X	2884	.	A	<*>	0	.	DP=19;I16=7,11,0,0,649,24531,0,0,1080,64800,0,0,335,7787,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,229:9:0	0,12,121:4:0	0,15,181:5:0
+X	2885	.	G	<*>	0	.	DP=19;I16=8,11,0,0,737,29253,0,0,1140,68400,0,0,362,8470,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,113:4:0	0,15,182:5:0
+X	2886	.	G	A,<*>	0	.	DP=18;I16=7,9,1,0,571,21281,20,400,960,57600,60,3600,334,7882,6,36;QS=2.76471,0.235294,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=1;BQB=1;MQ0F=0	PL:DP:DV	0,27,236,27,236,236:9:0	11,0,51,17,54,66:3:1	0,15,171,15,171,171:5:0
+X	2887	.	T	<*>	0	.	DP=19;I16=9,9,0,0,581,20407,0,0,1080,64800,0,0,341,7905,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,213:10:0	0,9,94:3:0	0,15,166:5:0
+X	2888	.	C	<*>	0	.	DP=20;I16=10,10,0,0,714,26630,0,0,1200,72000,0,0,368,8532,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,94:4:0	0,15,159:5:0
+X	2889	.	T	<*>	0	.	DP=19;I16=9,10,0,0,712,27106,0,0,1140,68400,0,0,372,8550,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,114:4:0	0,15,175:5:0
+X	2890	.	C	<*>	0	.	DP=19;I16=9,10,0,0,613,20711,0,0,1140,68400,0,0,376,8584,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,247:10:0	0,12,95:4:0	0,15,139:5:0
+X	2891	.	G	<*>	0	.	DP=20;I16=9,11,0,0,674,23754,0,0,1200,72000,0,0,380,8634,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,242:10:0	0,15,141:5:0	0,15,143:5:0
+X	2892	.	G	<*>	0	.	DP=21;I16=9,12,0,0,731,26677,0,0,1260,75600,0,0,385,8701,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,142:5:0	0,15,164:5:0
+X	2893	.	G	<*>	0	.	DP=21;I16=9,12,0,0,696,24498,0,0,1260,75600,0,0,389,8687,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,251:11:0	0,15,141:5:0	0,15,150:5:0
+X	2894	.	T	<*>	0	.	DP=21;I16=9,12,0,0,716,25490,0,0,1260,75600,0,0,393,8693,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,137:5:0	0,15,155:5:0
+X	2895	.	G	<*>	0	.	DP=22;I16=9,12,0,0,773,29225,0,0,1260,75600,0,0,372,8094,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,149:6:0	0,15,166:5:0
+X	2896	.	A	<*>	0	.	DP=22;I16=8,12,0,0,732,27684,0,0,1200,72000,0,0,361,7885,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,151:5:0	0,15,163:5:0
+X	2897	.	G	<*>	0	.	DP=22;I16=10,12,0,0,783,28783,0,0,1320,79200,0,0,407,8835,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,161:6:0	0,15,168:5:0
+X	2898	.	G	<*>	0	.	DP=22;I16=10,12,0,0,724,25596,0,0,1320,79200,0,0,412,8926,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,254:11:0	0,18,143:6:0	0,15,169:5:0
+X	2899	.	C	<*>	0	.	DP=22;I16=8,11,0,0,625,21143,0,0,1140,68400,0,0,356,7640,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,228:9:0	0,15,130:5:0	0,15,147:5:0
+X	2900	.	G	<*>	0	.	DP=24;I16=11,13,0,0,782,26700,0,0,1440,86400,0,0,420,9078,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,164:6:0	0,15,153:5:0
+X	2901	.	T	<*>	0	.	DP=24;I16=11,13,0,0,821,29195,0,0,1440,86400,0,0,426,9192,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,174:6:0	0,15,166:5:0
+X	2902	.	G	<*>	0	.	DP=24;I16=11,13,0,0,898,34176,0,0,1440,86400,0,0,432,9334,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,171:6:0	0,15,164:5:0
+X	2903	.	G	<*>	0	.	DP=24;I16=11,13,0,0,894,33764,0,0,1440,86400,0,0,437,94