changeset 13:dcf130f10ca5 draft default tip

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/bcftools commit d5a01866d60f9775392420988259f1e79c464163"
author iuc
date Thu, 14 Oct 2021 10:07:43 +0000
parents 776ad0b21536
children
files bcftools_plugin_impute_info.xml macros.xml test-data/annotate4.vcf test-data/annots4.tab test-data/annots4.vcf test-data/concat.3.0.vcf test-data/concat.3.a.vcf test-data/concat.3.b.vcf test-data/concat.3.c.vcf test-data/concat.3.d.vcf test-data/concat.3.e.vcf test-data/concat.3.f.vcf test-data/consensus.1.chain test-data/consensus.1.out test-data/filter.4.vcf test-data/mpileup.4.bam test-data/mpileup.c.X.vcf test-data/mpileup.c.vcf test-data/mpileup.regions.bed test-data/mpileup.regions.tab test-data/mpileup.tab test-data/query.filter.vcf test-data/vcf2sex.vcf test-data/view.filter.vcf test-data/view.vcf_bgzip
diffstat 25 files changed, 7 insertions(+), 8765 deletions(-) [+]
line wrap: on
line diff
--- a/bcftools_plugin_impute_info.xml	Fri Feb 05 19:23:10 2021 +0000
+++ b/bcftools_plugin_impute_info.xml	Thu Oct 14 10:07:43 2021 +0000
@@ -1,6 +1,7 @@
 <?xml version='1.0' encoding='utf-8'?>
 <tool name="bcftools @EXECUTABLE@" id="bcftools_plugin_@PLUGIN_ID@" version="@TOOL_VERSION@">
     <description>plugin Add imputation information metrics to the INFO field</description>
+    <expand macro="bio_tools" />
     <macros>
         <token name="@EXECUTABLE@">impute-info</token>
         <token name="@PLUGIN_ID@">impute_info</token>
--- a/macros.xml	Fri Feb 05 19:23:10 2021 +0000
+++ b/macros.xml	Thu Oct 14 10:07:43 2021 +0000
@@ -1,5 +1,10 @@
 <macros>
   <token name="@TOOL_VERSION@">1.10</token>
+  <xml name="bio_tools">
+      <xrefs>
+          <xref type="bio.tools">bcftools</xref>
+      </xrefs>
+  </xml>
   <xml name="requirements">
     <requirements>
       <requirement type="package" version="@TOOL_VERSION@">bcftools</requirement>
@@ -11,7 +16,7 @@
       <requirement type="package" version="1.10">samtools</requirement>
   </xml>
   <xml name="matplotlib_requirement">
-      <requirement type="package" version="3.1.0">matplotlib</requirement>
+      <requirement type="package" version="3.4.3">matplotlib</requirement>
   </xml>
   <xml name="version_command">
     <version_command>bcftools 2&gt;&amp;1 | grep 'Version:'</version_command>
--- a/test-data/annotate4.vcf	Fri Feb 05 19:23:10 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,13 +0,0 @@
-##fileformat=VCFv4.2
-##INFO=<ID=FR,Number=R,Type=Float,Description="test">
-##INFO=<ID=FA,Number=A,Type=Float,Description="test">
-##INFO=<ID=IA,Number=A,Type=Integer,Description="test">
-##INFO=<ID=IR,Number=R,Type=Integer,Description="test">
-##INFO=<ID=SA,Number=A,Type=String,Description="test">
-##INFO=<ID=SR,Number=R,Type=String,Description="test">
-##contig=<ID=1,assembly=b37,length=249250621>
-##reference=file:///lustre/scratch105/projects/g1k/ref/main_project/human_g1k_v37.fasta
-#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO
-1	1	.	C	T	.	.	.
-1	2	.	C	T,G	.	.	FA=.,9.9;FR=.,9.9,.;IA=.,99;IR=.,99,.;SA=.,99;SR=.,99,.
-1	3	.	C	A,T	.	.	.
--- a/test-data/annots4.tab	Fri Feb 05 19:23:10 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,3 +0,0 @@
-1	1	C	A,T,G	0,1.1,0	1.1,0,2.2,0	0,1,0	1,0,2,0	X,11,XXX	1,XX,222,XXX
-1	2	C	T,G	1.1,2.2	1.1,2.2,3.3	1,2	1,2,3	11,2	111,22,3
-1	3	C	T	1.1	1.1,2.2	1	1,2	11	11,2
--- a/test-data/annots4.vcf	Fri Feb 05 19:23:10 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,13 +0,0 @@
-##fileformat=VCFv4.2
-##INFO=<ID=FA,Number=A,Type=Float,Description="test">
-##INFO=<ID=FR,Number=R,Type=Float,Description="test">
-##INFO=<ID=IA,Number=A,Type=Integer,Description="test">
-##INFO=<ID=IR,Number=R,Type=Integer,Description="test">
-##INFO=<ID=SA,Number=A,Type=String,Description="test">
-##INFO=<ID=SR,Number=R,Type=String,Description="test">
-##contig=<ID=1,assembly=b37,length=249250621>
-##reference=file:///lustre/scratch105/projects/g1k/ref/main_project/human_g1k_v37.fasta
-#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO
-1	1	.	C	A,T,G	.	.	FA=0,1.1,0;FR=1.1,0,2.2,0;IA=0,1,0;IR=1,0,2,0;SA=X,11,XXX;SR=1,XX,222,XXX
-1	2	.	C	T,G	.	.	FA=1.1,2.2;FR=1.1,2.2,3.3;IA=1,2;IR=1,2,3;SA=11,2;SR=111,22,3
-1	3	.	C	T	.	.	FA=1.1;FR=1.1,2.2;IA=1;IR=1,2;SA=11;SR=11,2
--- a/test-data/concat.3.0.vcf	Fri Feb 05 19:23:10 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,8 +0,0 @@
-##fileformat=VCFv4.0
-##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
-##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
-##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
-##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
-##FILTER=<ID=q10,Description="Quality below 10">
-##contig=<ID=2,length=62435964>
-#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
--- a/test-data/concat.3.a.vcf	Fri Feb 05 19:23:10 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,27 +0,0 @@
-##fileformat=VCFv4.0
-##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
-##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
-##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
-##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
-##FILTER=<ID=q10,Description="Quality below 10">
-##contig=<ID=9,length=62435964>
-##contig=<ID=1,length=62435964>
-#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
-9	202	.	GTTT	G	1806	q10	DP=35	GT:GQ:DP	0|1:409:35	0|1
-9	212	.	C	T,G	1792	PASS	DP=32	GT:GQ:DP	0|1:245:32	0|1
-9	212	.	CAAA	C	1792	PASS	DP=32	GT:GQ:DP	0|1:245:32	0|1
-9	222	.	GA	G	628	q10	DP=21	GT:GQ:DP	0|1:21:21	0|1
-9	232	.	G	T	1016	PASS	DP=22	GT:GQ:DP	0|1:212:22	0|1
-9	232	.	GAA	GG	1016	PASS	DP=22	GT:GQ:DP	0|1:212:22	0|1
-9	242	.	GT	G	727	PASS	DP=30	GT:GQ:DP	0|1:150:30	0|1
-9	252	.	TAAAA	TA,T	246	PASS	DP=10	GT:GQ:DP	0|1:12:10	0|1
-9	262	.	TAAAA	TA,T	246	PASS	DP=10	GT:GQ:DP	0|1:12:10	0|1
-1	100	.	GTTT	G	1806	q10	DP=35	GT:GQ:DP	0|1:409:35	0|1
-1	110	.	C	T,G	1792	PASS	DP=32	GT:GQ:DP	0|1:245:32	0|1
-1	110	.	CAAA	C	1792	PASS	DP=32	GT:GQ:DP	0|1:245:32	0|1
-1	120	.	GA	G	628	q10	DP=21	GT:GQ:DP	0|1:21:21	0|1
-1	130	.	G	T	1016	PASS	DP=22	GT:GQ:DP	0|1:212:22	0|1
-1	130	.	GAA	GG	1016	PASS	DP=22	GT:GQ:DP	0|1:212:22	0|1
-1	140	.	GT	G	727	PASS	DP=30	GT:GQ:DP	0|1:150:30	0|1
-1	150	.	TAAAA	TA,T	246	PASS	DP=10	GT:GQ:DP	0|1:12:10	0|1
-1	160	.	TAAAA	TA,T	246	PASS	DP=10	GT:GQ:DP	0|1:12:10	0|1
--- a/test-data/concat.3.b.vcf	Fri Feb 05 19:23:10 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,223 +0,0 @@
-##fileformat=VCFv4.0
-##INFO=<ID=T1,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T2,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T3,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T4,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T5,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T6,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T7,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T8,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T9,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T10,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T11,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T12,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T13,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T14,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T15,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T16,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T17,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T18,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T19,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T20,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T21,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T22,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T23,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T24,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T25,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T26,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T27,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T28,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T29,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T30,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T31,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T32,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T33,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T34,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T35,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T36,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T37,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T38,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T39,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T40,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T41,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T42,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T43,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T44,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T45,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T46,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T47,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T48,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T49,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T50,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T51,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T52,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T53,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T54,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T55,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T56,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T57,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T58,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T59,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T60,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T61,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T62,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T63,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T64,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T65,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T66,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T67,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T68,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T69,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T70,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T71,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T72,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T73,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T74,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T75,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T76,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T77,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T78,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T79,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T80,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T81,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T82,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T83,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T84,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T85,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T86,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T87,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T88,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T89,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T90,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T91,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T92,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T93,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T94,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T95,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T96,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T97,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T98,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T99,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T100,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T101,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T102,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T103,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T104,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T105,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T106,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T107,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T108,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T109,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T110,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T111,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T112,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T113,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T114,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T115,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T116,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T117,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T118,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T119,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T120,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T121,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T122,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T123,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T124,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T125,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T126,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T127,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T128,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T129,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T130,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T131,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T132,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T133,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T134,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T135,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T136,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T137,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T138,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T139,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T140,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T141,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T142,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T143,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T144,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T145,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T146,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T147,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T148,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T149,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T150,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T151,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T152,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T153,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T154,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T155,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T156,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T157,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T158,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T159,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T160,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T161,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T162,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T163,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T164,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T165,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T166,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T167,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T168,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T169,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T170,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T171,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T172,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T173,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T174,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T175,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T176,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T177,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T178,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T179,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T180,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T181,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T182,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T183,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T184,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T185,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T186,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T187,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T188,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T189,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T190,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T191,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T192,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T193,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T194,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T195,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T196,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T197,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T198,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=T199,Number=1,Type=Integer,Description="Test Tag: Big header">
-##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
-##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
-##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
-##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
-##FILTER=<ID=q10,Description="Quality below 10">
-##contig=<ID=2,length=62435964>
-#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
-2	170	.	T	A	246	PASS	DP=10	GT	1|0	0|1
-2	180	.	T	A	246	PASS	DP=10	GT	1|0	0|1
-2	190	.	T	A	246	PASS	DP=10	GT	1|0	0|1
-2	200	.	T	A	246	PASS	DP=10	GT	1|0	0|1
-2	210	.	T	A	246	PASS	DP=10	GT	1|0	0|1
-2	220	.	T	A	246	PASS	DP=10	GT	1|0	0|1
-2	230	.	T	A	246	PASS	DP=10	GT	1|0	0|1
-2	240	.	T	A	246	PASS	DP=10	GT	1|0	0|1
-2	250	.	T	A	246	PASS	DP=10	GT	1|0	0|1
-2	260	.	T	A	246	PASS	DP=10	GT	1|0	0|1
-2	270	.	T	A	246	PASS	DP=10	GT	1|0	0|1
-2	280	.	T	A	246	PASS	DP=10	GT	1|0	0|1
-2	290	.	T	A	246	PASS	DP=10	GT	1|0	0|1
-2	300	.	T	A	246	PASS	DP=10	GT	1|0	0|1
-2	310	.	T	A	246	PASS	DP=10	GT	1|0	0|1
-2	320	.	T	A	246	PASS	DP=10	GT	1|0	0|1
--- a/test-data/concat.3.c.vcf	Fri Feb 05 19:23:10 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,22 +0,0 @@
-##fileformat=VCFv4.0
-##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
-##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
-##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
-##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
-##FILTER=<ID=q10,Description="Quality below 10">
-##contig=<ID=2,length=62435964>
-#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
-2	280	.	T	A	246	PASS	DP=10	GT	1|0	0|1
-2	290	.	T	A	246	PASS	DP=10	GT	1|0	1|0
-2	300	.	T	A	246	PASS	DP=10	GT	0|1	1|0
-2	310	.	T	A	246	PASS	DP=10	GT	0|1	1|0
-2	320	.	T	A	246	PASS	DP=10	GT	0|1	1|0
-2	330	.	T	A	246	PASS	DP=10	GT	0|1	1|0
-2	340	.	T	A	246	PASS	DP=10	GT	0|1	1|0
-2	350	.	T	A	246	PASS	DP=10	GT	0|1	1|0
-2	360	.	T	A	246	PASS	DP=10	GT	0|1	1|0
-2	370	.	T	A	246	PASS	DP=10	GT	0|1	1|0
-2	380	.	T	A	246	PASS	DP=10	GT	0|1	1|0
-2	390	.	T	A	246	PASS	DP=10	GT	0|1	1|0
-2	400	.	T	A	246	PASS	DP=10	GT	0|1	1|0
-2	410	.	T	A	246	PASS	DP=10	GT	0|1	1|0
--- a/test-data/concat.3.d.vcf	Fri Feb 05 19:23:10 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,20 +0,0 @@
-##fileformat=VCFv4.0
-##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
-##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
-##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
-##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
-##FILTER=<ID=q10,Description="Quality below 10">
-##contig=<ID=2,length=62435964>
-#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
-2	300	.	T	A	246	PASS	DP=10	GT	1|0	1|0
-2	320	.	T	A	246	PASS	DP=10	GT	1|0	1|0
-2	330	.	T	A	246	PASS	DP=10	GT	1|0	1|0
-2	340	.	T	A	246	PASS	DP=10	GT	1|0	1|0
-2	350	.	T	A	246	PASS	DP=10	GT	1|0	1|0
-2	360	.	T	A	246	PASS	DP=10	GT	1|0	1|0
-2	370	.	T	A	246	PASS	DP=10	GT	1|0	1|0
-2	380	.	T	A	246	PASS	DP=10	GT	1|0	1|0
-2	390	.	T	A	246	PASS	DP=10	GT	1|0	1|0
-2	490	.	T	A	246	PASS	DP=10	GT	1|0	1|0
-2	500	.	T	A	246	PASS	DP=10	GT	1|0	1|0
-2	510	.	T	A	246	PASS	DP=10	GT	1|0	1|0
--- a/test-data/concat.3.e.vcf	Fri Feb 05 19:23:10 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,20 +0,0 @@
-##fileformat=VCFv4.0
-##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
-##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
-##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
-##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
-##FILTER=<ID=q10,Description="Quality below 10">
-##contig=<ID=2,length=62435964>
-#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
-2	310	.	T	A	246	PASS	DP=10	GT	0|1	0|1
-2	320	.	T	A	246	PASS	DP=10	GT	0|1	0|1
-2	330	.	T	A	246	PASS	DP=10	GT	0|1	0|1
-2	340	.	T	A	246	PASS	DP=10	GT	0|1	0|1
-2	350	.	T	A	246	PASS	DP=10	GT	0|1	0|1
-2	360	.	T	A	246	PASS	DP=10	GT	0|1	0|1
-2	370	.	T	A	246	PASS	DP=10	GT	0|1	0|1
-2	380	.	T	A	246	PASS	DP=10	GT	0|1	0|1
-2	390	.	T	A	246	PASS	DP=10	GT	0|1	0|1
-2	490	.	T	A	246	PASS	DP=10	GT	0|1	0|1
-2	500	.	T	A	246	PASS	DP=10	GT	0|1	0|1
-2	510	.	T	A	246	PASS	DP=10	GT	0|1	0|1
--- a/test-data/concat.3.f.vcf	Fri Feb 05 19:23:10 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,20 +0,0 @@
-##fileformat=VCFv4.0
-##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
-##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
-##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
-##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
-##FILTER=<ID=q10,Description="Quality below 10">
-##contig=<ID=3,length=62435964>
-#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	A	B
-3	380	.	T	A	246	PASS	DP=10	GT	1|0	1|0
-3	390	.	T	A	246	PASS	DP=10	GT	1|0	1|0
-3	400	.	T	A	246	PASS	DP=10	GT	1|0	1|0
-3	410	.	T	A	246	PASS	DP=10	GT	1|0	1|0
-3	420	.	T	A	246	PASS	DP=10	GT	1|0	1|0
-3	430	.	T	A	246	PASS	DP=10	GT	1|0	1|0
-3	440	.	T	A	246	PASS	DP=10	GT	1|0	1|0
-3	450	.	T	A	246	PASS	DP=10	GT	1|0	1|0
-3	460	.	T	A	246	PASS	DP=10	GT	1|0	1|0
-3	470	.	T	A	246	PASS	DP=10	GT	1|0	1|0
-3	480	.	T	A	246	PASS	DP=10	GT	1|0	1|0
-3	490	.	T	A	246	PASS	DP=10	GT	1|0	1|0
--- a/test-data/consensus.1.chain	Fri Feb 05 19:23:10 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,12 +0,0 @@
-chain 497 1 501 + 1 501 1 502 + 1 502 1
-11 3 1
-1 0 3
-485
-
-chain 485 2 501 + 0 501 2 495 + 0 495 2
-61 3 1
-54 3 1
-58 0 8
-21 10 0
-291
-
--- a/test-data/consensus.1.out	Fri Feb 05 19:23:10 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,20 +0,0 @@
->1:2-501
-TACAAAATATGATAAAATCAAAAAGAACATAACCTACGTATCAACTAAAGTGGTTGTTTG
-AAGAAAAGGAAGACTTAAAAAGAGTCAGTACTAACCTACATAATATATACAATGTTCATT
-AAATAATAAAATGAGCTCATCATACTTAGGTCATCATAAATATATCTGAAATTCACAAAT
-ATTGATCAAATGGTAAAATAGACAAGTAGATTTTAATAGGTTAAACAATTACTGATTCTC
-TTGAAAGAATAAATTTAATATGAGACCTATTTCATTATAATGAACTCACAAATTAGAAAC
-TTCACACTGGGGGCTGGAGAGATGGCTCAGTAGTTAAGAACACTGACTGCTCTTCTGAAG
-GTCCTGAGTTCAAATCCCAGCAACCACATGGTGACTTACAACCATCTGTAATGACATCTG
-NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
-TTTAAAAACAAAAAAAAAGAA
->2
-NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
-AAATTAGTGATTTTCCATATTCTTTAAGTCATTTTAGAGTAATGTGTTCTTAAGATTTCA
-GAAAAACAAAAACTTGTGCTTTCCTGTTTGAAAAACAAACAGCTGTGGGGAATGGACGTA
-CGTTGTCGGGACAGCCTTTTTATAAAATAATGTTGAGGCTTTGATACGTCAAAGNNNNNN
-NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGCT
-GCTGCCAATGACAGCACACCCTGGGAATGCCCCAACTACTTACTACAAAGCAGTGTTACA
-TGGAGAAGATCTTCAAGAGTCTTTTTGCTAGATCTTTCCTTGGCTTTTGATGTGACTCCT
-CTCAATAAAATCCACAGTAATATAGTGAGTGGTCTCCTGCTCCAAACCAGTATTCCAGAC
-ACAGTTAATCCAGAC
--- a/test-data/filter.4.vcf	Fri Feb 05 19:23:10 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,10 +0,0 @@
-##fileformat=VCFv4.1
-##contig=<ID=chr1,length=135006516>
-##INFO=<ID=TEST1,Number=1,Type=Integer,Description="Test1">
-##INFO=<ID=TEST2,Number=1,Type=Float,Description="Test2">
-##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
-##FORMAT=<ID=TEST3,Number=1,Type=Integer,Description="Test3">
-##FORMAT=<ID=TEST4,Number=1,Type=Float,Description="Test4">
-#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	sample1	sample2
-chr1	1	.	A	T	100	.	TEST1=10;TEST2=10	GT:TEST3:TEST4	0/1:10:10	0/1:30:30
-chr1	2	.	A	T	100	.	TEST1=50;TEST2=50	GT:TEST3:TEST4	0/1:20:20	0/1:40:40
Binary file test-data/mpileup.4.bam has changed
--- a/test-data/mpileup.c.X.vcf	Fri Feb 05 19:23:10 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,4127 +0,0 @@
-##fileformat=VCFv4.2
-##FILTER=<ID=PASS,Description="All filters passed">
-##samtoolsVersion=1.1-19-g6b249e2+htslib-1.1-74-g845c515
-##samtoolsCommand=samtools mpileup -uvDV -b xxx//mpileup.bam.list -f xxx//mpileup.ref.fa.gz
-##reference=file://xxx//mpileup.ref.fa.gz
-##contig=<ID=X,length=81195210>
-##ALT=<ID=X,Description="Represents allele(s) other than observed.">
-##INFO=<ID=INDEL,Number=0,Type=Flag,Description="Indicates that the variant is an INDEL.">
-##INFO=<ID=IDV,Number=1,Type=Integer,Description="Maximum number of reads supporting an indel">
-##INFO=<ID=IMF,Number=1,Type=Float,Description="Maximum fraction of reads supporting an indel">
-##INFO=<ID=DP,Number=1,Type=Integer,Description="Raw read depth">
-##INFO=<ID=VDB,Number=1,Type=Float,Description="Variant Distance Bias for filtering splice-site artefacts in RNA-seq data (bigger is better)",Version="3">
-##INFO=<ID=RPB,Number=1,Type=Float,Description="Mann-Whitney U test of Read Position Bias (bigger is better)">
-##INFO=<ID=MQB,Number=1,Type=Float,Description="Mann-Whitney U test of Mapping Quality Bias (bigger is better)">
-##INFO=<ID=BQB,Number=1,Type=Float,Description="Mann-Whitney U test of Base Quality Bias (bigger is better)">
-##INFO=<ID=MQSB,Number=1,Type=Float,Description="Mann-Whitney U test of Mapping Quality vs Strand Bias (bigger is better)">
-##INFO=<ID=SGB,Number=1,Type=Float,Description="Segregation based metric.">
-##INFO=<ID=MQ0F,Number=1,Type=Float,Description="Fraction of MQ0 reads (smaller is better)">
-##INFO=<ID=I16,Number=16,Type=Float,Description="Auxiliary tag used for calling, see description of bcf_callret1_t in bam2bcf.h">
-##INFO=<ID=QS,Number=R,Type=Float,Description="Auxiliary tag used for calling">
-##FORMAT=<ID=PL,Number=G,Type=Integer,Description="List of Phred-scaled genotype likelihoods">
-##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Number of high-quality bases">
-##FORMAT=<ID=DV,Number=1,Type=Integer,Description="Number of high-quality non-reference bases">
-#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	HG00100	HG00101	HG00102
-X	1	.	A	<*>	0	.	DP=11;I16=11,0,0,0,452,18594,0,0,319,9251,0,0,223,4959,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-X	2	.	A	<*>	0	.	DP=11;I16=11,0,0,0,439,17587,0,0,319,9251,0,0,226,5030,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-X	3	.	G	<*>	0	.	DP=11;I16=11,0,0,0,431,16971,0,0,319,9251,0,0,229,5111,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-X	4	.	C	<*>	0	.	DP=11;I16=11,0,0,0,423,16417,0,0,319,9251,0,0,232,5202,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,71:3:0
-X	5	.	T	<*>	0	.	DP=11;I16=11,0,0,0,450,18520,0,0,319,9251,0,0,234,5252,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-X	6	.	T	<*>	0	.	DP=11;I16=11,0,0,0,403,14847,0,0,319,9251,0,0,236,5310,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-X	7	.	C	<*>	0	.	DP=11;I16=11,0,0,0,446,18114,0,0,319,9251,0,0,237,5327,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-X	8	.	T	<*>	0	.	DP=11;I16=11,0,0,0,465,19677,0,0,319,9251,0,0,238,5354,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-X	9	.	C	<*>	0	.	DP=11;I16=11,0,0,0,447,18205,0,0,319,9251,0,0,239,5391,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-X	10	.	A	<*>	0	.	DP=11;I16=11,0,0,0,426,16756,0,0,319,9251,0,0,240,5438,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,69:3:0
-X	11	.	C	<*>	0	.	DP=11;I16=11,0,0,0,413,15603,0,0,319,9251,0,0,241,5495,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-X	12	.	C	<*>	0	.	DP=11;I16=11,0,0,0,438,17506,0,0,319,9251,0,0,242,5562,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-X	13	.	C	<*>	0	.	DP=11;I16=11,0,0,0,437,17463,0,0,319,9251,0,0,243,5639,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-X	14	.	T	<*>	0	.	DP=11;I16=11,0,0,0,453,18715,0,0,319,9251,0,0,242,5628,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-X	15	.	G	<*>	0	.	DP=11;I16=11,0,0,0,439,17599,0,0,319,9251,0,0,240,5580,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-X	16	.	T	<*>	0	.	DP=11;I16=11,0,0,0,426,16546,0,0,319,9251,0,0,238,5544,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-X	17	.	T	<*>	0	.	DP=11;I16=11,0,0,0,407,15195,0,0,319,9251,0,0,235,5469,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-X	18	.	C	<*>	0	.	DP=12;I16=12,0,0,0,450,17136,0,0,379,12851,0,0,231,5353,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,18,113:6:0	0,9,72:3:0	0,9,72:3:0
-X	19	.	C	<*>	0	.	DP=13;I16=13,0,0,0,502,19652,0,0,439,16451,0,0,228,5246,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,18,112:6:0	0,12,89:4:0	0,9,72:3:0
-X	20	.	T	<*>	0	.	DP=13;I16=13,0,0,0,532,21878,0,0,439,16451,0,0,226,5150,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,18,116:6:0	0,12,98:4:0	0,9,72:3:0
-X	21	.	G	<*>	0	.	DP=13;I16=13,0,0,0,498,19254,0,0,439,16451,0,0,224,5066,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,18,117:6:0	0,12,94:4:0	0,9,72:3:0
-X	22	.	C	<*>	0	.	DP=13;I16=13,0,0,0,511,20289,0,0,470,19210,0,0,223,4993,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,18,115:6:0	0,12,91:4:0	0,9,76:3:0
-X	23	.	A	<*>	0	.	DP=14;I16=14,0,0,0,513,19399,0,0,530,22810,0,0,223,4931,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,133:7:0	0,12,82:4:0	0,9,82:3:0
-X	24	.	T	<*>	0	.	DP=14;I16=14,0,0,0,534,20540,0,0,530,22810,0,0,224,4882,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,131:7:0	0,12,96:4:0	0,9,80:3:0
-X	25	.	A	<*>	0	.	DP=15;I16=15,0,0,0,561,21133,0,0,590,26410,0,0,225,4847,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,140:8:0	0,12,96:4:0	0,9,81:3:0
-X	26	.	G	<*>	0	.	DP=15;I16=15,0,0,0,591,23429,0,0,590,26410,0,0,227,4827,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,151:8:0	0,12,96:4:0	0,9,81:3:0
-X	27	.	A	<*>	0	.	DP=15;I16=15,0,0,0,588,23120,0,0,590,26410,0,0,229,4823,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,146:8:0	0,12,98:4:0	0,9,83:3:0
-X	28	.	T	<*>	0	.	DP=16;I16=16,0,0,0,605,23001,0,0,650,30010,0,0,231,4835,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,147:8:0	0,12,97:4:0	0,12,101:4:0
-X	29	.	A	<*>	0	.	DP=17;I16=17,0,0,0,615,22533,0,0,710,33610,0,0,234,4864,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,146:8:0	0,15,102:5:0	0,12,104:4:0
-X	30	.	A	<*>	0	.	DP=17;I16=17,0,0,0,660,25914,0,0,710,33610,0,0,238,4912,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,149:8:0	0,15,115:5:0	0,12,108:4:0
-X	31	.	T	<*>	0	.	DP=17;I16=17,0,0,0,656,25392,0,0,710,33610,0,0,242,4980,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,150:8:0	0,15,113:5:0	0,12,105:4:0
-X	32	.	T	<*>	0	.	DP=17;I16=17,0,0,0,605,21789,0,0,741,36369,0,0,247,5067,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,143:8:0	0,15,104:5:0	0,12,104:4:0
-X	33	.	G	<*>	0	.	DP=17;I16=17,0,0,0,659,25757,0,0,741,36369,0,0,252,5124,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,158:8:0	0,15,118:5:0	0,12,105:4:0
-X	34	.	C	<*>	0	.	DP=17;I16=17,0,0,0,658,25704,0,0,741,36369,0,0,257,5203,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,151:8:0	0,15,121:5:0	0,12,106:4:0
-X	35	.	A	<*>	0	.	DP=18;I16=18,0,0,0,677,25881,0,0,801,39969,0,0,262,5304,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,152:8:0	0,15,109:5:0	0,15,121:5:0
-X	36	.	T	<*>	0	.	DP=18;I16=18,0,0,0,678,25796,0,0,801,39969,0,0,268,5428,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,151:8:0	0,15,114:5:0	0,15,125:5:0
-X	37	.	G	<*>	0	.	DP=18;I16=18,0,0,0,685,26291,0,0,801,39969,0,0,274,5576,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,157:8:0	0,15,116:5:0	0,15,126:5:0
-X	38	.	A	<*>	0	.	DP=18;I16=18,0,0,0,697,27245,0,0,801,39969,0,0,280,5748,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,152:8:0	0,15,116:5:0	0,15,129:5:0
-X	39	.	C	<*>	0	.	DP=16;I16=16,0,0,0,591,22311,0,0,743,38287,0,0,288,5942,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,148:7:0	0,12,94:4:0	0,15,123:5:0
-X	40	.	A	<*>	0	.	DP=16;I16=16,0,0,0,630,24896,0,0,743,38287,0,0,295,6107,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,146:7:0	0,12,104:4:0	0,15,127:5:0
-X	41	.	A	<*>	0	.	DP=17;I16=17,0,0,0,645,24685,0,0,803,41887,0,0,302,6294,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,151:8:0	0,12,104:4:0	0,15,131:5:0
-X	42	.	T	<*>	0	.	DP=17;I16=17,0,0,0,618,23118,0,0,803,41887,0,0,310,6504,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,155:8:0	0,12,82:4:0	0,15,127:5:0
-X	43	.	T	<*>	0	.	DP=17;I16=17,0,0,0,631,23689,0,0,803,41887,0,0,318,6738,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,151:8:0	0,12,101:4:0	0,15,129:5:0
-X	44	.	G	<*>	0	.	DP=17;I16=17,0,0,0,664,26162,0,0,803,41887,0,0,324,6896,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,164:8:0	0,12,100:4:0	0,15,129:5:0
-X	45	.	C	<*>	0	.	DP=17;I16=17,0,0,0,657,25525,0,0,803,41887,0,0,329,7027,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,163:8:0	0,12,108:4:0	0,15,125:5:0
-X	46	.	C	<*>	0	.	DP=17;I16=17,0,0,0,646,25244,0,0,803,41887,0,0,334,7180,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,161:8:0	0,12,98:4:0	0,15,131:5:0
-X	47	.	T	<*>	0	.	DP=17;I16=17,0,0,0,700,28998,0,0,803,41887,0,0,339,7355,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,165:8:0	0,12,110:4:0	0,15,136:5:0
-X	48	.	T	<*>	0	.	DP=17;I16=17,0,0,0,648,25020,0,0,803,41887,0,0,343,7501,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,155:8:0	0,12,105:4:0	0,15,131:5:0
-X	49	.	G	<*>	0	.	DP=18;I16=18,0,0,0,686,26674,0,0,832,42728,0,0,346,7616,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,158:8:0	0,15,119:5:0	0,15,128:5:0
-X	50	.	T	<*>	0	.	DP=18;I16=17,0,0,0,650,24972,0,0,772,39128,0,0,332,7426,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,155:8:0	0,12,101:4:0	0,15,128:5:0
-X	51	.	C	<*>	0	.	DP=18;I16=18,0,0,0,681,26529,0,0,832,42728,0,0,353,7853,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,167:8:0	0,15,99:5:0	0,15,127:5:0
-X	52	.	C	<*>	0	.	DP=18;I16=17,0,0,0,645,24983,0,0,803,41887,0,0,353,7965,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,164:8:0	0,12,99:4:0	0,15,128:5:0
-X	53	.	C	<*>	0	.	DP=18;I16=18,0,0,0,687,26735,0,0,832,42728,0,0,359,8113,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,164:8:0	0,15,113:5:0	0,15,132:5:0
-X	54	.	T	<*>	0	.	DP=18;I16=18,0,0,0,736,30194,0,0,832,42728,0,0,361,8219,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,163:8:0	0,15,128:5:0	0,15,136:5:0
-X	55	.	G	<*>	0	.	DP=18;I16=18,0,0,0,674,26082,0,0,832,42728,0,0,362,8290,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,168:8:0	0,15,112:5:0	0,15,122:5:0
-X	56	.	C	<*>	0	.	DP=18;I16=18,0,0,0,701,27645,0,0,832,42728,0,0,363,8375,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,162:8:0	0,15,121:5:0	0,15,131:5:0
-X	57	.	T	<*>	0	.	DP=18;I16=17,0,0,0,694,29118,0,0,803,41887,0,0,356,8410,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,163:8:0	0,12,117:4:0	0,15,138:5:0
-X	58	.	G	<*>	0	.	DP=17;I16=16,0,0,0,616,24356,0,0,774,41046,0,0,356,8454,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,159:7:0	0,12,95:4:0	0,15,131:5:0
-X	59	.	A	<*>	0	.	DP=17;I16=17,0,0,0,656,26038,0,0,803,41887,0,0,366,8606,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,155:7:0	0,15,116:5:0	0,15,134:5:0
-X	60	.	A	<*>	0	.	DP=17;I16=17,0,0,0,663,26463,0,0,803,41887,0,0,367,8687,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,151:7:0	0,15,127:5:0	0,15,138:5:0
-X	61	.	T	<*>	0	.	DP=17;I16=16,0,0,0,605,23215,0,0,774,41046,0,0,355,8583,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,152:7:0	0,12,101:4:0	0,15,131:5:0
-X	62	.	G	<*>	0	.	DP=18;I16=17,0,0,0,646,24868,0,0,834,44646,0,0,353,8557,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,158:7:0	0,12,103:4:0	0,18,141:6:0
-X	63	.	T	<*>	0	.	DP=18;I16=17,0,0,0,590,21682,0,0,803,41887,0,0,341,8111,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,148:7:0	0,12,80:4:0	0,18,144:6:0
-X	64	.	G	<*>	0	.	DP=19;I16=19,0,0,0,696,26416,0,0,923,49087,0,0,366,8758,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,169:8:0	0,15,103:5:0	0,18,142:6:0
-X	65	.	C	<*>	0	.	DP=18;I16=18,0,0,0,686,26512,0,0,894,48246,0,0,367,8743,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,163:7:0	0,15,116:5:0	0,18,147:6:0
-X	66	.	T	<*>	0	.	DP=18;I16=17,0,0,0,691,28315,0,0,834,44646,0,0,342,8068,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,164:7:0	0,12,110:4:0	0,18,153:6:0
-X	67	.	C	<*>	0	.	DP=17;I16=17,0,0,0,645,25313,0,0,834,44646,0,0,341,7983,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,163:7:0	0,12,94:4:0	0,18,147:6:0
-X	68	.	T	<*>	0	.	DP=17;I16=17,0,0,0,691,28307,0,0,834,44646,0,0,339,7863,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,165:7:0	0,12,108:4:0	0,18,151:6:0
-X	69	.	G	<*>	0	.	DP=17;I16=17,0,0,0,657,25721,0,0,865,47405,0,0,338,7758,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,172:8:0	0,9,93:3:0	0,18,142:6:0
-X	70	.	G	<*>	0	.	DP=17;I16=16,0,0,0,575,21391,0,0,836,46564,0,0,317,7227,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,162:8:0	0,6,64:2:0	0,18,141:6:0
-X	71	.	G	<*>	0	.	DP=17;I16=15,0,0,0,571,21975,0,0,776,42964,0,0,307,7029,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,170:8:0	0,6,72:2:0	0,15,130:5:0
-X	72	.	G	<*>	0	.	DP=17;I16=15,0,0,0,572,22002,0,0,776,42964,0,0,305,6907,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,171:8:0	0,6,65:2:0	0,15,131:5:0
-X	73	.	T	<*>	0	.	DP=18;I16=16,0,0,0,623,25301,0,0,836,46564,0,0,314,6918,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,158:8:0	0,6,94:2:0	0,18,143:6:0
-X	74	.	C	<*>	0	.	DP=18;I16=17,0,0,0,674,28110,0,0,865,47405,0,0,338,7468,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,176:8:0	0,9,106:3:0	0,18,141:6:0
-X	75	.	T	<*>	0	.	DP=18;I16=16,0,0,0,685,30675,0,0,836,46564,0,0,312,6782,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,175:8:0	0,6,90:2:0	0,18,150:6:0
-X	76	.	C	<*>	0	.	DP=18;I16=17,0,0,0,683,29481,0,0,865,47405,0,0,336,7360,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,174:8:0	0,9,98:3:0	0,18,148:6:0
-X	77	.	T	<*>	0	.	DP=18;I16=16,0,0,0,710,33072,0,0,836,46564,0,0,310,6702,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,179:8:0	0,6,92:2:0	0,18,154:6:0
-X	78	.	G	<*>	0	.	DP=18;I16=16,0,0,0,692,31158,0,0,836,46564,0,0,309,6683,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,180:8:0	0,6,94:2:0	0,18,149:6:0
-X	79	.	G	<*>	0	.	DP=18;I16=15,0,0,0,605,26629,0,0,776,42964,0,0,283,6053,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,168:8:0	0,3,60:1:0	0,18,149:6:0
-X	80	.	G	<*>	0	.	DP=18;I16=17,0,0,0,688,30128,0,0,865,47405,0,0,332,7312,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,173:8:0	0,9,106:3:0	0,18,151:6:0
-X	81	.	G	<*>	0	.	DP=18;I16=16,0,0,0,631,27429,0,0,836,46564,0,0,326,7310,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,165:7:0	0,9,97:3:0	0,18,145:6:0
-X	82	.	T	<*>	0	.	DP=18;I16=15,0,0,0,559,22735,0,0,776,42964,0,0,280,6122,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,154:8:0	0,3,60:1:0	0,18,131:6:0
-X	83	.	C	<*>	0	.	DP=18;I16=16,0,0,0,622,27146,0,0,836,46564,0,0,304,6798,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,170:8:0	0,6,75:2:0	0,18,145:6:0
-X	84	.	T	<*>	0	.	DP=18;I16=17,0,0,0,705,32445,0,0,865,47405,0,0,328,7488,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,181:8:0	0,9,85:3:0	0,18,154:6:0
-X	85	.	C	<*>	0	.	DP=18;I16=17,0,0,0,708,31222,0,0,865,47405,0,0,327,7567,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,181:8:0	0,9,108:3:0	0,18,153:6:0
-X	86	.	A	<*>	0	.	DP=18;I16=17,0,0,0,692,29540,0,0,865,47405,0,0,326,7660,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,169:8:0	0,9,111:3:0	0,18,149:6:0
-X	87	.	C	<*>	0	.	DP=18;I16=17,0,0,0,683,29493,0,0,896,50164,0,0,326,7766,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,174:8:0	0,9,103:3:0	0,18,148:6:0
-X	88	.	C	<*>	0	.	DP=18;I16=17,0,0,0,703,31005,0,0,896,50164,0,0,326,7834,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,174:8:0	0,9,113:3:0	0,18,153:6:0
-X	89	.	C	<*>	0	.	DP=18;I16=17,0,0,0,697,30875,0,0,896,50164,0,0,326,7914,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,176:8:0	0,9,103:3:0	0,18,154:6:0
-X	90	.	A	<*>	0	.	DP=17;I16=16,0,0,0,668,29732,0,0,867,49323,0,0,326,7954,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,173:8:0	0,9,114:3:0	0,15,138:5:0
-X	91	.	C	<*>	0	.	DP=16;I16=15,0,0,0,613,26409,0,0,838,48482,0,0,327,8001,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,170:7:0	0,9,113:3:0	0,15,133:5:0
-X	92	.	G	<*>	0	.	DP=16;I16=15,0,0,0,499,18731,0,0,838,48482,0,0,328,8054,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,143:7:0	0,9,100:3:0	0,15,96:5:0
-X	93	.	A	<*>	0	.	DP=16;I16=15,0,0,0,635,28655,0,0,869,51241,0,0,329,8063,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,167:7:0	0,9,108:3:0	0,15,145:5:0
-X	94	.	C	<*>	0	.	DP=16;I16=15,0,0,0,607,25893,0,0,869,51241,0,0,331,8079,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,166:7:0	0,9,105:3:0	0,15,135:5:0
-X	95	.	C	<*>	0	.	DP=17;I16=15,0,0,0,615,26761,0,0,900,54000,0,0,306,7378,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,178:8:0	0,6,91:2:0	0,15,135:5:0
-X	96	.	A	<*>	0	.	DP=17;I16=16,0,0,0,625,26705,0,0,929,54841,0,0,332,7936,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,172:8:0	0,9,99:3:0	0,15,134:5:0
-X	97	.	A	<*>	0	.	DP=18;I16=17,0,0,0,675,29017,0,0,958,55682,0,0,333,7879,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,179:9:0	0,9,104:3:0	0,15,145:5:0
-X	98	.	C	<*>	0	.	DP=18;I16=17,0,0,0,655,27231,0,0,958,55682,0,0,333,7735,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,179:9:0	0,9,105:3:0	0,15,131:5:0
-X	99	.	T	<*>	0	.	DP=18;I16=17,0,0,0,720,32840,0,0,958,55682,0,0,333,7607,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,186:9:0	0,9,115:3:0	0,15,153:5:0
-X	100	.	C	<*>	0	.	DP=18;I16=17,0,0,0,688,29762,0,0,958,55682,0,0,332,7446,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,189:9:0	0,9,108:3:0	0,15,134:5:0
-X	101	.	C	<*>	0	.	DP=18;I16=17,0,0,0,650,27530,0,0,958,55682,0,0,331,7303,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,182:9:0	0,9,99:3:0	0,15,132:5:0
-X	102	.	C	<*>	0	.	DP=18;I16=17,0,0,0,695,30453,0,0,958,55682,0,0,330,7178,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,188:9:0	0,9,111:3:0	0,15,139:5:0
-X	103	.	T	<*>	0	.	DP=18;I16=16,0,0,0,692,31998,0,0,929,54841,0,0,323,7035,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,189:8:0	0,9,108:3:0	0,15,147:5:0
-X	104	.	G	<*>	0	.	DP=18;I16=15,0,0,0,611,26723,0,0,900,54000,0,0,295,6259,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,178:8:0	0,6,89:2:0	0,15,133:5:0
-X	105	.	G	<*>	0	.	DP=19;I16=17,0,0,0,604,23936,0,0,989,58441,0,0,317,6751,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,170:9:0	0,9,97:3:0	0,15,125:5:0
-X	106	.	G	<*>	0	.	DP=19;I16=17,0,0,0,644,26574,0,0,989,58441,0,0,299,6093,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,30,190:10:0	0,6,85:2:0	0,15,124:5:0
-X	107	.	C	<*>	0	.	DP=19;I16=17,0,0,0,694,30064,0,0,989,58441,0,0,313,6543,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,192:9:0	0,9,108:3:0	0,15,136:5:0
-X	108	.	C	<*>	0	.	DP=19;I16=17,0,0,0,692,30148,0,0,989,58441,0,0,310,6420,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,190:9:0	0,9,108:3:0	0,15,135:5:0
-X	109	.	T	<*>	0	.	DP=19;I16=17,0,0,0,741,34273,0,0,989,58441,0,0,307,6319,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,195:9:0	0,9,110:3:0	0,15,150:5:0
-X	110	.	G	<*>	0	.	DP=19;I16=17,0,0,0,704,31276,0,0,989,58441,0,0,304,6240,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,194:9:0	0,9,104:3:0	0,15,136:5:0
-X	111	.	G	<*>	0	.	DP=19;I16=16,0,0,0,584,24362,0,0,929,54841,0,0,272,5416,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,30,167:10:0	0,6,88:2:0	0,12,118:4:0
-X	112	.	C	<*>	0	.	DP=19;I16=17,0,0,0,680,29854,0,0,989,58441,0,0,296,6052,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,191:9:0	0,9,95:3:0	0,15,135:5:0
-X	113	.	A	<*>	0	.	DP=19;I16=16,0,0,0,645,28035,0,0,960,57600,0,0,266,5318,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,176:9:0	0,6,87:2:0	0,15,139:5:0
-X	114	.	C	<*>	0	.	DP=19;I16=17,0,0,0,674,28788,0,0,989,58441,0,0,286,5856,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,27,182:9:0	0,9,103:3:0	0,15,133:5:0
-X	115	.	C	<*>	0	.	DP=21;I16=18,0,0,0,708,30546,0,0,1049,62041,0,0,274,5490,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,30,189:10:0	0,6,89:2:0	0,18,147:6:0
-X	116	.	A	<*>	0	.	DP=21;I16=17,1,0,0,727,31755,0,0,1049,62041,0,0,253,5079,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,183:9:0	0,6,90:2:0	0,21,175:7:0
-X	117	.	G	<*>	0	.	DP=21;I16=17,1,0,0,723,31221,0,0,1049,62041,0,0,249,5019,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,186:9:0	0,6,86:2:0	0,21,177:7:0
-X	118	.	G	<*>	0	.	DP=20;I16=16,1,0,0,636,26574,0,0,958,55682,0,0,266,5426,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,175:9:0	0,3,60:1:0	0,21,162:7:0
-X	119	.	G	<*>	0	.	DP=19;I16=16,1,0,0,629,26439,0,0,958,55682,0,0,267,5553,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,175:8:0	0,6,73:2:0	0,21,160:7:0
-X	120	.	A	<*>	0	.	DP=19;I16=16,1,0,0,672,29188,0,0,958,55682,0,0,264,5518,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,175:8:0	0,6,83:2:0	0,21,171:7:0
-X	121	.	G	<*>	0	.	DP=19;I16=16,1,0,0,662,28460,0,0,958,55682,0,0,260,5454,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,181:8:0	0,6,80:2:0	0,21,168:7:0
-X	122	.	C	<*>	0	.	DP=20;I16=17,1,0,0,716,31224,0,0,1018,59282,0,0,256,5410,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,181:8:0	0,9,99:3:0	0,21,178:7:0
-X	123	.	T	<*>	0	.	DP=18;I16=15,1,0,0,661,29997,0,0,898,52082,0,0,255,5385,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,167:7:0	0,9,112:3:0	0,18,166:6:0
-X	124	.	T	<*>	0	.	DP=19;I16=17,1,0,0,626,24802,0,0,987,56523,0,0,279,6003,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,154:9:0	0,9,104:3:0	0,18,154:6:0
-X	125	.	A	<*>	0	.	DP=18;I16=15,1,0,0,611,25689,0,0,898,52082,0,0,254,5340,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,154:7:0	0,9,104:3:0	0,18,162:6:0
-X	126	.	A	<*>	0	.	DP=18;I16=16,1,0,0,648,27366,0,0,927,52923,0,0,279,5947,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,162:8:0	0,9,107:3:0	0,18,174:6:0
-X	127	.	C	<*>	0	.	DP=18;I16=16,1,0,0,646,26972,0,0,927,52923,0,0,279,5949,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,163:8:0	0,9,109:3:0	0,18,160:6:0
-X	128	.	A	<*>	0	.	DP=18;I16=16,1,0,0,673,28797,0,0,927,52923,0,0,279,5971,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,169:8:0	0,9,111:3:0	0,18,162:6:0
-X	129	.	A	<*>	0	.	DP=17;I16=15,1,0,0,645,27891,0,0,867,49323,0,0,280,6012,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,168:8:0	0,9,113:3:0	0,15,159:5:0
-X	130	.	A	<*>	0	.	DP=17;I16=15,1,0,0,641,27295,0,0,867,49323,0,0,281,6071,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,169:8:0	0,9,113:3:0	0,15,152:5:0
-X	131	.	C	<*>	0	.	DP=16;I16=14,1,0,0,606,25732,0,0,838,48482,0,0,256,5472,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,167:7:0	0,9,110:3:0	0,15,147:5:0
-X	132	.	A	<*>	0	.	DP=16;I16=14,1,0,0,627,27579,0,0,838,48482,0,0,256,5514,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,169:7:0	0,9,110:3:0	0,15,151:5:0
-X	133	.	T	<*>	0	.	DP=15;I16=13,2,0,0,584,22816,0,0,838,48482,0,0,282,6196,0,0;QS=3,0;MQSB=0.576923;MQ0F=0	PL:DP:DV	0,21,163:7:0	0,9,105:3:0	0,15,150:5:0
-X	134	.	C	<*>	0	.	DP=15;I16=13,2,0,0,607,24653,0,0,838,48482,0,0,283,6267,0,0;QS=3,0;MQSB=0.576923;MQ0F=0	PL:DP:DV	0,21,177:7:0	0,9,105:3:0	0,15,152:5:0
-X	135	.	T	<*>	0	.	DP=15;I16=13,2,0,0,600,24178,0,0,838,48482,0,0,284,6352,0,0;QS=3,0;MQSB=0.576923;MQ0F=0	PL:DP:DV	0,21,173:7:0	0,9,106:3:0	0,15,156:5:0
-X	136	.	G	<*>	0	.	DP=15;I16=13,2,0,0,574,22258,0,0,838,48482,0,0,286,6450,0,0;QS=3,0;MQSB=0.576923;MQ0F=0	PL:DP:DV	0,21,172:7:0	0,9,105:3:0	0,15,134:5:0
-X	137	.	T	<*>	0	.	DP=15;I16=13,2,0,0,563,21377,0,0,838,48482,0,0,289,6561,0,0;QS=3,0;MQSB=0.576923;MQ0F=0	PL:DP:DV	0,21,160:7:0	0,9,104:3:0	0,15,139:5:0
-X	138	.	C	<*>	0	.	DP=15;I16=13,2,0,0,584,23088,0,0,838,48482,0,0,291,6637,0,0;QS=3,0;MQSB=0.576923;MQ0F=0	PL:DP:DV	0,21,172:7:0	0,9,108:3:0	0,15,142:5:0
-X	139	.	C	<*>	0	.	DP=15;I16=13,2,0,0,554,20790,0,0,838,48482,0,0,292,6680,0,0;QS=3,0;MQSB=0.576923;MQ0F=0	PL:DP:DV	0,21,161:7:0	0,9,106:3:0	0,15,143:5:0
-X	140	.	A	<*>	0	.	DP=15;I16=13,2,0,0,583,22789,0,0,838,48482,0,0,292,6690,0,0;QS=3,0;MQSB=0.576923;MQ0F=0	PL:DP:DV	0,21,163:7:0	0,9,107:3:0	0,15,153:5:0
-X	141	.	G	<*>	0	.	DP=14;I16=12,2,0,0,534,20750,0,0,778,44882,0,0,292,6664,0,0;QS=3,0;MQSB=0.583333;MQ0F=0	PL:DP:DV	0,18,158:6:0	0,9,108:3:0	0,15,142:5:0
-X	142	.	C	<*>	0	.	DP=14;I16=12,2,0,0,503,18593,0,0,778,44882,0,0,292,6650,0,0;QS=3,0;MQSB=0.583333;MQ0F=0	PL:DP:DV	0,18,157:6:0	0,9,97:3:0	0,15,129:5:0
-X	143	.	G	<*>	0	.	DP=14;I16=11,2,0,0,415,13657,0,0,718,41282,0,0,285,6599,0,0;QS=3,0;MQSB=0.590909;MQ0F=0	PL:DP:DV	0,18,128:6:0	0,9,95:3:0	0,12,97:4:0
-X	144	.	A	<*>	0	.	DP=14;I16=12,2,0,0,519,19725,0,0,778,44882,0,0,291,6609,0,0;QS=3,0;MQSB=0.583333;MQ0F=0	PL:DP:DV	0,18,152:6:0	0,9,105:3:0	0,15,129:5:0
-X	145	.	A	<*>	0	.	DP=14;I16=12,2,0,0,527,20289,0,0,778,44882,0,0,290,6584,0,0;QS=3,0;MQSB=0.583333;MQ0F=0	PL:DP:DV	0,18,153:6:0	0,9,106:3:0	0,15,138:5:0
-X	146	.	T	<*>	0	.	DP=14;I16=12,2,0,0,514,19484,0,0,778,44882,0,0,289,6573,0,0;QS=3,0;MQSB=0.583333;MQ0F=0	PL:DP:DV	0,18,152:6:0	0,9,103:3:0	0,15,128:5:0
-X	147	.	A	<*>	0	.	DP=14;I16=12,2,0,0,515,19213,0,0,778,44882,0,0,288,6576,0,0;QS=3,0;MQSB=0.583333;MQ0F=0	PL:DP:DV	0,18,150:6:0	0,9,99:3:0	0,15,140:5:0
-X	148	.	C	<*>	0	.	DP=14;I16=12,2,0,0,541,21019,0,0,778,44882,0,0,286,6542,0,0;QS=3,0;MQSB=0.583333;MQ0F=0	PL:DP:DV	0,18,157:6:0	0,9,106:3:0	0,15,146:5:0
-X	149	.	C	<*>	0	.	DP=14;I16=12,2,0,0,512,19326,0,0,778,44882,0,0,283,6471,0,0;QS=3,0;MQSB=0.583333;MQ0F=0	PL:DP:DV	0,18,148:6:0	0,9,109:3:0	0,15,140:5:0
-X	150	.	T	<*>	0	.	DP=13;I16=11,2,0,0,511,20251,0,0,749,44041,0,0,280,6362,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,18,153:6:0	0,6,84:2:0	0,15,152:5:0
-X	151	.	G	<*>	0	.	DP=13;I16=11,2,0,0,506,19826,0,0,749,44041,0,0,277,6263,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,18,157:6:0	0,6,84:2:0	0,15,144:5:0
-X	152	.	C	<*>	0	.	DP=14;I16=12,2,0,0,543,21283,0,0,809,47641,0,0,274,6174,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,21,168:7:0	0,6,84:2:0	0,15,146:5:0
-X	153	.	A	<*>	0	.	DP=14;I16=12,2,0,0,536,20594,0,0,809,47641,0,0,272,6096,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,21,156:7:0	0,6,81:2:0	0,15,153:5:0
-X	154	.	T	<*>	0	.	DP=14;I16=12,2,0,0,523,20051,0,0,809,47641,0,0,270,6030,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,21,159:7:0	0,6,83:2:0	0,15,139:5:0
-X	155	.	C	<*>	0	.	DP=14;I16=12,2,0,0,542,21254,0,0,809,47641,0,0,268,5976,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,21,172:7:0	0,6,85:2:0	0,15,139:5:0
-X	156	.	C	<*>	0	.	DP=14;I16=12,2,0,0,536,20884,0,0,809,47641,0,0,266,5934,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,21,163:7:0	0,6,84:2:0	0,15,150:5:0
-X	157	.	C	<*>	0	.	DP=14;I16=12,2,0,0,555,22081,0,0,809,47641,0,0,264,5904,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,21,169:7:0	0,6,85:2:0	0,15,149:5:0
-X	158	.	T	<*>	0	.	DP=14;I16=12,2,0,0,568,23154,0,0,809,47641,0,0,262,5886,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,21,170:7:0	0,6,84:2:0	0,15,159:5:0
-X	159	.	A	<*>	0	.	DP=15;I16=12,2,0,0,519,19467,0,0,809,47641,0,0,260,5880,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,21,157:7:0	0,6,83:2:0	0,15,135:5:0
-X	160	.	G	<*>	0	.	DP=15;I16=13,2,0,0,547,20633,0,0,869,51241,0,0,259,5887,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,21,165:7:0	0,6,85:2:0	0,18,139:6:0
-X	161	.	A	<*>	0	.	DP=15;I16=13,2,0,0,568,21610,0,0,869,51241,0,0,258,5908,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,21,157:7:0	0,6,83:2:0	0,18,162:6:0
-X	162	.	A	<*>	0	.	DP=15;I16=13,2,0,0,557,21139,0,0,869,51241,0,0,255,5843,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,21,147:7:0	0,6,87:2:0	0,18,167:6:0
-X	163	.	G	<*>	0	.	DP=14;I16=12,2,0,0,503,18645,0,0,809,47641,0,0,253,5791,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,21,153:7:0	0,6,79:2:0	0,15,138:5:0
-X	164	.	T	<*>	0	.	DP=14;I16=12,2,0,0,460,15968,0,0,809,47641,0,0,252,5750,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,18,131:6:0	0,6,79:2:0	0,18,136:6:0
-X	165	.	G	<*>	0	.	DP=14;I16=10,2,0,0,456,17460,0,0,689,40441,0,0,226,5094,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,18,149:6:0	0,6,80:2:0	0,12,122:4:0
-X	166	.	A	<*>	0	.	DP=14;I16=11,2,0,0,496,19138,0,0,749,44041,0,0,227,5077,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,18,145:6:0	0,6,82:2:0	0,15,148:5:0
-X	167	.	A	<*>	0	.	DP=14;I16=11,2,0,0,477,17851,0,0,749,44041,0,0,227,5071,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,18,132:6:0	0,6,86:2:0	0,15,147:5:0
-X	168	.	G	<*>	0	.	DP=14;I16=12,2,0,0,481,18015,0,0,809,47641,0,0,252,5702,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,18,145:6:0	0,6,82:2:0	0,18,140:6:0
-X	169	.	C	<*>	0	.	DP=13;I16=10,2,0,0,402,14224,0,0,689,40441,0,0,227,5045,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,15,106:5:0	0,6,76:2:0	0,15,145:5:0
-X	170	.	C	<*>	0	.	DP=13;I16=11,2,0,0,447,16383,0,0,749,44041,0,0,251,5601,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,15,128:5:0	0,6,80:2:0	0,18,143:6:0
-X	171	.	A	<*>	0	.	DP=13;I16=11,2,0,0,500,19366,0,0,749,44041,0,0,250,5546,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,15,134:5:0	0,6,81:2:0	0,18,166:6:0
-X	172	.	C	<*>	0	.	DP=13;I16=10,2,0,0,439,16395,0,0,689,40441,0,0,241,5441,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,15,138:5:0	0,6,75:2:0	0,15,129:5:0
-X	173	.	C	<*>	0	.	DP=13;I16=11,2,0,0,435,15225,0,0,749,44041,0,0,248,5478,0,0;QS=3,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,15,121:5:0	0,6,76:2:0	0,18,146:6:0
-X	174	.	G	<*>	0	.	DP=13;I16=11,1,0,0,351,10685,0,0,689,40441,0,0,238,5364,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,15,111:5:0	0,3,27:1:0	0,18,117:6:0
-X	175	.	C	<*>	0	.	DP=14;I16=13,1,0,0,511,19161,0,0,809,47641,0,0,249,5463,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,143:6:0	0,3,41:1:0	0,21,175:7:0
-X	176	.	C	<*>	0	.	DP=14;I16=13,1,0,0,489,17733,0,0,809,47641,0,0,251,5477,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,146:6:0	0,3,44:1:0	0,21,152:7:0
-X	177	.	C	<*>	0	.	DP=14;I16=13,1,0,0,488,17328,0,0,809,47641,0,0,253,5507,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,138:6:0	0,3,44:1:0	0,21,158:7:0
-X	178	.	A	<*>	0	.	DP=14;I16=13,1,0,0,519,19485,0,0,809,47641,0,0,254,5502,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,147:6:0	0,3,42:1:0	0,21,172:7:0
-X	179	.	A	<*>	0	.	DP=14;I16=13,1,0,0,478,17278,0,0,809,47641,0,0,255,5511,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,134:6:0	0,3,44:1:0	0,21,170:7:0
-X	180	.	A	<*>	0	.	DP=14;I16=12,1,0,0,425,14653,0,0,749,44041,0,0,250,5498,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,126:6:0	0,3,43:1:0	0,18,148:6:0
-X	181	.	G	<*>	0	.	DP=14;I16=11,1,0,0,450,17152,0,0,689,40441,0,0,233,5233,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,156:6:0	0,3,41:1:0	0,15,138:5:0
-X	182	.	A	<*>	0	.	DP=15;I16=14,1,0,0,515,18235,0,0,869,51241,0,0,258,5622,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,150:7:0	0,3,43:1:0	0,21,159:7:0
-X	183	.	C	<*>	0	.	DP=15;I16=13,1,0,0,483,17419,0,0,809,47641,0,0,235,5063,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,159:7:0	0,3,40:1:0	0,18,139:6:0
-X	184	.	A	<*>	0	.	DP=15;I16=14,1,0,0,535,19667,0,0,869,51241,0,0,262,5770,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,158:7:0	0,3,41:1:0	0,21,163:7:0
-X	185	.	C	<*>	0	.	DP=15;I16=13,1,0,0,487,17295,0,0,809,47641,0,0,238,5192,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,150:7:0	0,3,38:1:0	0,18,160:6:0
-X	186	.	G	<*>	0	.	DP=15;I16=12,1,0,0,381,11429,0,0,749,44041,0,0,239,5253,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,117:6:0	0,3,32:1:0	0,18,124:6:0
-X	187	.	C	<*>	0	.	DP=14;I16=13,1,0,0,511,18979,0,0,809,47641,0,0,266,5952,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,147:6:0	0,3,38:1:0	0,21,172:7:0
-X	188	.	C	<*>	0	.	DP=14;I16=13,1,0,0,496,18042,0,0,809,47641,0,0,267,5989,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,147:6:0	0,3,37:1:0	0,21,162:7:0
-X	189	.	C	<*>	0	.	DP=15;I16=13,2,0,0,552,20504,0,0,838,48482,0,0,268,6040,0,0;QS=3,0;MQSB=0;MQ0F=0	PL:DP:DV	0,18,152:6:0	0,6,67:2:0	0,21,167:7:0
-X	190	.	A	<*>	0	.	DP=15;I16=12,2,0,0,500,18230,0,0,778,44882,0,0,243,5381,0,0;QS=3,0;MQSB=0;MQ0F=0	PL:DP:DV	0,18,138:6:0	0,6,68:2:0	0,18,159:6:0
-X	191	.	T	<*>	0	.	DP=15;I16=13,2,0,0,534,19276,0,0,838,48482,0,0,267,5939,0,0;QS=3,0;MQSB=0;MQ0F=0	PL:DP:DV	0,18,143:6:0	0,6,67:2:0	0,21,169:7:0
-X	192	.	G	<*>	0	.	DP=15;I16=13,2,0,0,499,17439,0,0,838,48482,0,0,266,5890,0,0;QS=3,0;MQSB=0;MQ0F=0	PL:DP:DV	0,18,143:6:0	0,6,67:2:0	0,21,151:7:0
-X	193	.	T	<*>	0	.	DP=15;I16=13,2,0,0,505,17811,0,0,838,48482,0,0,265,5859,0,0;QS=3,0;MQSB=0;MQ0F=0	PL:DP:DV	0,18,140:6:0	0,6,63:2:0	0,21,157:7:0
-X	194	.	C	<*>	0	.	DP=14;I16=12,2,0,0,467,16569,0,0,778,44882,0,0,265,5845,0,0;QS=3,0;MQSB=0;MQ0F=0	PL:DP:DV	0,18,142:6:0	0,6,67:2:0	0,18,145:6:0
-X	195	.	C	<*>	0	.	DP=14;I16=11,3,0,0,503,18647,0,0,747,42123,0,0,266,5846,0,0;QS=3,0;MQSB=0.0368832;MQ0F=0	PL:DP:DV	0,18,159:6:0	0,6,71:2:0	0,18,160:6:0
-X	196	.	A	<*>	0	.	DP=14;I16=11,3,0,0,482,17400,0,0,747,42123,0,0,268,5862,0,0;QS=3,0;MQSB=0.0368832;MQ0F=0	PL:DP:DV	0,18,166:6:0	0,6,69:2:0	0,18,138:6:0
-X	197	.	G	<*>	0	.	DP=14;I16=11,3,0,0,481,17391,0,0,747,42123,0,0,270,5894,0,0;QS=3,0;MQSB=0.0368832;MQ0F=0	PL:DP:DV	0,18,164:6:0	0,6,68:2:0	0,18,134:6:0
-X	198	.	C	<*>	0	.	DP=14;I16=11,3,0,0,539,20957,0,0,747,42123,0,0,271,5893,0,0;QS=3,0;MQSB=0.0368832;MQ0F=0	PL:DP:DV	0,18,172:6:0	0,6,70:2:0	0,18,164:6:0
-X	199	.	T	<*>	0	.	DP=14;I16=11,3,0,0,505,19197,0,0,747,42123,0,0,271,5861,0,0;QS=3,0;MQSB=0.0368832;MQ0F=0	PL:DP:DV	0,18,162:6:0	0,6,73:2:0	0,18,154:6:0
-X	200	.	T	<*>	0	.	DP=15;I16=11,4,0,0,544,19918,0,0,776,42964,0,0,270,5798,0,0;QS=3,0;MQSB=0.0161635;MQ0F=0	PL:DP:DV	0,18,161:6:0	0,9,89:3:0	0,18,154:6:0
-X	201	.	A	<*>	0	.	DP=16;I16=12,4,0,0,568,20416,0,0,836,46564,0,0,269,5703,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,171:7:0	0,9,89:3:0	0,18,157:6:0
-X	202	.	A	<*>	0	.	DP=16;I16=12,4,0,0,566,20590,0,0,836,46564,0,0,269,5627,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,178:7:0	0,9,84:3:0	0,18,163:6:0
-X	203	.	C	<*>	0	.	DP=16;I16=12,4,0,0,557,20119,0,0,836,46564,0,0,269,5571,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,166:7:0	0,9,90:3:0	0,18,153:6:0
-X	204	.	C	<*>	0	.	DP=16;I16=12,4,0,0,591,22379,0,0,836,46564,0,0,269,5535,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,173:7:0	0,9,91:3:0	0,18,163:6:0
-X	205	.	T	<*>	0	.	DP=16;I16=12,4,0,0,635,25281,0,0,836,46564,0,0,269,5519,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,188:7:0	0,9,95:3:0	0,18,173:6:0
-X	206	.	G	<*>	0	.	DP=16;I16=12,4,0,0,577,21337,0,0,836,46564,0,0,269,5523,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,180:7:0	0,9,89:3:0	0,18,143:6:0
-X	207	.	C	<*>	0	.	DP=16;I16=12,4,0,0,574,21076,0,0,836,46564,0,0,269,5547,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,179:7:0	0,9,93:3:0	0,18,151:6:0
-X	208	.	A	<*>	0	.	DP=16;I16=12,4,0,0,576,21486,0,0,836,46564,0,0,268,5540,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,184:7:0	0,9,93:3:0	0,18,154:6:0
-X	209	.	T	<*>	0	.	DP=16;I16=12,4,0,0,567,20475,0,0,836,46564,0,0,267,5551,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,173:7:0	0,9,91:3:0	0,18,146:6:0
-X	210	.	C	<*>	0	.	DP=16;I16=12,4,0,0,577,21109,0,0,836,46564,0,0,266,5580,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,185:7:0	0,9,92:3:0	0,18,151:6:0
-X	211	.	C	<*>	0	.	DP=16;I16=12,4,0,0,563,20227,0,0,836,46564,0,0,265,5627,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,172:7:0	0,9,92:3:0	0,18,153:6:0
-X	212	.	C	<*>	0	.	DP=16;I16=12,4,0,0,589,22179,0,0,836,46564,0,0,263,5643,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,181:7:0	0,9,92:3:0	0,18,152:6:0
-X	213	.	T	<*>	0	.	DP=16;I16=12,4,0,0,598,22838,0,0,836,46564,0,0,262,5678,0,0;QS=3,0;MQSB=0.0144756;MQ0F=0	PL:DP:DV	0,21,181:7:0	0,9,95:3:0	0,18,165:6:0
-X	214	.	A	<*>	0	.	DP=16;I16=11,4,0,0,529,19401,0,0,776,42964,0,0,240,5248,0,0;QS=3,0;MQSB=0.0161635;MQ0F=0	PL:DP:DV	0,21,176:7:0	0,9,92:3:0	0,15,118:5:0
-X	215	.	G	<*>	0	.	DP=15;I16=12,3,0,0,521,19073,0,0,807,45723,0,0,262,5754,0,0;QS=3,0;MQSB=0.0342181;MQ0F=0	PL:DP:DV	0,21,185:7:0	0,9,90:3:0	0,15,105:5:0
-X	216	.	A	<*>	0	.	DP=14;I16=10,3,0,0,464,16900,0,0,687,38523,0,0,238,5166,0,0;QS=3,0;MQSB=0.040184;MQ0F=0	PL:DP:DV	0,21,173:7:0	0,9,92:3:0	0,9,81:3:0
-X	217	.	A	<*>	0	.	DP=14;I16=11,3,0,0,515,19433,0,0,747,42123,0,0,264,5842,0,0;QS=3,0;MQSB=0.0368832;MQ0F=0	PL:DP:DV	0,21,181:7:0	0,9,90:3:0	0,12,97:4:0
-X	218	.	G	<*>	0	.	DP=14;I16=11,3,0,0,507,18957,0,0,747,42123,0,0,265,5907,0,0;QS=3,0;MQSB=0.0368832;MQ0F=0	PL:DP:DV	0,21,178:7:0	0,9,90:3:0	0,12,110:4:0
-X	219	.	T	<*>	0	.	DP=14;I16=11,3,0,0,470,16286,0,0,747,42123,0,0,266,5986,0,0;QS=3,0;MQSB=0.0368832;MQ0F=0	PL:DP:DV	0,21,173:7:0	0,9,88:3:0	0,12,89:4:0
-X	220	.	G	<*>	0	.	DP=14;I16=10,3,0,0,485,18307,0,0,687,38523,0,0,242,5454,0,0;QS=3,0;MQSB=0.040184;MQ0F=0	PL:DP:DV	0,21,188:7:0	0,9,88:3:0	0,9,80:3:0
-X	221	.	A	<*>	0	.	DP=14;I16=11,3,0,0,487,17615,0,0,747,42123,0,0,267,6135,0,0;QS=3,0;MQSB=0.0368832;MQ0F=0	PL:DP:DV	0,21,176:7:0	0,9,88:3:0	0,12,101:4:0
-X	222	.	A	<*>	0	.	DP=14;I16=10,3,0,0,465,17367,0,0,687,38523,0,0,242,5578,0,0;QS=3,0;MQSB=0.040184;MQ0F=0	PL:DP:DV	0,21,186:7:0	0,9,85:3:0	0,9,69:3:0
-X	223	.	G	<*>	0	.	DP=13;I16=9,3,0,0,405,14327,0,0,627,34923,0,0,243,5657,0,0;QS=3,0;MQSB=0.0443614;MQ0F=0	PL:DP:DV	0,18,168:6:0	0,6,53:2:0	0,12,81:4:0
-X	224	.	G	<*>	0	.	DP=12;I16=9,3,0,0,379,12759,0,0,627,34923,0,0,270,6370,0,0;QS=3,0;MQSB=0.0443614;MQ0F=0	PL:DP:DV	0,18,168:6:0	0,6,50:2:0	0,12,70:4:0
-X	225	.	C	<*>	0	.	DP=12;I16=8,3,0,0,382,13896,0,0,567,31323,0,0,261,6345,0,0;QS=3,0;MQSB=0.0497871;MQ0F=0	PL:DP:DV	0,18,165:6:0	0,6,48:2:0	0,9,83:3:0
-X	226	.	A	<*>	0	.	DP=13;I16=8,3,0,0,381,13669,0,0,567,31323,0,0,248,5894,0,0;QS=3,0;MQSB=0.0497871;MQ0F=0	PL:DP:DV	0,18,166:6:0	0,6,53:2:0	0,9,84:3:0
-X	227	.	C	<*>	0	.	DP=13;I16=8,4,0,0,406,14306,0,0,596,32164,0,0,267,6253,0,0;QS=3,0;MQSB=0.0249144;MQ0F=0	PL:DP:DV	0,21,190:7:0	0,6,53:2:0	0,9,73:3:0
-X	228	.	C	<*>	0	.	DP=13;I16=9,4,0,0,417,14381,0,0,656,35764,0,0,292,6884,0,0;QS=3,0;MQSB=0.0211283;MQ0F=0	PL:DP:DV	0,21,187:7:0	0,6,45:2:0	0,12,96:4:0
-X	229	.	G	<*>	0	.	DP=13;I16=9,3,0,0,358,11424,0,0,627,34923,0,0,270,6414,0,0;QS=3,0;MQSB=0.0443614;MQ0F=0	PL:DP:DV	0,18,136:6:0	0,6,53:2:0	0,12,70:4:0
-X	230	.	C	<*>	0	.	DP=13;I16=9,4,0,0,461,16861,0,0,656,35764,0,0,292,6920,0,0;QS=3,0;MQSB=0.0211283;MQ0F=0	PL:DP:DV	0,21,186:7:0	0,6,53:2:0	0,12,100:4:0
-X	231	.	C	<*>	0	.	DP=13;I16=7,4,0,0,414,15832,0,0,536,28564,0,0,247,5925,0,0;QS=3,0;MQSB=0.0401934;MQ0F=0	PL:DP:DV	0,18,184:6:0	0,6,53:2:0	0,9,82:3:0
-X	232	.	C	<*>	0	.	DP=14;I16=9,4,0,0,471,17371,0,0,656,35764,0,0,267,6363,0,0;QS=3,0;MQSB=0.0211283;MQ0F=0	PL:DP:DV	0,21,198:7:0	0,6,53:2:0	0,12,101:4:0
-X	233	.	A	<*>	0	.	DP=14;I16=10,4,0,0,496,18142,0,0,716,39364,0,0,292,6984,0,0;QS=3,0;MQSB=0.0183156;MQ0F=0	PL:DP:DV	0,21,192:7:0	0,6,53:2:0	0,15,119:5:0
-X	234	.	A	<*>	0	.	DP=14;I16=10,4,0,0,502,18390,0,0,716,39364,0,0,292,6988,0,0;QS=3,0;MQSB=0.0183156;MQ0F=0	PL:DP:DV	0,21,185:7:0	0,6,53:2:0	0,15,123:5:0
-X	235	.	A	<*>	0	.	DP=14;I16=9,4,0,0,476,17652,0,0,656,35764,0,0,267,6375,0,0;QS=3,0;MQSB=0.0211283;MQ0F=0	PL:DP:DV	0,21,186:7:0	0,6,53:2:0	0,12,111:4:0
-X	236	.	G	<*>	0	.	DP=15;I16=11,4,0,0,501,17481,0,0,776,42964,0,0,290,6924,0,0;QS=3,0;MQSB=0.0161635;MQ0F=0	PL:DP:DV	0,24,206:8:0	0,6,53:2:0	0,15,103:5:0
-X	237	.	A	<*>	0	.	DP=14;I16=9,4,0,0,465,16877,0,0,656,35764,0,0,266,6282,0,0;QS=3,0;MQSB=0.0211283;MQ0F=0	PL:DP:DV	0,24,206:8:0	0,6,53:2:0	0,9,92:3:0
-X	238	.	C	<*>	0	.	DP=14;I16=10,4,0,0,482,17238,0,0,716,39364,0,0,292,6900,0,0;QS=3,0;MQSB=0.0183156;MQ0F=0	PL:DP:DV	0,24,211:8:0	0,6,53:2:0	0,12,82:4:0
-X	239	.	A	<*>	0	.	DP=15;I16=10,5,0,0,525,19155,0,0,776,42964,0,0,292,6852,0,0;QS=3,0;MQSB=0.0497871;MQ0F=0	PL:DP:DV	0,27,223:9:0	0,6,50:2:0	0,12,108:4:0
-X	240	.	C	<*>	0	.	DP=15;I16=10,5,0,0,512,17930,0,0,776,42964,0,0,292,6764,0,0;QS=3,0;MQSB=0.0497871;MQ0F=0	PL:DP:DV	0,27,220:9:0	0,6,53:2:0	0,12,106:4:0
-X	241	.	G	<*>	0	.	DP=15;I16=9,5,0,0,444,14636,0,0,716,39364,0,0,269,6159,0,0;QS=3,0;MQSB=0.0561348;MQ0F=0	PL:DP:DV	0,27,203:9:0	0,6,53:2:0	0,9,59:3:0
-X	242	.	C	<*>	0	.	DP=15;I16=10,5,0,0,555,21177,0,0,776,42964,0,0,292,6624,0,0;QS=3,0;MQSB=0.0497871;MQ0F=0	PL:DP:DV	0,27,242:9:0	0,6,53:2:0	0,12,94:4:0
-X	243	.	C	<*>	0	.	DP=16;I16=9,5,0,0,523,19737,0,0,716,39364,0,0,284,6508,0,0;QS=3,0;MQSB=0.0561348;MQ0F=0	PL:DP:DV	0,24,220:8:0	0,6,53:2:0	0,12,104:4:0
-X	244	.	C	<*>	0	.	DP=16;I16=10,6,0,0,620,24272,0,0,805,43805,0,0,298,6568,0,0;QS=3,0;MQSB=0.0253122;MQ0F=0	PL:DP:DV	0,27,245:9:0	0,9,72:3:0	0,12,106:4:0
-X	245	.	A	<*>	0	.	DP=17;I16=10,7,0,0,649,24843,0,0,865,47405,0,0,299,6553,0,0;QS=3,0;MQSB=0.0509867;MQ0F=0	PL:DP:DV	0,27,236:9:0	0,12,93:4:0	0,12,115:4:0
-X	246	.	T	<*>	0	.	DP=18;I16=10,8,0,0,649,23833,0,0,894,48246,0,0,301,6553,0,0;QS=3,0;MQSB=0.0286491;MQ0F=0	PL:DP:DV	0,30,247:10:0	0,12,94:4:0	0,12,98:4:0
-X	247	.	G	<*>	0	.	DP=18;I16=10,8,0,0,642,23610,0,0,894,48246,0,0,304,6570,0,0;QS=3,0;MQSB=0.0286491;MQ0F=0	PL:DP:DV	0,30,252:10:0	0,12,83:4:0	0,12,103:4:0
-X	248	.	T	<*>	0	.	DP=18;I16=10,8,0,0,636,22944,0,0,894,48246,0,0,307,6605,0,0;QS=3,0;MQSB=0.0286491;MQ0F=0	PL:DP:DV	0,30,234:10:0	0,12,86:4:0	0,12,114:4:0
-X	249	.	C	<*>	0	.	DP=18;I16=10,8,0,0,656,24846,0,0,894,48246,0,0,310,6658,0,0;QS=3,0;MQSB=0.0286491;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,12,79:4:0	0,12,112:4:0
-X	250	.	C	<*>	0	.	DP=19;I16=10,9,0,0,694,26160,0,0,923,49087,0,0,311,6631,0,0;QS=3,0;MQSB=0.0168512;MQ0F=0	PL:DP:DV	0,30,248:10:0	0,12,89:4:0	0,15,142:5:0
-X	251	.	A	<*>	0	.	DP=19;I16=9,9,0,0,688,26506,0,0,863,45487,0,0,313,6627,0,0;QS=3,0;MQSB=0.0208913;MQ0F=0	PL:DP:DV	0,27,233:9:0	0,12,97:4:0	0,15,148:5:0
-X	252	.	G	<*>	0	.	DP=18;I16=8,9,0,0,641,24631,0,0,803,41887,0,0,304,6502,0,0;QS=3,0;MQSB=0.026526;MQ0F=0	PL:DP:DV	0,27,243:9:0	0,12,91:4:0	0,12,121:4:0
-X	253	.	C	<*>	0	.	DP=19;I16=9,10,0,0,705,26921,0,0,892,46328,0,0,319,6687,0,0;QS=3,0;MQSB=0.0132999;MQ0F=0	PL:DP:DV	0,27,247:9:0	0,12,86:4:0	0,18,155:6:0
-X	254	.	T	<*>	0	.	DP=20;I16=10,9,0,0,719,27517,0,0,892,46328,0,0,314,6670,0,0;QS=3,0;MQSB=0.00482795;MQ0F=0	PL:DP:DV	0,30,254:10:0	0,9,72:3:0	0,18,164:6:0
-X	255	.	T	<*>	0	.	DP=21;I16=11,10,0,0,750,27076,0,0,1012,53528,0,0,328,6840,0,0;QS=3,0;MQSB=0.00822975;MQ0F=0	PL:DP:DV	0,33,241:11:0	0,12,95:4:0	0,18,161:6:0
-X	256	.	A	<*>	0	.	DP=22;I16=11,11,0,0,811,30063,0,0,1049,54897,0,0,334,6956,0,0;QS=3,0;MQSB=0.00507916;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,110:5:0	0,18,166:6:0
-X	257	.	T	<*>	0	.	DP=22;I16=11,11,0,0,814,30420,0,0,1049,54897,0,0,341,7101,0,0;QS=3,0;MQSB=0.00507916;MQ0F=0	PL:DP:DV	0,33,247:11:0	0,15,113:5:0	0,18,168:6:0
-X	258	.	T	<*>	0	.	DP=22;I16=11,11,0,0,791,28943,0,0,1049,54897,0,0,347,7225,0,0;QS=3,0;MQSB=0.00507916;MQ0F=0	PL:DP:DV	0,33,254:11:0	0,15,116:5:0	0,18,155:6:0
-X	259	.	C	<*>	0	.	DP=22;I16=11,10,0,0,785,29809,0,0,1020,54056,0,0,332,6936,0,0;QS=3,0;MQSB=0.00822975;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,90:4:0	0,18,170:6:0
-X	260	.	T	<*>	0	.	DP=21;I16=10,11,0,0,829,32899,0,0,989,51297,0,0,360,7556,0,0;QS=3,0;MQSB=0.00660016;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,118:5:0	0,15,156:5:0
-X	261	.	G	<*>	0	.	DP=21;I16=10,11,0,0,735,27379,0,0,989,51297,0,0,367,7761,0,0;QS=3,0;MQSB=0.00660016;MQ0F=0	PL:DP:DV	0,33,254:11:0	0,15,111:5:0	0,15,122:5:0
-X	262	.	C	<*>	0	.	DP=22;I16=10,12,0,0,806,30278,0,0,1049,54897,0,0,373,7941,0,0;QS=3,0;MQSB=0.0122507;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,99:5:0	0,18,164:6:0
-X	263	.	C	<*>	0	.	DP=22;I16=10,12,0,0,799,29717,0,0,1049,54897,0,0,380,8146,0,0;QS=3,0;MQSB=0.0122507;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,98:5:0	0,18,168:6:0
-X	264	.	C	<*>	0	.	DP=22;I16=10,12,0,0,821,31325,0,0,1049,54897,0,0,386,8326,0,0;QS=3,0;MQSB=0.0122507;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,104:5:0	0,18,172:6:0
-X	265	.	A	<*>	0	.	DP=21;I16=9,12,0,0,800,31906,0,0,989,51297,0,0,390,8380,0,0;QS=3,0;MQSB=0.0158903;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,114:5:0	0,15,129:5:0
-X	266	.	G	<*>	0	.	DP=21;I16=9,11,0,0,747,28155,0,0,960,50456,0,0,369,7833,0,0;QS=3,0;MQSB=0.0237479;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,97:4:0	0,15,138:5:0
-X	267	.	T	<*>	0	.	DP=21;I16=9,11,0,0,739,27465,0,0,960,50456,0,0,373,7935,0,0;QS=3,0;MQSB=0.0237479;MQ0F=0	PL:DP:DV	0,33,254:11:0	0,12,101:4:0	0,15,149:5:0
-X	268	.	T	<*>	0	.	DP=21;I16=9,12,0,0,748,27708,0,0,989,51297,0,0,402,8686,0,0;QS=3,0;MQSB=0.0158903;MQ0F=0	PL:DP:DV	0,33,238:11:0	0,15,110:5:0	0,15,156:5:0
-X	269	.	C	<*>	0	.	DP=22;I16=9,12,0,0,764,28632,0,0,989,51297,0,0,381,8211,0,0;QS=3,0;MQSB=0.0158903;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,91:4:0	0,15,154:5:0
-X	270	.	C	<*>	0	.	DP=22;I16=9,12,0,0,758,28146,0,0,989,51297,0,0,385,8337,0,0;QS=3,0;MQSB=0.0158903;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,96:4:0	0,15,143:5:0
-X	271	.	T	<*>	0	.	DP=22;I16=9,13,0,0,847,32935,0,0,1018,52138,0,0,413,9065,0,0;QS=3,0;MQSB=0.0109431;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,113:5:0	0,15,152:5:0
-X	272	.	C	<*>	0	.	DP=22;I16=9,12,0,0,809,31413,0,0,989,51297,0,0,390,8518,0,0;QS=3,0;MQSB=0.0158903;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,96:4:0	0,15,149:5:0
-X	273	.	T	<*>	0	.	DP=22;I16=9,12,0,0,798,30664,0,0,989,51297,0,0,392,8620,0,0;QS=3,0;MQSB=0.0158903;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,95:4:0	0,15,161:5:0
-X	274	.	C	<*>	0	.	DP=22;I16=9,12,0,0,763,28177,0,0,989,51297,0,0,394,8746,0,0;QS=3,0;MQSB=0.0158903;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,101:4:0	0,15,144:5:0
-X	275	.	C	<*>	0	.	DP=20;I16=7,13,0,0,768,29994,0,0,898,44938,0,0,423,9519,0,0;QS=3,0;MQSB=0.0213617;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,114:5:0	0,12,122:4:0
-X	276	.	A	<*>	0	.	DP=20;I16=7,13,0,0,805,32931,0,0,898,44938,0,0,424,9538,0,0;QS=3,0;MQSB=0.0213617;MQ0F=0	PL:DP:DV	0,33,253:11:0	0,15,122:5:0	0,12,124:4:0
-X	277	.	G	<*>	0	.	DP=20;I16=7,13,0,0,764,29732,0,0,898,44938,0,0,425,9579,0,0;QS=3,0;MQSB=0.0213617;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,114:5:0	0,12,121:4:0
-X	278	.	A	<*>	0	.	DP=21;I16=6,14,0,0,722,26452,0,0,867,42179,0,0,415,9521,0,0;QS=3,0;MQSB=0.0246228;MQ0F=0	PL:DP:DV	0,30,238:10:0	0,18,123:6:0	0,12,121:4:0
-X	279	.	A	<*>	0	.	DP=22;I16=7,15,0,0,786,28694,0,0,956,46620,0,0,427,9677,0,0;QS=3,0;MQSB=0.0124927;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,123:6:0	0,12,122:4:0
-X	280	.	A	<*>	0	.	DP=22;I16=7,15,0,0,815,31561,0,0,956,46620,0,0,428,9684,0,0;QS=3,0;MQSB=0.0124927;MQ0F=0	PL:DP:DV	0,36,253:12:0	0,18,130:6:0	0,12,129:4:0
-X	281	.	G	<*>	0	.	DP=22;I16=7,15,0,0,820,31416,0,0,956,46620,0,0,428,9662,0,0;QS=3,0;MQSB=0.0124927;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,122:6:0	0,12,123:4:0
-X	282	.	G	<*>	0	.	DP=22;I16=7,15,0,0,806,30420,0,0,956,46620,0,0,427,9609,0,0;QS=3,0;MQSB=0.0124927;MQ0F=0	PL:DP:DV	0,36,253:12:0	0,18,124:6:0	0,12,119:4:0
-X	283	.	C	<*>	0	.	DP=23;I16=7,15,0,0,827,31785,0,0,956,46620,0,0,426,9574,0,0;QS=3,0;MQSB=0.0124927;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,125:6:0	0,12,122:4:0
-X	284	.	T	<*>	0	.	DP=23;I16=7,16,0,0,901,35479,0,0,1016,50220,0,0,431,9593,0,0;QS=3,0;MQSB=0.0194969;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,126:6:0	0,15,144:5:0
-X	285	.	G	<*>	0	.	DP=23;I16=7,16,0,0,860,32856,0,0,1016,50220,0,0,431,9607,0,0;QS=3,0;MQSB=0.0194969;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,119:6:0	0,15,132:5:0
-X	286	.	C	<*>	0	.	DP=24;I16=8,16,0,0,875,32883,0,0,1076,53820,0,0,431,9641,0,0;QS=3,0;MQSB=0.0132999;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,150:7:0	0,15,134:5:0
-X	287	.	A	<*>	0	.	DP=25;I16=9,16,0,0,895,32957,0,0,1136,57420,0,0,432,9696,0,0;QS=3,0;MQSB=0.00934348;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,178:8:0	0,15,133:5:0
-X	288	.	T	<*>	0	.	DP=25;I16=9,16,0,0,931,35011,0,0,1136,57420,0,0,432,9674,0,0;QS=3,0;MQSB=0.00934348;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,184:8:0	0,15,146:5:0
-X	289	.	G	<*>	0	.	DP=25;I16=9,16,0,0,939,36117,0,0,1136,57420,0,0,432,9676,0,0;QS=3,0;MQSB=0.00934348;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,185:8:0	0,15,136:5:0
-X	290	.	G	<*>	0	.	DP=23;I16=8,15,0,0,805,29157,0,0,1047,52979,0,0,433,9651,0,0;QS=3,0;MQSB=0.0177152;MQ0F=0	PL:DP:DV	0,33,240:11:0	0,21,164:7:0	0,15,126:5:0
-X	291	.	T	<*>	0	.	DP=24;I16=8,15,0,0,840,31616,0,0,1047,52979,0,0,421,9479,0,0;QS=3,0;MQSB=0.0177152;MQ0F=0	PL:DP:DV	0,33,244:11:0	0,21,168:7:0	0,15,136:5:0
-X	292	.	T	<*>	0	.	DP=25;I16=9,16,0,0,888,32274,0,0,1167,60179,0,0,436,9668,0,0;QS=3,0;MQSB=0.0197089;MQ0F=0	PL:DP:DV	0,33,253:11:0	0,24,181:8:0	0,18,156:6:0
-X	293	.	G	<*>	0	.	DP=26;I16=10,15,0,0,934,35232,0,0,1167,60179,0,0,424,9488,0,0;QS=3,0;MQSB=0.0095249;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,196:8:0	0,15,145:5:0
-X	294	.	A	<*>	0	.	DP=26;I16=10,16,0,0,931,33937,0,0,1227,63779,0,0,443,9785,0,0;QS=3,0;MQSB=0.0149748;MQ0F=0	PL:DP:DV	0,36,252:12:0	0,24,201:8:0	0,18,161:6:0
-X	295	.	C	<*>	0	.	DP=25;I16=10,14,0,0,897,33973,0,0,1169,62097,0,0,430,9544,0,0;QS=3,0;MQSB=0.0310726;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,180:7:0	0,18,159:6:0
-X	296	.	A	<*>	0	.	DP=25;I16=10,15,0,0,874,31846,0,0,1198,62938,0,0,451,9905,0,0;QS=3,0;MQSB=0.0213617;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,169:8:0	0,18,169:6:0
-X	297	.	C	<*>	0	.	DP=25;I16=9,15,0,0,901,34305,0,0,1138,59338,0,0,445,9901,0,0;QS=3,0;MQSB=0.0273237;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,174:7:0	0,18,161:6:0
-X	298	.	A	<*>	0	.	DP=26;I16=11,15,0,0,936,34652,0,0,1258,66538,0,0,459,10121,0,0;QS=3,0;MQSB=0.017008;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,184:8:0	0,21,191:7:0
-X	299	.	C	<*>	0	.	DP=27;I16=11,15,0,0,971,36863,0,0,1258,66538,0,0,464,10266,0,0;QS=3,0;MQSB=0.017008;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,193:8:0	0,21,189:7:0
-X	300	.	A	<*>	0	.	DP=27;I16=11,15,0,0,1001,39455,0,0,1258,66538,0,0,469,10437,0,0;QS=3,0;MQSB=0.017008;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,204:8:0	0,21,210:7:0
-X	301	.	G	<*>	0	.	DP=25;I16=10,14,0,0,928,36116,0,0,1169,62097,0,0,476,10632,0,0;QS=3,0;MQSB=0.0310726;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,195:7:0	0,21,196:7:0
-X	302	.	T	<*>	0	.	DP=25;I16=10,14,0,0,879,32885,0,0,1169,62097,0,0,483,10849,0,0;QS=3,0;MQSB=0.0310726;MQ0F=0	PL:DP:DV	0,30,231:10:0	0,21,172:7:0	0,21,202:7:0
-X	302	.	T	TA	0	.	INDEL;IDV=7;IMF=1;DP=25;I16=2,4,8,11,214,7674,793,33369,236,10564,993,55133,109,2229,377,8629;QS=0.511212,2.48879;VDB=0.27613;SGB=-4.22417;MQSB=0.0443614;MQ0F=0	PL:DP:DV	167,0,96:11:6	157,0,9:7:6	201,21,0:7:7
-X	303	.	G	<*>	0	.	DP=25;I16=10,15,0,0,976,38516,0,0,1229,65697,0,0,497,11181,0,0;QS=3,0;MQSB=0.0443614;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,197:7:0	0,21,195:7:0
-X	304	.	C	<*>	0	.	DP=27;I16=11,16,0,0,991,37005,0,0,1318,70138,0,0,503,11359,0,0;QS=3,0;MQSB=0.129164;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,206:8:0	0,24,200:8:0
-X	305	.	C	<*>	0	.	DP=27;I16=11,16,0,0,1057,41761,0,0,1318,70138,0,0,510,11508,0,0;QS=3,0;MQSB=0.129164;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,213:8:0	0,24,211:8:0
-X	306	.	T	<*>	0	.	DP=27;I16=11,16,0,0,1033,40253,0,0,1318,70138,0,0,517,11679,0,0;QS=3,0;MQSB=0.129164;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,207:8:0	0,24,217:8:0
-X	307	.	G	<*>	0	.	DP=27;I16=11,15,0,0,984,37886,0,0,1289,69297,0,0,498,11198,0,0;QS=3,0;MQSB=0.174566;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,189:7:0	0,24,203:8:0
-X	308	.	C	<*>	0	.	DP=27;I16=11,16,0,0,892,30810,0,0,1318,70138,0,0,529,11991,0,0;QS=3,0;MQSB=0.129164;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,178:8:0	0,24,185:8:0
-X	309	.	G	<*>	0	.	DP=27;I16=11,16,0,0,951,34599,0,0,1318,70138,0,0,535,12183,0,0;QS=3,0;MQSB=0.129164;MQ0F=0	PL:DP:DV	0,33,243:11:0	0,24,183:8:0	0,24,205:8:0
-X	310	.	A	<*>	0	.	DP=27;I16=11,16,0,0,1001,38063,0,0,1318,70138,0,0,540,12350,0,0;QS=3,0;MQSB=0.129164;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,200:8:0	0,24,217:8:0
-X	311	.	C	<*>	0	.	DP=27;I16=11,16,0,0,1037,40263,0,0,1318,70138,0,0,544,12492,0,0;QS=3,0;MQSB=0.129164;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,215:8:0	0,24,210:8:0
-X	312	.	A	<*>	0	.	DP=26;I16=10,16,0,0,985,38043,0,0,1258,66538,0,0,549,12657,0,0;QS=3,0;MQSB=0.157183;MQ0F=0	PL:DP:DV	0,30,237:10:0	0,24,215:8:0	0,24,218:8:0
-X	313	.	A	<*>	0	.	DP=26;I16=10,16,0,0,983,37969,0,0,1258,66538,0,0,551,12695,0,0;QS=3,0;MQSB=0.157183;MQ0F=0	PL:DP:DV	0,30,235:10:0	0,24,219:8:0	0,24,215:8:0
-X	314	.	A	<*>	0	.	DP=27;I16=10,17,0,0,1050,41798,0,0,1318,70138,0,0,553,12757,0,0;QS=3,0;MQSB=0.195223;MQ0F=0	PL:DP:DV	0,33,250:11:0	0,24,217:8:0	0,24,227:8:0
-X	315	.	G	<*>	0	.	DP=26;I16=10,16,0,0,1025,40941,0,0,1289,69297,0,0,557,12843,0,0;QS=3,0;MQSB=0.252051;MQ0F=0	PL:DP:DV	0,30,252:10:0	0,24,216:8:0	0,24,225:8:0
-X	316	.	C	<*>	0	.	DP=27;I16=10,15,0,0,983,39393,0,0,1252,67928,0,0,535,12277,0,0;QS=3,0;MQSB=0.312403;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,183:7:0	0,24,224:8:0
-X	317	.	T	<*>	0	.	DP=27;I16=10,16,0,0,1028,41392,0,0,1320,72056,0,0,547,12557,0,0;QS=3,0;MQSB=0.377061;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,24,230:8:0	0,24,206:8:0
-X	318	.	G	<*>	0	.	DP=27;I16=10,17,0,0,1038,40546,0,0,1349,72897,0,0,570,13018,0,0;QS=3,0;MQSB=0.297797;MQ0F=0	PL:DP:DV	0,30,249:10:0	0,27,235:9:0	0,24,208:8:0
-X	319	.	A	<*>	0	.	DP=27;I16=9,17,0,0,994,38654,0,0,1289,69297,0,0,560,12906,0,0;QS=3,0;MQSB=0.346864;MQ0F=0	PL:DP:DV	0,30,249:10:0	0,27,228:9:0	0,21,185:7:0
-X	320	.	A	<*>	0	.	DP=27;I16=10,17,0,0,1022,39418,0,0,1349,72897,0,0,573,13053,0,0;QS=3,0;MQSB=0.297797;MQ0F=0	PL:DP:DV	0,30,247:10:0	0,27,230:9:0	0,24,211:8:0
-X	321	.	T	<*>	0	.	DP=27;I16=10,17,0,0,1026,39772,0,0,1349,72897,0,0,573,13029,0,0;QS=3,0;MQSB=0.297797;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,27,214:9:0	0,24,218:8:0
-X	322	.	G	<*>	0	.	DP=28;I16=10,18,0,0,1091,43151,0,0,1409,76497,0,0,573,13029,0,0;QS=3,0;MQSB=0.343265;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,27,226:9:0	0,27,223:9:0
-X	323	.	C	<*>	0	.	DP=28;I16=9,18,0,0,1067,42619,0,0,1349,72897,0,0,565,12939,0,0;QS=3,0;MQSB=0.394987;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,27,225:9:0	0,24,198:8:0
-X	324	.	T	<*>	0	.	DP=30;I16=12,18,0,0,1145,44221,0,0,1529,83697,0,0,573,13001,0,0;QS=3,0;MQSB=0.264959;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,27,237:9:0	0,33,255:11:0
-X	325	.	A	<*>	0	.	DP=31;I16=13,18,0,0,1132,42058,0,0,1589,87297,0,0,573,12925,0,0;QS=3,0;MQSB=0.235201;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,208:9:0	0,33,255:11:0
-X	326	.	T	<*>	0	.	DP=31;I16=13,18,0,0,1157,44193,0,0,1589,87297,0,0,574,12878,0,0;QS=3,0;MQSB=0.235201;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,216:9:0	0,33,255:11:0
-X	327	.	C	<*>	0	.	DP=31;I16=13,18,0,0,1147,43895,0,0,1589,87297,0,0,575,12861,0,0;QS=3,0;MQSB=0.235201;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,198:9:0	0,33,255:11:0
-X	328	.	A	<*>	0	.	DP=31;I16=13,18,0,0,1167,44531,0,0,1589,87297,0,0,574,12776,0,0;QS=3,0;MQSB=0.235201;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,226:9:0	0,33,255:11:0
-X	329	.	T	<*>	0	.	DP=31;I16=13,18,0,0,1210,47742,0,0,1589,87297,0,0,572,12676,0,0;QS=3,0;MQSB=0.235201;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,237:9:0	0,33,255:11:0
-X	330	.	T	<*>	0	.	DP=31;I16=13,18,0,0,1185,45839,0,0,1589,87297,0,0,568,12510,0,0;QS=3,0;MQSB=0.235201;MQ0F=0	PL:DP:DV	0,33,254:11:0	0,27,231:9:0	0,33,255:11:0
-X	331	.	T	<*>	0	.	DP=32;I16=14,18,0,0,1154,42510,0,0,1649,90897,0,0,563,12327,0,0;QS=3,0;MQSB=0.210122;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,222:9:0	0,36,255:12:0
-X	332	.	A	<*>	0	.	DP=32;I16=14,18,0,0,1156,42666,0,0,1649,90897,0,0,560,12178,0,0;QS=3,0;MQSB=0.210122;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,214:9:0	0,33,255:11:0
-X	333	.	A	<*>	0	.	DP=32;I16=14,18,0,0,1141,41987,0,0,1649,90897,0,0,558,12064,0,0;QS=3,0;MQSB=0.210122;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,223:9:0	0,33,255:11:0
-X	334	.	A	<*>	0	.	DP=32;I16=14,18,0,0,1162,43328,0,0,1649,90897,0,0,556,11986,0,0;QS=3,0;MQSB=0.210122;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,221:9:0	0,33,255:11:0
-X	335	.	A	<*>	0	.	DP=32;I16=12,18,0,0,1077,40287,0,0,1529,83697,0,0,552,11934,0,0;QS=3,0;MQSB=0.264959;MQ0F=0	PL:DP:DV	0,30,250:10:0	0,27,219:9:0	0,33,251:11:0
-X	336	.	A	<*>	0	.	DP=32;I16=14,17,0,0,1088,39758,0,0,1612,89528,0,0,536,11574,0,0;QS=3,0;MQSB=0.274662;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,211:8:0	0,36,255:12:0
-X	337	.	C	<*>	0	.	DP=32;I16=13,17,0,0,1115,42381,0,0,1552,85928,0,0,531,11565,0,0;QS=3,0;MQSB=0.301511;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,24,202:8:0	0,36,255:12:0
-X	338	.	T	<*>	0	.	DP=30;I16=14,16,0,0,1191,47979,0,0,1560,86456,0,0,554,11878,0,0;QS=3,0;MQSB=0.242376;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,24,226:8:0	0,36,255:12:0
-X	339	.	C	<*>	0	.	DP=31;I16=14,17,0,0,1130,43210,0,0,1589,87297,0,0,554,11874,0,0;QS=3,0;MQSB=0.175471;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,185:8:0	0,36,255:12:0
-X	340	.	C	<*>	0	.	DP=31;I16=14,17,0,0,1196,47044,0,0,1589,87297,0,0,554,11852,0,0;QS=3,0;MQSB=0.175471;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,221:8:0	0,36,255:12:0
-X	341	.	T	<*>	0	.	DP=31;I16=14,17,0,0,1227,48995,0,0,1589,87297,0,0,554,11862,0,0;QS=3,0;MQSB=0.175471;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,216:8:0	0,36,255:12:0
-X	342	.	T	<*>	0	.	DP=31;I16=14,17,0,0,1162,43942,0,0,1589,87297,0,0,554,11904,0,0;QS=3,0;MQSB=0.175471;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,210:8:0	0,36,255:12:0
-X	343	.	G	<*>	0	.	DP=32;I16=14,17,0,0,1150,43702,0,0,1620,90056,0,0,550,11962,0,0;QS=3,0;MQSB=0.283511;MQ0F=0	PL:DP:DV	0,30,249:10:0	0,27,218:9:0	0,36,255:12:0
-X	344	.	C	<*>	0	.	DP=32;I16=14,18,0,0,1181,45169,0,0,1649,90897,0,0,554,12036,0,0;QS=3,0;MQSB=0.210122;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,217:9:0	0,36,255:12:0
-X	345	.	T	<*>	0	.	DP=31;I16=14,17,0,0,1205,47259,0,0,1589,87297,0,0,555,12129,0,0;QS=3,0;MQSB=0.175471;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,221:8:0	0,36,255:12:0
-X	346	.	G	<*>	0	.	DP=31;I16=15,16,0,0,1147,43597,0,0,1620,90056,0,0,557,12255,0,0;QS=3,0;MQSB=0.220358;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,212:8:0	0,36,255:12:0
-X	347	.	G	<*>	0	.	DP=31;I16=14,16,0,0,1119,42227,0,0,1560,86456,0,0,545,12189,0,0;QS=3,0;MQSB=0.242376;MQ0F=0	PL:DP:DV	0,30,251:10:0	0,24,207:8:0	0,36,255:12:0
-X	348	.	T	<*>	0	.	DP=32;I16=15,16,0,0,1145,43007,0,0,1620,90056,0,0,546,12300,0,0;QS=3,0;MQSB=0.220358;MQ0F=0	PL:DP:DV	0,30,243:10:0	0,27,228:9:0	0,36,255:12:0
-X	349	.	T	<*>	0	.	DP=32;I16=16,16,0,0,1194,45350,0,0,1680,93656,0,0,565,12731,0,0;QS=3,0;MQSB=0.201402;MQ0F=0	PL:DP:DV	0,33,246:11:0	0,27,230:9:0	0,36,255:12:0
-X	350	.	T	<*>	0	.	DP=31;I16=16,15,0,0,1142,43072,0,0,1651,92815,0,0,567,12837,0,0;QS=3,0;MQSB=0.286505;MQ0F=0	PL:DP:DV	0,33,249:11:0	0,27,230:9:0	0,33,255:11:0
-X	351	.	G	<*>	0	.	DP=31;I16=16,15,0,0,1146,43750,0,0,1651,92815,0,0,568,12920,0,0;QS=3,0;MQSB=0.286505;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,212:9:0	0,33,255:11:0
-X	352	.	A	<*>	0	.	DP=31;I16=16,14,0,0,1150,45520,0,0,1591,89215,0,0,544,12404,0,0;QS=3,0;MQSB=0.242376;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,224:8:0	0,33,255:11:0
-X	353	.	G	<*>	0	.	DP=29;I16=15,14,0,0,1109,43095,0,0,1562,88374,0,0,570,13064,0,0;QS=3,0;MQSB=0.424373;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,27,231:9:0	0,30,255:10:0
-X	354	.	A	<*>	0	.	DP=28;I16=14,14,0,0,1078,42938,0,0,1502,84774,0,0,571,13075,0,0;QS=3,0;MQSB=0.450096;MQ0F=0	PL:DP:DV	0,27,225:9:0	0,27,244:9:0	0,30,255:10:0
-X	355	.	G	T,<*>	0	.	DP=28;I16=14,13,0,1,1001,37907,41,1681,1442,81174,60,3600,547,12487,25,625;QS=2.875,0.125,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.450096;BQB=1;MQ0F=0	PL:DP:DV	14,0,200,38,203,231:9:1	0,27,222,27,222,222:9:0	0,30,255,30,255,255:10:0
-X	356	.	G	<*>	0	.	DP=27;I16=14,13,0,0,993,37481,0,0,1465,83405,0,0,574,13174,0,0;QS=3,0;MQSB=0.580277;MQ0F=0	PL:DP:DV	0,27,228:9:0	0,24,201:8:0	0,30,255:10:0
-X	357	.	C	<*>	0	.	DP=28;I16=14,13,0,0,1021,39471,0,0,1465,83405,0,0,550,12584,0,0;QS=3,0;MQSB=0.580277;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,24,205:8:0	0,27,251:9:0
-X	358	.	A	<*>	0	.	DP=28;I16=15,13,0,0,1050,40518,0,0,1525,87005,0,0,576,13216,0,0;QS=3,0;MQSB=0.556581;MQ0F=0	PL:DP:DV	0,30,254:10:0	0,24,197:8:0	0,30,255:10:0
-X	359	.	G	<*>	0	.	DP=29;I16=15,13,0,0,1085,42761,0,0,1525,87005,0,0,552,12620,0,0;QS=3,0;MQSB=0.556581;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,187:7:0	0,33,255:11:0
-X	360	.	A	<*>	0	.	DP=29;I16=15,14,0,0,1111,43259,0,0,1585,90605,0,0,579,13297,0,0;QS=3,0;MQSB=0.604224;MQ0F=0	PL:DP:DV	0,30,252:10:0	0,24,220:8:0	0,33,255:11:0
-X	361	.	A	<*>	0	.	DP=29;I16=15,14,0,0,1116,43442,0,0,1585,90605,0,0,579,13273,0,0;QS=3,0;MQSB=0.604224;MQ0F=0	PL:DP:DV	0,30,252:10:0	0,24,219:8:0	0,33,255:11:0
-X	362	.	A	<*>	0	.	DP=29;I16=16,13,0,0,1104,42700,0,0,1585,90605,0,0,580,13272,0,0;QS=3,0;MQSB=0.535133;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,218:8:0	0,30,255:10:0
-X	363	.	A	<*>	0	.	DP=29;I16=16,13,0,0,1087,41437,0,0,1585,90605,0,0,581,13245,0,0;QS=3,0;MQSB=0.535133;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,213:8:0	0,30,255:10:0
-X	364	.	T	<*>	0	.	DP=29;I16=16,13,0,0,1032,37960,0,0,1585,90605,0,0,582,13244,0,0;QS=3,0;MQSB=0.535133;MQ0F=0	PL:DP:DV	0,33,250:11:0	0,24,205:8:0	0,30,255:10:0
-X	365	.	G	<*>	0	.	DP=29;I16=16,13,0,0,1105,43079,0,0,1585,90605,0,0,582,13218,0,0;QS=3,0;MQSB=0.535133;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,211:8:0	0,30,255:10:0
-X	366	.	A	<*>	0	.	DP=29;I16=16,13,0,0,1090,41562,0,0,1585,90605,0,0,581,13167,0,0;QS=3,0;MQSB=0.535133;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,211:8:0	0,30,255:10:0
-X	367	.	T	<*>	0	.	DP=29;I16=16,13,0,0,1055,39149,0,0,1585,90605,0,0,579,13093,0,0;QS=3,0;MQSB=0.535133;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,204:8:0	0,30,255:10:0
-X	368	.	A	<*>	0	.	DP=29;I16=16,13,0,0,1054,39632,0,0,1585,90605,0,0,576,12998,0,0;QS=3,0;MQSB=0.535133;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,208:8:0	0,30,255:10:0
-X	369	.	T	<*>	0	.	DP=28;I16=16,11,0,0,1037,40275,0,0,1496,86164,0,0,548,12256,0,0;QS=3,0;MQSB=0.659218;MQ0F=0	PL:DP:DV	0,30,250:10:0	0,21,196:7:0	0,30,255:10:0
-X	370	.	C	<*>	0	.	DP=28;I16=16,12,0,0,1045,40219,0,0,1556,89764,0,0,570,12790,0,0;QS=3,0;MQSB=0.705296;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,24,201:8:0	0,30,255:10:0
-X	371	.	T	<*>	0	.	DP=29;I16=16,13,0,0,1155,46591,0,0,1616,93364,0,0,567,12725,0,0;QS=3,0;MQSB=0.744925;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,24,227:8:0	0,33,255:11:0
-X	372	.	C	<*>	0	.	DP=30;I16=16,14,0,0,1139,44019,0,0,1676,96964,0,0,564,12636,0,0;QS=3,0;MQSB=0.779025;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,215:8:0	0,33,255:11:0
-X	373	.	A	<*>	0	.	DP=30;I16=16,14,0,0,1142,44118,0,0,1676,96964,0,0,561,12525,0,0;QS=3,0;MQSB=0.779025;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,220:8:0	0,33,255:11:0
-X	374	.	T	<*>	0	.	DP=30;I16=16,14,0,0,1098,41180,0,0,1676,96964,0,0,556,12344,0,0;QS=3,0;MQSB=0.779025;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,221:8:0	0,33,255:11:0
-X	375	.	A	T,<*>	0	.	DP=31;I16=17,13,0,1,1138,43798,14,196,1676,96964,60,3600,547,12177,4,16;QS=2.9661,0.0338983,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.763662;BQB=1;MQ0F=0	PL:DP:DV	0,36,255,36,255,255:12:0	0,24,218,24,218,218:8:0	0,18,255,30,255,255:11:1
-X	376	.	G	<*>	0	.	DP=31;I16=17,14,0,0,1131,42581,0,0,1736,100564,0,0,547,12073,0,0;QS=3,0;MQSB=0.763662;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,220:8:0	0,33,255:11:0
-X	377	.	T	<*>	0	.	DP=31;I16=16,14,0,0,1105,41629,0,0,1676,96964,0,0,518,11360,0,0;QS=3,0;MQSB=0.779025;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,211:8:0	0,33,255:11:0
-X	378	.	T	<*>	0	.	DP=30;I16=18,12,0,0,1098,41066,0,0,1707,99723,0,0,541,11927,0,0;QS=3,0;MQSB=0.878946;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,186:7:0	0,30,255:10:0
-X	379	.	G	<*>	0	.	DP=29;I16=18,10,0,0,1053,40181,0,0,1618,95282,0,0,534,11848,0,0;QS=3,0;MQSB=0.981777;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,187:7:0	0,30,255:10:0
-X	380	.	C	<*>	0	.	DP=29;I16=18,10,0,0,1087,42743,0,0,1618,95282,0,0,514,11172,0,0;QS=3,0;MQSB=0.981777;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,177:6:0	0,30,255:10:0
-X	381	.	T	<*>	0	.	DP=29;I16=18,11,0,0,1168,47412,0,0,1678,98882,0,0,537,11729,0,0;QS=3,0;MQSB=0.987702;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,212:7:0	0,30,255:10:0
-X	382	.	T	<*>	0	.	DP=29;I16=17,11,0,0,1054,40450,0,0,1618,95282,0,0,510,11068,0,0;QS=3,0;MQSB=0.990092;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,182:7:0	0,30,255:10:0
-X	383	.	T	<*>	0	.	DP=29;I16=18,10,0,0,1052,39798,0,0,1618,95282,0,0,507,11013,0,0;QS=3,0;MQSB=0.981777;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,165:6:0	0,30,255:10:0
-X	384	.	A	<*>	0	.	DP=31;I16=19,11,0,0,1077,39885,0,0,1738,102482,0,0,504,10988,0,0;QS=3,0;MQSB=0.985292;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,176:7:0	0,30,255:10:0
-X	385	.	C	<*>	0	.	DP=31;I16=19,12,0,0,1118,41180,0,0,1798,106082,0,0,527,11569,0,0;QS=3,0;MQSB=0.989977;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,24,186:8:0	0,30,255:10:0
-X	386	.	T	<*>	0	.	DP=30;I16=18,12,0,0,1158,45592,0,0,1738,102482,0,0,526,11556,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,191:7:0	0,30,255:10:0
-X	387	.	T	<*>	0	.	DP=30;I16=18,12,0,0,1105,41821,0,0,1738,102482,0,0,525,11573,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,187:7:0	0,30,255:10:0
-X	388	.	T	<*>	0	.	DP=29;I16=17,12,0,0,1089,41577,0,0,1678,98882,0,0,523,11519,0,0;QS=3,0;MQSB=0.993891;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,180:6:0	0,30,255:10:0
-X	389	.	G	<*>	0	.	DP=29;I16=17,12,0,0,1067,40095,0,0,1678,98882,0,0,520,11444,0,0;QS=3,0;MQSB=0.993891;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,171:6:0	0,30,255:10:0
-X	390	.	C	<*>	0	.	DP=29;I16=17,12,0,0,1071,40423,0,0,1678,98882,0,0,517,11399,0,0;QS=3,0;MQSB=0.993891;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,162:6:0	0,30,255:10:0
-X	391	.	A	<*>	0	.	DP=29;I16=18,11,0,0,1091,41603,0,0,1647,96123,0,0,515,11383,0,0;QS=3,0;MQSB=0.995968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,163:6:0	0,30,255:10:0
-X	392	.	T	<*>	0	.	DP=29;I16=18,11,0,0,1046,38838,0,0,1647,96123,0,0,515,11395,0,0;QS=3,0;MQSB=0.995968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,153:5:0	0,33,255:11:0
-X	393	.	A	<*>	0	.	DP=28;I16=17,11,0,0,1014,37582,0,0,1587,92523,0,0,517,11435,0,0;QS=3,0;MQSB=0.993109;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,133:5:0	0,33,255:11:0
-X	394	.	T	<*>	0	.	DP=28;I16=17,11,0,0,1022,38342,0,0,1587,92523,0,0,519,11503,0,0;QS=3,0;MQSB=0.993109;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,141:5:0	0,33,255:11:0
-X	395	.	T	<*>	0	.	DP=28;I16=17,11,0,0,1060,40596,0,0,1587,92523,0,0,521,11599,0,0;QS=3,0;MQSB=0.993109;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,164:5:0	0,33,255:11:0
-X	396	.	T	<*>	0	.	DP=28;I16=17,11,0,0,1032,39228,0,0,1587,92523,0,0,523,11723,0,0;QS=3,0;MQSB=0.993109;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,158:5:0	0,33,255:11:0
-X	397	.	T	<*>	0	.	DP=28;I16=17,11,0,0,1046,39510,0,0,1587,92523,0,0,524,11824,0,0;QS=3,0;MQSB=0.993109;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,149:5:0	0,33,255:11:0
-X	398	.	A	<*>	0	.	DP=28;I16=17,11,0,0,1021,38105,0,0,1587,92523,0,0,524,11850,0,0;QS=3,0;MQSB=0.993109;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,144:5:0	0,30,255:10:0
-X	399	.	A	<*>	0	.	DP=28;I16=17,11,0,0,1015,38469,0,0,1587,92523,0,0,526,11900,0,0;QS=3,0;MQSB=0.993109;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,140:5:0	0,30,255:10:0
-X	400	.	A	<*>	0	.	DP=29;I16=17,12,0,0,1056,39702,0,0,1647,96123,0,0,526,11828,0,0;QS=3,0;MQSB=0.988062;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,159:5:0	0,33,255:11:0
-X	401	.	A	<*>	0	.	DP=29;I16=17,11,0,0,1052,40302,0,0,1587,92523,0,0,501,11113,0,0;QS=3,0;MQSB=0.993109;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,160:5:0	0,30,255:10:0
-X	402	.	T	<*>	0	.	DP=29;I16=17,12,0,0,1082,41232,0,0,1647,96123,0,0,526,11680,0,0;QS=3,0;MQSB=0.988062;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,149:5:0	0,33,255:11:0
-X	403	.	T	<*>	0	.	DP=29;I16=17,12,0,0,1085,40985,0,0,1647,96123,0,0,526,11654,0,0;QS=3,0;MQSB=0.988062;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,148:5:0	0,33,255:11:0
-X	404	.	G	<*>	0	.	DP=29;I16=17,12,0,0,1074,40524,0,0,1647,96123,0,0,525,11609,0,0;QS=3,0;MQSB=0.988062;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,131:5:0	0,33,255:11:0
-X	405	.	T	<*>	0	.	DP=27;I16=16,10,0,0,988,37870,0,0,1498,88082,0,0,519,11543,0,0;QS=3,0;MQSB=0.987578;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,103:3:0	0,30,255:10:0
-X	406	.	G	<*>	0	.	DP=27;I16=16,11,0,0,976,36752,0,0,1558,91682,0,0,527,11601,0,0;QS=3,0;MQSB=0.992419;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,125:4:0	0,30,247:10:0
-X	407	.	A	<*>	0	.	DP=27;I16=16,11,0,0,1007,38355,0,0,1558,91682,0,0,526,11538,0,0;QS=3,0;MQSB=0.992419;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,125:4:0	0,30,255:10:0
-X	408	.	C	<*>	0	.	DP=28;I16=16,11,0,0,1006,38136,0,0,1558,91682,0,0,521,11489,0,0;QS=3,0;MQSB=0.992419;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,110:3:0	0,30,244:10:0
-X	409	.	T	<*>	0	.	DP=29;I16=17,12,0,0,1100,42734,0,0,1678,98882,0,0,525,11503,0,0;QS=3,0;MQSB=0.993891;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,131:4:0	0,33,255:11:0
-X	410	.	T	<*>	0	.	DP=29;I16=17,12,0,0,1035,38325,0,0,1678,98882,0,0,524,11432,0,0;QS=3,0;MQSB=0.993891;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,125:4:0	0,33,255:11:0
-X	411	.	T	<*>	0	.	DP=29;I16=17,10,0,0,1003,37747,0,0,1558,91682,0,0,496,10716,0,0;QS=3,0;MQSB=0.984677;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,104:3:0	0,30,255:10:0
-X	412	.	C	T,<*>	0	.	DP=30;I16=17,12,1,0,1094,42458,14,196,1678,98882,60,3600,495,10659,25,625;QS=2.97455,0.0254545,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.991968;BQB=1;MQ0F=0	PL:DP:DV	0,30,255,42,255,255:15:1	0,12,124,12,124,124:4:0	0,33,255,33,255,255:11:0
-X	413	.	A	<*>	0	.	DP=31;I16=18,13,0,0,1189,45985,0,0,1798,106082,0,0,520,11258,0,0;QS=3,0;MQSB=0.995005;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,9,102:3:0	0,33,255:11:0
-X	414	.	T	<*>	0	.	DP=30;I16=18,12,0,0,1151,44355,0,0,1738,102482,0,0,523,11265,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,109:3:0	0,33,255:11:0
-X	415	.	G	<*>	0	.	DP=30;I16=18,12,0,0,1131,43175,0,0,1738,102482,0,0,526,11306,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,110:3:0	0,33,255:11:0
-X	416	.	G	<*>	0	.	DP=30;I16=17,12,0,0,1083,41273,0,0,1678,98882,0,0,514,11156,0,0;QS=3,0;MQSB=0.993891;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,114:3:0	0,30,253:10:0
-X	417	.	C	<*>	0	.	DP=30;I16=18,12,0,0,1114,42244,0,0,1738,102482,0,0,531,11439,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,108:3:0	0,33,255:11:0
-X	418	.	A	<*>	0	.	DP=30;I16=18,12,0,0,1146,44248,0,0,1738,102482,0,0,532,11478,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,111:3:0	0,33,255:11:0
-X	419	.	T	<*>	0	.	DP=30;I16=18,12,0,0,1117,42327,0,0,1738,102482,0,0,532,11498,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,112:3:0	0,33,255:11:0
-X	420	.	A	<*>	0	.	DP=31;I16=18,13,0,0,1117,41011,0,0,1798,106082,0,0,532,11550,0,0;QS=3,0;MQSB=0.995005;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,108:3:0	0,36,255:12:0
-X	421	.	A	<*>	0	.	DP=33;I16=19,14,0,0,1208,45398,0,0,1887,110523,0,0,533,11635,0,0;QS=3,0;MQSB=0.986656;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,113:3:0	0,42,255:14:0
-X	422	.	A	<*>	0	.	DP=33;I16=19,13,0,0,1205,46441,0,0,1827,106923,0,0,510,11082,0,0;QS=3,0;MQSB=0.991023;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,116:3:0	0,39,255:13:0
-X	423	.	T	<*>	0	.	DP=32;I16=19,13,0,0,1202,45416,0,0,1827,106923,0,0,538,11818,0,0;QS=3,0;MQSB=0.991023;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,110:3:0	0,39,255:13:0
-X	424	.	A	<*>	0	.	DP=32;I16=19,13,0,0,1147,41685,0,0,1827,106923,0,0,539,11867,0,0;QS=3,0;MQSB=0.991023;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,106:3:0	0,39,255:13:0
-X	425	.	A	<*>	0	.	DP=29;I16=16,13,0,0,1070,40616,0,0,1647,96123,0,0,542,11900,0,0;QS=3,0;MQSB=0.976248;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,111:3:0	0,33,249:11:0
-X	426	.	T	<*>	0	.	DP=29;I16=16,12,0,0,997,36561,0,0,1587,92523,0,0,519,11287,0,0;QS=3,0;MQSB=0.982906;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,105:3:0	0,30,225:10:0
-X	427	.	A	<*>	0	.	DP=29;I16=16,13,0,0,1024,37266,0,0,1647,96123,0,0,546,11952,0,0;QS=3,0;MQSB=0.976248;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,111:3:0	0,33,242:11:0
-X	428	.	C	<*>	0	.	DP=29;I16=16,13,0,0,1064,39706,0,0,1647,96123,0,0,548,12020,0,0;QS=3,0;MQSB=0.976248;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,111:3:0	0,33,254:11:0
-X	429	.	T	<*>	0	.	DP=30;I16=16,14,0,0,1150,44918,0,0,1707,99723,0,0,549,12067,0,0;QS=3,0;MQSB=0.969373;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,115:3:0	0,33,255:11:0
-X	430	.	G	<*>	0	.	DP=30;I16=16,14,0,0,1113,42443,0,0,1707,99723,0,0,551,12145,0,0;QS=3,0;MQSB=0.969373;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,112:3:0	0,33,246:11:0
-X	431	.	G	<*>	0	.	DP=30;I16=14,14,0,0,1003,36953,0,0,1587,92523,0,0,553,12255,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,101:3:0	0,30,225:10:0
-X	432	.	T	<*>	0	.	DP=28;I16=14,14,0,0,1049,39621,0,0,1587,92523,0,0,556,12346,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,114:3:0	0,30,255:10:0
-X	433	.	T	<*>	0	.	DP=28;I16=14,12,0,0,949,35443,0,0,1467,85323,0,0,509,11217,0,0;QS=3,0;MQSB=0.967472;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,112:3:0	0,27,227:9:0
-X	434	.	T	<*>	0	.	DP=29;I16=15,14,0,0,1036,37654,0,0,1647,96123,0,0,561,12567,0,0;QS=3,0;MQSB=0.960561;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,98:3:0	0,30,243:10:0
-X	435	.	A	<*>	0	.	DP=29;I16=15,13,0,0,1024,37970,0,0,1587,92523,0,0,556,12560,0,0;QS=3,0;MQSB=0.968414;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,103:3:0	0,30,237:10:0
-X	436	.	T	<*>	0	.	DP=28;I16=14,14,0,0,998,36220,0,0,1587,92523,0,0,564,12654,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,110:3:0	0,27,223:9:0
-X	437	.	T	<*>	0	.	DP=28;I16=13,14,0,0,990,36832,0,0,1558,91682,0,0,549,12435,0,0;QS=3,0;MQSB=0.999706;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,109:3:0	0,24,207:8:0
-X	438	.	A	<*>	0	.	DP=28;I16=14,13,0,0,972,35640,0,0,1527,88923,0,0,540,12082,0,0;QS=3,0;MQSB=0.9585;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,107:3:0	0,24,216:8:0
-X	439	.	C	<*>	0	.	DP=28;I16=14,14,0,0,1055,40273,0,0,1587,92523,0,0,563,12649,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,107:3:0	0,27,224:9:0
-X	440	.	A	<*>	0	.	DP=28;I16=14,14,0,0,1095,43251,0,0,1587,92523,0,0,561,12615,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,115:3:0	0,27,247:9:0
-X	441	.	G	<*>	0	.	DP=29;I16=15,14,0,0,1068,40344,0,0,1647,96123,0,0,559,12605,0,0;QS=3,0;MQSB=0.960561;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,9,104:3:0	0,27,198:9:0
-X	442	.	A	<*>	0	.	DP=29;I16=15,14,0,0,1091,41507,0,0,1647,96123,0,0,558,12620,0,0;QS=3,0;MQSB=0.960561;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,9,112:3:0	0,27,233:9:0
-X	443	.	A	<*>	0	.	DP=30;I16=15,14,0,0,1173,49439,0,0,1647,96123,0,0,557,12661,0,0;QS=3,0;MQSB=0.960561;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,9,129:3:0	0,27,246:9:0
-X	444	.	G	<*>	0	.	DP=29;I16=15,13,0,0,1095,44661,0,0,1587,92523,0,0,557,12727,0,0;QS=3,0;MQSB=0.968414;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,91:2:0	0,27,227:9:0
-X	445	.	C	<*>	0	.	DP=30;I16=16,13,0,0,1100,43706,0,0,1647,96123,0,0,557,12817,0,0;QS=3,0;MQSB=0.976248;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,9,111:3:0	0,27,219:9:0
-X	446	.	A	<*>	0	.	DP=30;I16=16,13,0,0,1107,44265,0,0,1647,96123,0,0,557,12881,0,0;QS=3,0;MQSB=0.976248;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,9,115:3:0	0,27,232:9:0
-X	447	.	C	<*>	0	.	DP=29;I16=16,12,0,0,1108,45364,0,0,1618,95282,0,0,555,12817,0,0;QS=3,0;MQSB=0.856268;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,114:3:0	0,27,235:9:0
-X	448	.	T	<*>	0	.	DP=29;I16=16,12,0,0,1125,47237,0,0,1618,95282,0,0,553,12773,0,0;QS=3,0;MQSB=0.856268;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,118:3:0	0,27,240:9:0
-X	449	.	A	<*>	0	.	DP=28;I16=15,12,0,0,1091,45981,0,0,1558,91682,0,0,552,12748,0,0;QS=3,0;MQSB=0.84246;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,90:2:0	0,27,245:9:0
-X	450	.	G	<*>	0	.	DP=28;I16=15,12,0,0,1069,44603,0,0,1558,91682,0,0,551,12741,0,0;QS=3,0;MQSB=0.84246;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,91:2:0	0,27,233:9:0
-X	451	.	A	<*>	0	.	DP=28;I16=15,12,0,0,1021,41371,0,0,1558,91682,0,0,550,12752,0,0;QS=3,0;MQSB=0.84246;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,93:2:0	0,27,244:9:0
-X	452	.	A	<*>	0	.	DP=31;I16=18,11,0,0,1079,43353,0,0,1678,98882,0,0,530,12420,0,0;QS=3,0;MQSB=0.884952;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,9,110:3:0	0,24,225:8:0
-X	453	.	A	<*>	0	.	DP=31;I16=17,11,0,0,1037,41069,0,0,1649,98041,0,0,508,11882,0,0;QS=3,0;MQSB=0.967085;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,9,111:3:0	0,21,221:7:0
-X	454	.	A	<*>	0	.	DP=31;I16=18,12,0,0,1158,47028,0,0,1738,102482,0,0,554,12904,0,0;QS=3,0;MQSB=0.878946;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,9,113:3:0	0,30,255:10:0
-X	455	.	T	<*>	0	.	DP=32;I16=17,13,0,0,1148,46574,0,0,1715,100251,0,0,550,12864,0,0;QS=3,0;MQSB=0.973855;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,113:3:0	0,33,255:11:0
-X	456	.	G	<*>	0	.	DP=32;I16=17,13,0,0,1161,47287,0,0,1746,103010,0,0,534,12296,0,0;QS=3,0;MQSB=0.998031;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,9,116:3:0	0,30,245:10:0
-X	457	.	C	<*>	0	.	DP=33;I16=19,13,0,0,1218,48642,0,0,1835,107451,0,0,563,12967,0,0;QS=3,0;MQSB=0.985204;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,9,118:3:0	0,33,255:11:0
-X	458	.	A	<*>	0	.	DP=33;I16=19,13,0,0,1226,49034,0,0,1835,107451,0,0,568,12990,0,0;QS=3,0;MQSB=0.985204;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,9,111:3:0	0,33,255:11:0
-X	459	.	T	<*>	0	.	DP=33;I16=18,13,0,0,1167,46981,0,0,1775,103851,0,0,565,12945,0,0;QS=3,0;MQSB=0.980167;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,92:2:0	0,33,255:11:0
-X	460	.	G	<*>	0	.	DP=32;I16=19,12,0,0,1219,50105,0,0,1775,103851,0,0,575,12929,0,0;QS=3,0;MQSB=0.989977;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,9,116:3:0	0,30,255:10:0
-X	461	.	T	<*>	0	.	DP=32;I16=19,12,0,0,1213,49819,0,0,1775,103851,0,0,577,12845,0,0;QS=3,0;MQSB=0.989977;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,9,115:3:0	0,30,255:10:0
-X	462	.	G	<*>	0	.	DP=32;I16=19,12,0,0,1190,48962,0,0,1775,103851,0,0,580,12792,0,0;QS=3,0;MQSB=0.989977;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,119:4:0	0,30,241:10:0
-X	463	.	G	<*>	0	.	DP=32;I16=19,12,0,0,1114,44214,0,0,1775,103851,0,0,584,12770,0,0;QS=3,0;MQSB=0.989977;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,114:4:0	0,30,221:10:0
-X	464	.	A	<*>	0	.	DP=32;I16=18,11,0,0,1100,43908,0,0,1686,99410,0,0,556,12106,0,0;QS=3,0;MQSB=0.99095;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,133:4:0	0,24,213:8:0
-X	465	.	C	<*>	0	.	DP=33;I16=20,11,0,0,1191,48085,0,0,1775,103851,0,0,586,12786,0,0;QS=3,0;MQSB=0.996597;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,140:5:0	0,27,231:9:0
-X	466	.	A	<*>	0	.	DP=34;I16=21,12,0,0,1293,53311,0,0,1895,111051,0,0,597,12897,0,0;QS=3,0;MQSB=0.995633;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,154:5:0	0,30,255:10:0
-X	467	.	A	<*>	0	.	DP=34;I16=21,11,0,0,1256,51450,0,0,1835,107451,0,0,597,12891,0,0;QS=3,0;MQSB=0.998231;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,157:5:0	0,27,248:9:0
-X	468	.	A	<*>	0	.	DP=35;I16=22,12,0,0,1274,51268,0,0,1955,114651,0,0,604,12904,0,0;QS=3,0;MQSB=0.997406;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,154:5:0	0,30,251:10:0
-X	469	.	A	<*>	0	.	DP=35;I16=22,12,0,0,1285,52989,0,0,1955,114651,0,0,608,12940,0,0;QS=3,0;MQSB=0.997406;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,146:5:0	0,30,255:10:0
-X	470	.	G	<*>	0	.	DP=35;I16=22,12,0,0,1281,51055,0,0,1955,114651,0,0,612,13016,0,0;QS=3,0;MQSB=0.997406;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,148:5:0	0,30,238:10:0
-X	471	.	T	<*>	0	.	DP=36;I16=22,11,0,0,1239,49021,0,0,1918,113282,0,0,599,12825,0,0;QS=3,0;MQSB=0.915545;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,150:5:0	0,27,232:9:0
-X	472	.	T	<*>	0	.	DP=35;I16=21,12,0,0,1245,48915,0,0,1926,113810,0,0,595,12559,0,0;QS=3,0;MQSB=0.988858;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,153:5:0	0,27,237:9:0
-X	473	.	G	<*>	0	.	DP=35;I16=21,12,0,0,1307,53473,0,0,1926,113810,0,0,599,12651,0,0;QS=3,0;MQSB=0.988858;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,141:5:0	0,27,249:9:0
-X	474	.	G	<*>	0	.	DP=36;I16=22,12,0,0,1284,51708,0,0,1986,117410,0,0,602,12734,0,0;QS=3,0;MQSB=0.986937;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,131:5:0	0,30,255:10:0
-X	475	.	G	<*>	0	.	DP=36;I16=23,12,0,0,1311,51609,0,0,2015,118251,0,0,631,13485,0,0;QS=3,0;MQSB=0.998642;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,141:5:0	0,33,252:11:0
-X	476	.	A	<*>	0	.	DP=36;I16=23,12,0,0,1312,52078,0,0,2015,118251,0,0,634,13606,0,0;QS=3,0;MQSB=0.998642;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,157:5:0	0,33,255:11:0
-X	477	.	T	<*>	0	.	DP=36;I16=23,12,0,0,1318,52668,0,0,2015,118251,0,0,637,13773,0,0;QS=3,0;MQSB=0.998642;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,148:5:0	0,33,255:11:0
-X	478	.	T	<*>	0	.	DP=38;I16=25,12,0,0,1338,51774,0,0,2135,125451,0,0,637,13833,0,0;QS=3,0;MQSB=0.999868;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,18,154:6:0	0,33,255:11:0
-X	479	.	A	<*>	0	.	DP=38;I16=25,12,0,0,1420,57788,0,0,2135,125451,0,0,639,13935,0,0;QS=3,0;MQSB=0.999868;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,18,163:6:0	0,33,255:11:0
-X	480	.	G	<*>	0	.	DP=37;I16=25,11,0,0,1438,60172,0,0,2075,121851,0,0,641,14029,0,0;QS=3,0;MQSB=0.999853;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,18,165:6:0	0,33,255:11:0
-X	481	.	G	<*>	0	.	DP=37;I16=25,11,0,0,1392,55824,0,0,2075,121851,0,0,642,14112,0,0;QS=3,0;MQSB=0.999853;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,18,165:6:0	0,33,255:11:0
-X	482	.	A	<*>	0	.	DP=37;I16=24,11,0,0,1352,55134,0,0,2015,118251,0,0,618,13608,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,143:5:0	0,33,255:11:0
-X	483	.	G	<*>	0	.	DP=37;I16=24,12,0,0,1417,57747,0,0,2075,121851,0,0,642,14240,0,0;QS=3,0;MQSB=0.999437;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,18,165:6:0	0,33,255:11:0
-X	484	.	A	<*>	0	.	DP=36;I16=24,11,0,0,1340,53992,0,0,2015,118251,0,0,643,14281,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,168:6:0	0,33,255:11:0
-X	485	.	G	<*>	0	.	DP=35;I16=23,12,0,0,1329,51411,0,0,2015,118251,0,0,669,14931,0,0;QS=3,0;MQSB=0.998642;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,160:6:0	0,33,255:11:0
-X	486	.	A	<*>	0	.	DP=34;I16=22,12,0,0,1311,51523,0,0,1955,114651,0,0,671,14989,0,0;QS=3,0;MQSB=0.997406;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,173:6:0	0,33,255:11:0
-X	487	.	G	<*>	0	.	DP=34;I16=22,12,0,0,1306,50760,0,0,1955,114651,0,0,672,15030,0,0;QS=3,0;MQSB=0.997406;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,169:6:0	0,33,255:11:0
-X	488	.	A	<*>	0	.	DP=35;I16=22,12,0,0,1274,48140,0,0,1986,117410,0,0,646,14380,0,0;QS=3,0;MQSB=0.986937;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,177:6:0	0,30,255:10:0
-X	489	.	A	<*>	0	.	DP=35;I16=23,12,0,0,1264,46916,0,0,2015,118251,0,0,671,15015,0,0;QS=3,0;MQSB=0.998642;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,175:6:0	0,33,255:11:0
-X	490	.	A	<*>	0	.	DP=36;I16=24,12,0,0,1332,50280,0,0,2075,121851,0,0,671,15061,0,0;QS=3,0;MQSB=0.999437;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,188:7:0	0,33,255:11:0
-X	491	.	T	<*>	0	.	DP=36;I16=24,12,0,0,1284,46802,0,0,2075,121851,0,0,671,15093,0,0;QS=3,0;MQSB=0.999437;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,178:7:0	0,33,255:11:0
-X	492	.	G	<*>	0	.	DP=35;I16=21,12,0,0,1252,48326,0,0,1926,113810,0,0,621,13859,0,0;QS=3,0;MQSB=0.988858;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,172:6:0	0,30,251:10:0
-X	493	.	A	<*>	0	.	DP=34;I16=22,11,0,0,1273,49481,0,0,1926,113810,0,0,650,14672,0,0;QS=3,0;MQSB=0.981935;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,186:7:0	0,24,240:8:0
-X	494	.	A	<*>	0	.	DP=34;I16=22,12,0,0,1326,52604,0,0,1986,117410,0,0,672,15182,0,0;QS=3,0;MQSB=0.986937;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,196:7:0	0,27,255:9:0
-X	495	.	G	<*>	0	.	DP=34;I16=21,12,0,0,1255,48577,0,0,1926,113810,0,0,647,14611,0,0;QS=3,0;MQSB=0.988858;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,168:6:0	0,27,244:9:0
-X	496	.	A	<*>	0	.	DP=34;I16=22,12,0,0,1250,46926,0,0,1986,117410,0,0,670,15220,0,0;QS=3,0;MQSB=0.986937;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,186:7:0	0,27,249:9:0
-X	497	.	C	<*>	0	.	DP=34;I16=22,12,0,0,1250,47006,0,0,1986,117410,0,0,665,15087,0,0;QS=3,0;MQSB=0.986937;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,164:7:0	0,27,239:9:0
-X	498	.	A	<*>	0	.	DP=34;I16=22,12,0,0,1286,49158,0,0,1986,117410,0,0,661,14987,0,0;QS=3,0;MQSB=0.986937;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,185:7:0	0,27,252:9:0
-X	499	.	T	<*>	0	.	DP=34;I16=23,11,0,0,1224,45284,0,0,1986,117410,0,0,659,14919,0,0;QS=3,0;MQSB=0.979712;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,183:7:0	0,30,255:10:0
-X	500	.	A	<*>	0	.	DP=34;I16=23,11,0,0,1230,45152,0,0,1986,117410,0,0,657,14833,0,0;QS=3,0;MQSB=0.979712;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,179:7:0	0,30,255:10:0
-X	501	.	T	<*>	0	.	DP=33;I16=23,10,0,0,1241,47167,0,0,1926,113810,0,0,656,14778,0,0;QS=3,0;MQSB=0.972757;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,186:7:0	0,27,241:9:0
-X	502	.	G	<*>	0	.	DP=33;I16=23,10,0,0,1215,45829,0,0,1926,113810,0,0,655,14753,0,0;QS=3,0;MQSB=0.972757;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,183:7:0	0,27,235:9:0
-X	503	.	T	<*>	0	.	DP=34;I16=23,11,0,0,1194,43366,0,0,1986,117410,0,0,654,14758,0,0;QS=3,0;MQSB=0.979712;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,177:7:0	0,27,234:9:0
-X	504	.	C	<*>	0	.	DP=34;I16=23,11,0,0,1218,45552,0,0,1986,117410,0,0,651,14643,0,0;QS=3,0;MQSB=0.979712;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,183:7:0	0,27,219:9:0
-X	505	.	C	<*>	0	.	DP=35;I16=23,11,0,0,1207,44321,0,0,1986,117410,0,0,641,14509,0,0;QS=3,0;MQSB=0.979712;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,189:7:0	0,27,221:9:0
-X	506	.	A	<*>	0	.	DP=35;I16=24,11,0,0,1266,46776,0,0,2046,121010,0,0,646,14504,0,0;QS=3,0;MQSB=0.977529;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,188:7:0	0,27,231:9:0
-X	507	.	C	<*>	0	.	DP=35;I16=23,11,0,0,1220,45016,0,0,1986,117410,0,0,635,14401,0,0;QS=3,0;MQSB=0.979712;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,183:7:0	0,27,226:9:0
-X	508	.	A	<*>	0	.	DP=34;I16=24,10,0,0,1204,44542,0,0,1986,117410,0,0,643,14491,0,0;QS=3,0;MQSB=0.970272;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,189:7:0	0,27,220:9:0
-X	509	.	C	<*>	0	.	DP=34;I16=24,10,0,0,1272,48272,0,0,1986,117410,0,0,640,14430,0,0;QS=3,0;MQSB=0.970272;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,186:7:0	0,27,241:9:0
-X	510	.	A	<*>	0	.	DP=34;I16=22,11,0,0,1194,44196,0,0,1926,113810,0,0,613,13773,0,0;QS=3,0;MQSB=0.981935;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,187:7:0	0,24,221:8:0
-X	511	.	A	<*>	0	.	DP=34;I16=23,11,0,0,1222,45562,0,0,1986,117410,0,0,637,14395,0,0;QS=3,0;MQSB=0.979712;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,195:7:0	0,24,233:8:0
-X	512	.	A	C,<*>	0	.	DP=33;I16=22,10,0,1,1121,40793,13,169,1866,110210,60,3600,628,14340,9,81;QS=2.97719,0.022807,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.981935;BQB=1;MQ0F=0	PL:DP:DV	0,39,255,51,255,255:18:1	0,21,183,21,183,183:7:0	0,24,231,24,231,231:8:0
-X	513	.	A	<*>	0	.	DP=32;I16=20,10,0,0,1115,42183,0,0,1746,103010,0,0,598,13624,0,0;QS=3,0;MQSB=0.980594;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,175:6:0	0,24,233:8:0
-X	514	.	A	T,<*>	0	.	DP=32;I16=20,9,0,1,1066,40004,16,256,1686,99410,60,3600,586,13500,11,121;QS=2.97075,0.0292505,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.980594;BQB=1;MQ0F=0	PL:DP:DV	0,31,255,45,255,255:16:1	0,18,171,18,171,171:6:0	0,24,235,24,235,235:8:0
-X	515	.	C	<*>	0	.	DP=32;I16=18,10,0,0,1010,37294,0,0,1626,95810,0,0,561,12915,0,0;QS=3,0;MQSB=0.986018;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,167:6:0	0,24,211:8:0
-X	516	.	C	<*>	0	.	DP=32;I16=21,10,0,0,1100,40570,0,0,1806,106610,0,0,612,13954,0,0;QS=3,0;MQSB=0.977926;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,187:7:0	0,24,215:8:0
-X	517	.	T	<*>	0	.	DP=33;I16=23,10,0,0,1269,49995,0,0,1926,113810,0,0,636,14626,0,0;QS=3,0;MQSB=0.972757;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,201:7:0	0,24,242:8:0
-X	518	.	G	<*>	0	.	DP=34;I16=24,10,0,0,1247,46839,0,0,1986,117410,0,0,636,14696,0,0;QS=3,0;MQSB=0.970272;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,182:7:0	0,24,220:8:0
-X	519	.	T	<*>	0	.	DP=36;I16=25,11,0,0,1283,46693,0,0,2106,124610,0,0,636,14742,0,0;QS=3,0;MQSB=0.975394;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,21,177:7:0	0,24,224:8:0
-X	520	.	T	<*>	0	.	DP=36;I16=24,11,0,0,1238,44894,0,0,2046,121010,0,0,613,14193,0,0;QS=3,0;MQSB=0.977529;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,21,180:7:0	0,24,223:8:0
-X	521	.	C	<*>	0	.	DP=34;I16=25,9,0,0,1280,49454,0,0,1986,117410,0,0,641,14875,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,21,191:7:0	0,21,204:7:0
-X	522	.	A	<*>	0	.	DP=32;I16=24,8,0,0,1158,43228,0,0,1897,112969,0,0,646,14960,0,0;QS=3,0;MQSB=0.872525;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,21,185:7:0	0,15,170:5:0
-X	523	.	T	G,<*>	0	.	DP=32;I16=23,8,1,0,1184,45708,15,225,1837,109369,60,3600,626,14446,25,625;QS=2.9794,0.0206044,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.872525;BQB=1;MQ0F=0	PL:DP:DV	0,44,255,57,255,255:20:1	0,21,191,21,191,191:7:0	0,15,166,15,166,166:5:0
-X	524	.	T	<*>	0	.	DP=32;I16=24,7,0,0,1084,39474,0,0,1837,109369,0,0,629,14483,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,21,194:7:0	0,12,140:4:0
-X	525	.	G	<*>	0	.	DP=32;I16=24,7,0,0,1181,45669,0,0,1837,109369,0,0,631,14495,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,21,188:7:0	0,12,129:4:0
-X	526	.	C	<*>	0	.	DP=32;I16=24,7,0,0,1146,43950,0,0,1860,111600,0,0,633,14531,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,21,185:7:0	0,12,131:4:0
-X	527	.	A	<*>	0	.	DP=33;I16=24,8,0,0,1209,46265,0,0,1897,112969,0,0,636,14634,0,0;QS=3,0;MQSB=0.872525;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,194:7:0	0,18,181:6:0
-X	528	.	G	<*>	0	.	DP=33;I16=24,8,0,0,1256,49824,0,0,1897,112969,0,0,634,14484,0,0;QS=3,0;MQSB=0.872525;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,18,169:6:0	0,18,193:6:0
-X	529	.	C	<*>	0	.	DP=32;I16=24,7,0,0,1148,44362,0,0,1837,109369,0,0,633,14357,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,187:7:0	0,18,184:6:0
-X	530	.	T	<*>	0	.	DP=32;I16=25,7,0,0,1244,49168,0,0,1897,112969,0,0,657,14883,0,0;QS=3,0;MQSB=0.850154;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,196:7:0	0,18,202:6:0
-X	531	.	T	<*>	0	.	DP=32;I16=25,7,0,0,1177,44171,0,0,1897,112969,0,0,654,14714,0,0;QS=3,0;MQSB=0.850154;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,181:7:0	0,18,193:6:0
-X	532	.	T	<*>	0	.	DP=32;I16=24,7,0,0,1153,43543,0,0,1837,109369,0,0,630,14116,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,181:7:0	0,18,192:6:0
-X	533	.	C	<*>	0	.	DP=32;I16=24,7,0,0,1142,43940,0,0,1837,109369,0,0,619,13649,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,178:7:0	0,18,180:6:0
-X	534	.	T	<*>	0	.	DP=31;I16=24,6,0,0,1212,49426,0,0,1777,105769,0,0,615,13479,0,0;QS=3,0;MQSB=0.82403;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,205:7:0	0,18,205:6:0
-X	535	.	A	<*>	0	.	DP=31;I16=24,6,0,0,1080,39870,0,0,1777,105769,0,0,611,13341,0,0;QS=3,0;MQSB=0.82403;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,194:7:0	0,18,189:6:0
-X	536	.	C	<*>	0	.	DP=31;I16=24,7,0,0,1097,40707,0,0,1837,109369,0,0,631,13809,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,184:7:0	0,18,157:6:0
-X	537	.	C	<*>	0	.	DP=31;I16=22,7,0,0,1034,38564,0,0,1717,102169,0,0,587,12861,0,0;QS=3,0;MQSB=0.854582;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,172:7:0	0,18,183:6:0
-X	538	.	A	<*>	0	.	DP=31;I16=24,7,0,0,1138,42478,0,0,1837,109369,0,0,620,13536,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,189:7:0	0,18,181:6:0
-X	539	.	T	<*>	0	.	DP=31;I16=24,7,0,0,1134,42070,0,0,1837,109369,0,0,614,13422,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,178:7:0	0,18,181:6:0
-X	540	.	C	<*>	0	.	DP=31;I16=24,7,0,0,1148,43768,0,0,1837,109369,0,0,608,13340,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,177:7:0	0,18,178:6:0
-X	541	.	A	<*>	0	.	DP=32;I16=24,6,0,0,1083,40483,0,0,1777,105769,0,0,551,11991,0,0;QS=3,0;MQSB=0.82403;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,180:8:0	0,15,150:5:0
-X	542	.	C	<*>	0	.	DP=33;I16=25,6,0,0,1123,41759,0,0,1837,109369,0,0,570,12552,0,0;QS=3,0;MQSB=0.822578;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,172:8:0	0,18,174:6:0
-X	543	.	C	<*>	0	.	DP=34;I16=25,9,0,0,1219,45959,0,0,1986,117410,0,0,601,13245,0,0;QS=3,0;MQSB=0.621145;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,27,194:9:0	0,18,188:6:0
-X	544	.	A	<*>	0	.	DP=33;I16=24,8,0,0,1170,43898,0,0,1866,110210,0,0,570,12506,0,0;QS=3,0;MQSB=0.579578;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,24,192:8:0	0,18,180:6:0
-X	545	.	A	<*>	0	.	DP=33;I16=25,8,0,0,1174,43602,0,0,1926,113810,0,0,587,12951,0,0;QS=3,0;MQSB=0.576102;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,24,190:8:0	0,18,184:6:0
-X	546	.	A	<*>	0	.	DP=32;I16=24,8,0,0,1126,41444,0,0,1866,110210,0,0,580,12802,0,0;QS=3,0;MQSB=0.579578;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,166:7:0	0,18,193:6:0
-X	547	.	A	<*>	0	.	DP=32;I16=24,7,0,0,1129,42381,0,0,1806,106610,0,0,547,12009,0,0;QS=3,0;MQSB=0.525788;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,180:7:0	0,18,195:6:0
-X	548	.	A	<*>	0	.	DP=33;I16=23,9,0,0,1153,42673,0,0,1866,110210,0,0,561,12489,0,0;QS=3,0;MQSB=0.628357;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,181:7:0	0,21,211:7:0
-X	549	.	T	G,<*>	0	.	DP=32;I16=22,8,0,1,1101,40987,20,400,1746,103010,60,3600,530,11716,25,625;QS=2.96748,0.0325203,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.632337;BQB=1;MQ0F=0	PL:DP:DV	0,31,255,48,255,255:17:1	0,21,168,21,168,168:7:0	0,21,208,21,208,208:7:0
-X	550	.	T	<*>	0	.	DP=32;I16=22,9,0,0,1052,37298,0,0,1806,106610,0,0,548,12176,0,0;QS=3,0;MQSB=0.632337;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,150:7:0	0,21,220:7:0
-X	551	.	G	<*>	0	.	DP=31;I16=22,9,0,0,1121,41639,0,0,1806,106610,0,0,541,12045,0,0;QS=3,0;MQSB=0.632337;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,172:7:0	0,21,208:7:0
-X	552	.	C	<*>	0	.	DP=30;I16=21,9,0,0,1093,41365,0,0,1746,103010,0,0,535,11947,0,0;QS=3,0;MQSB=0.636601;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,167:7:0	0,21,208:7:0
-X	553	.	A	<*>	0	.	DP=30;I16=20,8,0,0,981,35387,0,0,1626,95810,0,0,485,10831,0,0;QS=3,0;MQSB=0.596163;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,150:6:0	0,21,194:7:0
-X	554	.	A	<*>	0	.	DP=30;I16=19,9,0,0,975,35601,0,0,1626,95810,0,0,488,10906,0,0;QS=3,0;MQSB=0.646113;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,139:5:0	0,24,211:8:0
-X	555	.	A	<*>	0	.	DP=30;I16=20,10,0,0,1024,36526,0,0,1746,103010,0,0,514,11392,0,0;QS=3,0;MQSB=0.679025;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,150:6:0	0,21,211:7:0
-X	556	.	C	<*>	0	.	DP=29;I16=20,9,0,0,1055,39195,0,0,1709,101641,0,0,509,11219,0,0;QS=3,0;MQSB=0.894839;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,158:6:0	0,18,186:6:0
-X	557	.	A	<*>	0	.	DP=27;I16=18,9,0,0,987,36749,0,0,1589,94441,0,0,506,11074,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,157:6:0	0,18,186:6:0
-X	558	.	A	<*>	0	.	DP=27;I16=18,8,0,0,948,35808,0,0,1560,93600,0,0,477,10281,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,143:5:0	0,18,177:6:0
-X	559	.	C	A,<*>	0	.	DP=27;I16=17,8,0,1,908,33726,14,196,1500,90000,29,841,448,9516,25,625;QS=2.92708,0.0729167,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.90038;BQB=1;MQ0F=0	PL:DP:DV	0,42,255,42,255,255:14:0	0,4,116,15,119,123:6:1	0,18,169,18,169,169:6:0
-X	560	.	C	<*>	0	.	DP=28;I16=19,9,0,0,992,36552,0,0,1649,98041,0,0,494,10654,0,0;QS=3,0;MQSB=0.896555;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,160:6:0	0,21,181:7:0
-X	561	.	A	<*>	0	.	DP=28;I16=18,9,0,0,963,35455,0,0,1589,94441,0,0,466,9946,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,158:6:0	0,21,194:7:0
-X	562	.	C	<*>	0	.	DP=28;I16=18,9,0,0,1006,38392,0,0,1589,94441,0,0,463,9893,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,153:6:0	0,21,187:7:0
-X	563	.	A	<*>	0	.	DP=27;I16=17,9,0,0,893,32413,0,0,1529,90841,0,0,460,9820,0,0;QS=3,0;MQSB=0.90038;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,149:5:0	0,21,179:7:0
-X	564	.	C	<*>	0	.	DP=27;I16=18,9,0,0,859,28747,0,0,1589,94441,0,0,482,10402,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,121:5:0	0,21,182:7:0
-X	565	.	G	<*>	0	.	DP=30;I16=17,9,0,0,818,26928,0,0,1560,93600,0,0,454,9764,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,96:4:0	0,21,154:7:0
-X	566	.	C	<*>	0	.	DP=29;I16=15,11,0,0,903,33405,0,0,1529,90841,0,0,424,9084,0,0;QS=3,0;MQSB=0.927041;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,155:5:0	0,18,167:6:0
-X	567	.	C	<*>	0	.	DP=30;I16=15,12,0,0,932,33774,0,0,1589,94441,0,0,462,10178,0,0;QS=3,0;MQSB=0.935229;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,155:5:0	0,21,196:7:0
-X	568	.	C	<*>	0	.	DP=29;I16=15,13,0,0,1057,40817,0,0,1649,98041,0,0,482,10438,0,0;QS=3,0;MQSB=0.942064;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,183:6:0	0,18,189:6:0
-X	569	.	T	<*>	0	.	DP=30;I16=16,12,0,0,1056,41296,0,0,1649,98041,0,0,493,10655,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,190:6:0	0,21,213:7:0
-X	570	.	T	<*>	0	.	DP=30;I16=16,12,0,0,954,34972,0,0,1680,100800,0,0,472,10086,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,157:5:0	0,21,195:7:0
-X	571	.	C	<*>	0	.	DP=31;I16=17,12,0,0,1061,40675,0,0,1740,104400,0,0,472,10158,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,155:5:0	0,21,193:7:0
-X	572	.	A	<*>	0	.	DP=31;I16=18,12,0,0,1102,42642,0,0,1769,105241,0,0,499,10887,0,0;QS=3,0;MQSB=0.929991;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,203:7:0	0,18,175:6:0
-X	573	.	A	<*>	0	.	DP=31;I16=18,12,0,0,1057,38473,0,0,1769,105241,0,0,501,10975,0,0;QS=3,0;MQSB=0.929991;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,199:7:0	0,18,178:6:0
-X	574	.	C	A,<*>	0	.	DP=31;I16=18,11,0,1,1088,41328,15,225,1740,104400,29,841,478,10422,25,625;QS=2.94071,0.0592885,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.929991;BQB=1;MQ0F=0	PL:DP:DV	0,48,255,48,255,255:16:0	0,9,170,21,173,177:8:1	0,18,173,18,173,173:6:0
-X	575	.	T	<*>	0	.	DP=30;I16=16,10,0,0,1024,41260,0,0,1560,93600,0,0,448,9842,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,21,209:7:0	0,15,163:5:0
-X	576	.	G	<*>	0	.	DP=30;I16=17,12,0,0,1047,40077,0,0,1709,101641,0,0,507,11087,0,0;QS=3,0;MQSB=0.931617;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,208:8:0	0,15,151:5:0
-X	577	.	G	<*>	0	.	DP=30;I16=16,12,0,0,999,37747,0,0,1649,98041,0,0,489,10755,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,204:8:0	0,15,146:5:0
-X	578	.	G	<*>	0	.	DP=29;I16=16,13,0,0,975,34803,0,0,1709,101641,0,0,520,11286,0,0;QS=3,0;MQSB=0.940317;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,198:8:0	0,15,151:5:0
-X	579	.	G	<*>	0	.	DP=30;I16=15,13,0,0,1028,38752,0,0,1649,98041,0,0,484,10514,0,0;QS=3,0;MQSB=0.942064;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,224:8:0	0,12,145:4:0
-X	580	.	A	C,<*>	0	.	DP=30;I16=15,14,1,0,1060,39178,16,256,1709,101641,60,3600,510,11078,17,289;QS=2.97338,0.0266223,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.946202;BQB=1;MQ0F=0	PL:DP:DV	0,34,255,48,255,255:17:1	0,24,221,24,221,221:8:0	0,15,155,15,155,155:5:0
-X	581	.	A	<*>	0	.	DP=31;I16=16,15,0,0,1083,39215,0,0,1829,108841,0,0,530,11384,0,0;QS=3,0;MQSB=0.951229;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,24,223:8:0	0,15,153:5:0
-X	582	.	C	<*>	0	.	DP=31;I16=15,15,0,0,1080,39870,0,0,1769,105241,0,0,519,11211,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,207:8:0	0,15,151:5:0
-X	583	.	T	<*>	0	.	DP=30;I16=16,14,0,0,1136,43996,0,0,1769,105241,0,0,539,11523,0,0;QS=3,0;MQSB=0.946202;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,238:8:0	0,15,163:5:0
-X	584	.	C	<*>	0	.	DP=31;I16=16,13,0,0,1051,39351,0,0,1709,101641,0,0,499,10619,0,0;QS=3,0;MQSB=0.960189;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,207:7:0	0,15,157:5:0
-X	585	.	A	<*>	0	.	DP=31;I16=17,14,0,0,1096,39866,0,0,1798,106082,0,0,549,11751,0,0;QS=3,0;MQSB=0.998229;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,24,211:8:0	0,15,157:5:0
-X	586	.	T	<*>	0	.	DP=31;I16=16,14,0,0,1081,39839,0,0,1738,102482,0,0,546,11796,0,0;QS=3,0;MQSB=0.999136;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,212:8:0	0,15,156:5:0
-X	587	.	C	<*>	0	.	DP=31;I16=17,13,0,0,1070,39402,0,0,1769,105241,0,0,532,11350,0,0;QS=3,0;MQSB=0.963674;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,201:7:0	0,15,155:5:0
-X	588	.	A	<*>	0	.	DP=31;I16=17,14,0,0,1126,41642,0,0,1798,106082,0,0,562,12140,0,0;QS=3,0;MQSB=0.998229;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,24,222:8:0	0,15,164:5:0
-X	589	.	A	<*>	0	.	DP=31;I16=17,14,0,0,1157,43973,0,0,1798,106082,0,0,568,12340,0,0;QS=3,0;MQSB=0.998229;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,24,236:8:0	0,15,165:5:0
-X	590	.	C	<*>	0	.	DP=32;I16=16,14,0,0,1094,41302,0,0,1769,105241,0,0,549,11951,0,0;QS=3,0;MQSB=0.958545;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,192:6:0	0,18,175:6:0
-X	591	.	A	<*>	0	.	DP=31;I16=16,15,0,0,1165,44163,0,0,1798,106082,0,0,579,12695,0,0;QS=3,0;MQSB=0.999805;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,209:7:0	0,18,188:6:0
-X	592	.	A	<*>	0	.	DP=31;I16=15,15,0,0,1114,42144,0,0,1738,102482,0,0,571,12651,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,215:7:0	0,18,182:6:0
-X	593	.	C	<*>	0	.	DP=31;I16=15,14,0,0,1065,39889,0,0,1709,101641,0,0,550,12132,0,0;QS=3,0;MQSB=0.954405;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,191:6:0	0,18,174:6:0
-X	594	.	A	<*>	0	.	DP=33;I16=16,16,0,0,1163,42917,0,0,1858,109682,0,0,572,12672,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,205:7:0	0,24,212:8:0
-X	595	.	A	<*>	0	.	DP=33;I16=17,16,0,0,1130,39996,0,0,1918,113282,0,0,589,12905,0,0;QS=3,0;MQSB=0.999838;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,198:7:0	0,24,213:8:0
-X	596	.	A	<*>	0	.	DP=33;I16=16,16,0,0,1059,37039,0,0,1858,109682,0,0,590,12952,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,169:7:0	0,24,230:8:0
-X	597	.	C	<*>	0	.	DP=33;I16=17,16,0,0,1196,44890,0,0,1918,113282,0,0,592,12990,0,0;QS=3,0;MQSB=0.999838;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,204:7:0	0,24,220:8:0
-X	598	.	T	<*>	0	.	DP=33;I16=16,16,0,0,1214,47104,0,0,1858,109682,0,0,593,13013,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,217:7:0	0,24,239:8:0
-X	599	.	T	<*>	0	.	DP=33;I16=16,17,0,0,1183,43669,0,0,1918,113282,0,0,599,13095,0,0;QS=3,0;MQSB=0.999838;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,197:7:0	0,27,247:9:0
-X	600	.	G	<*>	0	.	DP=32;I16=15,17,0,0,1174,44066,0,0,1858,109682,0,0,601,13145,0,0;QS=3,0;MQSB=0.999287;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,194:7:0	0,24,232:8:0
-X	601	.	T	<*>	0	.	DP=32;I16=15,17,0,0,1114,39954,0,0,1858,109682,0,0,603,13227,0,0;QS=3,0;MQSB=0.999287;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,188:7:0	0,24,235:8:0
-X	602	.	G	<*>	0	.	DP=32;I16=15,15,0,0,1090,40326,0,0,1769,105241,0,0,555,12091,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,185:6:0	0,24,229:8:0
-X	603	.	G	<*>	0	.	DP=31;I16=15,16,0,0,1052,37460,0,0,1798,106082,0,0,607,13437,0,0;QS=3,0;MQSB=0.999805;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,186:7:0	0,24,219:8:0
-X	604	.	T	<*>	0	.	DP=31;I16=14,16,0,0,1009,35893,0,0,1769,105241,0,0,564,12540,0,0;QS=3,0;MQSB=0.958545;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,195:8:0	0,21,212:7:0
-X	605	.	T	<*>	0	.	DP=31;I16=12,15,0,0,1001,37741,0,0,1589,94441,0,0,514,11258,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,200:7:0	0,21,214:7:0
-X	606	.	T	<*>	0	.	DP=31;I16=13,16,0,0,992,35202,0,0,1709,101641,0,0,587,13125,0,0;QS=3,0;MQSB=0.960189;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,21,189:7:0	0,24,217:8:0
-X	607	.	A	<*>	0	.	DP=31;I16=14,16,0,0,1027,36129,0,0,1738,102482,0,0,607,13577,0,0;QS=3,0;MQSB=0.999136;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,176:7:0	0,24,222:8:0
-X	608	.	C	<*>	0	.	DP=32;I16=15,15,0,0,983,33775,0,0,1769,105241,0,0,564,12564,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,21,178:7:0	0,27,214:9:0
-X	609	.	C	<*>	0	.	DP=32;I16=14,17,0,0,1074,38220,0,0,1798,106082,0,0,606,13678,0,0;QS=3,0;MQSB=0.998229;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,190:7:0	0,27,238:9:0
-X	610	.	C	<*>	0	.	DP=32;I16=15,16,0,0,1158,44218,0,0,1829,108841,0,0,594,13444,0,0;QS=3,0;MQSB=0.951229;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,211:8:0	0,27,246:9:0
-X	611	.	A	<*>	0	.	DP=32;I16=15,16,0,0,1080,39204,0,0,1798,106082,0,0,590,13260,0,0;QS=3,0;MQSB=0.999805;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,220:9:0	0,27,246:9:0
-X	612	.	C	<*>	0	.	DP=33;I16=16,17,0,0,1175,43305,0,0,1918,113282,0,0,617,13993,0,0;QS=3,0;MQSB=0.999838;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,27,214:9:0	0,27,250:9:0
-X	613	.	A	<*>	0	.	DP=34;I16=16,17,0,0,1131,40011,0,0,1949,116041,0,0,604,13874,0,0;QS=3,0;MQSB=0.954207;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,27,223:9:0	0,27,239:9:0
-X	614	.	C	<*>	0	.	DP=34;I16=16,17,0,0,1183,43743,0,0,1949,116041,0,0,608,14022,0,0;QS=3,0;MQSB=0.954207;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,27,223:9:0	0,27,245:9:0
-X	615	.	A	<*>	0	.	DP=34;I16=16,18,0,0,1199,43809,0,0,1978,116882,0,0,626,14394,0,0;QS=3,0;MQSB=0.999405;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,30,240:10:0	0,27,254:9:0
-X	616	.	A	<*>	0	.	DP=34;I16=16,17,0,0,1190,44024,0,0,1949,116041,0,0,615,14351,0,0;QS=3,0;MQSB=0.954207;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,27,247:9:0	0,27,255:9:0
-X	617	.	T	<*>	0	.	DP=33;I16=15,18,0,0,1170,43066,0,0,1918,113282,0,0,630,14624,0,0;QS=3,0;MQSB=0.998531;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,30,241:10:0	0,27,255:9:0
-X	618	.	G	<*>	0	.	DP=34;I16=15,19,0,0,1166,41452,0,0,1978,116882,0,0,632,14706,0,0;QS=3,0;MQSB=0.997597;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,30,248:10:0	0,27,240:9:0
-X	619	.	G	<*>	0	.	DP=32;I16=14,18,0,0,1153,42591,0,0,1858,109682,0,0,638,14816,0,0;QS=3,0;MQSB=0.997118;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,30,254:10:0	0,27,247:9:0
-X	620	.	A	<*>	0	.	DP=32;I16=14,17,0,0,1083,39757,0,0,1798,106082,0,0,616,14176,0,0;QS=3,0;MQSB=0.998229;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,30,248:10:0	0,27,255:9:0
-X	621	.	A	<*>	0	.	DP=32;I16=13,18,0,0,1170,45248,0,0,1798,106082,0,0,627,14519,0,0;QS=3,0;MQSB=0.995005;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,255:9:0	0,27,255:9:0
-X	622	.	G	<*>	0	.	DP=32;I16=12,18,0,0,1060,39160,0,0,1769,105241,0,0,604,13888,0,0;QS=3,0;MQSB=0.968257;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,236:9:0	0,27,249:9:0
-X	623	.	A	T,<*>	0	.	DP=32;I16=10,18,1,0,1010,37414,15,225,1649,98041,60,3600,563,12953,25,625;QS=2.96144,0.0385604,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.969907;BQB=1;MQ0F=0	PL:DP:DV	0,20,241,33,244,246:12:1	0,24,213,24,213,213:8:0	0,27,255,27,255,255:9:0
-X	624	.	C	<*>	0	.	DP=32;I16=13,17,0,0,1034,37292,0,0,1738,102482,0,0,607,13887,0,0;QS=3,0;MQSB=0.996503;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,220:9:0	0,27,242:9:0
-X	625	.	C	<*>	0	.	DP=32;I16=13,18,0,0,1108,41138,0,0,1798,106082,0,0,632,14470,0,0;QS=3,0;MQSB=0.995005;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,234:9:0	0,27,249:9:0
-X	626	.	A	<*>	0	.	DP=32;I16=13,17,0,0,1090,40718,0,0,1738,102482,0,0,607,13827,0,0;QS=3,0;MQSB=0.996503;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,237:9:0	0,27,247:9:0
-X	627	.	C	<*>	0	.	DP=32;I16=12,18,0,0,1146,44452,0,0,1769,105241,0,0,607,13833,0,0;QS=3,0;MQSB=0.968257;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,244:9:0	0,27,255:9:0
-X	628	.	T	<*>	0	.	DP=32;I16=11,19,0,0,1124,43114,0,0,1769,105241,0,0,608,13862,0,0;QS=3,0;MQSB=0.972375;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,249:9:0	0,24,249:8:0
-X	629	.	T	<*>	0	.	DP=32;I16=12,19,0,0,1114,41138,0,0,1798,106082,0,0,634,14490,0,0;QS=3,0;MQSB=0.989977;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,247:9:0	0,24,226:8:0
-X	630	.	A	<*>	0	.	DP=31;I16=11,18,0,0,1101,42885,0,0,1740,104400,0,0,610,13844,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,24,242:8:0	0,24,235:8:0
-X	631	.	G	<*>	0	.	DP=31;I16=12,18,0,0,1083,40525,0,0,1769,105241,0,0,636,14474,0,0;QS=3,0;MQSB=0.929991;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,233:8:0	0,24,223:8:0
-X	632	.	C	<*>	0	.	DP=31;I16=11,18,0,0,1105,42665,0,0,1740,104400,0,0,612,13880,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,24,233:8:0	0,24,224:8:0
-X	633	.	A	<*>	0	.	DP=31;I16=12,18,0,0,1056,38190,0,0,1769,105241,0,0,638,14562,0,0;QS=3,0;MQSB=0.929991;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,218:8:0	0,24,214:8:0
-X	634	.	A	<*>	0	.	DP=31;I16=12,18,0,0,1110,42208,0,0,1769,105241,0,0,638,14594,0,0;QS=3,0;MQSB=0.929991;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,238:8:0	0,24,229:8:0
-X	635	.	C	<*>	0	.	DP=31;I16=11,18,0,0,1031,37871,0,0,1740,104400,0,0,613,14025,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,24,220:8:0	0,24,229:8:0
-X	636	.	A	<*>	0	.	DP=31;I16=11,18,0,0,1115,43327,0,0,1740,104400,0,0,611,14005,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,24,228:8:0	0,24,243:8:0
-X	637	.	A	<*>	0	.	DP=31;I16=12,18,0,0,1152,44602,0,0,1769,105241,0,0,634,14634,0,0;QS=3,0;MQSB=0.929991;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,238:8:0	0,24,242:8:0
-X	638	.	A	<*>	0	.	DP=31;I16=12,18,0,0,1118,42406,0,0,1769,105241,0,0,631,14611,0,0;QS=3,0;MQSB=0.929991;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,235:8:0	0,24,238:8:0
-X	639	.	A	<*>	0	.	DP=30;I16=11,18,0,0,1037,38233,0,0,1709,101641,0,0,602,13934,0,0;QS=3,0;MQSB=0.921439;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,24,230:8:0	0,24,227:8:0
-X	640	.	A	<*>	0	.	DP=31;I16=11,19,0,0,1154,45368,0,0,1769,105241,0,0,596,13804,0,0;QS=3,0;MQSB=0.91982;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,242:8:0	0,24,240:8:0
-X	641	.	G	<*>	0	.	DP=31;I16=11,19,0,0,1018,36496,0,0,1769,105241,0,0,590,13650,0,0;QS=3,0;MQSB=0.91982;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,214:8:0	0,24,218:8:0
-X	642	.	G	<*>	0	.	DP=30;I16=11,19,0,0,1057,38459,0,0,1769,105241,0,0,610,14148,0,0;QS=3,0;MQSB=0.91982;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,187:7:0	0,24,221:8:0
-X	643	.	A	<*>	0	.	DP=29;I16=11,17,0,0,969,35477,0,0,1649,98041,0,0,585,13605,0,0;QS=3,0;MQSB=0.923174;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,199:7:0	0,24,237:8:0
-X	644	.	C	A,<*>	0	.	DP=29;I16=9,18,1,0,898,30864,17,289,1620,97200,60,3600,549,12567,25,625;QS=2.95685,0.0431472,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=1;BQB=1;MQ0F=0	PL:DP:DV	0,22,236,36,239,243:13:1	0,21,195,21,195,195:7:0	0,24,204,24,204,204:8:0
-X	645	.	C	<*>	0	.	DP=30;I16=10,19,0,0,1067,40337,0,0,1709,101641,0,0,584,13274,0,0;QS=3,0;MQSB=0.909373;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,21,198:7:0	0,24,226:8:0
-X	646	.	A	T,<*>	0	.	DP=31;I16=9,20,1,0,1044,38174,14,196,1740,104400,60,3600,553,12499,25,625;QS=2.97113,0.028866,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=1;BQB=1;MQ0F=0	PL:DP:DV	0,27,255,39,255,255:14:1	0,21,197,21,197,197:7:0	0,27,229,27,229,229:9:0
-X	647	.	A	<*>	0	.	DP=33;I16=10,21,0,0,1041,35883,0,0,1829,108841,0,0,573,12999,0,0;QS=3,0;MQSB=0.906252;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,21,189:7:0	0,30,213:10:0
-X	648	.	A	<*>	0	.	DP=33;I16=11,22,0,0,1030,34122,0,0,1949,116041,0,0,594,13478,0,0;QS=3,0;MQSB=0.915545;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,188:7:0	0,30,194:10:0
-X	649	.	C	<*>	0	.	DP=32;I16=10,21,0,0,1099,39879,0,0,1860,111600,0,0,566,12738,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,188:7:0	0,27,217:9:0
-X	650	.	T	<*>	0	.	DP=31;I16=11,18,0,0,1006,37114,0,0,1709,101641,0,0,549,12407,0,0;QS=3,0;MQSB=0.921439;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,187:6:0	0,24,226:8:0
-X	651	.	C	<*>	0	.	DP=32;I16=11,20,0,0,1117,41181,0,0,1829,108841,0,0,581,13107,0,0;QS=3,0;MQSB=0.918304;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,186:6:0	0,27,229:9:0
-X	652	.	C	<*>	0	.	DP=32;I16=9,21,0,0,1126,43084,0,0,1769,105241,0,0,557,12423,0,0;QS=3,0;MQSB=0.893237;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,196:6:0	0,24,213:8:0
-X	653	.	T	<*>	0	.	DP=33;I16=9,23,0,0,1141,42631,0,0,1889,112441,0,0,556,12382,0,0;QS=3,0;MQSB=0.890331;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,198:6:0	0,24,225:8:0
-X	654	.	G	<*>	0	.	DP=33;I16=10,23,0,0,1171,43025,0,0,1949,116041,0,0,578,12798,0,0;QS=3,0;MQSB=0.903508;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,18,191:6:0	0,24,223:8:0
-X	655	.	G	<*>	0	.	DP=32;I16=10,22,0,0,1118,40202,0,0,1889,112441,0,0,575,12573,0,0;QS=3,0;MQSB=0.904837;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,181:6:0	0,24,213:8:0
-X	656	.	T	<*>	0	.	DP=32;I16=10,22,0,0,1090,38566,0,0,1889,112441,0,0,571,12333,0,0;QS=3,0;MQSB=0.904837;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,185:6:0	0,24,213:8:0
-X	657	.	A	<*>	0	.	DP=32;I16=10,21,0,0,1100,40006,0,0,1829,108841,0,0,557,12029,0,0;QS=3,0;MQSB=0.906252;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,183:6:0	0,24,191:8:0
-X	658	.	C	<*>	0	.	DP=32;I16=10,21,0,0,1115,41039,0,0,1829,108841,0,0,542,11520,0,0;QS=3,0;MQSB=0.906252;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,168:5:0	0,24,211:8:0
-X	659	.	A	<*>	0	.	DP=32;I16=10,21,0,0,1141,42897,0,0,1829,108841,0,0,547,11685,0,0;QS=3,0;MQSB=0.906252;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,191:6:0	0,24,216:8:0
-X	660	.	T	<*>	0	.	DP=33;I16=10,22,0,0,1139,41887,0,0,1889,112441,0,0,553,11659,0,0;QS=3,0;MQSB=0.904837;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,186:6:0	0,24,214:8:0
-X	661	.	G	<*>	0	.	DP=32;I16=9,22,0,0,1107,41531,0,0,1829,108841,0,0,549,11549,0,0;QS=3,0;MQSB=0.891738;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,191:6:0	0,21,188:7:0
-X	662	.	C	<*>	0	.	DP=32;I16=8,22,0,0,1087,40811,0,0,1800,108000,0,0,523,10991,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,192:6:0	0,21,187:7:0
-X	663	.	A	<*>	0	.	DP=32;I16=9,22,0,0,1036,36816,0,0,1829,108841,0,0,540,11388,0,0;QS=3,0;MQSB=0.891738;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,192:6:0	0,21,186:7:0
-X	664	.	A	<*>	0	.	DP=32;I16=9,23,0,0,1125,40759,0,0,1889,112441,0,0,552,11628,0,0;QS=3,0;MQSB=0.890331;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,18,188:6:0	0,21,184:7:0
-X	665	.	C	<*>	0	.	DP=30;I16=9,21,0,0,1075,39697,0,0,1769,105241,0,0,550,11650,0,0;QS=3,0;MQSB=0.893237;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,186:6:0	0,21,184:7:0
-X	666	.	T	<*>	0	.	DP=29;I16=9,20,0,0,1096,41946,0,0,1709,101641,0,0,547,11607,0,0;QS=3,0;MQSB=0.894839;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,171:5:0	0,21,194:7:0
-X	667	.	G	<*>	0	.	DP=31;I16=11,19,0,0,1037,37627,0,0,1769,105241,0,0,524,11198,0,0;QS=3,0;MQSB=0.91982;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,189:6:0	0,21,188:7:0
-X	668	.	A	<*>	0	.	DP=31;I16=11,20,0,0,1102,39980,0,0,1829,108841,0,0,543,11625,0,0;QS=3,0;MQSB=0.918304;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,190:6:0	0,21,187:7:0
-X	669	.	C	<*>	0	.	DP=30;I16=10,19,0,0,1051,38869,0,0,1740,104400,0,0,528,11464,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,182:6:0	0,21,189:7:0
-X	670	.	A	<*>	0	.	DP=30;I16=11,19,0,0,1121,43423,0,0,1769,105241,0,0,540,11642,0,0;QS=3,0;MQSB=0.91982;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,194:6:0	0,21,205:7:0
-X	671	.	G	<*>	0	.	DP=30;I16=11,19,0,0,1101,41035,0,0,1769,105241,0,0,537,11637,0,0;QS=3,0;MQSB=0.91982;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,181:6:0	0,21,191:7:0
-X	672	.	A	<*>	0	.	DP=30;I16=10,19,0,0,1031,37795,0,0,1740,104400,0,0,521,11479,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,185:6:0	0,21,185:7:0
-X	673	.	T	<*>	0	.	DP=29;I16=8,19,0,0,954,34984,0,0,1589,94441,0,0,497,10885,0,0;QS=3,0;MQSB=0.880529;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,126:4:0	0,21,192:7:0
-X	674	.	G	<*>	0	.	DP=29;I16=10,18,0,0,974,35736,0,0,1649,98041,0,0,497,10827,0,0;QS=3,0;MQSB=0.911099;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,146:5:0	0,21,185:7:0
-X	675	.	A	<*>	0	.	DP=28;I16=9,19,0,0,996,36338,0,0,1649,98041,0,0,517,11389,0,0;QS=3,0;MQSB=0.896555;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,124:4:0	0,21,189:7:0
-X	676	.	A	<*>	0	.	DP=29;I16=8,19,0,0,988,36578,0,0,1589,94441,0,0,462,10106,0,0;QS=3,0;MQSB=0.880529;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,128:4:0	0,21,186:7:0
-X	677	.	T	<*>	0	.	DP=29;I16=9,20,0,0,1006,36126,0,0,1709,101641,0,0,507,11303,0,0;QS=3,0;MQSB=0.894839;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,12,120:4:0	0,21,192:7:0
-X	678	.	C	<*>	0	.	DP=29;I16=9,20,0,0,1020,36984,0,0,1709,101641,0,0,502,11280,0,0;QS=3,0;MQSB=0.894839;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,12,117:4:0	0,21,191:7:0
-X	679	.	T	<*>	0	.	DP=27;I16=6,19,0,0,902,33612,0,0,1469,87241,0,0,460,10414,0,0;QS=3,0;MQSB=0.833024;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,96:3:0	0,21,195:7:0
-X	680	.	C	<*>	0	.	DP=26;I16=7,18,0,0,879,32295,0,0,1469,87241,0,0,468,10482,0,0;QS=3,0;MQSB=0.862128;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,98:3:0	0,21,181:7:0
-X	681	.	A	<*>	0	.	DP=27;I16=7,17,0,0,844,30190,0,0,1409,83641,0,0,465,10425,0,0;QS=3,0;MQSB=0.864405;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,106:3:0	0,21,174:7:0
-X	682	.	A	<*>	0	.	DP=27;I16=7,20,0,0,919,32179,0,0,1589,94441,0,0,500,11096,0,0;QS=3,0;MQSB=0.858077;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,145:5:0	0,21,176:7:0
-X	683	.	A	<*>	0	.	DP=29;I16=8,21,0,0,949,32735,0,0,1709,101641,0,0,499,11103,0,0;QS=3,0;MQSB=0.876998;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,172:6:0	0,21,167:7:0
-X	684	.	C	<*>	0	.	DP=29;I16=6,21,0,0,802,24468,0,0,1589,94441,0,0,473,10459,0,0;QS=3,0;MQSB=0.829029;MQ0F=0	PL:DP:DV	0,45,251:15:0	0,15,118:5:0	0,21,145:7:0
-X	685	.	G	<*>	0	.	DP=28;I16=6,21,0,0,908,32092,0,0,1620,97200,0,0,498,11090,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,130:5:0	0,21,175:7:0
-X	686	.	C	<*>	0	.	DP=28;I16=7,21,0,0,977,35493,0,0,1680,100800,0,0,500,11080,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,170:6:0	0,21,180:7:0
-X	687	.	A	<*>	0	.	DP=28;I16=6,20,0,0,900,31952,0,0,1560,93600,0,0,475,10469,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,175:6:0	0,21,174:7:0
-X	688	.	T	<*>	0	.	DP=27;I16=6,21,0,0,937,33971,0,0,1620,97200,0,0,501,11135,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,153:6:0	0,21,187:7:0
-X	689	.	T	A,<*>	0	.	DP=27;I16=5,20,1,0,829,28967,13,169,1500,90000,60,3600,463,10359,25,625;QS=2.97105,0.0289532,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=1;BQB=1;MQ0F=0	PL:DP:DV	0,28,231,39,234,234:14:1	0,15,116,15,116,116:5:0	0,21,185,21,185,185:7:0
-X	690	.	C	<*>	0	.	DP=27;I16=6,20,0,0,935,34553,0,0,1560,93600,0,0,486,10974,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,146:5:0	0,21,165:7:0
-X	691	.	C	<*>	0	.	DP=26;I16=5,18,0,0,842,31906,0,0,1380,82800,0,0,446,10166,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,129:4:0	0,18,161:6:0
-X	692	.	T	<*>	0	.	DP=26;I16=6,19,0,0,886,32434,0,0,1500,90000,0,0,486,11082,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,146:5:0	0,18,164:6:0
-X	693	.	C	<*>	0	.	DP=27;I16=6,20,0,0,891,31839,0,0,1560,93600,0,0,483,11007,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,141:5:0	0,21,172:7:0
-X	694	.	C	<*>	0	.	DP=27;I16=6,21,0,0,808,25004,0,0,1620,97200,0,0,498,11248,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,242:14:0	0,18,136:6:0	0,21,146:7:0
-X	695	.	G	<*>	0	.	DP=25;I16=4,20,0,0,807,28037,0,0,1440,86400,0,0,476,10692,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,246:13:0	0,18,145:6:0	0,15,124:5:0
-X	696	.	T	<*>	0	.	DP=25;I16=5,20,0,0,896,32870,0,0,1500,90000,0,0,499,11129,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,150:6:0	0,15,141:5:0
-X	697	.	G	<*>	0	.	DP=26;I16=5,19,0,0,852,30594,0,0,1409,83641,0,0,450,9858,0,0;QS=3,0;MQSB=0.796124;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,142:5:0	0,15,120:5:0
-X	698	.	T	<*>	0	.	DP=27;I16=6,20,0,0,917,33201,0,0,1529,90841,0,0,502,11114,0,0;QS=3,0;MQSB=0.83095;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,154:6:0	0,15,131:5:0
-X	699	.	G	<*>	0	.	DP=28;I16=5,21,0,0,923,34103,0,0,1529,90841,0,0,498,10884,0,0;QS=3,0;MQSB=0.79189;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,163:6:0	0,15,132:5:0
-X	700	.	A	<*>	0	.	DP=28;I16=6,22,0,0,989,35833,0,0,1618,95282,0,0,530,11626,0,0;QS=3,0;MQSB=0.904554;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,169:7:0	0,18,148:6:0
-X	701	.	A	<*>	0	.	DP=29;I16=5,23,0,0,992,35956,0,0,1618,95282,0,0,517,11459,0,0;QS=3,0;MQSB=0.864394;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,186:7:0	0,18,144:6:0
-X	702	.	A	<*>	0	.	DP=29;I16=5,23,0,0,1103,44105,0,0,1618,95282,0,0,520,11508,0,0;QS=3,0;MQSB=0.864394;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,204:7:0	0,18,159:6:0
-X	703	.	G	<*>	0	.	DP=29;I16=5,23,0,0,1014,37508,0,0,1618,95282,0,0,522,11534,0,0;QS=3,0;MQSB=0.864394;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,172:7:0	0,18,144:6:0
-X	704	.	A	T,<*>	0	.	DP=29;I16=4,23,1,0,954,34200,16,256,1558,91682,60,3600,499,10963,13,169;QS=2.97064,0.0293578,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.864394;BQB=1;MQ0F=0	PL:DP:DV	0,31,255,45,255,255:16:1	0,18,154,18,154,154:6:0	0,18,139,18,139,139:6:0
-X	705	.	A	<*>	0	.	DP=29;I16=6,22,0,0,1042,39930,0,0,1618,95282,0,0,513,11189,0,0;QS=3,0;MQSB=0.904554;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,189:7:0	0,18,157:6:0
-X	706	.	G	<*>	0	.	DP=30;I16=6,23,0,0,1029,37763,0,0,1678,98882,0,0,513,11225,0,0;QS=3,0;MQSB=0.900586;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,170:7:0	0,18,131:6:0
-X	707	.	C	<*>	0	.	DP=30;I16=5,22,0,0,944,34494,0,0,1558,91682,0,0,464,10040,0,0;QS=3,0;MQSB=0.868709;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,131:5:0	0,18,134:6:0
-X	708	.	C	<*>	0	.	DP=30;I16=6,24,0,0,898,27574,0,0,1738,102482,0,0,540,12010,0,0;QS=3,0;MQSB=0.896846;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,153:8:0	0,18,110:6:0
-X	709	.	G	<*>	0	.	DP=29;I16=5,22,0,0,968,36130,0,0,1558,91682,0,0,507,11343,0,0;QS=3,0;MQSB=0.868709;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,178:8:0	0,15,132:5:0
-X	710	.	G	<*>	0	.	DP=29;I16=5,23,0,0,961,34825,0,0,1618,95282,0,0,533,12029,0,0;QS=3,0;MQSB=0.864394;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,174:8:0	0,15,122:5:0
-X	711	.	A	<*>	0	.	DP=29;I16=6,23,0,0,996,35700,0,0,1647,96123,0,0,565,12723,0,0;QS=3,0;MQSB=0.957107;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,171:7:0	0,18,142:6:0
-X	712	.	C	<*>	0	.	DP=29;I16=6,23,0,0,1069,40863,0,0,1647,96123,0,0,565,12767,0,0;QS=3,0;MQSB=0.957107;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,156:7:0	0,18,146:6:0
-X	713	.	T	<*>	0	.	DP=29;I16=6,23,0,0,1072,40426,0,0,1647,96123,0,0,565,12835,0,0;QS=3,0;MQSB=0.957107;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,187:7:0	0,18,149:6:0
-X	714	.	C	<*>	0	.	DP=28;I16=6,21,0,0,988,37236,0,0,1558,91682,0,0,541,12301,0,0;QS=3,0;MQSB=0.90877;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,153:6:0	0,15,125:5:0
-X	715	.	A	<*>	0	.	DP=28;I16=6,20,0,0,884,31414,0,0,1498,88082,0,0,522,12004,0,0;QS=3,0;MQSB=0.913254;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,138:6:0	0,15,120:5:0
-X	716	.	C	<*>	0	.	DP=29;I16=4,23,0,0,998,37756,0,0,1527,88923,0,0,547,12501,0,0;QS=3,0;MQSB=0.877203;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,141:5:0	0,18,145:6:0
-X	717	.	A	<*>	0	.	DP=31;I16=8,23,0,0,1136,42928,0,0,1767,103323,0,0,574,13254,0,0;QS=3,0;MQSB=0.987595;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,212:8:0	0,18,153:6:0
-X	718	.	G	<*>	0	.	DP=29;I16=7,22,0,0,1066,40006,0,0,1647,96123,0,0,579,13407,0,0;QS=3,0;MQSB=0.979435;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,223:8:0	0,18,139:6:0
-X	719	.	G	<*>	0	.	DP=29;I16=7,19,0,0,952,35868,0,0,1529,90841,0,0,510,11756,0,0;QS=3,0;MQSB=0.860025;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,204:8:0	0,12,120:4:0
-X	720	.	G	<*>	0	.	DP=28;I16=6,20,0,0,986,37838,0,0,1467,85323,0,0,552,12940,0,0;QS=3,0;MQSB=0.970805;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,216:8:0	0,18,147:6:0
-X	721	.	C	<*>	0	.	DP=28;I16=6,21,0,0,989,36901,0,0,1527,88923,0,0,567,13183,0,0;QS=3,0;MQSB=0.966147;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,24,197:8:0	0,18,147:6:0
-X	722	.	A	<*>	0	.	DP=28;I16=6,21,0,0,949,33837,0,0,1527,88923,0,0,569,13225,0,0;QS=3,0;MQSB=0.966147;MQ0F=0	PL:DP:DV	0,39,244:13:0	0,24,205:8:0	0,18,143:6:0
-X	723	.	A	<*>	0	.	DP=28;I16=6,19,0,0,925,34825,0,0,1438,84482,0,0,530,12366,0,0;QS=3,0;MQSB=0.918029;MQ0F=0	PL:DP:DV	0,36,253:12:0	0,24,206:8:0	0,15,135:5:0
-X	724	.	C	<*>	0	.	DP=28;I16=5,22,0,0,967,35983,0,0,1527,88923,0,0,566,13028,0,0;QS=3,0;MQSB=0.932273;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,21,161:7:0	0,18,140:6:0
-X	725	.	A	<*>	0	.	DP=28;I16=6,21,0,0,911,31971,0,0,1527,88923,0,0,565,12987,0,0;QS=3,0;MQSB=0.966147;MQ0F=0	PL:DP:DV	0,42,246:14:0	0,21,168:7:0	0,18,137:6:0
-X	726	.	C	<*>	0	.	DP=28;I16=6,21,0,0,947,34531,0,0,1527,88923,0,0,563,12919,0,0;QS=3,0;MQSB=0.966147;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,21,166:7:0	0,18,136:6:0
-X	727	.	A	C,<*>	0	.	DP=28;I16=6,20,0,1,904,32194,17,289,1498,88082,29,841,535,12199,25,625;QS=2.90811,0.0918919,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.966147;BQB=1;MQ0F=0	PL:DP:DV	0,42,247,42,247,247:14:0	0,21,191,21,191,191:7:0	0,1,109,15,112,119:6:1
-X	728	.	C	<*>	0	.	DP=29;I16=6,22,0,0,1018,37990,0,0,1587,92523,0,0,557,12701,0,0;QS=3,0;MQSB=0.961573;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,208:8:0	0,18,142:6:0
-X	729	.	T	<*>	0	.	DP=29;I16=7,22,0,0,1063,39315,0,0,1647,96123,0,0,581,13227,0,0;QS=3,0;MQSB=0.979435;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,244:9:0	0,18,142:6:0
-X	730	.	A	<*>	0	.	DP=29;I16=7,21,0,0,993,35883,0,0,1618,95282,0,0,555,12529,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,219:9:0	0,15,135:5:0
-X	731	.	T	<*>	0	.	DP=29;I16=7,22,0,0,1024,37312,0,0,1647,96123,0,0,578,13058,0,0;QS=3,0;MQSB=0.979435;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,210:9:0	0,18,148:6:0
-X	732	.	C	<*>	0	.	DP=29;I16=7,21,0,0,1006,37058,0,0,1618,95282,0,0,550,12314,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,219:9:0	0,15,129:5:0
-X	733	.	T	<*>	0	.	DP=29;I16=7,21,0,0,985,35497,0,0,1618,95282,0,0,547,12221,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,222:9:0	0,15,134:5:0
-X	734	.	G	<*>	0	.	DP=29;I16=7,21,0,0,997,36453,0,0,1587,92523,0,0,544,12154,0,0;QS=3,0;MQSB=0.982906;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,204:8:0	0,18,139:6:0
-X	735	.	A	<*>	0	.	DP=30;I16=7,21,0,0,963,33993,0,0,1618,95282,0,0,515,11437,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,190:8:0	0,18,148:6:0
-X	736	.	C	<*>	0	.	DP=30;I16=8,20,0,0,1042,39326,0,0,1618,95282,0,0,512,11320,0,0;QS=3,0;MQSB=0.954515;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,218:8:0	0,18,152:6:0
-X	737	.	T	<*>	0	.	DP=30;I16=8,22,0,0,1071,39825,0,0,1707,99723,0,0,560,12480,0,0;QS=3,0;MQSB=0.990151;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,243:9:0	0,21,149:7:0
-X	738	.	G	<*>	0	.	DP=30;I16=8,21,0,0,1016,36816,0,0,1678,98882,0,0,533,11793,0,0;QS=3,0;MQSB=0.950946;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,210:9:0	0,18,141:6:0
-X	739	.	T	<*>	0	.	DP=30;I16=7,22,0,0,1020,37326,0,0,1647,96123,0,0,534,11900,0,0;QS=3,0;MQSB=0.979435;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,202:8:0	0,21,155:7:0
-X	740	.	T	<*>	0	.	DP=29;I16=7,21,0,0,1011,37465,0,0,1587,92523,0,0,532,11848,0,0;QS=3,0;MQSB=0.982906;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,24,232:8:0	0,21,155:7:0
-X	741	.	T	<*>	0	.	DP=29;I16=7,21,0,0,984,36052,0,0,1587,92523,0,0,528,11722,0,0;QS=3,0;MQSB=0.982906;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,24,224:8:0	0,21,151:7:0
-X	742	.	C	<*>	0	.	DP=30;I16=8,21,0,0,1046,39056,0,0,1678,98882,0,0,525,11671,0,0;QS=3,0;MQSB=0.950946;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,243:9:0	0,18,136:6:0
-X	743	.	A	<*>	0	.	DP=30;I16=8,21,0,0,1026,37156,0,0,1678,98882,0,0,520,11500,0,0;QS=3,0;MQSB=0.950946;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,239:9:0	0,18,131:6:0
-X	744	.	T	<*>	0	.	DP=30;I16=8,22,0,0,1100,41010,0,0,1707,99723,0,0,540,11984,0,0;QS=3,0;MQSB=0.990151;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,247:9:0	0,21,154:7:0
-X	745	.	G	<*>	0	.	DP=31;I16=9,22,0,0,1078,38890,0,0,1767,103323,0,0,535,11873,0,0;QS=3,0;MQSB=0.996219;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,227:9:0	0,24,178:8:0
-X	746	.	G	<*>	0	.	DP=31;I16=9,21,0,0,1001,35191,0,0,1707,99723,0,0,531,11793,0,0;QS=3,0;MQSB=0.997698;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,201:9:0	0,24,178:8:0
-X	747	.	G	<*>	0	.	DP=30;I16=9,20,0,0,1017,36831,0,0,1647,96123,0,0,509,11343,0,0;QS=3,0;MQSB=0.99889;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,201:8:0	0,21,174:7:0
-X	748	.	A	<*>	0	.	DP=30;I16=10,20,0,0,1046,37438,0,0,1707,99723,0,0,529,11721,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,27,242:9:0	0,18,159:6:0
-X	749	.	A	<*>	0	.	DP=31;I16=10,21,0,0,1077,38303,0,0,1767,103323,0,0,530,11728,0,0;QS=3,0;MQSB=0.999777;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,27,240:9:0	0,18,164:6:0
-X	750	.	A	<*>	0	.	DP=32;I16=10,20,0,0,1129,43093,0,0,1738,102482,0,0,500,11252,0,0;QS=3,0;MQSB=0.976097;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,232:8:0	0,15,161:5:0
-X	751	.	G	<*>	0	.	DP=31;I16=11,20,0,0,1065,37955,0,0,1767,103323,0,0,535,11787,0,0;QS=3,0;MQSB=0.999148;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,27,206:9:0	0,18,150:6:0
-X	752	.	T	<*>	0	.	DP=31;I16=11,20,0,0,1034,35786,0,0,1767,103323,0,0,537,11793,0,0;QS=3,0;MQSB=0.999148;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,27,223:9:0	0,18,143:6:0
-X	753	.	C	<*>	0	.	DP=31;I16=12,19,0,0,1073,38779,0,0,1767,103323,0,0,540,11834,0,0;QS=3,0;MQSB=0.994873;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,30,227:10:0	0,18,158:6:0
-X	754	.	T	<*>	0	.	DP=31;I16=12,19,0,0,1135,42527,0,0,1767,103323,0,0,542,11808,0,0;QS=3,0;MQSB=0.994873;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,30,255:10:0	0,18,172:6:0
-X	755	.	G	<*>	0	.	DP=31;I16=12,19,0,0,1157,43695,0,0,1767,103323,0,0,544,11814,0,0;QS=3,0;MQSB=0.994873;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,30,255:10:0	0,18,162:6:0
-X	756	.	G	<*>	0	.	DP=30;I16=12,17,0,0,1002,35566,0,0,1647,96123,0,0,539,11753,0,0;QS=3,0;MQSB=0.988062;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,30,242:10:0	0,18,157:6:0
-X	757	.	A	<*>	0	.	DP=30;I16=12,17,0,0,1035,37723,0,0,1678,98882,0,0,523,11197,0,0;QS=3,0;MQSB=0.993891;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,30,248:10:0	0,15,152:5:0
-X	758	.	A	<*>	0	.	DP=30;I16=12,18,0,0,1015,35685,0,0,1707,99723,0,0,549,11825,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,30,247:10:0	0,18,156:6:0
-X	759	.	A	<*>	0	.	DP=30;I16=12,16,0,0,998,36498,0,0,1618,95282,0,0,526,11472,0,0;QS=3,0;MQSB=0.995699;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,242:9:0	0,15,151:5:0
-X	760	.	C	<*>	0	.	DP=31;I16=12,18,0,0,916,29466,0,0,1707,99723,0,0,547,11741,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,30,217:10:0	0,18,128:6:0
-X	761	.	G	<*>	0	.	DP=30;I16=11,16,0,0,932,32884,0,0,1589,94441,0,0,512,11028,0,0;QS=3,0;MQSB=0.925036;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,220:9:0	0,15,153:5:0
-X	762	.	G	<*>	0	.	DP=29;I16=11,18,0,0,1012,36984,0,0,1647,96123,0,0,541,11629,0,0;QS=3,0;MQSB=0.995968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,220:9:0	0,21,173:7:0
-X	763	.	C	A,<*>	0	.	DP=29;I16=11,16,0,1,948,35124,15,225,1558,91682,29,841,527,11473,2,4;QS=2.93697,0.0630252,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.993109;BQB=1;MQ0F=0	PL:DP:DV	0,39,255,39,255,255:13:0	0,24,193,24,193,193:8:0	0,6,158,18,161,165:7:1
-X	764	.	A	<*>	0	.	DP=31;I16=12,18,0,0,1051,37737,0,0,1738,102482,0,0,516,11020,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,30,250:10:0	0,18,163:6:0
-X	765	.	A	<*>	0	.	DP=32;I16=12,18,0,0,1071,39369,0,0,1738,102482,0,0,525,11379,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,30,254:10:0	0,18,169:6:0
-X	766	.	C	<*>	0	.	DP=31;I16=13,18,0,0,1065,38285,0,0,1798,106082,0,0,547,11797,0,0;QS=3,0;MQSB=0.995005;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,33,235:11:0	0,18,164:6:0
-X	767	.	A	<*>	0	.	DP=30;I16=12,18,0,0,996,34692,0,0,1738,102482,0,0,552,11926,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,33,244:11:0	0,18,148:6:0
-X	768	.	C	<*>	0	.	DP=30;I16=12,18,0,0,1095,40739,0,0,1738,102482,0,0,556,12038,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,33,255:11:0	0,18,173:6:0
-X	769	.	C	<*>	0	.	DP=30;I16=12,18,0,0,1110,42272,0,0,1738,102482,0,0,559,12133,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,33,255:11:0	0,18,173:6:0
-X	770	.	A	<*>	0	.	DP=30;I16=12,18,0,0,1098,40852,0,0,1738,102482,0,0,562,12262,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,33,255:11:0	0,18,171:6:0
-X	771	.	T	<*>	0	.	DP=30;I16=12,18,0,0,1111,41771,0,0,1738,102482,0,0,563,12325,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,33,255:11:0	0,18,177:6:0
-X	772	.	T	<*>	0	.	DP=30;I16=12,18,0,0,1107,41429,0,0,1738,102482,0,0,563,12373,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,33,255:11:0	0,18,176:6:0
-X	773	.	G	<*>	0	.	DP=30;I16=12,18,0,0,1123,42761,0,0,1738,102482,0,0,562,12406,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,33,255:11:0	0,18,175:6:0
-X	774	.	A	<*>	0	.	DP=30;I16=12,18,0,0,1151,44801,0,0,1738,102482,0,0,560,12422,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,33,255:11:0	0,18,179:6:0
-X	775	.	G	<*>	0	.	DP=30;I16=12,18,0,0,1136,43766,0,0,1738,102482,0,0,557,12419,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,33,255:11:0	0,18,177:6:0
-X	776	.	A	<*>	0	.	DP=29;I16=12,17,0,0,1053,38865,0,0,1678,98882,0,0,553,12345,0,0;QS=3,0;MQSB=0.993891;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,30,255:10:0	0,18,169:6:0
-X	777	.	C	<*>	0	.	DP=28;I16=12,16,0,0,1019,37631,0,0,1618,95282,0,0,550,12298,0,0;QS=3,0;MQSB=0.995699;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,229:9:0	0,18,165:6:0
-X	778	.	A	<*>	0	.	DP=28;I16=12,16,0,0,1079,42041,0,0,1618,95282,0,0,547,12277,0,0;QS=3,0;MQSB=0.995699;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,241:9:0	0,18,181:6:0
-X	779	.	G	<*>	0	.	DP=28;I16=12,16,0,0,1025,38825,0,0,1618,95282,0,0,543,12231,0,0;QS=3,0;MQSB=0.995699;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,231:9:0	0,18,170:6:0
-X	780	.	A	<*>	0	.	DP=28;I16=12,16,0,0,1005,36773,0,0,1618,95282,0,0,538,12160,0,0;QS=3,0;MQSB=0.995699;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,242:9:0	0,18,166:6:0
-X	781	.	A	<*>	0	.	DP=28;I16=12,15,0,0,965,35857,0,0,1589,94441,0,0,519,11889,0,0;QS=3,0;MQSB=0.935229;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,222:8:0	0,15,159:5:0
-X	782	.	A	<*>	0	.	DP=28;I16=12,16,0,0,1003,37315,0,0,1618,95282,0,0,530,12044,0,0;QS=3,0;MQSB=0.995699;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,229:8:0	0,18,171:6:0
-X	783	.	A	<*>	0	.	DP=28;I16=12,16,0,0,989,36477,0,0,1618,95282,0,0,527,12001,0,0;QS=3,0;MQSB=0.995699;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,24,230:8:0	0,21,178:7:0
-X	784	.	C	<*>	0	.	DP=26;I16=11,15,0,0,967,36387,0,0,1498,88082,0,0,527,11983,0,0;QS=3,0;MQSB=0.994627;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,207:7:0	0,21,178:7:0
-X	785	.	A	<*>	0	.	DP=26;I16=11,15,0,0,989,38499,0,0,1498,88082,0,0,527,11989,0,0;QS=3,0;MQSB=0.994627;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,213:7:0	0,21,187:7:0
-X	786	.	G	<*>	0	.	DP=26;I16=11,14,0,0,938,35698,0,0,1438,84482,0,0,501,11343,0,0;QS=3,0;MQSB=0.996634;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,211:7:0	0,21,180:7:0
-X	787	.	G	<*>	0	.	DP=26;I16=11,15,0,0,914,33428,0,0,1498,88082,0,0,525,11969,0,0;QS=3,0;MQSB=0.994627;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,189:7:0	0,21,175:7:0
-X	788	.	T	<*>	0	.	DP=26;I16=11,15,0,0,913,33357,0,0,1498,88082,0,0,524,11992,0,0;QS=3,0;MQSB=0.994627;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,180:7:0	0,21,188:7:0
-X	789	.	G	<*>	0	.	DP=26;I16=11,15,0,0,963,36645,0,0,1498,88082,0,0,523,12037,0,0;QS=3,0;MQSB=0.994627;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,193:7:0	0,21,183:7:0
-X	790	.	A	<*>	0	.	DP=26;I16=11,15,0,0,999,39113,0,0,1498,88082,0,0,520,12002,0,0;QS=3,0;MQSB=0.994627;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,198:7:0	0,21,201:7:0
-X	791	.	G	<*>	0	.	DP=26;I16=11,15,0,0,934,34208,0,0,1498,88082,0,0,516,11934,0,0;QS=3,0;MQSB=0.994627;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,180:7:0	0,21,172:7:0
-X	792	.	T	<*>	0	.	DP=26;I16=11,15,0,0,895,32009,0,0,1498,88082,0,0,511,11833,0,0;QS=3,0;MQSB=0.994627;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,184:7:0	0,21,172:7:0
-X	793	.	G	<*>	0	.	DP=27;I16=11,15,0,0,965,36389,0,0,1498,88082,0,0,504,11652,0,0;QS=3,0;MQSB=0.994627;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,193:7:0	0,21,170:7:0
-X	794	.	G	<*>	0	.	DP=26;I16=11,15,0,0,888,31804,0,0,1498,88082,0,0,508,11592,0,0;QS=3,0;MQSB=0.994627;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,198:8:0	0,18,161:6:0
-X	795	.	T	<*>	0	.	DP=26;I16=9,15,0,0,859,31399,0,0,1409,83641,0,0,472,10908,0,0;QS=3,0;MQSB=0.96464;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,211:7:0	0,18,160:6:0
-X	796	.	T	<*>	0	.	DP=27;I16=11,16,0,0,907,31641,0,0,1558,91682,0,0,499,11375,0,0;QS=3,0;MQSB=0.992419;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,221:9:0	0,15,150:5:0
-X	797	.	G	<*>	0	.	DP=26;I16=11,15,0,0,882,31700,0,0,1529,90841,0,0,498,11298,0,0;QS=3,0;MQSB=0.927041;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,215:9:0	0,12,135:4:0
-X	798	.	C	<*>	0	.	DP=26;I16=9,15,0,0,806,28552,0,0,1440,86400,0,0,466,10582,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,207:8:0	0,12,126:4:0
-X	799	.	C	<*>	0	.	DP=26;I16=10,15,0,0,947,36407,0,0,1500,90000,0,0,491,11185,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,234:9:0	0,12,137:4:0
-X	800	.	T	<*>	0	.	DP=26;I16=11,15,0,0,993,38475,0,0,1529,90841,0,0,495,11199,0,0;QS=3,0;MQSB=0.927041;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,27,255:9:0	0,12,139:4:0
-X	801	.	G	<*>	0	.	DP=25;I16=11,14,0,0,938,35854,0,0,1469,87241,0,0,495,11209,0,0;QS=3,0;MQSB=0.929204;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,240:9:0	0,12,145:4:0
-X	802	.	G	<*>	0	.	DP=25;I16=11,14,0,0,892,32802,0,0,1469,87241,0,0,495,11239,0,0;QS=3,0;MQSB=0.929204;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,229:9:0	0,12,137:4:0
-X	803	.	G	<*>	0	.	DP=25;I16=11,14,0,0,906,33502,0,0,1469,87241,0,0,495,11289,0,0;QS=3,0;MQSB=0.929204;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,237:9:0	0,12,136:4:0
-X	804	.	G	<*>	0	.	DP=25;I16=11,12,0,0,868,33326,0,0,1349,80041,0,0,466,10846,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,223:8:0	0,12,138:4:0
-X	805	.	C	<*>	0	.	DP=24;I16=9,14,0,0,810,29684,0,0,1380,82800,0,0,482,11208,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,220:8:0	0,12,128:4:0
-X	806	.	C	<*>	0	.	DP=25;I16=9,14,0,0,814,29856,0,0,1380,82800,0,0,483,11293,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,214:8:0	0,12,122:4:0
-X	807	.	A	<*>	0	.	DP=25;I16=10,15,0,0,939,35997,0,0,1500,90000,0,0,503,11525,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,242:9:0	0,12,146:4:0
-X	808	.	G	<*>	0	.	DP=25;I16=10,15,0,0,918,34720,0,0,1500,90000,0,0,505,11591,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,238:9:0	0,12,136:4:0
-X	809	.	G	<*>	0	.	DP=25;I16=10,15,0,0,926,34932,0,0,1500,90000,0,0,506,11626,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,226:9:0	0,12,136:4:0
-X	810	.	G	C,<*>	0	.	DP=25;I16=10,13,0,1,824,30436,14,196,1380,82800,60,3600,480,11288,14,196;QS=2.96552,0.0344828,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=1;BQB=1;MQ0F=0	PL:DP:DV	0,21,255,33,255,255:12:1	0,24,216,24,216,216:8:0	0,12,132,12,132,132:4:0
-X	811	.	A	<*>	0	.	DP=25;I16=9,14,0,0,808,29404,0,0,1380,82800,0,0,484,11294,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,204:7:0	0,12,139:4:0
-X	812	.	A	<*>	0	.	DP=25;I16=10,15,0,0,831,29515,0,0,1500,90000,0,0,500,11392,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,216:9:0	0,12,139:4:0
-X	813	.	C	<*>	0	.	DP=25;I16=10,15,0,0,915,34093,0,0,1500,90000,0,0,497,11307,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,239:9:0	0,12,138:4:0
-X	814	.	T	<*>	0	.	DP=25;I16=10,15,0,0,987,39343,0,0,1500,90000,0,0,494,11244,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,255:9:0	0,12,148:4:0
-X	815	.	T	<*>	0	.	DP=25;I16=10,15,0,0,894,32670,0,0,1500,90000,0,0,491,11203,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,235:9:0	0,12,143:4:0
-X	816	.	T	<*>	0	.	DP=25;I16=10,15,0,0,898,32990,0,0,1500,90000,0,0,488,11184,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,239:9:0	0,12,136:4:0
-X	817	.	C	<*>	0	.	DP=24;I16=10,14,0,0,898,34256,0,0,1440,86400,0,0,485,11137,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,235:9:0	0,12,124:4:0
-X	818	.	T	<*>	0	.	DP=23;I16=9,14,0,0,883,34371,0,0,1380,82800,0,0,484,11110,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,225:8:0	0,12,143:4:0
-X	819	.	G	<*>	0	.	DP=23;I16=9,13,0,0,832,31932,0,0,1320,79200,0,0,461,10573,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,24,217:8:0	0,12,142:4:0
-X	820	.	G	<*>	0	.	DP=24;I16=10,14,0,0,844,30848,0,0,1440,86400,0,0,484,11114,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,230:9:0	0,12,135:4:0
-X	821	.	G	<*>	0	.	DP=24;I16=10,14,0,0,852,31572,0,0,1440,86400,0,0,484,11098,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,234:9:0	0,12,142:4:0
-X	822	.	G	<*>	0	.	DP=25;I16=10,15,0,0,879,31785,0,0,1500,90000,0,0,481,10955,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,220:9:0	0,12,127:4:0
-X	823	.	T	<*>	0	.	DP=25;I16=10,15,0,0,844,29686,0,0,1500,90000,0,0,478,10786,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,217:9:0	0,12,127:4:0
-X	824	.	C	<*>	0	.	DP=25;I16=9,14,0,0,824,30252,0,0,1380,82800,0,0,427,9477,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,215:9:0	0,9,98:3:0
-X	825	.	A	<*>	0	.	DP=25;I16=10,15,0,0,881,31665,0,0,1500,90000,0,0,467,10277,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,234:9:0	0,12,116:4:0
-X	826	.	T	<*>	0	.	DP=25;I16=10,15,0,0,826,28364,0,0,1500,90000,0,0,461,10039,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,250:12:0	0,27,232:9:0	0,12,117:4:0
-X	827	.	A	<*>	0	.	DP=25;I16=10,15,0,0,851,29477,0,0,1500,90000,0,0,455,9829,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,227:9:0	0,12,123:4:0
-X	828	.	T	C,<*>	0	.	DP=25;I16=2,4,8,11,199,6917,656,23340,360,21600,1140,68400,116,2716,333,6931;QS=0.597777,2.40222,0;VDB=0.842082;SGB=-4.20907;RPB=0.950652;MQB=1;MQSB=1;BQB=0.929717;MQ0F=0	PL:DP:DV	211,0,35,217,65,255:12:10	116,0,91,128,106,213:9:5	120,12,0,120,12,120:4:4
-X	829	.	T	<*>	0	.	DP=24;I16=10,13,0,0,863,32931,0,0,1380,82800,0,0,418,8818,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,242:8:0	0,12,132:4:0
-X	830	.	C	<*>	0	.	DP=24;I16=10,14,0,0,910,34966,0,0,1440,86400,0,0,437,9267,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,220:8:0	0,12,134:4:0
-X	831	.	T	<*>	0	.	DP=24;I16=10,14,0,0,906,34886,0,0,1440,86400,0,0,431,9119,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,243:8:0	0,12,133:4:0
-X	832	.	C	<*>	0	.	DP=24;I16=10,14,0,0,888,33634,0,0,1440,86400,0,0,425,8999,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,220:8:0	0,12,123:4:0
-X	833	.	T	<*>	0	.	DP=25;I16=10,14,0,0,820,29920,0,0,1440,86400,0,0,418,8856,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,224:8:0	0,12,113:4:0
-X	834	.	G	A,<*>	0	.	DP=25;I16=2,3,7,10,164,5898,590,21124,300,18000,1020,61200,104,2296,305,6441;QS=0.520056,2.47994,0;VDB=0.788006;SGB=-4.01214;RPB=0.999233;MQB=1;MQSB=1;BQB=0.821668;MQ0F=0	PL:DP:DV	185,0,46,191,73,246:11:9	128,0,59,137,74,193:8:5	89,9,0,89,9,89:3:3
-X	835	.	T	<*>	0	.	DP=26;I16=9,15,0,0,767,26675,0,0,1440,86400,0,0,406,8652,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,240:12:0	0,24,213:8:0	0,12,98:4:0
-X	836	.	G	<*>	0	.	DP=23;I16=8,15,0,0,833,30561,0,0,1380,82800,0,0,403,8541,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,243:11:0	0,24,214:8:0	0,12,130:4:0
-X	837	.	T	<*>	0	.	DP=23;I16=8,15,0,0,843,31499,0,0,1380,82800,0,0,400,8456,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,241:11:0	0,24,221:8:0	0,12,143:4:0
-X	838	.	T	<*>	0	.	DP=23;I16=8,15,0,0,870,33172,0,0,1380,82800,0,0,397,8397,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,252:11:0	0,24,224:8:0	0,12,134:4:0
-X	839	.	G	<*>	0	.	DP=24;I16=8,15,0,0,862,32774,0,0,1380,82800,0,0,393,8315,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,249:11:0	0,24,212:8:0	0,12,142:4:0
-X	840	.	A	<*>	0	.	DP=25;I16=9,15,0,0,876,32682,0,0,1440,86400,0,0,375,7731,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,243:11:0	0,21,196:7:0	0,18,180:6:0
-X	841	.	T	<*>	0	.	DP=25;I16=9,16,0,0,861,30879,0,0,1500,90000,0,0,396,8260,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,213:11:0	0,24,226:8:0	0,18,185:6:0
-X	842	.	T	<*>	0	.	DP=24;I16=9,15,0,0,872,31990,0,0,1440,86400,0,0,393,8199,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,227:10:0	0,24,231:8:0	0,18,175:6:0
-X	843	.	C	<*>	0	.	DP=24;I16=9,15,0,0,844,30604,0,0,1440,86400,0,0,390,8172,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,228:10:0	0,24,229:8:0	0,18,160:6:0
-X	844	.	T	<*>	0	.	DP=24;I16=9,15,0,0,900,34094,0,0,1440,86400,0,0,386,8128,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,227:10:0	0,24,238:8:0	0,18,189:6:0
-X	845	.	G	<*>	0	.	DP=25;I16=10,15,0,0,916,33866,0,0,1500,90000,0,0,382,8116,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,239:10:0	0,24,225:8:0	0,21,196:7:0
-X	846	.	G	<*>	0	.	DP=24;I16=9,14,0,0,802,28414,0,0,1380,82800,0,0,354,7460,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,223:9:0	0,24,208:8:0	0,18,164:6:0
-X	847	.	T	<*>	0	.	DP=24;I16=8,15,0,0,809,29007,0,0,1380,82800,0,0,377,8083,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,210:9:0	0,24,219:8:0	0,18,149:6:0
-X	848	.	G	<*>	0	.	DP=23;I16=8,15,0,0,829,30351,0,0,1380,82800,0,0,384,8138,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,199:8:0	0,27,243:9:0	0,18,167:6:0
-X	849	.	G	<*>	0	.	DP=22;I16=8,12,0,0,684,23844,0,0,1200,72000,0,0,349,7517,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,160:6:0	0,27,233:9:0	0,15,140:5:0
-X	850	.	T	<*>	0	.	DP=21;I16=6,14,0,0,706,25508,0,0,1200,72000,0,0,360,7568,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,153:6:0	0,24,226:8:0	0,18,147:6:0
-X	851	.	G	<*>	0	.	DP=21;I16=7,14,0,0,707,24667,0,0,1260,75600,0,0,386,8254,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,140:6:0	0,27,233:9:0	0,18,156:6:0
-X	852	.	G	<*>	0	.	DP=21;I16=7,13,0,0,687,24223,0,0,1200,72000,0,0,368,7976,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,147:6:0	0,27,222:9:0	0,15,146:5:0
-X	853	.	A	<*>	0	.	DP=21;I16=7,14,0,0,721,25603,0,0,1260,75600,0,0,388,8442,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,146:6:0	0,27,223:9:0	0,18,166:6:0
-X	854	.	A	<*>	0	.	DP=21;I16=7,14,0,0,725,25843,0,0,1260,75600,0,0,389,8517,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,179:7:0	0,24,209:8:0	0,18,168:6:0
-X	855	.	A	<*>	0	.	DP=21;I16=7,14,0,0,683,23803,0,0,1260,75600,0,0,391,8611,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,171:7:0	0,24,204:8:0	0,18,152:6:0
-X	856	.	C	<*>	0	.	DP=21;I16=7,14,0,0,763,28293,0,0,1260,75600,0,0,392,8676,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,192:7:0	0,24,222:8:0	0,18,172:6:0
-X	857	.	A	<*>	0	.	DP=22;I16=8,14,0,0,786,28480,0,0,1320,79200,0,0,393,8763,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,182:7:0	0,24,220:8:0	0,21,194:7:0
-X	858	.	A	<*>	0	.	DP=22;I16=8,14,0,0,816,31358,0,0,1320,79200,0,0,395,8873,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,192:7:0	0,24,236:8:0	0,21,198:7:0
-X	859	.	G	<*>	0	.	DP=22;I16=8,14,0,0,824,31356,0,0,1320,79200,0,0,395,8907,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,202:7:0	0,24,223:8:0	0,21,203:7:0
-X	860	.	A	<*>	0	.	DP=22;I16=8,13,0,0,743,26985,0,0,1260,75600,0,0,369,8291,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,184:7:0	0,21,202:7:0	0,21,190:7:0
-X	861	.	C	<*>	0	.	DP=22;I16=8,14,0,0,770,28376,0,0,1320,79200,0,0,393,8899,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,206:8:0	0,24,216:8:0	0,18,161:6:0
-X	862	.	T	<*>	0	.	DP=22;I16=8,14,0,0,762,27500,0,0,1320,79200,0,0,393,8905,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,188:8:0	0,24,213:8:0	0,18,177:6:0
-X	863	.	G	<*>	0	.	DP=23;I16=9,14,0,0,836,30660,0,0,1380,82800,0,0,393,8935,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,228:9:0	0,24,221:8:0	0,18,180:6:0
-X	864	.	T	<*>	0	.	DP=22;I16=9,13,0,0,795,29085,0,0,1320,79200,0,0,395,8989,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,215:8:0	0,24,221:8:0	0,18,180:6:0
-X	865	.	C	<*>	0	.	DP=22;I16=8,14,0,0,785,28475,0,0,1320,79200,0,0,397,9015,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,227:9:0	0,21,193:7:0	0,18,177:6:0
-X	866	.	C	<*>	0	.	DP=21;I16=7,13,0,0,694,24890,0,0,1200,72000,0,0,395,8985,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,220:8:0	0,18,149:6:0	0,18,177:6:0
-X	867	.	C	<*>	0	.	DP=21;I16=7,14,0,0,761,28443,0,0,1260,75600,0,0,403,9023,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,223:9:0	0,18,182:6:0	0,18,187:6:0
-X	868	.	A	<*>	0	.	DP=21;I16=7,14,0,0,799,31183,0,0,1260,75600,0,0,406,9054,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,228:9:0	0,18,189:6:0	0,18,202:6:0
-X	869	.	G	<*>	0	.	DP=21;I16=7,14,0,0,795,30733,0,0,1260,75600,0,0,409,9103,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,236:9:0	0,18,190:6:0	0,18,187:6:0
-X	870	.	C	<*>	0	.	DP=21;I16=7,13,0,0,758,29080,0,0,1200,72000,0,0,403,9089,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,226:8:0	0,18,183:6:0	0,18,187:6:0
-X	871	.	C	<*>	0	.	DP=21;I16=7,14,0,0,769,29383,0,0,1260,75600,0,0,413,9155,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,232:9:0	0,18,176:6:0	0,18,192:6:0
-X	872	.	T	<*>	0	.	DP=21;I16=7,14,0,0,785,29879,0,0,1260,75600,0,0,413,9109,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,228:9:0	0,18,187:6:0	0,18,188:6:0
-X	873	.	G	<*>	0	.	DP=21;I16=7,14,0,0,768,28506,0,0,1260,75600,0,0,413,9083,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,233:9:0	0,18,172:6:0	0,18,182:6:0
-X	874	.	G	<*>	0	.	DP=21;I16=7,12,0,0,700,26434,0,0,1140,68400,0,0,374,8234,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,227:8:0	0,15,143:5:0	0,18,189:6:0
-X	875	.	G	<*>	0	.	DP=21;I16=7,14,0,0,717,25659,0,0,1260,75600,0,0,411,8995,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,227:9:0	0,18,163:6:0	0,18,159:6:0
-X	876	.	T	<*>	0	.	DP=21;I16=7,14,0,0,719,25261,0,0,1260,75600,0,0,410,8984,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,222:9:0	0,18,156:6:0	0,18,173:6:0
-X	877	.	G	<*>	0	.	DP=21;I16=7,14,0,0,747,27419,0,0,1260,75600,0,0,409,8995,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,235:9:0	0,18,162:6:0	0,18,176:6:0
-X	878	.	A	<*>	0	.	DP=21;I16=7,13,0,0,738,27650,0,0,1200,72000,0,0,391,8739,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,216:8:0	0,18,172:6:0	0,18,191:6:0
-X	879	.	T	<*>	0	.	DP=21;I16=7,13,0,0,731,26927,0,0,1200,72000,0,0,389,8759,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,214:8:0	0,18,175:6:0	0,18,184:6:0
-X	880	.	A	<*>	0	.	DP=21;I16=7,14,0,0,737,26481,0,0,1260,75600,0,0,405,9109,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,227:9:0	0,18,165:6:0	0,18,172:6:0
-X	881	.	C	<*>	0	.	DP=20;I16=7,13,0,0,742,27898,0,0,1200,72000,0,0,404,9154,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,231:8:0	0,18,164:6:0	0,18,183:6:0
-X	882	.	A	<*>	0	.	DP=20;I16=7,13,0,0,776,30564,0,0,1200,72000,0,0,403,9217,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,225:8:0	0,18,188:6:0	0,18,200:6:0
-X	883	.	G	<*>	0	.	DP=20;I16=7,13,0,0,702,25898,0,0,1200,72000,0,0,401,9247,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,214:8:0	0,18,175:6:0	0,18,176:6:0
-X	884	.	C	<*>	0	.	DP=19;I16=7,12,0,0,629,21449,0,0,1140,68400,0,0,400,9292,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,201:8:0	0,18,155:6:0	0,15,144:5:0
-X	885	.	G	<*>	0	.	DP=18;I16=7,11,0,0,605,20851,0,0,1080,64800,0,0,400,9350,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,215:8:0	0,15,140:5:0	0,15,130:5:0
-X	886	.	A	<*>	0	.	DP=18;I16=7,11,0,0,681,26145,0,0,1080,64800,0,0,400,9420,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,222:8:0	0,15,164:5:0	0,15,163:5:0
-X	887	.	G	<*>	0	.	DP=18;I16=7,11,0,0,631,22891,0,0,1080,64800,0,0,399,9451,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,222:8:0	0,15,138:5:0	0,15,149:5:0
-X	888	.	A	<*>	0	.	DP=18;I16=7,10,0,0,593,21563,0,0,1020,61200,0,0,373,8867,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,216:8:0	0,15,132:5:0	0,12,127:4:0
-X	889	.	C	<*>	0	.	DP=18;I16=7,11,0,0,624,22732,0,0,1080,64800,0,0,396,9492,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,213:8:0	0,15,134:5:0	0,15,160:5:0
-X	890	.	C	<*>	0	.	DP=19;I16=7,11,0,0,616,22426,0,0,1080,64800,0,0,368,8826,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,215:8:0	0,15,138:5:0	0,15,152:5:0
-X	891	.	C	<*>	0	.	DP=19;I16=7,11,0,0,661,24891,0,0,1080,64800,0,0,365,8745,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,227:8:0	0,15,141:5:0	0,15,165:5:0
-X	892	.	C	<*>	0	.	DP=19;I16=7,12,0,0,691,25761,0,0,1140,68400,0,0,387,9299,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,230:9:0	0,15,146:5:0	0,15,167:5:0
-X	893	.	A	<*>	0	.	DP=19;I16=7,12,0,0,673,24521,0,0,1140,68400,0,0,384,9238,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,221:9:0	0,15,142:5:0	0,15,166:5:0
-X	894	.	T	<*>	0	.	DP=19;I16=7,12,0,0,670,24268,0,0,1140,68400,0,0,380,9138,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,225:9:0	0,15,134:5:0	0,15,165:5:0
-X	895	.	C	<*>	0	.	DP=20;I16=8,12,0,0,712,26186,0,0,1200,72000,0,0,376,9050,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,248:10:0	0,15,149:5:0	0,15,162:5:0
-X	896	.	T	<*>	0	.	DP=19;I16=8,10,0,0,684,26696,0,0,1080,64800,0,0,348,8300,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,238:9:0	0,12,141:4:0	0,15,180:5:0
-X	897	.	C	<*>	0	.	DP=18;I16=8,10,0,0,693,27001,0,0,1080,64800,0,0,370,8764,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,12,131:4:0	0,15,166:5:0
-X	898	.	T	<*>	0	.	DP=18;I16=8,10,0,0,674,25656,0,0,1080,64800,0,0,367,8617,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,243:9:0	0,12,125:4:0	0,15,172:5:0
-X	899	.	A	<*>	0	.	DP=18;I16=9,8,0,0,597,21451,0,0,1020,61200,0,0,340,7858,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,239:9:0	0,9,99:3:0	0,15,145:5:0
-X	900	.	C	<*>	0	.	DP=18;I16=9,9,0,0,658,24550,0,0,1080,64800,0,0,364,8362,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,98:3:0	0,15,166:5:0
-X	901	.	C	<*>	0	.	DP=18;I16=9,9,0,0,680,26004,0,0,1080,64800,0,0,363,8255,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,99:3:0	0,15,169:5:0
-X	902	.	A	<*>	0	.	DP=18;I16=9,9,0,0,681,26253,0,0,1080,64800,0,0,362,8162,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,9,115:3:0	0,15,174:5:0
-X	903	.	A	<*>	0	.	DP=18;I16=9,8,0,0,645,24625,0,0,1020,61200,0,0,336,7458,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,250:9:0	0,9,101:3:0	0,15,171:5:0
-X	904	.	A	<*>	0	.	DP=18;I16=9,9,0,0,640,23412,0,0,1080,64800,0,0,359,7969,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,249:10:0	0,9,85:3:0	0,15,174:5:0
-X	905	.	A	<*>	0	.	DP=18;I16=9,9,0,0,675,25673,0,0,1080,64800,0,0,357,7871,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,103:3:0	0,15,172:5:0
-X	906	.	A	<*>	0	.	DP=18;I16=9,9,0,0,669,25193,0,0,1080,64800,0,0,355,7789,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,102:3:0	0,15,166:5:0
-X	907	.	A	<*>	0	.	DP=18;I16=9,9,0,0,661,24541,0,0,1080,64800,0,0,353,7723,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,94:3:0	0,15,165:5:0
-X	908	.	T	<*>	0	.	DP=18;I16=9,9,0,0,673,25579,0,0,1080,64800,0,0,351,7673,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,83:3:0	0,15,168:5:0
-X	909	.	T	<*>	0	.	DP=18;I16=9,9,0,0,653,23847,0,0,1080,64800,0,0,348,7590,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,95:3:0	0,15,161:5:0
-X	910	.	A	<*>	0	.	DP=18;I16=9,9,0,0,652,23790,0,0,1080,64800,0,0,344,7476,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,248:10:0	0,9,104:3:0	0,15,162:5:0
-X	911	.	A	<*>	0	.	DP=18;I16=9,9,0,0,688,26440,0,0,1080,64800,0,0,340,7382,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,109:3:0	0,15,168:5:0
-X	912	.	A	<*>	0	.	DP=18;I16=9,9,0,0,691,26705,0,0,1080,64800,0,0,336,7308,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,115:3:0	0,15,173:5:0
-X	913	.	A	<*>	0	.	DP=19;I16=9,10,0,0,692,25762,0,0,1140,68400,0,0,332,7254,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,109:3:0	0,15,171:5:0
-X	914	.	A	<*>	0	.	DP=19;I16=9,10,0,0,712,26966,0,0,1140,68400,0,0,329,7221,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,109:3:0	0,15,164:5:0
-X	915	.	T	<*>	0	.	DP=18;I16=9,9,0,0,638,23228,0,0,1080,64800,0,0,326,7160,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,247:10:0	0,9,99:3:0	0,15,163:5:0
-X	916	.	T	<*>	0	.	DP=19;I16=9,8,0,0,626,23136,0,0,1020,61200,0,0,296,6396,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,241:9:0	0,9,103:3:0	0,15,164:5:0
-X	917	.	A	<*>	0	.	DP=19;I16=9,10,0,0,726,27962,0,0,1117,66169,0,0,318,6908,0,0;QS=3,0;MQSB=0.934728;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,125:4:0	0,15,171:5:0
-X	918	.	G	<*>	0	.	DP=19;I16=9,10,0,0,688,25456,0,0,1117,66169,0,0,314,6818,0,0;QS=3,0;MQSB=0.934728;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,129:4:0	0,15,147:5:0
-X	919	.	C	<*>	0	.	DP=18;I16=8,10,0,0,672,25786,0,0,1057,62569,0,0,311,6751,0,0;QS=3,0;MQSB=0.938795;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,92:3:0	0,15,152:5:0
-X	920	.	T	<*>	0	.	DP=18;I16=8,10,0,0,681,26113,0,0,1057,62569,0,0,308,6706,0,0;QS=3,0;MQSB=0.938795;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,95:3:0	0,15,171:5:0
-X	921	.	G	<*>	0	.	DP=17;I16=7,10,0,0,617,22841,0,0,997,58969,0,0,304,6582,0,0;QS=3,0;MQSB=0.943335;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,6,47:2:0	0,15,164:5:0
-X	922	.	G	<*>	0	.	DP=16;I16=7,8,0,0,560,21156,0,0,877,51769,0,0,276,5852,0,0;QS=3,0;MQSB=0.921243;MQ0F=0	PL:DP:DV	0,24,243:8:0	0,6,64:2:0	0,15,151:5:0
-X	923	.	G	<*>	0	.	DP=16;I16=7,8,0,0,562,21350,0,0,877,51769,0,0,273,5765,0,0;QS=3,0;MQSB=0.921243;MQ0F=0	PL:DP:DV	0,24,245:8:0	0,6,65:2:0	0,15,144:5:0
-X	924	.	C	<*>	0	.	DP=16;I16=7,9,0,0,603,22955,0,0,937,55369,0,0,295,6321,0,0;QS=3,0;MQSB=0.933674;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,6,57:2:0	0,15,157:5:0
-X	925	.	A	<*>	0	.	DP=16;I16=7,9,0,0,576,21618,0,0,937,55369,0,0,291,6219,0,0;QS=3,0;MQSB=0.933674;MQ0F=0	PL:DP:DV	0,27,244:9:0	0,6,58:2:0	0,15,163:5:0
-X	926	.	T	<*>	0	.	DP=16;I16=7,9,0,0,585,22015,0,0,937,55369,0,0,287,6133,0,0;QS=3,0;MQSB=0.933674;MQ0F=0	PL:DP:DV	0,27,241:9:0	0,6,63:2:0	0,15,161:5:0
-X	927	.	G	<*>	0	.	DP=17;I16=7,10,0,0,641,24481,0,0,997,58969,0,0,283,6063,0,0;QS=3,0;MQSB=0.943335;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,9,82:3:0	0,15,158:5:0
-X	928	.	G	<*>	0	.	DP=17;I16=7,10,0,0,625,23195,0,0,997,58969,0,0,280,6010,0,0;QS=3,0;MQSB=0.943335;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,9,84:3:0	0,15,150:5:0
-X	929	.	T	<*>	0	.	DP=16;I16=7,9,0,0,580,21580,0,0,937,55369,0,0,277,5925,0,0;QS=3,0;MQSB=0.933674;MQ0F=0	PL:DP:DV	0,27,248:9:0	0,9,79:3:0	0,12,128:4:0
-X	930	.	G	<*>	0	.	DP=16;I16=7,8,0,0,565,21561,0,0,877,51769,0,0,249,5233,0,0;QS=3,0;MQSB=0.921243;MQ0F=0	PL:DP:DV	0,24,247:8:0	0,9,82:3:0	0,12,127:4:0
-X	931	.	G	<*>	0	.	DP=16;I16=7,9,0,0,553,19935,0,0,937,55369,0,0,271,5809,0,0;QS=3,0;MQSB=0.933674;MQ0F=0	PL:DP:DV	0,27,244:9:0	0,9,80:3:0	0,12,113:4:0
-X	932	.	T	<*>	0	.	DP=16;I16=7,9,0,0,558,20128,0,0,937,55369,0,0,268,5778,0,0;QS=3,0;MQSB=0.933674;MQ0F=0	PL:DP:DV	0,27,229:9:0	0,9,89:3:0	0,12,122:4:0
-X	933	.	G	<*>	0	.	DP=16;I16=7,8,0,0,558,20926,0,0,877,51769,0,0,239,5091,0,0;QS=3,0;MQSB=0.921243;MQ0F=0	PL:DP:DV	0,24,241:8:0	0,9,94:3:0	0,12,116:4:0
-X	934	.	C	<*>	0	.	DP=15;I16=7,8,0,0,548,20256,0,0,877,51769,0,0,261,5673,0,0;QS=3,0;MQSB=0.921243;MQ0F=0	PL:DP:DV	0,27,244:9:0	0,9,83:3:0	0,9,99:3:0
-X	935	.	A	<*>	0	.	DP=15;I16=7,8,0,0,534,19780,0,0,846,49010,0,0,259,5647,0,0;QS=3,0;MQSB=0.720273;MQ0F=0	PL:DP:DV	0,27,233:9:0	0,9,86:3:0	0,9,101:3:0
-X	936	.	T	<*>	0	.	DP=15;I16=7,8,0,0,579,22499,0,0,846,49010,0,0,257,5589,0,0;QS=3,0;MQSB=0.720273;MQ0F=0	PL:DP:DV	0,27,252:9:0	0,9,91:3:0	0,9,100:3:0
-X	937	.	G	<*>	0	.	DP=16;I16=8,7,0,0,550,20650,0,0,846,49010,0,0,232,5022,0,0;QS=3,0;MQSB=0.651439;MQ0F=0	PL:DP:DV	0,24,228:8:0	0,9,84:3:0	0,12,115:4:0
-X	938	.	C	<*>	0	.	DP=16;I16=8,7,0,0,553,20669,0,0,846,49010,0,0,231,5001,0,0;QS=3,0;MQSB=0.651439;MQ0F=0	PL:DP:DV	0,24,234:8:0	0,9,77:3:0	0,12,119:4:0
-X	939	.	C	<*>	0	.	DP=16;I16=8,8,0,0,582,22100,0,0,906,52610,0,0,250,5392,0,0;QS=3,0;MQSB=0.702619;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,9,71:3:0	0,12,115:4:0
-X	940	.	T	<*>	0	.	DP=15;I16=8,7,0,0,583,23339,0,0,846,49010,0,0,248,5320,0,0;QS=3,0;MQSB=0.651439;MQ0F=0	PL:DP:DV	0,27,252:9:0	0,6,71:2:0	0,12,124:4:0
-X	941	.	G	<*>	0	.	DP=14;I16=7,7,0,0,501,18707,0,0,786,45410,0,0,246,5216,0,0;QS=3,0;MQSB=0.714506;MQ0F=0	PL:DP:DV	0,27,240:9:0	0,6,59:2:0	0,9,93:3:0
-X	942	.	T	<*>	0	.	DP=14;I16=7,7,0,0,525,19799,0,0,786,45410,0,0,244,5128,0,0;QS=3,0;MQSB=0.714506;MQ0F=0	PL:DP:DV	0,27,237:9:0	0,6,70:2:0	0,9,94:3:0
-X	943	.	A	<*>	0	.	DP=14;I16=7,7,0,0,545,21399,0,0,786,45410,0,0,242,5056,0,0;QS=3,0;MQSB=0.714506;MQ0F=0	PL:DP:DV	0,27,248:9:0	0,6,71:2:0	0,9,93:3:0
-X	944	.	G	<*>	0	.	DP=14;I16=7,7,0,0,529,20143,0,0,786,45410,0,0,240,5000,0,0;QS=3,0;MQSB=0.714506;MQ0F=0	PL:DP:DV	0,27,249:9:0	0,6,65:2:0	0,9,95:3:0
-X	945	.	T	<*>	0	.	DP=14;I16=7,7,0,0,523,19621,0,0,786,45410,0,0,238,4960,0,0;QS=3,0;MQSB=0.714506;MQ0F=0	PL:DP:DV	0,27,239:9:0	0,6,70:2:0	0,9,95:3:0
-X	946	.	C	<*>	0	.	DP=13;I16=6,6,0,0,455,17581,0,0,666,38210,0,0,223,4739,0,0;QS=3,0;MQSB=0.660716;MQ0F=0	PL:DP:DV	0,24,240:8:0	0,6,56:2:0	0,6,70:2:0
-X	947	.	C	<*>	0	.	DP=14;I16=7,7,0,0,509,19007,0,0,755,42651,0,0,238,4928,0,0;QS=3,0;MQSB=0.925999;MQ0F=0	PL:DP:DV	0,27,251:9:0	0,9,83:3:0	0,6,66:2:0
-X	948	.	C	<*>	0	.	DP=14;I16=7,7,0,0,520,20050,0,0,755,42651,0,0,237,4887,0,0;QS=3,0;MQSB=0.925999;MQ0F=0	PL:DP:DV	0,27,254:9:0	0,9,78:3:0	0,6,69:2:0
-X	949	.	A	<*>	0	.	DP=15;I16=7,8,0,0,547,20705,0,0,815,46251,0,0,236,4864,0,0;QS=3,0;MQSB=0.959011;MQ0F=0	PL:DP:DV	0,30,250:10:0	0,9,90:3:0	0,6,72:2:0
-X	950	.	G	<*>	0	.	DP=15;I16=6,8,0,0,563,22871,0,0,786,45410,0,0,231,4835,0,0;QS=3,0;MQSB=0.740818;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,6,71:2:0	0,6,72:2:0
-X	951	.	C	<*>	0	.	DP=16;I16=7,8,0,0,554,21080,0,0,846,49010,0,0,230,4840,0,0;QS=3,0;MQSB=0.720273;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,65:2:0	0,6,73:2:0
-X	952	.	T	<*>	0	.	DP=16;I16=8,8,0,0,595,22565,0,0,875,49851,0,0,237,4913,0,0;QS=3,0;MQSB=0.934676;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,93:3:0	0,6,73:2:0
-X	953	.	A	<*>	0	.	DP=16;I16=8,8,0,0,567,20515,0,0,875,49851,0,0,237,4921,0,0;QS=3,0;MQSB=0.934676;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,91:3:0	0,6,69:2:0
-X	954	.	T	<*>	0	.	DP=15;I16=7,8,0,0,544,20412,0,0,815,46251,0,0,238,4948,0,0;QS=3,0;MQSB=0.959011;MQ0F=0	PL:DP:DV	0,30,249:10:0	0,9,94:3:0	0,6,69:2:0
-X	955	.	T	<*>	0	.	DP=15;I16=7,8,0,0,543,19953,0,0,815,46251,0,0,239,4993,0,0;QS=3,0;MQSB=0.959011;MQ0F=0	PL:DP:DV	0,30,246:10:0	0,9,95:3:0	0,6,68:2:0
-X	956	.	C	<*>	0	.	DP=15;I16=6,8,0,0,543,21255,0,0,786,45410,0,0,229,4935,0,0;QS=3,0;MQSB=0.740818;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,6,62:2:0	0,6,70:2:0
-X	957	.	A	<*>	0	.	DP=15;I16=7,8,0,0,504,17684,0,0,815,46251,0,0,241,5137,0,0;QS=3,0;MQSB=0.959011;MQ0F=0	PL:DP:DV	0,30,240:10:0	0,9,74:3:0	0,6,67:2:0
-X	958	.	C	<*>	0	.	DP=14;I16=6,8,0,0,505,18981,0,0,755,42651,0,0,243,5235,0,0;QS=3,0;MQSB=0.981425;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,9,78:3:0	0,3,39:1:0
-X	959	.	A	<*>	0	.	DP=14;I16=5,8,0,0,519,20885,0,0,726,41810,0,0,231,5153,0,0;QS=3,0;MQSB=0.765017;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,6,72:2:0	0,3,38:1:0
-X	960	.	G	<*>	0	.	DP=15;I16=6,9,0,0,539,19901,0,0,815,46251,0,0,247,5479,0,0;QS=3,0;MQSB=0.99308;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,106:4:0	0,3,41:1:0
-X	961	.	T	<*>	0	.	DP=14;I16=6,8,0,0,523,19835,0,0,755,42651,0,0,250,5574,0,0;QS=3,0;MQSB=0.981425;MQ0F=0	PL:DP:DV	0,27,248:9:0	0,12,114:4:0	0,3,39:1:0
-X	962	.	G	<*>	0	.	DP=14;I16=5,8,0,0,498,19194,0,0,726,41810,0,0,236,5394,0,0;QS=3,0;MQSB=0.765017;MQ0F=0	PL:DP:DV	0,27,253:9:0	0,9,91:3:0	0,3,36:1:0
-X	963	.	C	<*>	0	.	DP=13;I16=5,8,0,0,500,19610,0,0,695,39051,0,0,256,5754,0,0;QS=3,0;MQSB=0.997325;MQ0F=0	PL:DP:DV	0,24,234:8:0	0,12,118:4:0	0,3,40:1:0
-X	964	.	T	<*>	0	.	DP=13;I16=5,8,0,0,512,20430,0,0,695,39051,0,0,259,5835,0,0;QS=3,0;MQSB=0.997325;MQ0F=0	PL:DP:DV	0,24,227:8:0	0,12,128:4:0	0,3,42:1:0
-X	965	.	G	<*>	0	.	DP=13;I16=4,8,0,0,467,18429,0,0,666,38210,0,0,241,5477,0,0;QS=3,0;MQSB=0.793923;MQ0F=0	PL:DP:DV	0,24,228:8:0	0,9,93:3:0	0,3,40:1:0
-X	966	.	A	<*>	0	.	DP=13;I16=4,8,0,0,443,16785,0,0,666,38210,0,0,242,5490,0,0;QS=3,0;MQSB=0.793923;MQ0F=0	PL:DP:DV	0,24,212:8:0	0,9,95:3:0	0,3,40:1:0
-X	967	.	G	<*>	0	.	DP=13;I16=4,8,0,0,464,18036,0,0,666,38210,0,0,243,5513,0,0;QS=3,0;MQSB=0.793923;MQ0F=0	PL:DP:DV	0,24,230:8:0	0,9,91:3:0	0,3,41:1:0
-X	968	.	G	<*>	0	.	DP=13;I16=4,8,0,0,441,16549,0,0,666,38210,0,0,244,5546,0,0;QS=3,0;MQSB=0.793923;MQ0F=0	PL:DP:DV	0,24,218:8:0	0,9,87:3:0	0,3,42:1:0
-X	969	.	T	<*>	0	.	DP=13;I16=4,8,0,0,450,16970,0,0,666,38210,0,0,245,5589,0,0;QS=3,0;MQSB=0.793923;MQ0F=0	PL:DP:DV	0,24,220:8:0	0,9,98:3:0	0,3,31:1:0
-X	970	.	G	<*>	0	.	DP=13;I16=4,7,0,0,413,15579,0,0,629,36841,0,0,220,4968,0,0;QS=3,0;MQSB=0.924449;MQ0F=0	PL:DP:DV	0,24,221:8:0	0,6,71:2:0	0,3,33:1:0
-X	971	.	G	<*>	0	.	DP=13;I16=4,8,0,0,459,17711,0,0,666,38210,0,0,245,5609,0,0;QS=3,0;MQSB=0.793923;MQ0F=0	PL:DP:DV	0,24,223:8:0	0,9,93:3:0	0,3,38:1:0
-X	972	.	G	<*>	0	.	DP=13;I16=4,8,0,0,446,17192,0,0,666,38210,0,0,245,5637,0,0;QS=3,0;MQSB=0.793923;MQ0F=0	PL:DP:DV	0,24,210:8:0	0,9,96:3:0	0,3,39:1:0
-X	973	.	A	<*>	0	.	DP=12;I16=4,7,0,0,402,15018,0,0,606,34610,0,0,246,5676,0,0;QS=3,0;MQSB=0.763675;MQ0F=0	PL:DP:DV	0,21,192:7:0	0,9,89:3:0	0,3,42:1:0
-X	974	.	A	<*>	0	.	DP=12;I16=4,7,0,0,417,16273,0,0,606,34610,0,0,247,5725,0,0;QS=3,0;MQSB=0.763675;MQ0F=0	PL:DP:DV	0,21,198:7:0	0,9,96:3:0	0,3,42:1:0
-X	975	.	G	<*>	0	.	DP=13;I16=4,8,0,0,454,17560,0,0,666,38210,0,0,247,5733,0,0;QS=3,0;MQSB=0.793923;MQ0F=0	PL:DP:DV	0,24,213:8:0	0,9,95:3:0	0,3,42:1:0
-X	976	.	A	<*>	0	.	DP=13;I16=4,8,0,0,431,16083,0,0,666,38210,0,0,248,5750,0,0;QS=3,0;MQSB=0.793923;MQ0F=0	PL:DP:DV	0,24,227:8:0	0,9,70:3:0	0,3,41:1:0
-X	977	.	T	<*>	0	.	DP=13;I16=4,8,0,0,438,16316,0,0,666,38210,0,0,248,5726,0,0;QS=3,0;MQSB=0.793923;MQ0F=0	PL:DP:DV	0,24,210:8:0	0,9,93:3:0	0,3,37:1:0
-X	978	.	G	<*>	0	.	DP=12;I16=4,8,0,0,430,16060,0,0,666,38210,0,0,248,5710,0,0;QS=3,0;MQSB=0.793923;MQ0F=0	PL:DP:DV	0,24,224:8:0	0,9,75:3:0	0,3,40:1:0
-X	979	.	C	<*>	0	.	DP=13;I16=4,8,0,0,453,17461,0,0,689,40441,0,0,223,5077,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,27,232:9:0	0,6,72:2:0	0,3,41:1:0
-X	980	.	T	<*>	0	.	DP=13;I16=4,8,0,0,438,16412,0,0,689,40441,0,0,224,5078,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,27,220:9:0	0,6,76:2:0	0,3,43:1:0
-X	981	.	T	<*>	0	.	DP=13;I16=4,9,0,0,484,18602,0,0,726,41810,0,0,250,5714,0,0;QS=3,0;MQSB=0.826565;MQ0F=0	PL:DP:DV	0,27,224:9:0	0,9,97:3:0	0,3,41:1:0
-X	982	.	G	<*>	0	.	DP=14;I16=4,10,0,0,520,20128,0,0,786,45410,0,0,250,5686,0,0;QS=3,0;MQSB=0.852144;MQ0F=0	PL:DP:DV	0,30,237:10:0	0,9,99:3:0	0,3,40:1:0
-X	983	.	A	<*>	0	.	DP=14;I16=4,10,0,0,570,23360,0,0,786,45410,0,0,251,5671,0,0;QS=3,0;MQSB=0.852144;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,101:3:0	0,3,42:1:0
-X	984	.	G	<*>	0	.	DP=15;I16=4,10,0,0,529,20459,0,0,786,45410,0,0,252,5670,0,0;QS=3,0;MQSB=0.852144;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,9,88:3:0	0,3,43:1:0
-X	985	.	C	<*>	0	.	DP=17;I16=4,13,0,0,580,20280,0,0,966,56210,0,0,261,5747,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,33,246:11:0	0,12,100:4:0	0,6,65:2:0
-X	986	.	C	A,<*>	0	.	DP=17;I16=3,12,0,1,519,18353,13,169,846,49010,60,3600,235,5101,4,16;QS=2.95873,0.0412698,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.921781;BQB=1;MQ0F=0	PL:DP:DV	0,16,197,27,200,201:10:1	0,12,108,12,108,108:4:0	0,6,69,6,69,69:2:0
-X	987	.	C	<*>	0	.	DP=17;I16=4,13,0,0,634,23914,0,0,966,56210,0,0,267,5755,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,107:4:0	0,6,69:2:0
-X	988	.	A	<*>	0	.	DP=17;I16=4,13,0,0,633,24341,0,0,966,56210,0,0,269,5737,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,111:4:0	0,6,82:2:0
-X	989	.	G	<*>	0	.	DP=17;I16=4,13,0,0,635,24149,0,0,966,56210,0,0,271,5739,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,114:4:0	0,6,80:2:0
-X	990	.	G	<*>	0	.	DP=16;I16=4,12,0,0,591,22177,0,0,906,52610,0,0,274,5760,0,0;QS=3,0;MQSB=0.88901;MQ0F=0	PL:DP:DV	0,30,246:10:0	0,12,105:4:0	0,6,83:2:0
-X	991	.	A	<*>	0	.	DP=16;I16=3,11,0,0,548,21542,0,0,809,47641,0,0,227,4549,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,27,232:9:0	0,9,100:3:0	0,6,80:2:0
-X	992	.	G	<*>	0	.	DP=16;I16=4,12,0,0,562,20436,0,0,906,52610,0,0,278,5760,0,0;QS=3,0;MQSB=0.88901;MQ0F=0	PL:DP:DV	0,30,240:10:0	0,12,102:4:0	0,6,76:2:0
-X	993	.	T	<*>	0	.	DP=16;I16=4,12,0,0,564,20752,0,0,906,52610,0,0,280,5790,0,0;QS=3,0;MQSB=0.88901;MQ0F=0	PL:DP:DV	0,30,222:10:0	0,12,121:4:0	0,6,73:2:0
-X	994	.	T	<*>	0	.	DP=17;I16=5,11,0,0,597,22625,0,0,906,52610,0,0,270,5696,0,0;QS=3,0;MQSB=0.851779;MQ0F=0	PL:DP:DV	0,27,227:9:0	0,12,123:4:0	0,9,103:3:0
-X	995	.	C	<*>	0	.	DP=16;I16=4,11,0,0,588,23228,0,0,846,49010,0,0,273,5741,0,0;QS=3,0;MQSB=0.872525;MQ0F=0	PL:DP:DV	0,24,216:8:0	0,12,119:4:0	0,9,110:3:0
-X	996	.	A	<*>	0	.	DP=16;I16=4,12,0,0,562,20416,0,0,906,52610,0,0,290,6000,0,0;QS=3,0;MQSB=0.88901;MQ0F=0	PL:DP:DV	0,27,207:9:0	0,12,107:4:0	0,9,113:3:0
-X	997	.	A	<*>	0	.	DP=16;I16=4,12,0,0,600,23520,0,0,906,52610,0,0,294,6110,0,0;QS=3,0;MQSB=0.88901;MQ0F=0	PL:DP:DV	0,27,209:9:0	0,12,123:4:0	0,9,121:3:0
-X	998	.	G	<*>	0	.	DP=17;I16=4,13,0,0,603,22299,0,0,966,56210,0,0,298,6240,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,30,226:10:0	0,12,99:4:0	0,9,115:3:0
-X	999	.	G	<*>	0	.	DP=17;I16=4,12,0,0,575,21519,0,0,906,52610,0,0,302,6390,0,0;QS=3,0;MQSB=0.88901;MQ0F=0	PL:DP:DV	0,27,202:9:0	0,12,118:4:0	0,9,111:3:0
-X	1000	.	C	<*>	0	.	DP=17;I16=4,13,0,0,637,24465,0,0,966,56210,0,0,308,6564,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,30,235:10:0	0,12,118:4:0	0,9,109:3:0
-X	1001	.	T	<*>	0	.	DP=17;I16=4,13,0,0,647,24907,0,0,966,56210,0,0,312,6708,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,30,228:10:0	0,12,120:4:0	0,9,122:3:0
-X	1002	.	G	<*>	0	.	DP=17;I16=4,13,0,0,627,23691,0,0,966,56210,0,0,316,6872,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,30,220:10:0	0,12,123:4:0	0,9,109:3:0
-X	1003	.	C	T,<*>	0	.	DP=18;I16=4,13,0,1,633,23953,22,484,966,56210,60,3600,297,6515,21,441;QS=2.9375,0.0625,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.913725;BQB=1;MQ0F=0	PL:DP:DV	0,8,207,27,211,220:10:1	0,15,132,15,132,132:5:0	0,9,102,9,102,102:3:0
-X	1004	.	A	<*>	0	.	DP=19;I16=5,14,0,0,653,23107,0,0,1086,63410,0,0,321,7061,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,33,231:11:0	0,15,131:5:0	0,9,98:3:0
-X	1005	.	A	<*>	0	.	DP=19;I16=5,14,0,0,670,24380,0,0,1086,63410,0,0,324,7138,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,33,231:11:0	0,15,132:5:0	0,9,113:3:0
-X	1006	.	T	<*>	0	.	DP=19;I16=4,14,0,0,659,24869,0,0,1026,59810,0,0,327,7237,0,0;QS=3,0;MQSB=0.913725;MQ0F=0	PL:DP:DV	0,30,220:10:0	0,15,134:5:0	0,9,115:3:0
-X	1007	.	G	<*>	0	.	DP=18;I16=4,13,0,0,651,25373,0,0,966,56210,0,0,306,6732,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,27,225:9:0	0,15,138:5:0	0,9,113:3:0
-X	1008	.	A	<*>	0	.	DP=18;I16=4,13,0,0,667,27041,0,0,966,56210,0,0,309,6821,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,27,222:9:0	0,15,147:5:0	0,9,118:3:0
-X	1009	.	G	<*>	0	.	DP=18;I16=4,13,0,0,635,24431,0,0,966,56210,0,0,312,6928,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,27,213:9:0	0,15,139:5:0	0,9,116:3:0
-X	1010	.	C	<*>	0	.	DP=18;I16=4,14,0,0,661,25289,0,0,1026,59810,0,0,339,7629,0,0;QS=3,0;MQSB=0.913725;MQ0F=0	PL:DP:DV	0,30,234:10:0	0,15,126:5:0	0,9,114:3:0
-X	1011	.	T	<*>	0	.	DP=18;I16=4,14,0,0,671,25325,0,0,1026,59810,0,0,339,7623,0,0;QS=3,0;MQSB=0.913725;MQ0F=0	PL:DP:DV	0,30,226:10:0	0,15,131:5:0	0,9,118:3:0
-X	1012	.	A	<*>	0	.	DP=19;I16=5,14,0,0,639,22891,0,0,1063,61179,0,0,339,7633,0,0;QS=3,0;MQSB=0.990403;MQ0F=0	PL:DP:DV	0,30,201:10:0	0,18,154:6:0	0,9,113:3:0
-X	1013	.	T	<*>	0	.	DP=18;I16=5,12,0,0,623,23913,0,0,943,53979,0,0,325,7385,0,0;QS=3,0;MQSB=0.998612;MQ0F=0	PL:DP:DV	0,24,202:8:0	0,18,161:6:0	0,9,115:3:0
-X	1014	.	G	<*>	0	.	DP=18;I16=5,13,0,0,656,24596,0,0,1003,57579,0,0,341,7605,0,0;QS=3,0;MQSB=0.995153;MQ0F=0	PL:DP:DV	0,27,218:9:0	0,18,159:6:0	0,9,113:3:0
-X	1015	.	A	<*>	0	.	DP=18;I16=5,13,0,0,646,23878,0,0,1003,57579,0,0,342,7618,0,0;QS=3,0;MQSB=0.995153;MQ0F=0	PL:DP:DV	0,27,209:9:0	0,18,164:6:0	0,9,109:3:0
-X	1016	.	T	<*>	0	.	DP=17;I16=4,12,0,0,588,22114,0,0,929,54841,0,0,340,7632,0,0;QS=3,0;MQSB=0.971017;MQ0F=0	PL:DP:DV	0,27,212:9:0	0,12,124:4:0	0,9,101:3:0
-X	1017	.	T	<*>	0	.	DP=18;I16=5,13,0,0,635,23433,0,0,1026,59810,0,0,346,7694,0,0;QS=3,0;MQSB=0.942222;MQ0F=0	PL:DP:DV	0,27,213:9:0	0,18,155:6:0	0,9,105:3:0
-X	1018	.	G	<*>	0	.	DP=18;I16=5,13,0,0,650,24550,0,0,1026,59810,0,0,349,7757,0,0;QS=3,0;MQSB=0.942222;MQ0F=0	PL:DP:DV	0,27,215:9:0	0,18,179:6:0	0,9,91:3:0
-X	1019	.	C	<*>	0	.	DP=18;I16=5,12,0,0,555,18561,0,0,966,56210,0,0,327,7213,0,0;QS=3,0;MQSB=0.951229;MQ0F=0	PL:DP:DV	0,24,181:8:0	0,18,143:6:0	0,9,104:3:0
-X	1020	.	G	<*>	0	.	DP=19;I16=6,12,0,0,625,22287,0,0,1026,59810,0,0,332,7402,0,0;QS=3,0;MQSB=0.97296;MQ0F=0	PL:DP:DV	0,27,228:9:0	0,18,157:6:0	0,9,87:3:0
-X	1021	.	C	<*>	0	.	DP=19;I16=5,13,0,0,625,22761,0,0,1026,59810,0,0,332,7326,0,0;QS=3,0;MQSB=0.942222;MQ0F=0	PL:DP:DV	0,27,220:9:0	0,18,153:6:0	0,9,92:3:0
-X	1022	.	C	<*>	0	.	DP=19;I16=6,13,0,0,727,27975,0,0,1086,63410,0,0,360,8034,0,0;QS=3,0;MQSB=0.965977;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,168:6:0	0,9,110:3:0
-X	1023	.	A	<*>	0	.	DP=19;I16=6,12,0,0,647,23997,0,0,1026,59810,0,0,338,7510,0,0;QS=3,0;MQSB=0.97296;MQ0F=0	PL:DP:DV	0,27,216:9:0	0,18,168:6:0	0,9,112:3:0
-X	1024	.	C	<*>	0	.	DP=20;I16=7,13,0,0,729,27471,0,0,1146,67010,0,0,364,8154,0,0;QS=3,0;MQSB=0.980568;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,169:6:0	0,9,106:3:0
-X	1025	.	T	<*>	0	.	DP=20;I16=7,13,0,0,757,29387,0,0,1146,67010,0,0,366,8192,0,0;QS=3,0;MQSB=0.980568;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,181:6:0	0,9,117:3:0
-X	1026	.	G	<*>	0	.	DP=20;I16=7,13,0,0,747,28435,0,0,1146,67010,0,0,367,8201,0,0;QS=3,0;MQSB=0.980568;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,169:6:0	0,9,113:3:0
-X	1027	.	C	<*>	0	.	DP=20;I16=7,13,0,0,720,26688,0,0,1146,67010,0,0,368,8232,0,0;QS=3,0;MQSB=0.980568;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,145:6:0	0,9,110:3:0
-X	1028	.	A	<*>	0	.	DP=19;I16=6,12,0,0,645,23681,0,0,1026,59810,0,0,348,7800,0,0;QS=3,0;MQSB=0.97296;MQ0F=0	PL:DP:DV	0,30,238:10:0	0,15,146:5:0	0,9,99:3:0
-X	1029	.	C	<*>	0	.	DP=19;I16=7,12,0,0,699,26817,0,0,1086,63410,0,0,371,8305,0,0;QS=3,0;MQSB=0.985816;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,138:5:0	0,9,111:3:0
-X	1030	.	T	<*>	0	.	DP=19;I16=7,12,0,0,749,29789,0,0,1086,63410,0,0,371,8293,0,0;QS=3,0;MQSB=0.985816;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,158:5:0	0,9,122:3:0
-X	1031	.	T	<*>	0	.	DP=21;I16=9,12,0,0,748,27726,0,0,1206,70610,0,0,371,8297,0,0;QS=3,0;MQSB=0.997478;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,144:5:0	0,9,113:3:0
-X	1032	.	T	<*>	0	.	DP=21;I16=9,12,0,0,761,28033,0,0,1206,70610,0,0,373,8319,0,0;QS=3,0;MQSB=0.997478;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,156:5:0	0,9,111:3:0
-X	1033	.	G	<*>	0	.	DP=22;I16=10,12,0,0,773,28227,0,0,1266,74210,0,0,375,8361,0,0;QS=3,0;MQSB=0.999457;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,169:6:0	0,9,101:3:0
-X	1034	.	G	<*>	0	.	DP=22;I16=8,12,0,0,703,25617,0,0,1169,69241,0,0,340,7684,0,0;QS=3,0;MQSB=0.953497;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,149:5:0	0,9,102:3:0
-X	1035	.	C	<*>	0	.	DP=21;I16=10,11,0,0,719,26103,0,0,1237,73369,0,0,382,8508,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,163:6:0	0,9,94:3:0
-X	1036	.	C	<*>	0	.	DP=22;I16=11,10,0,0,756,28390,0,0,1237,73369,0,0,360,7938,0,0;QS=3,0;MQSB=0.939898;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,175:6:0	0,12,135:4:0
-X	1037	.	T	<*>	0	.	DP=22;I16=11,11,0,0,839,32737,0,0,1297,76969,0,0,389,8641,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,188:6:0	0,12,138:4:0
-X	1038	.	G	<*>	0	.	DP=21;I16=10,10,0,0,752,28750,0,0,1177,69769,0,0,368,8066,0,0;QS=3,0;MQSB=0.931063;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,184:6:0	0,9,107:3:0
-X	1039	.	G	<*>	0	.	DP=21;I16=10,11,0,0,775,29373,0,0,1237,73369,0,0,397,8761,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,189:6:0	0,9,111:3:0
-X	1040	.	A	<*>	0	.	DP=21;I16=10,11,0,0,759,28007,0,0,1237,73369,0,0,401,8851,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,177:6:0	0,9,107:3:0
-X	1041	.	C	<*>	0	.	DP=21;I16=8,11,0,0,713,27117,0,0,1140,68400,0,0,371,8255,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,155:5:0	0,9,110:3:0
-X	1042	.	A	<*>	0	.	DP=23;I16=12,10,0,0,800,29464,0,0,1297,76969,0,0,384,8466,0,0;QS=3,0;MQSB=0.947103;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,185:6:0	0,15,145:5:0
-X	1043	.	A	<*>	0	.	DP=23;I16=12,11,0,0,850,32160,0,0,1357,80569,0,0,414,9192,0,0;QS=3,0;MQSB=0.944319;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,188:6:0	0,15,159:5:0
-X	1044	.	C	<*>	0	.	DP=23;I16=12,10,0,0,812,30758,0,0,1297,76969,0,0,394,8690,0,0;QS=3,0;MQSB=0.947103;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,181:6:0	0,15,150:5:0
-X	1045	.	A	<*>	0	.	DP=23;I16=12,11,0,0,887,34519,0,0,1357,80569,0,0,424,9460,0,0;QS=3,0;MQSB=0.944319;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,197:6:0	0,15,156:5:0
-X	1046	.	G	<*>	0	.	DP=23;I16=12,11,0,0,862,33240,0,0,1357,80569,0,0,428,9576,0,0;QS=3,0;MQSB=0.944319;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,183:6:0	0,15,158:5:0
-X	1047	.	A	<*>	0	.	DP=23;I16=12,11,0,0,890,34804,0,0,1357,80569,0,0,432,9712,0,0;QS=3,0;MQSB=0.944319;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,198:6:0	0,15,165:5:0
-X	1048	.	G	<*>	0	.	DP=23;I16=12,10,0,0,846,33054,0,0,1297,76969,0,0,411,9243,0,0;QS=3,0;MQSB=0.947103;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,195:6:0	0,15,156:5:0
-X	1049	.	C	<*>	0	.	DP=22;I16=12,10,0,0,808,30644,0,0,1297,76969,0,0,441,10043,0,0;QS=3,0;MQSB=0.947103;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,182:6:0	0,15,160:5:0
-X	1050	.	A	<*>	0	.	DP=22;I16=11,10,0,0,808,31334,0,0,1237,73369,0,0,430,9940,0,0;QS=3,0;MQSB=0.939898;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,193:6:0	0,12,138:4:0
-X	1051	.	A	<*>	0	.	DP=21;I16=11,9,0,0,731,27495,0,0,1177,69769,0,0,423,9621,0,0;QS=3,0;MQSB=0.943233;MQ0F=0	PL:DP:DV	0,27,238:9:0	0,18,187:6:0	0,15,150:5:0
-X	1052	.	A	<*>	0	.	DP=21;I16=11,9,0,0,759,29327,0,0,1177,69769,0,0,427,9747,0,0;QS=3,0;MQSB=0.943233;MQ0F=0	PL:DP:DV	0,27,247:9:0	0,18,190:6:0	0,15,150:5:0
-X	1053	.	A	<*>	0	.	DP=21;I16=11,8,0,0,674,25210,0,0,1117,66169,0,0,406,9264,0,0;QS=3,0;MQSB=0.946915;MQ0F=0	PL:DP:DV	0,24,224:8:0	0,18,161:6:0	0,15,149:5:0
-X	1054	.	C	<*>	0	.	DP=21;I16=11,10,0,0,791,30157,0,0,1237,73369,0,0,459,10623,0,0;QS=3,0;MQSB=0.939898;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,189:6:0	0,15,153:5:0
-X	1055	.	C	<*>	0	.	DP=22;I16=12,10,0,0,818,31448,0,0,1297,76969,0,0,462,10750,0,0;QS=3,0;MQSB=0.947103;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,191:6:0	0,15,157:5:0
-X	1056	.	C	<*>	0	.	DP=22;I16=12,9,0,0,793,31265,0,0,1237,73369,0,0,441,10271,0,0;QS=3,0;MQSB=0.950149;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,195:6:0	0,15,161:5:0
-X	1057	.	T	<*>	0	.	DP=23;I16=12,10,0,0,821,31667,0,0,1297,76969,0,0,467,10911,0,0;QS=3,0;MQSB=0.947103;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,196:6:0	0,15,159:5:0
-X	1058	.	G	<*>	0	.	DP=23;I16=12,11,0,0,863,32871,0,0,1357,80569,0,0,493,11569,0,0;QS=3,0;MQSB=0.944319;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,197:7:0	0,15,155:5:0
-X	1059	.	T	<*>	0	.	DP=23;I16=12,10,0,0,797,29803,0,0,1297,76969,0,0,468,10944,0,0;QS=3,0;MQSB=0.947103;MQ0F=0	PL:DP:DV	0,30,249:10:0	0,21,202:7:0	0,15,152:5:0
-X	1060	.	C	<*>	0	.	DP=23;I16=12,11,0,0,829,31041,0,0,1357,80569,0,0,492,11536,0,0;QS=3,0;MQSB=0.944319;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,178:7:0	0,15,163:5:0
-X	1061	.	T	<*>	0	.	DP=22;I16=12,9,0,0,810,31840,0,0,1237,73369,0,0,465,10797,0,0;QS=3,0;MQSB=0.950149;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,175:5:0	0,15,158:5:0
-X	1062	.	C	A,<*>	0	.	DP=22;I16=12,9,0,1,826,32780,33,1089,1237,73369,60,3600,462,10652,25,625;QS=2.85398,0.146018,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.947103;BQB=1;MQ0F=0	PL:DP:DV	0,33,255,33,255,255:11:0	15,0,151,30,154,176:6:1	0,15,164,15,164,164:5:0
-X	1063	.	T	<*>	0	.	DP=22;I16=12,9,0,0,820,32460,0,0,1237,73369,0,0,459,10525,0,0;QS=3,0;MQSB=0.950149;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,183:6:0	0,15,166:5:0
-X	1064	.	A	<*>	0	.	DP=23;I16=12,9,0,0,793,30355,0,0,1237,73369,0,0,464,10752,0,0;QS=3,0;MQSB=0.950149;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,180:6:0	0,15,162:5:0
-X	1065	.	A	<*>	0	.	DP=23;I16=12,9,0,0,814,31978,0,0,1237,73369,0,0,462,10694,0,0;QS=3,0;MQSB=0.950149;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,186:6:0	0,15,174:5:0
-X	1066	.	A	<*>	0	.	DP=27;I16=15,9,0,0,890,34378,0,0,1417,84169,0,0,460,10652,0,0;QS=3,0;MQSB=0.96464;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,198:7:0	0,18,181:6:0
-X	1067	.	A	<*>	0	.	DP=27;I16=15,10,0,0,913,35031,0,0,1477,87769,0,0,470,10600,0,0;QS=3,0;MQSB=0.962269;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,208:7:0	0,18,182:6:0
-X	1068	.	A	<*>	0	.	DP=27;I16=15,9,0,0,898,34580,0,0,1417,84169,0,0,456,10342,0,0;QS=3,0;MQSB=0.96464;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,24,218:8:0	0,18,181:6:0
-X	1069	.	A	<*>	0	.	DP=28;I16=16,10,0,0,914,33888,0,0,1537,91369,0,0,481,10925,0,0;QS=3,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,207:8:0	0,21,177:7:0
-X	1070	.	A	<*>	0	.	DP=28;I16=15,11,0,0,955,36445,0,0,1537,91369,0,0,467,10351,0,0;QS=3,0;MQSB=0.960078;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,223:8:0	0,21,188:7:0
-X	1071	.	G	<*>	0	.	DP=28;I16=16,10,0,0,974,37570,0,0,1537,91369,0,0,466,10284,0,0;QS=3,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,192:7:0	0,21,191:7:0
-X	1072	.	A	<*>	0	.	DP=28;I16=16,11,0,0,1007,38205,0,0,1597,94969,0,0,490,10868,0,0;QS=3,0;MQSB=0.96384;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,239:8:0	0,21,195:7:0
-X	1073	.	A	<*>	0	.	DP=28;I16=16,10,0,0,976,37822,0,0,1537,91369,0,0,463,10177,0,0;QS=3,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,33,254:11:0	0,24,236:8:0	0,21,199:7:0
-X	1074	.	A	<*>	0	.	DP=28;I16=16,11,0,0,1003,38097,0,0,1597,94969,0,0,484,10664,0,0;QS=3,0;MQSB=0.96384;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,232:8:0	0,21,203:7:0
-X	1075	.	A	<*>	0	.	DP=28;I16=16,10,0,0,964,36762,0,0,1537,91369,0,0,476,10564,0,0;QS=3,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,222:8:0	0,21,200:7:0
-X	1076	.	G	<*>	0	.	DP=28;I16=16,10,0,0,966,37048,0,0,1537,91369,0,0,476,10536,0,0;QS=3,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,209:8:0	0,21,183:7:0
-X	1077	.	A	<*>	0	.	DP=29;I16=17,11,0,0,1038,39240,0,0,1657,98569,0,0,480,10548,0,0;QS=3,0;MQSB=0.967085;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,231:8:0	0,24,209:8:0
-X	1078	.	A	<*>	0	.	DP=29;I16=17,11,0,0,1053,40425,0,0,1657,98569,0,0,480,10562,0,0;QS=3,0;MQSB=0.967085;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,234:8:0	0,24,214:8:0
-X	1079	.	A	<*>	0	.	DP=28;I16=17,10,0,0,1019,39007,0,0,1597,94969,0,0,479,10505,0,0;QS=3,0;MQSB=0.968979;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,223:8:0	0,24,206:8:0
-X	1080	.	A	<*>	0	.	DP=29;I16=18,10,0,0,1049,40827,0,0,1657,98569,0,0,478,10478,0,0;QS=3,0;MQSB=0.971673;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,246:9:0	0,24,218:8:0
-X	1081	.	G	<*>	0	.	DP=30;I16=19,8,0,0,988,37392,0,0,1597,94969,0,0,436,9550,0,0;QS=3,0;MQSB=0.977696;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,24,210:8:0	0,27,210:9:0
-X	1082	.	A	<*>	0	.	DP=30;I16=20,7,0,0,989,37109,0,0,1597,94969,0,0,438,9564,0,0;QS=3,0;MQSB=0.981425;MQ0F=0	PL:DP:DV	0,27,224:9:0	0,27,226:9:0	0,27,217:9:0
-X	1083	.	A	<*>	0	.	DP=30;I16=20,8,0,0,1039,39827,0,0,1657,98569,0,0,455,9803,0,0;QS=3,0;MQSB=0.979523;MQ0F=0	PL:DP:DV	0,30,246:10:0	0,27,233:9:0	0,27,217:9:0
-X	1084	.	A	<*>	0	.	DP=31;I16=21,8,0,0,1049,39097,0,0,1717,102169,0,0,457,9849,0,0;QS=3,0;MQSB=0.981133;MQ0F=0	PL:DP:DV	0,33,253:11:0	0,27,226:9:0	0,27,215:9:0
-X	1085	.	A	<*>	0	.	DP=30;I16=21,8,0,0,1052,39534,0,0,1717,102169,0,0,486,10552,0,0;QS=3,0;MQSB=0.981133;MQ0F=0	PL:DP:DV	0,30,232:10:0	0,30,247:10:0	0,27,214:9:0
-X	1086	.	A	<*>	0	.	DP=28;I16=21,6,0,0,969,36223,0,0,1597,94969,0,0,492,10660,0,0;QS=3,0;MQSB=0.98481;MQ0F=0	PL:DP:DV	0,30,219:10:0	0,27,236:9:0	0,24,179:8:0
-X	1087	.	C	<*>	0	.	DP=28;I16=22,6,0,0,984,36046,0,0,1657,98569,0,0,498,10796,0,0;QS=3,0;MQSB=0.985992;MQ0F=0	PL:DP:DV	0,30,234:10:0	0,27,229:9:0	0,27,173:9:0
-X	1088	.	T	<*>	0	.	DP=29;I16=23,6,0,0,1133,45203,0,0,1717,102169,0,0,503,10863,0,0;QS=3,0;MQSB=0.987041;MQ0F=0	PL:DP:DV	0,30,252:10:0	0,30,250:10:0	0,27,198:9:0
-X	1089	.	C	<*>	0	.	DP=29;I16=23,6,0,0,1093,42347,0,0,1717,102169,0,0,509,10965,0,0;QS=3,0;MQSB=0.987041;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,30,237:10:0	0,27,188:9:0
-X	1090	.	A	<*>	0	.	DP=29;I16=23,6,0,0,1061,39845,0,0,1717,102169,0,0,515,11103,0,0;QS=3,0;MQSB=0.987041;MQ0F=0	PL:DP:DV	0,30,221:10:0	0,30,250:10:0	0,27,183:9:0
-X	1091	.	C	<*>	0	.	DP=29;I16=23,6,0,0,1063,39713,0,0,1717,102169,0,0,521,11277,0,0;QS=3,0;MQSB=0.987041;MQ0F=0	PL:DP:DV	0,30,247:10:0	0,30,244:10:0	0,27,177:9:0
-X	1092	.	T	<*>	0	.	DP=29;I16=23,6,0,0,1121,44489,0,0,1717,102169,0,0,524,11334,0,0;QS=3,0;MQSB=0.987041;MQ0F=0	PL:DP:DV	0,30,244:10:0	0,30,251:10:0	0,27,198:9:0
-X	1093	.	G	<*>	0	.	DP=29;I16=23,6,0,0,1085,41377,0,0,1717,102169,0,0,526,11372,0,0;QS=3,0;MQSB=0.987041;MQ0F=0	PL:DP:DV	0,30,249:10:0	0,30,243:10:0	0,27,184:9:0
-X	1094	.	G	<*>	0	.	DP=29;I16=22,6,0,0,1018,38808,0,0,1657,98569,0,0,521,11393,0,0;QS=3,0;MQSB=0.985992;MQ0F=0	PL:DP:DV	0,30,243:10:0	0,30,232:10:0	0,24,185:8:0
-X	1095	.	A	<*>	0	.	DP=28;I16=22,6,0,0,1023,38551,0,0,1657,98569,0,0,529,11443,0,0;QS=3,0;MQSB=0.985992;MQ0F=0	PL:DP:DV	0,30,236:10:0	0,30,244:10:0	0,24,178:8:0
-X	1096	.	T	<*>	0	.	DP=30;I16=24,5,0,0,1020,37168,0,0,1717,102169,0,0,505,10849,0,0;QS=3,0;MQSB=0.989637;MQ0F=0	PL:DP:DV	0,33,234:11:0	0,27,220:9:0	0,27,178:9:0
-X	1097	.	A	<*>	0	.	DP=30;I16=24,6,0,0,1056,38166,0,0,1777,105769,0,0,533,11537,0,0;QS=3,0;MQSB=0.987976;MQ0F=0	PL:DP:DV	0,33,230:11:0	0,30,237:10:0	0,27,177:9:0
-X	1098	.	T	<*>	0	.	DP=29;I16=24,5,0,0,1081,40557,0,0,1717,102169,0,0,537,11633,0,0;QS=3,0;MQSB=0.989637;MQ0F=0	PL:DP:DV	0,30,210:10:0	0,30,251:10:0	0,27,186:9:0
-X	1099	.	G	<*>	0	.	DP=29;I16=24,5,0,0,1091,41719,0,0,1717,102169,0,0,540,11712,0,0;QS=3,0;MQSB=0.989637;MQ0F=0	PL:DP:DV	0,30,229:10:0	0,30,242:10:0	0,27,182:9:0
-X	1100	.	A	<*>	0	.	DP=29;I16=24,5,0,0,1106,42976,0,0,1717,102169,0,0,543,11825,0,0;QS=3,0;MQSB=0.989637;MQ0F=0	PL:DP:DV	0,30,210:10:0	0,30,255:10:0	0,27,191:9:0
-X	1101	.	A	<*>	0	.	DP=29;I16=24,5,0,0,1154,46420,0,0,1717,102169,0,0,545,11921,0,0;QS=3,0;MQSB=0.989637;MQ0F=0	PL:DP:DV	0,30,222:10:0	0,30,255:10:0	0,27,198:9:0
-X	1102	.	T	<*>	0	.	DP=29;I16=24,4,0,0,1046,39520,0,0,1657,98569,0,0,522,11424,0,0;QS=3,0;MQSB=0.991416;MQ0F=0	PL:DP:DV	0,30,210:10:0	0,27,233:9:0	0,27,186:9:0
-X	1103	.	G	<*>	0	.	DP=30;I16=24,6,0,0,1134,43486,0,0,1777,105769,0,0,548,12158,0,0;QS=3,0;MQSB=0.987976;MQ0F=0	PL:DP:DV	0,30,223:10:0	0,30,255:10:0	0,30,222:10:0
-X	1104	.	A	<*>	0	.	DP=28;I16=23,5,0,0,1089,43067,0,0,1657,98569,0,0,552,12296,0,0;QS=3,0;MQSB=0.988819;MQ0F=0	PL:DP:DV	0,27,213:9:0	0,27,233:9:0	0,30,233:10:0
-X	1105	.	T	<*>	0	.	DP=28;I16=23,5,0,0,1035,38743,0,0,1657,98569,0,0,556,12462,0,0;QS=3,0;MQSB=0.988819;MQ0F=0	PL:DP:DV	0,27,203:9:0	0,27,227:9:0	0,30,222:10:0
-X	1106	.	A	<*>	0	.	DP=29;I16=23,5,0,0,1003,36715,0,0,1657,98569,0,0,532,11882,0,0;QS=3,0;MQSB=0.988819;MQ0F=0	PL:DP:DV	0,30,227:10:0	0,24,198:8:0	0,30,217:10:0
-X	1107	.	C	<*>	0	.	DP=29;I16=23,6,0,0,1093,41509,0,0,1717,102169,0,0,558,12532,0,0;QS=3,0;MQSB=0.987041;MQ0F=0	PL:DP:DV	0,30,244:10:0	0,27,233:9:0	0,30,220:10:0
-X	1108	.	A	<*>	0	.	DP=29;I16=23,6,0,0,1138,44908,0,0,1717,102169,0,0,558,12536,0,0;QS=3,0;MQSB=0.987041;MQ0F=0	PL:DP:DV	0,30,239:10:0	0,27,253:9:0	0,30,227:10:0
-X	1109	.	G	<*>	0	.	DP=29;I16=23,6,0,0,1140,45200,0,0,1717,102169,0,0,557,12519,0,0;QS=3,0;MQSB=0.987041;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,27,240:9:0	0,30,224:10:0
-X	1110	.	G	<*>	0	.	DP=29;I16=23,6,0,0,1086,41054,0,0,1717,102169,0,0,555,12481,0,0;QS=3,0;MQSB=0.987041;MQ0F=0	PL:DP:DV	0,30,242:10:0	0,27,229:9:0	0,30,224:10:0
-X	1111	.	T	<*>	0	.	DP=29;I16=22,6,0,0,1025,37919,0,0,1680,100800,0,0,552,12470,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,227:10:0	0,24,227:8:0	0,30,211:10:0
-X	1112	.	T	<*>	0	.	DP=28;I16=22,6,0,0,1034,38986,0,0,1680,100800,0,0,550,12440,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,226:10:0	0,24,221:8:0	0,30,221:10:0
-X	1113	.	G	<*>	0	.	DP=28;I16=23,5,0,0,1085,42273,0,0,1680,100800,0,0,548,12386,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,202:7:0	0,33,222:11:0
-X	1114	.	A	<*>	0	.	DP=28;I16=23,5,0,0,1079,42279,0,0,1680,100800,0,0,546,12306,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,235:10:0	0,21,209:7:0	0,33,238:11:0
-X	1115	.	G	<*>	0	.	DP=28;I16=23,5,0,0,1114,44550,0,0,1680,100800,0,0,544,12250,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,208:7:0	0,33,234:11:0
-X	1116	.	G	<*>	0	.	DP=29;I16=24,5,0,0,1059,39531,0,0,1740,104400,0,0,542,12218,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,236:10:0	0,24,204:8:0	0,33,226:11:0
-X	1117	.	A	<*>	0	.	DP=29;I16=24,5,0,0,1124,43896,0,0,1740,104400,0,0,541,12211,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,235:10:0	0,24,227:8:0	0,33,234:11:0
-X	1118	.	T	<*>	0	.	DP=29;I16=24,4,0,0,1100,44802,0,0,1680,100800,0,0,539,12131,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,230:10:0	0,21,188:7:0	0,33,248:11:0
-X	1119	.	C	<*>	0	.	DP=29;I16=23,4,0,0,1078,44864,0,0,1620,97200,0,0,526,11958,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,224:9:0	0,21,191:7:0	0,33,255:11:0
-X	1120	.	C	<*>	0	.	DP=29;I16=23,5,0,0,1113,46071,0,0,1680,100800,0,0,536,12054,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,227:9:0	0,24,214:8:0	0,33,255:11:0
-X	1121	.	A	<*>	0	.	DP=30;I16=24,5,0,0,1167,48549,0,0,1740,104400,0,0,536,12056,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,233:9:0	0,24,220:8:0	0,36,255:12:0
-X	1122	.	T	<*>	0	.	DP=32;I16=26,5,0,0,1235,50967,0,0,1860,111600,0,0,535,11985,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,230:10:0	0,27,238:9:0	0,36,255:12:0
-X	1123	.	T	<*>	0	.	DP=32;I16=26,5,0,0,1219,50121,0,0,1860,111600,0,0,535,11893,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,221:10:0	0,27,236:9:0	0,36,255:12:0
-X	1124	.	A	<*>	0	.	DP=31;I16=25,5,0,0,1187,48827,0,0,1800,108000,0,0,536,11832,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,218:9:0	0,27,235:9:0	0,36,255:12:0
-X	1125	.	T	<*>	0	.	DP=31;I16=25,5,0,0,1211,51001,0,0,1800,108000,0,0,537,11801,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,228:9:0	0,27,235:9:0	0,36,255:12:0
-X	1126	.	C	<*>	0	.	DP=31;I16=25,5,0,0,1225,52001,0,0,1800,108000,0,0,538,11800,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,234:9:0	0,27,241:9:0	0,36,255:12:0
-X	1127	.	T	<*>	0	.	DP=31;I16=25,5,0,0,1257,55245,0,0,1800,108000,0,0,539,11829,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,231:9:0	0,27,252:9:0	0,36,255:12:0
-X	1128	.	G	<*>	0	.	DP=31;I16=25,5,0,0,1217,51743,0,0,1800,108000,0,0,540,11888,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,236:9:0	0,27,229:9:0	0,36,255:12:0
-X	1129	.	A	G,<*>	0	.	DP=31;I16=24,4,0,1,1101,45631,32,1024,1680,100800,60,3600,514,11300,25,625;QS=2.93535,0.0646465,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=1;BQB=1;MQ0F=0	PL:DP:DV	0,24,204,24,204,204:8:0	0,27,229,27,229,229:9:0	0,4,198,33,201,219:12:1
-X	1130	.	A	<*>	0	.	DP=31;I16=25,5,0,0,1189,49509,0,0,1800,108000,0,0,539,11943,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,215:9:0	0,27,236:9:0	0,36,255:12:0
-X	1131	.	A	<*>	0	.	DP=29;I16=23,5,0,0,1156,49362,0,0,1680,100800,0,0,540,11988,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,206:7:0	0,27,250:9:0	0,36,255:12:0
-X	1132	.	T	<*>	0	.	DP=29;I16=23,5,0,0,1123,47359,0,0,1680,100800,0,0,540,12008,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,198:7:0	0,27,229:9:0	0,36,255:12:0
-X	1133	.	G	<*>	0	.	DP=30;I16=23,5,0,0,1148,48796,0,0,1680,100800,0,0,540,12052,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,214:7:0	0,27,232:9:0	0,36,255:12:0
-X	1134	.	C	<*>	0	.	DP=29;I16=22,6,0,0,1162,50224,0,0,1680,100800,0,0,547,12155,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,209:7:0	0,27,254:9:0	0,36,255:12:0
-X	1135	.	T	<*>	0	.	DP=29;I16=22,6,0,0,1214,55020,0,0,1680,100800,0,0,549,12257,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,209:7:0	0,27,255:9:0	0,36,255:12:0
-X	1136	.	T	<*>	0	.	DP=29;I16=22,6,0,0,1148,49270,0,0,1680,100800,0,0,551,12383,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,200:7:0	0,27,255:9:0	0,36,255:12:0
-X	1137	.	G	<*>	0	.	DP=28;I16=21,6,0,0,1087,46051,0,0,1620,97200,0,0,554,12532,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,214:7:0	0,27,234:9:0	0,33,254:11:0
-X	1138	.	G	<*>	0	.	DP=28;I16=21,6,0,0,1040,42504,0,0,1620,97200,0,0,557,12703,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,197:7:0	0,27,234:9:0	0,33,246:11:0
-X	1139	.	A	<*>	0	.	DP=28;I16=21,6,0,0,1103,47389,0,0,1620,97200,0,0,559,12845,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,200:7:0	0,27,254:9:0	0,33,255:11:0
-X	1140	.	C	<*>	0	.	DP=28;I16=21,6,0,0,1072,44372,0,0,1620,97200,0,0,561,13007,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,214:7:0	0,27,234:9:0	0,33,250:11:0
-X	1141	.	C	<*>	0	.	DP=28;I16=21,6,0,0,1106,47298,0,0,1620,97200,0,0,562,13140,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,212:7:0	0,27,245:9:0	0,33,255:11:0
-X	1142	.	A	<*>	0	.	DP=28;I16=21,6,0,0,1114,47788,0,0,1620,97200,0,0,560,13146,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,212:7:0	0,27,255:9:0	0,33,251:11:0
-X	1143	.	G	<*>	0	.	DP=26;I16=19,7,0,0,1041,42249,0,0,1560,93600,0,0,585,13799,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,222:7:0	0,27,249:9:0	0,30,253:10:0
-X	1144	.	A	<*>	0	.	DP=26;I16=19,7,0,0,1018,40154,0,0,1560,93600,0,0,585,13847,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,205:7:0	0,27,250:9:0	0,30,255:10:0
-X	1145	.	T	<*>	0	.	DP=26;I16=19,7,0,0,1016,39852,0,0,1560,93600,0,0,584,13866,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,206:7:0	0,27,250:9:0	0,30,249:10:0
-X	1146	.	G	<*>	0	.	DP=26;I16=19,7,0,0,1011,39743,0,0,1560,93600,0,0,582,13856,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,210:7:0	0,27,246:9:0	0,30,254:10:0
-X	1147	.	T	<*>	0	.	DP=27;I16=20,6,0,0,1010,39730,0,0,1560,93600,0,0,579,13815,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,207:8:0	0,24,234:8:0	0,30,255:10:0
-X	1148	.	T	<*>	0	.	DP=26;I16=20,6,0,0,1002,39214,0,0,1560,93600,0,0,576,13690,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,196:8:0	0,24,237:8:0	0,30,255:10:0
-X	1149	.	T	<*>	0	.	DP=26;I16=20,6,0,0,1022,40532,0,0,1560,93600,0,0,573,13579,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,205:8:0	0,24,231:8:0	0,30,255:10:0
-X	1150	.	T	<*>	0	.	DP=26;I16=20,6,0,0,1032,41212,0,0,1560,93600,0,0,569,13433,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,208:8:0	0,24,236:8:0	0,30,255:10:0
-X	1151	.	G	<*>	0	.	DP=26;I16=20,6,0,0,1021,40285,0,0,1560,93600,0,0,565,13303,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,220:8:0	0,24,231:8:0	0,30,248:10:0
-X	1152	.	A	<*>	0	.	DP=27;I16=20,7,0,0,1040,40772,0,0,1620,97200,0,0,561,13189,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,202:8:0	0,24,230:8:0	0,33,255:11:0
-X	1153	.	A	<*>	0	.	DP=27;I16=20,7,0,0,1039,40717,0,0,1620,97200,0,0,557,13043,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,202:8:0	0,24,233:8:0	0,33,255:11:0
-X	1154	.	T	<*>	0	.	DP=28;I16=21,7,0,0,1073,41861,0,0,1680,100800,0,0,552,12866,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,212:9:0	0,24,236:8:0	0,33,255:11:0
-X	1155	.	T	<*>	0	.	DP=27;I16=20,7,0,0,1074,43046,0,0,1620,97200,0,0,549,12707,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,211:8:0	0,24,236:8:0	0,33,255:11:0
-X	1156	.	T	<*>	0	.	DP=28;I16=19,8,0,0,1065,42533,0,0,1620,97200,0,0,520,11892,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,210:8:0	0,24,239:8:0	0,33,255:11:0
-X	1157	.	T	<*>	0	.	DP=28;I16=20,8,0,0,1094,43108,0,0,1680,100800,0,0,541,12299,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,230:9:0	0,24,230:8:0	0,33,255:11:0
-X	1158	.	G	<*>	0	.	DP=28;I16=20,8,0,0,1098,43584,0,0,1680,100800,0,0,536,12056,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,240:9:0	0,24,224:8:0	0,33,255:11:0
-X	1159	.	G	<*>	0	.	DP=28;I16=20,8,0,0,1096,43222,0,0,1680,100800,0,0,530,11790,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,249:9:0	0,24,229:8:0	0,33,255:11:0
-X	1160	.	A	<*>	0	.	DP=30;I16=20,10,0,0,1146,44510,0,0,1800,108000,0,0,524,11552,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,229:9:0	0,24,242:8:0	0,39,255:13:0
-X	1161	.	T	<*>	0	.	DP=30;I16=20,10,0,0,1136,43548,0,0,1800,108000,0,0,520,11344,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,221:9:0	0,24,230:8:0	0,39,255:13:0
-X	1162	.	T	<*>	0	.	DP=30;I16=20,10,0,0,1147,44365,0,0,1800,108000,0,0,516,11168,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,232:9:0	0,24,229:8:0	0,39,255:13:0
-X	1163	.	T	<*>	0	.	DP=31;I16=20,11,0,0,1176,45394,0,0,1860,111600,0,0,511,10975,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,243:10:0	0,24,231:8:0	0,39,255:13:0
-X	1164	.	T	<*>	0	.	DP=31;I16=20,11,0,0,1166,44864,0,0,1860,111600,0,0,506,10768,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,235:10:0	0,24,234:8:0	0,39,255:13:0
-X	1165	.	T	<*>	0	.	DP=31;I16=20,11,0,0,1189,46635,0,0,1860,111600,0,0,501,10599,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,240:10:0	0,24,231:8:0	0,39,255:13:0
-X	1166	.	T	<*>	0	.	DP=30;I16=19,11,0,0,1137,43791,0,0,1800,108000,0,0,497,10467,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,231:9:0	0,24,228:8:0	0,39,255:13:0
-X	1167	.	C	<*>	0	.	DP=28;I16=17,11,0,0,1114,44588,0,0,1680,100800,0,0,495,10369,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,21,216:7:0	0,36,255:12:0
-X	1168	.	A	<*>	0	.	DP=28;I16=17,11,0,0,1074,41862,0,0,1680,100800,0,0,493,10303,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,238:9:0	0,21,203:7:0	0,36,255:12:0
-X	1169	.	T	<*>	0	.	DP=28;I16=17,11,0,0,1089,42589,0,0,1680,100800,0,0,491,10269,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,247:9:0	0,21,212:7:0	0,36,255:12:0
-X	1170	.	A	<*>	0	.	DP=27;I16=16,11,0,0,1033,39891,0,0,1620,97200,0,0,490,10266,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,244:9:0	0,21,214:7:0	0,33,255:11:0
-X	1171	.	T	<*>	0	.	DP=28;I16=17,11,0,0,1086,42472,0,0,1680,100800,0,0,488,10244,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,249:9:0	0,24,223:8:0	0,33,255:11:0
-X	1172	.	T	<*>	0	.	DP=28;I16=17,11,0,0,1086,42598,0,0,1680,100800,0,0,486,10206,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,235:9:0	0,24,228:8:0	0,33,255:11:0
-X	1173	.	T	<*>	0	.	DP=29;I16=18,11,0,0,1126,44348,0,0,1740,104400,0,0,483,10153,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,241:9:0	0,27,241:9:0	0,33,255:11:0
-X	1174	.	T	<*>	0	.	DP=29;I16=18,11,0,0,1098,42352,0,0,1740,104400,0,0,481,10135,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,230:9:0	0,27,238:9:0	0,33,255:11:0
-X	1175	.	G	<*>	0	.	DP=28;I16=18,10,0,0,1063,40975,0,0,1680,100800,0,0,480,10152,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,234:8:0	0,27,234:9:0	0,33,255:11:0
-X	1176	.	T	<*>	0	.	DP=28;I16=18,10,0,0,1045,39823,0,0,1680,100800,0,0,479,10203,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,221:8:0	0,27,233:9:0	0,33,255:11:0
-X	1177	.	A	<*>	0	.	DP=28;I16=18,10,0,0,1040,39006,0,0,1680,100800,0,0,478,10288,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,220:8:0	0,27,228:9:0	0,33,255:11:0
-X	1178	.	A	<*>	0	.	DP=27;I16=17,10,0,0,1006,38238,0,0,1620,97200,0,0,477,10355,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,221:8:0	0,27,227:9:0	0,30,255:10:0
-X	1179	.	T	<*>	0	.	DP=27;I16=17,10,0,0,1012,38396,0,0,1620,97200,0,0,475,10403,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,223:8:0	0,27,224:9:0	0,30,255:10:0
-X	1180	.	C	<*>	0	.	DP=27;I16=16,10,0,0,1006,39508,0,0,1560,93600,0,0,469,10423,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,222:7:0	0,27,224:9:0	0,30,255:10:0
-X	1181	.	T	<*>	0	.	DP=26;I16=16,10,0,0,1021,40581,0,0,1560,93600,0,0,469,10441,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,236:8:0	0,24,229:8:0	0,30,255:10:0
-X	1182	.	T	<*>	0	.	DP=26;I16=14,11,0,0,939,35915,0,0,1500,90000,0,0,457,10347,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,236:9:0	0,21,209:7:0	0,27,255:9:0
-X	1183	.	T	<*>	0	.	DP=25;I16=13,11,0,0,899,34555,0,0,1440,86400,0,0,455,10341,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,239:9:0	0,18,192:6:0	0,27,255:9:0
-X	1184	.	G	<*>	0	.	DP=24;I16=13,11,0,0,916,35398,0,0,1440,86400,0,0,465,10479,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,234:8:0	0,21,201:7:0	0,27,255:9:0
-X	1185	.	C	<*>	0	.	DP=24;I16=13,11,0,0,908,35014,0,0,1440,86400,0,0,465,10541,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,246:8:0	0,21,191:7:0	0,27,250:9:0
-X	1186	.	A	<*>	0	.	DP=24;I16=13,11,0,0,946,37648,0,0,1440,86400,0,0,463,10525,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,240:8:0	0,21,205:7:0	0,27,255:9:0
-X	1187	.	G	<*>	0	.	DP=25;I16=14,11,0,0,908,33870,0,0,1500,90000,0,0,461,10529,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,240:9:0	0,21,205:7:0	0,27,240:9:0
-X	1188	.	T	<*>	0	.	DP=25;I16=14,11,0,0,886,32138,0,0,1500,90000,0,0,461,10553,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,248:10:0	0,21,196:7:0	0,24,216:8:0
-X	1189	.	A	<*>	0	.	DP=25;I16=14,11,0,0,920,34392,0,0,1500,90000,0,0,461,10497,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,174:6:0	0,27,252:9:0
-X	1190	.	T	<*>	0	.	DP=26;I16=14,12,0,0,960,35876,0,0,1560,93600,0,0,462,10462,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,185:6:0	0,27,252:9:0
-X	1191	.	A	<*>	0	.	DP=26;I16=14,12,0,0,928,33922,0,0,1560,93600,0,0,464,10450,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,173:6:0	0,27,245:9:0
-X	1192	.	T	<*>	0	.	DP=26;I16=14,12,0,0,981,37505,0,0,1560,93600,0,0,465,10413,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,191:6:0	0,27,255:9:0
-X	1193	.	T	<*>	0	.	DP=26;I16=14,12,0,0,976,37054,0,0,1560,93600,0,0,466,10402,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,191:6:0	0,27,255:9:0
-X	1194	.	T	<*>	0	.	DP=26;I16=14,12,0,0,951,35219,0,0,1560,93600,0,0,466,10368,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,178:6:0	0,27,249:9:0
-X	1195	.	A	<*>	0	.	DP=26;I16=14,12,0,0,917,33253,0,0,1560,93600,0,0,466,10362,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,177:6:0	0,27,235:9:0
-X	1196	.	C	<*>	0	.	DP=25;I16=13,12,0,0,921,34209,0,0,1500,90000,0,0,466,10334,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,187:6:0	0,27,236:9:0
-X	1197	.	C	<*>	0	.	DP=24;I16=12,12,0,0,906,34862,0,0,1440,86400,0,0,464,10184,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,186:6:0	0,24,233:8:0
-X	1198	.	A	<*>	0	.	DP=24;I16=12,12,0,0,937,36815,0,0,1440,86400,0,0,461,10013,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,190:6:0	0,24,245:8:0
-X	1199	.	G	<*>	0	.	DP=24;I16=12,12,0,0,879,33035,0,0,1440,86400,0,0,457,9821,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,163:6:0	0,24,221:8:0
-X	1200	.	T	<*>	0	.	DP=24;I16=11,12,0,0,895,35141,0,0,1380,82800,0,0,428,9032,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,176:5:0	0,24,247:8:0
-X	1201	.	T	<*>	0	.	DP=24;I16=12,12,0,0,889,33727,0,0,1440,86400,0,0,449,9521,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,177:6:0	0,24,238:8:0
-X	1202	.	C	<*>	0	.	DP=25;I16=13,12,0,0,929,35121,0,0,1500,90000,0,0,445,9413,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,175:6:0	0,24,230:8:0
-X	1203	.	A	<*>	0	.	DP=25;I16=13,12,0,0,943,36107,0,0,1500,90000,0,0,442,9334,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,184:6:0	0,24,241:8:0
-X	1204	.	G	<*>	0	.	DP=24;I16=13,11,0,0,876,33106,0,0,1440,86400,0,0,439,9235,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,174:6:0	0,21,218:7:0
-X	1205	.	C	<*>	0	.	DP=24;I16=13,11,0,0,891,33869,0,0,1440,86400,0,0,436,9166,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,176:6:0	0,21,217:7:0
-X	1206	.	A	<*>	0	.	DP=23;I16=13,10,0,0,846,31744,0,0,1380,82800,0,0,434,9126,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,179:6:0	0,21,212:7:0
-X	1207	.	T	<*>	0	.	DP=23;I16=13,9,0,0,819,30877,0,0,1320,79200,0,0,407,8489,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,254:10:0	0,18,189:6:0	0,18,194:6:0
-X	1208	.	C	<*>	0	.	DP=24;I16=14,10,0,0,910,35236,0,0,1440,86400,0,0,429,9079,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,190:7:0	0,21,217:7:0
-X	1209	.	C	T,<*>	0	.	DP=24;I16=14,9,0,1,869,33481,21,441,1380,82800,60,3600,408,8710,19,361;QS=2.91393,0.0860656,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=1;BQB=1;MQ0F=0	PL:DP:DV	0,30,255,30,255,255:10:0	0,0,153,18,156,166:7:1	0,21,209,21,209,209:7:0
-X	1210	.	C	<*>	0	.	DP=24;I16=14,10,0,0,915,35713,0,0,1440,86400,0,0,425,9091,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,199:7:0	0,21,209:7:0
-X	1211	.	T	<*>	0	.	DP=24;I16=14,10,0,0,905,34669,0,0,1440,86400,0,0,423,9139,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,213:7:0	0,21,214:7:0
-X	1212	.	A	<*>	0	.	DP=24;I16=14,10,0,0,850,30690,0,0,1440,86400,0,0,421,9215,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,246:10:0	0,21,190:7:0	0,21,204:7:0
-X	1213	.	A	<*>	0	.	DP=24;I16=14,10,0,0,852,31192,0,0,1440,86400,0,0,418,9268,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,21,197:7:0	0,21,195:7:0
-X	1214	.	C	<*>	0	.	DP=23;I16=13,10,0,0,851,32099,0,0,1380,82800,0,0,415,9295,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,186:7:0	0,18,184:6:0
-X	1215	.	T	<*>	0	.	DP=23;I16=13,9,0,0,839,32475,0,0,1320,79200,0,0,386,8668,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,211:7:0	0,15,172:5:0
-X	1216	.	C	<*>	0	.	DP=23;I16=13,10,0,0,863,32923,0,0,1380,82800,0,0,406,9260,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,196:7:0	0,18,172:6:0
-X	1217	.	A	<*>	0	.	DP=22;I16=12,10,0,0,820,30926,0,0,1320,79200,0,0,402,9244,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,172:6:0	0,18,191:6:0
-X	1218	.	A	<*>	0	.	DP=22;I16=12,10,0,0,764,27286,0,0,1320,79200,0,0,398,9244,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,145:6:0	0,18,184:6:0
-X	1219	.	A	<*>	0	.	DP=21;I16=12,9,0,0,803,31119,0,0,1260,75600,0,0,395,9259,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,175:6:0	0,15,173:5:0
-X	1220	.	A	<*>	0	.	DP=21;I16=12,9,0,0,752,27700,0,0,1260,75600,0,0,392,9288,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,18,167:6:0	0,15,167:5:0
-X	1221	.	A	<*>	0	.	DP=20;I16=12,8,0,0,722,26564,0,0,1200,72000,0,0,390,9330,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,147:5:0	0,15,157:5:0
-X	1222	.	T	<*>	0	.	DP=18;I16=10,8,0,0,666,25034,0,0,1080,64800,0,0,389,9333,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,245:9:0	0,15,143:5:0	0,12,142:4:0
-X	1223	.	T	<*>	0	.	DP=17;I16=9,7,0,0,574,21262,0,0,960,57600,0,0,364,8720,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,232:9:0	0,12,122:4:0	0,9,120:3:0
-X	1224	.	C	<*>	0	.	DP=19;I16=10,7,0,0,639,24429,0,0,1020,61200,0,0,364,8740,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,128:4:0	0,9,112:3:0
-X	1225	.	A	<*>	0	.	DP=19;I16=10,9,0,0,713,27139,0,0,1109,65641,0,0,395,9419,0,0;QS=3,0;MQSB=0.920044;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,137:5:0	0,12,145:4:0
-X	1226	.	A	<*>	0	.	DP=19;I16=10,9,0,0,688,25468,0,0,1109,65641,0,0,397,9469,0,0;QS=3,0;MQSB=0.920044;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,127:5:0	0,12,147:4:0
-X	1227	.	A	<*>	0	.	DP=19;I16=10,9,0,0,698,26104,0,0,1109,65641,0,0,399,9531,0,0;QS=3,0;MQSB=0.920044;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,133:5:0	0,12,146:4:0
-X	1228	.	A	<*>	0	.	DP=19;I16=10,9,0,0,705,26721,0,0,1109,65641,0,0,399,9505,0,0;QS=3,0;MQSB=0.920044;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,143:5:0	0,12,145:4:0
-X	1229	.	A	<*>	0	.	DP=18;I16=10,8,0,0,693,26891,0,0,1049,62041,0,0,400,9490,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,123:4:0	0,12,138:4:0
-X	1230	.	T	<*>	0	.	DP=18;I16=10,8,0,0,643,23601,0,0,1049,62041,0,0,401,9485,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,30,245:10:0	0,12,115:4:0	0,12,144:4:0
-X	1231	.	C	<*>	0	.	DP=18;I16=10,7,0,0,663,26041,0,0,1020,61200,0,0,390,9320,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,98:3:0	0,12,138:4:0
-X	1232	.	T	<*>	0	.	DP=18;I16=10,8,0,0,683,26261,0,0,1049,62041,0,0,401,9409,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,133:4:0	0,12,129:4:0
-X	1233	.	G	<*>	0	.	DP=18;I16=10,8,0,0,657,24509,0,0,1049,62041,0,0,401,9389,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,124:4:0	0,12,129:4:0
-X	1234	.	A	<*>	0	.	DP=19;I16=10,8,0,0,677,26177,0,0,1080,64800,0,0,386,9134,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,101:3:0	0,12,144:4:0
-X	1235	.	A	<*>	0	.	DP=19;I16=10,9,0,0,697,26363,0,0,1109,65641,0,0,400,9282,0,0;QS=3,0;MQSB=0.920044;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,129:4:0	0,12,140:4:0
-X	1236	.	A	<*>	0	.	DP=19;I16=10,9,0,0,671,24693,0,0,1109,65641,0,0,398,9148,0,0;QS=3,0;MQSB=0.920044;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,103:4:0	0,12,136:4:0
-X	1237	.	T	<*>	0	.	DP=19;I16=9,9,0,0,649,24061,0,0,1049,62041,0,0,370,8356,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,98:3:0	0,12,135:4:0
-X	1238	.	C	<*>	0	.	DP=20;I16=11,9,0,0,733,27709,0,0,1169,69241,0,0,391,8783,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,104:4:0	0,12,145:4:0
-X	1239	.	C	<*>	0	.	DP=20;I16=10,9,0,0,672,24596,0,0,1109,65641,0,0,363,7981,0,0;QS=3,0;MQSB=0.920044;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,76:3:0	0,12,124:4:0
-X	1240	.	C	<*>	0	.	DP=20;I16=11,9,0,0,723,26895,0,0,1169,69241,0,0,385,8451,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,118:4:0	0,12,129:4:0
-X	1241	.	A	<*>	0	.	DP=20;I16=11,9,0,0,719,26575,0,0,1169,69241,0,0,382,8318,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,104:4:0	0,12,141:4:0
-X	1242	.	A	<*>	0	.	DP=21;I16=12,9,0,0,749,27599,0,0,1229,72841,0,0,379,8207,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,109:4:0	0,15,153:5:0
-X	1243	.	A	<*>	0	.	DP=21;I16=12,9,0,0,738,26862,0,0,1229,72841,0,0,377,8119,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,110:4:0	0,15,158:5:0
-X	1244	.	C	<*>	0	.	DP=21;I16=12,8,0,0,670,22952,0,0,1169,69241,0,0,365,7955,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,101:4:0	0,15,148:5:0
-X	1245	.	G	<*>	0	.	DP=21;I16=12,9,0,0,657,21627,0,0,1229,72841,0,0,373,8015,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,36,245:12:0	0,12,95:4:0	0,15,158:5:0
-X	1246	.	C	<*>	0	.	DP=21;I16=12,9,0,0,652,21348,0,0,1229,72841,0,0,370,7948,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,36,252:12:0	0,12,95:4:0	0,15,146:5:0
-X	1247	.	G	<*>	0	.	DP=20;I16=11,9,0,0,655,22291,0,0,1169,69241,0,0,367,7853,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,87:4:0	0,15,150:5:0
-X	1248	.	C	<*>	0	.	DP=20;I16=10,8,0,0,659,25037,0,0,1080,64800,0,0,314,6530,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,90:3:0	0,15,156:5:0
-X	1249	.	C	<*>	0	.	DP=21;I16=12,9,0,0,772,28954,0,0,1229,72841,0,0,360,7680,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,111:4:0	0,15,166:5:0
-X	1250	.	A	<*>	0	.	DP=21;I16=12,9,0,0,757,27599,0,0,1229,72841,0,0,356,7554,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,114:4:0	0,15,161:5:0
-X	1251	.	A	<*>	0	.	DP=21;I16=12,9,0,0,758,27890,0,0,1229,72841,0,0,352,7452,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,115:4:0	0,15,174:5:0
-X	1252	.	T	<*>	0	.	DP=21;I16=12,9,0,0,758,27574,0,0,1229,72841,0,0,348,7374,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,124:4:0	0,15,159:5:0
-X	1253	.	A	<*>	0	.	DP=20;I16=12,8,0,0,718,26292,0,0,1169,69241,0,0,345,7319,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,127:4:0	0,12,144:4:0
-X	1254	.	A	<*>	0	.	DP=20;I16=12,8,0,0,781,30817,0,0,1169,69241,0,0,342,7286,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,134:4:0	0,12,156:4:0
-X	1255	.	G	<*>	0	.	DP=21;I16=12,9,0,0,785,30039,0,0,1229,72841,0,0,339,7275,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,128:4:0	0,15,169:5:0
-X	1256	.	C	<*>	0	.	DP=20;I16=12,8,0,0,742,27910,0,0,1169,69241,0,0,338,7286,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,116:4:0	0,15,165:5:0
-X	1257	.	A	<*>	0	.	DP=20;I16=12,8,0,0,745,28017,0,0,1169,69241,0,0,337,7319,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,132:4:0	0,15,167:5:0
-X	1258	.	T	<*>	0	.	DP=20;I16=12,8,0,0,753,28507,0,0,1169,69241,0,0,336,7374,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,126:4:0	0,15,170:5:0
-X	1259	.	T	<*>	0	.	DP=20;I16=12,8,0,0,690,24762,0,0,1169,69241,0,0,335,7451,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,33,236:11:0	0,12,128:4:0	0,15,170:5:0
-X	1260	.	C	<*>	0	.	DP=20;I16=12,8,0,0,719,26541,0,0,1169,69241,0,0,333,7499,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,127:4:0	0,15,155:5:0
-X	1261	.	C	<*>	0	.	DP=18;I16=11,6,0,0,602,22374,0,0,989,58441,0,0,308,6940,0,0;QS=3,0;MQSB=0.85832;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,117:4:0	0,9,109:3:0
-X	1262	.	C	<*>	0	.	DP=18;I16=12,6,0,0,653,24345,0,0,1049,62041,0,0,333,7597,0,0;QS=3,0;MQSB=0.85394;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,15,145:5:0	0,9,114:3:0
-X	1263	.	T	<*>	0	.	DP=17;I16=12,5,0,0,654,25656,0,0,989,58441,0,0,335,7645,0,0;QS=3,0;MQSB=0.818731;MQ0F=0	PL:DP:DV	0,27,238:9:0	0,15,158:5:0	0,9,118:3:0
-X	1264	.	T	<*>	0	.	DP=17;I16=12,5,0,0,615,22855,0,0,989,58441,0,0,336,7658,0,0;QS=3,0;MQSB=0.818731;MQ0F=0	PL:DP:DV	0,27,226:9:0	0,15,149:5:0	0,9,114:3:0
-X	1265	.	T	<*>	0	.	DP=17;I16=12,5,0,0,620,23176,0,0,989,58441,0,0,334,7538,0,0;QS=3,0;MQSB=0.818731;MQ0F=0	PL:DP:DV	0,27,232:9:0	0,15,144:5:0	0,9,114:3:0
-X	1266	.	G	<*>	0	.	DP=18;I16=13,5,0,0,675,25765,0,0,1049,62041,0,0,332,7438,0,0;QS=3,0;MQSB=0.814433;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,145:5:0	0,9,114:3:0
-X	1267	.	A	<*>	0	.	DP=18;I16=13,5,0,0,663,24799,0,0,1049,62041,0,0,331,7359,0,0;QS=3,0;MQSB=0.814433;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,15,138:5:0	0,9,114:3:0
-X	1268	.	G	<*>	0	.	DP=18;I16=13,5,0,0,638,23584,0,0,1049,62041,0,0,329,7251,0,0;QS=3,0;MQSB=0.814433;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,112:5:0	0,9,108:3:0
-X	1269	.	C	<*>	0	.	DP=18;I16=13,5,0,0,592,20458,0,0,1049,62041,0,0,327,7163,0,0;QS=3,0;MQSB=0.814433;MQ0F=0	PL:DP:DV	0,30,224:10:0	0,15,130:5:0	0,9,107:3:0
-X	1270	.	G	<*>	0	.	DP=18;I16=13,5,0,0,537,16775,0,0,1049,62041,0,0,325,7095,0,0;QS=3,0;MQSB=0.814433;MQ0F=0	PL:DP:DV	0,30,206:10:0	0,15,104:5:0	0,9,98:3:0
-X	1271	.	T	<*>	0	.	DP=18;I16=12,5,0,0,620,22824,0,0,989,58441,0,0,298,6422,0,0;QS=3,0;MQSB=0.818731;MQ0F=0	PL:DP:DV	0,27,240:9:0	0,15,138:5:0	0,9,109:3:0
-X	1272	.	C	<*>	0	.	DP=17;I16=11,5,0,0,597,22587,0,0,929,54841,0,0,297,6393,0,0;QS=3,0;MQSB=0.823561;MQ0F=0	PL:DP:DV	0,27,251:9:0	0,12,113:4:0	0,9,110:3:0
-X	1273	.	A	<*>	0	.	DP=18;I16=12,6,0,0,633,23063,0,0,1049,62041,0,0,318,6866,0,0;QS=3,0;MQSB=0.85394;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,109:4:0	0,9,113:3:0
-X	1274	.	T	<*>	0	.	DP=17;I16=10,6,0,0,609,23335,0,0,929,54841,0,0,293,6205,0,0;QS=3,0;MQSB=0.863243;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,67:2:0	0,9,115:3:0
-X	1275	.	G	<*>	0	.	DP=17;I16=11,6,0,0,602,21976,0,0,989,58441,0,0,317,6763,0,0;QS=3,0;MQSB=0.85832;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,87:3:0	0,9,112:3:0
-X	1276	.	T	<*>	0	.	DP=17;I16=11,6,0,0,587,20925,0,0,989,58441,0,0,316,6714,0,0;QS=3,0;MQSB=0.85832;MQ0F=0	PL:DP:DV	0,33,248:11:0	0,9,94:3:0	0,9,110:3:0
-X	1277	.	C	<*>	0	.	DP=18;I16=11,7,0,0,590,20126,0,0,1049,62041,0,0,314,6634,0,0;QS=3,0;MQSB=0.883327;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,85:3:0	0,9,106:3:0
-X	1278	.	G	<*>	0	.	DP=18;I16=11,7,0,0,603,20675,0,0,1049,62041,0,0,313,6575,0,0;QS=3,0;MQSB=0.883327;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,77:3:0	0,9,96:3:0
-X	1279	.	G	<*>	0	.	DP=18;I16=11,7,0,0,646,23662,0,0,1049,62041,0,0,312,6538,0,0;QS=3,0;MQSB=0.883327;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,85:3:0	0,9,113:3:0
-X	1280	.	T	<*>	0	.	DP=18;I16=10,7,0,0,558,19192,0,0,989,58441,0,0,296,6298,0,0;QS=3,0;MQSB=0.887766;MQ0F=0	PL:DP:DV	0,33,249:11:0	0,9,86:3:0	0,9,97:3:0
-X	1281	.	G	<*>	0	.	DP=17;I16=10,6,0,0,564,21244,0,0,929,54841,0,0,270,5658,0,0;QS=3,0;MQSB=0.863243;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,85:3:0	0,9,103:3:0
-X	1282	.	C	<*>	0	.	DP=18;I16=10,8,0,0,654,24308,0,0,1049,62041,0,0,294,6286,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,94:3:0	0,12,131:4:0
-X	1283	.	T	<*>	0	.	DP=18;I16=10,8,0,0,677,26313,0,0,1049,62041,0,0,294,6308,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,83:3:0	0,12,154:4:0
-X	1284	.	T	<*>	0	.	DP=18;I16=10,8,0,0,631,22949,0,0,1049,62041,0,0,293,6301,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,33,254:11:0	0,9,92:3:0	0,12,145:4:0
-X	1285	.	G	<*>	0	.	DP=18;I16=10,7,0,0,657,25545,0,0,989,58441,0,0,267,5691,0,0;QS=3,0;MQSB=0.887766;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,94:3:0	0,12,145:4:0
-X	1286	.	G	<*>	0	.	DP=18;I16=10,8,0,0,650,24684,0,0,1049,62041,0,0,291,6353,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,78:3:0	0,12,148:4:0
-X	1287	.	A	<*>	0	.	DP=17;I16=9,8,0,0,609,22229,0,0,989,58441,0,0,291,6411,0,0;QS=3,0;MQSB=0.91051;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,91:3:0	0,12,137:4:0
-X	1288	.	A	<*>	0	.	DP=17;I16=9,8,0,0,605,22315,0,0,989,58441,0,0,290,6438,0,0;QS=3,0;MQSB=0.91051;MQ0F=0	PL:DP:DV	0,30,245:10:0	0,9,103:3:0	0,12,140:4:0
-X	1289	.	T	<*>	0	.	DP=18;I16=10,8,0,0,637,23207,0,0,1049,62041,0,0,289,6483,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,99:3:0	0,12,141:4:0
-X	1290	.	G	<*>	0	.	DP=15;I16=9,6,0,0,559,21163,0,0,869,51241,0,0,292,6544,0,0;QS=3,0;MQSB=0.868815;MQ0F=0	PL:DP:DV	0,27,242:9:0	0,9,97:3:0	0,9,106:3:0
-X	1291	.	T	<*>	0	.	DP=15;I16=9,6,0,0,547,20303,0,0,869,51241,0,0,295,6619,0,0;QS=3,0;MQSB=0.868815;MQ0F=0	PL:DP:DV	0,27,225:9:0	0,9,91:3:0	0,9,117:3:0
-X	1292	.	T	<*>	0	.	DP=15;I16=9,6,0,0,559,21121,0,0,869,51241,0,0,297,6657,0,0;QS=3,0;MQSB=0.868815;MQ0F=0	PL:DP:DV	0,27,236:9:0	0,9,95:3:0	0,9,113:3:0
-X	1293	.	T	<*>	0	.	DP=15;I16=9,6,0,0,578,22428,0,0,869,51241,0,0,299,6707,0,0;QS=3,0;MQSB=0.868815;MQ0F=0	PL:DP:DV	0,27,242:9:0	0,9,100:3:0	0,9,116:3:0
-X	1294	.	G	<*>	0	.	DP=16;I16=9,7,0,0,606,23572,0,0,929,54841,0,0,301,6769,0,0;QS=3,0;MQSB=0.892753;MQ0F=0	PL:DP:DV	0,27,254:9:0	0,12,110:4:0	0,9,119:3:0
-X	1295	.	G	<*>	0	.	DP=16;I16=9,7,0,0,567,21419,0,0,929,54841,0,0,304,6844,0,0;QS=3,0;MQSB=0.892753;MQ0F=0	PL:DP:DV	0,27,244:9:0	0,12,102:4:0	0,9,114:3:0
-X	1296	.	G	<*>	0	.	DP=16;I16=8,7,0,0,518,19300,0,0,869,51241,0,0,294,6740,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,27,227:9:0	0,9,89:3:0	0,9,114:3:0
-X	1297	.	G	<*>	0	.	DP=18;I16=9,8,0,0,551,19323,0,0,958,55682,0,0,322,7444,0,0;QS=3,0;MQSB=0.998843;MQ0F=0	PL:DP:DV	0,30,219:10:0	0,9,86:3:0	0,12,133:4:0
-X	1298	.	T	<*>	0	.	DP=18;I16=10,8,0,0,615,22371,0,0,1018,59282,0,0,336,7638,0,0;QS=3,0;MQSB=0.99606;MQ0F=0	PL:DP:DV	0,30,233:10:0	0,12,105:4:0	0,12,138:4:0
-X	1299	.	T	<*>	0	.	DP=18;I16=9,8,0,0,619,23135,0,0,958,55682,0,0,328,7548,0,0;QS=3,0;MQSB=0.998843;MQ0F=0	PL:DP:DV	0,30,242:10:0	0,9,97:3:0	0,12,136:4:0
-X	1300	.	T	<*>	0	.	DP=18;I16=10,8,0,0,631,23107,0,0,1018,59282,0,0,338,7638,0,0;QS=3,0;MQSB=0.99606;MQ0F=0	PL:DP:DV	0,30,235:10:0	0,12,121:4:0	0,12,136:4:0
-X	1301	.	T	G,<*>	0	.	DP=18;I16=8,8,1,0,599,22623,18,324,929,54841,29,841,314,7040,25,625;QS=2.9434,0.0566038,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.998843;BQB=1;MQ0F=0	PL:DP:DV	0,9,213,24,216,222:9:1	0,12,126,12,126,126:4:0	0,12,135,12,135,135:4:0
-X	1302	.	G	<*>	0	.	DP=17;I16=9,8,0,0,624,23544,0,0,958,55682,0,0,341,7709,0,0;QS=3,0;MQSB=0.998843;MQ0F=0	PL:DP:DV	0,27,240:9:0	0,12,127:4:0	0,12,140:4:0
-X	1303	.	G	<*>	0	.	DP=17;I16=9,8,0,0,582,21200,0,0,958,55682,0,0,342,7718,0,0;QS=3,0;MQSB=0.998843;MQ0F=0	PL:DP:DV	0,27,217:9:0	0,12,125:4:0	0,12,138:4:0
-X	1304	.	A	<*>	0	.	DP=18;I16=10,8,0,0,652,24124,0,0,1018,59282,0,0,343,7741,0,0;QS=3,0;MQSB=0.99606;MQ0F=0	PL:DP:DV	0,27,218:9:0	0,12,131:4:0	0,15,169:5:0
-X	1305	.	T	<*>	0	.	DP=18;I16=10,8,0,0,685,26381,0,0,1018,59282,0,0,345,7779,0,0;QS=3,0;MQSB=0.99606;MQ0F=0	PL:DP:DV	0,27,241:9:0	0,12,122:4:0	0,15,174:5:0
-X	1306	.	T	<*>	0	.	DP=18;I16=9,8,0,0,644,24628,0,0,958,55682,0,0,345,7829,0,0;QS=3,0;MQSB=0.998843;MQ0F=0	PL:DP:DV	0,27,236:9:0	0,9,106:3:0	0,15,168:5:0
-X	1307	.	T	<*>	0	.	DP=17;I16=9,8,0,0,628,23746,0,0,958,55682,0,0,348,7902,0,0;QS=3,0;MQSB=0.998843;MQ0F=0	PL:DP:DV	0,27,226:9:0	0,9,104:3:0	0,15,167:5:0
-X	1308	.	A	<*>	0	.	DP=19;I16=9,10,0,0,690,25500,0,0,1078,62882,0,0,350,7938,0,0;QS=3,0;MQSB=0.999167;MQ0F=0	PL:DP:DV	0,30,236:10:0	0,12,127:4:0	0,15,173:5:0
-X	1309	.	C	<*>	0	.	DP=19;I16=9,9,0,0,698,27148,0,0,1049,62041,0,0,342,7818,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,106:3:0	0,15,169:5:0
-X	1310	.	A	<*>	0	.	DP=19;I16=9,10,0,0,751,29953,0,0,1078,62882,0,0,356,7958,0,0;QS=3,0;MQSB=0.999167;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,132:4:0	0,15,183:5:0
-X	1311	.	G	<*>	0	.	DP=19;I16=9,10,0,0,742,29384,0,0,1078,62882,0,0,359,7995,0,0;QS=3,0;MQSB=0.999167;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,128:4:0	0,15,174:5:0
-X	1312	.	C	<*>	0	.	DP=19;I16=9,10,0,0,717,27783,0,0,1078,62882,0,0,362,8050,0,0;QS=3,0;MQSB=0.999167;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,115:4:0	0,15,166:5:0
-X	1313	.	T	<*>	0	.	DP=19;I16=9,10,0,0,751,30061,0,0,1078,62882,0,0,364,8074,0,0;QS=3,0;MQSB=0.999167;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,135:4:0	0,15,175:5:0
-X	1314	.	T	<*>	0	.	DP=19;I16=9,10,0,0,707,26983,0,0,1078,62882,0,0,366,8118,0,0;QS=3,0;MQSB=0.999167;MQ0F=0	PL:DP:DV	0,30,245:10:0	0,12,134:4:0	0,15,174:5:0
-X	1315	.	T	<*>	0	.	DP=19;I16=9,10,0,0,717,27491,0,0,1078,62882,0,0,367,8131,0,0;QS=3,0;MQSB=0.999167;MQ0F=0	PL:DP:DV	0,30,250:10:0	0,12,132:4:0	0,15,174:5:0
-X	1316	.	G	<*>	0	.	DP=21;I16=10,11,0,0,776,29502,0,0,1198,70082,0,0,368,8162,0,0;QS=3,0;MQSB=0.99938;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,128:4:0	0,18,188:6:0
-X	1317	.	G	<*>	0	.	DP=21;I16=10,11,0,0,751,27855,0,0,1198,70082,0,0,371,8213,0,0;QS=3,0;MQSB=0.99938;MQ0F=0	PL:DP:DV	0,33,253:11:0	0,12,130:4:0	0,18,179:6:0
-X	1318	.	G	<*>	0	.	DP=21;I16=10,11,0,0,749,27663,0,0,1198,70082,0,0,372,8188,0,0;QS=3,0;MQSB=0.99938;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,130:4:0	0,18,184:6:0
-X	1319	.	A	<*>	0	.	DP=21;I16=10,11,0,0,768,28390,0,0,1198,70082,0,0,373,8189,0,0;QS=3,0;MQSB=0.99938;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,124:4:0	0,18,186:6:0
-X	1320	.	C	<*>	0	.	DP=21;I16=10,11,0,0,728,25496,0,0,1198,70082,0,0,373,8165,0,0;QS=3,0;MQSB=0.99938;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,113:4:0	0,18,161:6:0
-X	1321	.	G	<*>	0	.	DP=22;I16=10,12,0,0,762,27412,0,0,1289,76441,0,0,374,8164,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,33,244:11:0	0,9,104:3:0	0,24,208:8:0
-X	1322	.	C	<*>	0	.	DP=22;I16=10,12,0,0,852,33528,0,0,1289,76441,0,0,377,8187,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,111:3:0	0,24,225:8:0
-X	1323	.	T	<*>	0	.	DP=22;I16=10,12,0,0,874,35152,0,0,1289,76441,0,0,379,8185,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,112:3:0	0,24,237:8:0
-X	1324	.	C	<*>	0	.	DP=21;I16=9,12,0,0,793,30585,0,0,1229,72841,0,0,381,8157,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,109:3:0	0,24,218:8:0
-X	1325	.	A	<*>	0	.	DP=21;I16=9,12,0,0,782,29430,0,0,1229,72841,0,0,383,8153,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,105:3:0	0,24,218:8:0
-X	1326	.	A	<*>	0	.	DP=21;I16=9,12,0,0,791,30479,0,0,1229,72841,0,0,385,8173,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,30,249:10:0	0,9,108:3:0	0,24,230:8:0
-X	1327	.	C	<*>	0	.	DP=23;I16=11,12,0,0,834,31048,0,0,1349,80041,0,0,387,8217,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,99:3:0	0,27,237:9:0
-X	1328	.	C	<*>	0	.	DP=23;I16=11,12,0,0,878,33972,0,0,1349,80041,0,0,391,8287,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,105:3:0	0,27,254:9:0
-X	1329	.	T	<*>	0	.	DP=23;I16=11,12,0,0,882,34756,0,0,1349,80041,0,0,395,8385,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,112:3:0	0,27,255:9:0
-X	1330	.	G	<*>	0	.	DP=23;I16=11,12,0,0,856,32638,0,0,1349,80041,0,0,398,8460,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,101:3:0	0,27,241:9:0
-X	1331	.	T	<*>	0	.	DP=23;I16=11,12,0,0,847,31785,0,0,1349,80041,0,0,400,8512,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,106:3:0	0,27,247:9:0
-X	1332	.	A	<*>	0	.	DP=23;I16=11,12,0,0,826,30264,0,0,1349,80041,0,0,402,8592,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,33,252:11:0	0,9,104:3:0	0,27,238:9:0
-X	1333	.	C	<*>	0	.	DP=23;I16=11,12,0,0,836,30928,0,0,1349,80041,0,0,404,8700,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,101:3:0	0,27,236:9:0
-X	1334	.	C	<*>	0	.	DP=22;I16=11,11,0,0,830,32380,0,0,1289,76441,0,0,405,8733,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,107:3:0	0,27,238:9:0
-X	1335	.	T	<*>	0	.	DP=22;I16=11,11,0,0,877,35371,0,0,1289,76441,0,0,406,8788,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,113:3:0	0,27,253:9:0
-X	1336	.	C	<*>	0	.	DP=25;I16=12,12,0,0,890,33648,0,0,1378,80882,0,0,398,8784,0,0;QS=3,0;MQSB=0.786628;MQ0F=0	PL:DP:DV	0,33,250:11:0	0,12,131:4:0	0,27,237:9:0
-X	1337	.	A	<*>	0	.	DP=26;I16=13,13,0,0,941,34611,0,0,1498,88082,0,0,411,8967,0,0;QS=3,0;MQSB=0.800737;MQ0F=0	PL:DP:DV	0,33,249:11:0	0,15,152:5:0	0,30,247:10:0
-X	1338	.	A	<*>	0	.	DP=26;I16=12,14,0,0,982,37358,0,0,1498,88082,0,0,416,9048,0,0;QS=3,0;MQSB=0.771623;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,153:5:0	0,30,255:10:0
-X	1339	.	T	<*>	0	.	DP=27;I16=12,15,0,0,989,36855,0,0,1558,91682,0,0,422,9160,0,0;QS=3,0;MQSB=0.765017;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,151:5:0	0,33,255:11:0
-X	1340	.	A	<*>	0	.	DP=27;I16=11,15,0,0,937,34141,0,0,1498,88082,0,0,425,9289,0,0;QS=3,0;MQSB=0.738577;MQ0F=0	PL:DP:DV	0,30,250:10:0	0,15,149:5:0	0,33,254:11:0
-X	1341	.	A	<*>	0	.	DP=27;I16=12,14,0,0,929,33961,0,0,1498,88082,0,0,410,8810,0,0;QS=3,0;MQSB=0.771623;MQ0F=0	PL:DP:DV	0,30,245:10:0	0,15,141:5:0	0,33,255:11:0
-X	1342	.	A	<*>	0	.	DP=27;I16=12,15,0,0,951,34575,0,0,1558,91682,0,0,439,9499,0,0;QS=3,0;MQSB=0.765017;MQ0F=0	PL:DP:DV	0,33,254:11:0	0,15,159:5:0	0,33,249:11:0
-X	1343	.	C	<*>	0	.	DP=25;I16=10,15,0,0,902,33364,0,0,1469,87241,0,0,445,9593,0,0;QS=3,0;MQSB=0.9171;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,140:5:0	0,30,233:10:0
-X	1344	.	C	<*>	0	.	DP=26;I16=10,16,0,0,985,37915,0,0,1529,90841,0,0,451,9715,0,0;QS=3,0;MQSB=0.914947;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,163:6:0	0,30,238:10:0
-X	1345	.	T	<*>	0	.	DP=26;I16=10,16,0,0,1004,39262,0,0,1529,90841,0,0,458,9866,0,0;QS=3,0;MQSB=0.914947;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,182:6:0	0,30,242:10:0
-X	1346	.	G	<*>	0	.	DP=26;I16=10,16,0,0,1003,38983,0,0,1529,90841,0,0,465,10047,0,0;QS=3,0;MQSB=0.914947;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,172:6:0	0,30,239:10:0
-X	1347	.	A	<*>	0	.	DP=26;I16=10,16,0,0,995,38409,0,0,1529,90841,0,0,470,10156,0,0;QS=3,0;MQSB=0.914947;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,177:6:0	0,30,243:10:0
-X	1348	.	T	<*>	0	.	DP=26;I16=10,16,0,0,988,38126,0,0,1529,90841,0,0,474,10242,0,0;QS=3,0;MQSB=0.914947;MQ0F=0	PL:DP:DV	0,30,252:10:0	0,18,185:6:0	0,30,251:10:0
-X	1349	.	T	<*>	0	.	DP=26;I16=9,15,0,0,905,34409,0,0,1409,83641,0,0,454,9730,0,0;QS=3,0;MQSB=0.904837;MQ0F=0	PL:DP:DV	0,24,225:8:0	0,18,176:6:0	0,30,248:10:0
-X	1350	.	T	<*>	0	.	DP=26;I16=10,16,0,0,975,36909,0,0,1498,88082,0,0,485,10495,0,0;QS=3,0;MQSB=0.700784;MQ0F=0	PL:DP:DV	0,27,242:9:0	0,21,195:7:0	0,30,249:10:0
-X	1351	.	T	<*>	0	.	DP=26;I16=10,16,0,0,956,35602,0,0,1498,88082,0,0,491,10663,0,0;QS=3,0;MQSB=0.700784;MQ0F=0	PL:DP:DV	0,27,238:9:0	0,21,193:7:0	0,30,240:10:0
-X	1352	.	A	<*>	0	.	DP=26;I16=10,16,0,0,901,31965,0,0,1498,88082,0,0,496,10810,0,0;QS=3,0;MQSB=0.700784;MQ0F=0	PL:DP:DV	0,27,250:9:0	0,21,180:7:0	0,30,211:10:0
-X	1353	.	A	<*>	0	.	DP=26;I16=10,16,0,0,927,33583,0,0,1498,88082,0,0,499,10885,0,0;QS=3,0;MQSB=0.700784;MQ0F=0	PL:DP:DV	0,27,240:9:0	0,21,187:7:0	0,30,224:10:0
-X	1354	.	A	<*>	0	.	DP=26;I16=10,16,0,0,927,33621,0,0,1498,88082,0,0,502,10986,0,0;QS=3,0;MQSB=0.700784;MQ0F=0	PL:DP:DV	0,27,237:9:0	0,21,190:7:0	0,30,223:10:0
-X	1355	.	A	<*>	0	.	DP=26;I16=10,16,0,0,924,33736,0,0,1498,88082,0,0,505,11113,0,0;QS=3,0;MQSB=0.700784;MQ0F=0	PL:DP:DV	0,27,239:9:0	0,21,186:7:0	0,30,227:10:0
-X	1356	.	A	<*>	0	.	DP=25;I16=10,15,0,0,916,34050,0,0,1438,84482,0,0,509,11265,0,0;QS=3,0;MQSB=0.707404;MQ0F=0	PL:DP:DV	0,27,249:9:0	0,21,178:7:0	0,27,226:9:0
-X	1357	.	A	<*>	0	.	DP=25;I16=9,15,0,0,949,38007,0,0,1378,80882,0,0,488,10816,0,0;QS=3,0;MQSB=0.67032;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,21,193:7:0	0,24,217:8:0
-X	1358	.	G	<*>	0	.	DP=25;I16=9,15,0,0,873,32435,0,0,1378,80882,0,0,491,10967,0,0;QS=3,0;MQSB=0.67032;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,21,172:7:0	0,24,188:8:0
-X	1359	.	T	<*>	0	.	DP=25;I16=9,15,0,0,857,31139,0,0,1378,80882,0,0,494,11144,0,0;QS=3,0;MQSB=0.67032;MQ0F=0	PL:DP:DV	0,27,232:9:0	0,21,184:7:0	0,24,196:8:0
-X	1360	.	T	<*>	0	.	DP=25;I16=9,15,0,0,879,32419,0,0,1378,80882,0,0,497,11347,0,0;QS=3,0;MQSB=0.67032;MQ0F=0	PL:DP:DV	0,27,248:9:0	0,21,184:7:0	0,24,192:8:0
-X	1361	.	T	<*>	0	.	DP=27;I16=9,17,0,0,936,34238,0,0,1498,88082,0,0,500,11576,0,0;QS=3,0;MQSB=0.657209;MQ0F=0	PL:DP:DV	0,27,234:9:0	0,24,201:8:0	0,27,206:9:0
-X	1362	.	G	<*>	0	.	DP=26;I16=9,17,0,0,973,36785,0,0,1498,88082,0,0,502,11680,0,0;QS=3,0;MQSB=0.657209;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,24,202:8:0	0,27,207:9:0
-X	1363	.	G	<*>	0	.	DP=25;I16=8,17,0,0,936,35390,0,0,1438,84482,0,0,504,11756,0,0;QS=3,0;MQSB=0.612391;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,21,181:7:0	0,27,202:9:0
-X	1364	.	G	<*>	0	.	DP=25;I16=8,17,0,0,902,32840,0,0,1438,84482,0,0,504,11752,0,0;QS=3,0;MQSB=0.612391;MQ0F=0	PL:DP:DV	0,27,233:9:0	0,21,184:7:0	0,27,200:9:0
-X	1365	.	G	<*>	0	.	DP=26;I16=9,17,0,0,946,35224,0,0,1498,88082,0,0,503,11717,0,0;QS=3,0;MQSB=0.657209;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,24,190:8:0	0,27,202:9:0
-X	1366	.	G	<*>	0	.	DP=25;I16=8,15,0,0,840,31058,0,0,1318,77282,0,0,454,10450,0,0;QS=3,0;MQSB=0.625784;MQ0F=0	PL:DP:DV	0,21,215:7:0	0,21,181:7:0	0,27,199:9:0
-X	1367	.	G	C,<*>	0	.	DP=25;I16=7,16,0,1,836,30888,27,729,1349,80041,60,3600,472,11152,15,225;QS=2.91641,0.0835913,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.864405;BQB=1;MQ0F=0	PL:DP:DV	0,24,236,24,236,236:8:0	0,21,179,21,179,179:7:0	0,0,171,24,174,189:9:1
-X	1368	.	A	<*>	0	.	DP=26;I16=8,17,0,0,869,30839,0,0,1438,84482,0,0,481,11095,0,0;QS=3,0;MQSB=0.612391;MQ0F=0	PL:DP:DV	0,27,240:9:0	0,21,180:7:0	0,27,197:9:0
-X	1369	.	T	<*>	0	.	DP=26;I16=8,18,0,0,902,32160,0,0,1498,88082,0,0,508,11758,0,0;QS=3,0;MQSB=0.606531;MQ0F=0	PL:DP:DV	0,27,242:9:0	0,24,197:8:0	0,27,194:9:0
-X	1370	.	T	<*>	0	.	DP=27;I16=8,17,0,0,926,34736,0,0,1438,84482,0,0,458,10466,0,0;QS=3,0;MQSB=0.612391;MQ0F=0	PL:DP:DV	0,27,238:9:0	0,21,195:7:0	0,27,215:9:0
-X	1371	.	C	<*>	0	.	DP=27;I16=8,19,0,0,929,33255,0,0,1558,91682,0,0,509,11695,0,0;QS=3,0;MQSB=0.601139;MQ0F=0	PL:DP:DV	0,27,241:9:0	0,24,196:8:0	0,30,196:10:0
-X	1372	.	C	<*>	0	.	DP=27;I16=8,19,0,0,954,34882,0,0,1558,91682,0,0,510,11696,0,0;QS=3,0;MQSB=0.601139;MQ0F=0	PL:DP:DV	0,27,251:9:0	0,24,198:8:0	0,30,200:10:0
-X	1373	.	C	<*>	0	.	DP=26;I16=8,17,0,0,892,32692,0,0,1438,84482,0,0,486,11044,0,0;QS=3,0;MQSB=0.612391;MQ0F=0	PL:DP:DV	0,24,243:8:0	0,21,186:7:0	0,30,195:10:0
-X	1374	.	C	<*>	0	.	DP=26;I16=8,17,0,0,953,36553,0,0,1438,84482,0,0,487,11039,0,0;QS=3,0;MQSB=0.612391;MQ0F=0	PL:DP:DV	0,24,249:8:0	0,21,193:7:0	0,30,211:10:0
-X	1375	.	T	<*>	0	.	DP=27;I16=9,18,0,0,1011,38377,0,0,1558,91682,0,0,512,11630,0,0;QS=3,0;MQSB=0.651439;MQ0F=0	PL:DP:DV	0,27,243:9:0	0,24,215:8:0	0,30,215:10:0
-X	1376	.	A	<*>	0	.	DP=27;I16=9,17,0,0,912,32444,0,0,1498,88082,0,0,488,10992,0,0;QS=3,0;MQSB=0.657209;MQ0F=0	PL:DP:DV	0,27,234:9:0	0,21,198:7:0	0,30,195:10:0
-X	1377	.	A	<*>	0	.	DP=26;I16=9,17,0,0,994,38518,0,0,1498,88082,0,0,515,11625,0,0;QS=3,0;MQSB=0.657209;MQ0F=0	PL:DP:DV	0,24,228:8:0	0,24,221:8:0	0,30,228:10:0
-X	1378	.	G	<*>	0	.	DP=26;I16=9,17,0,0,910,33180,0,0,1498,88082,0,0,517,11653,0,0;QS=3,0;MQSB=0.657209;MQ0F=0	PL:DP:DV	0,24,234:8:0	0,24,199:8:0	0,30,197:10:0
-X	1379	.	C	<*>	0	.	DP=26;I16=9,17,0,0,891,31779,0,0,1498,88082,0,0,519,11701,0,0;QS=3,0;MQSB=0.657209;MQ0F=0	PL:DP:DV	0,24,228:8:0	0,24,198:8:0	0,30,193:10:0
-X	1380	.	C	<*>	0	.	DP=26;I16=9,17,0,0,925,33925,0,0,1498,88082,0,0,520,11720,0,0;QS=3,0;MQSB=0.657209;MQ0F=0	PL:DP:DV	0,24,226:8:0	0,24,202:8:0	0,30,209:10:0
-X	1381	.	C	<*>	0	.	DP=28;I16=10,18,0,0,878,28560,0,0,1618,95282,0,0,521,11761,0,0;QS=3,0;MQSB=0.689069;MQ0F=0	PL:DP:DV	0,24,211:8:0	0,24,177:8:0	0,36,208:12:0
-X	1382	.	G	<*>	0	.	DP=28;I16=8,18,0,0,905,32553,0,0,1529,90841,0,0,482,10912,0,0;QS=3,0;MQSB=0.882497;MQ0F=0	PL:DP:DV	0,24,213:8:0	0,18,152:6:0	0,36,243:12:0
-X	1383	.	C	<*>	0	.	DP=27;I16=10,16,0,0,897,32373,0,0,1498,88082,0,0,502,11242,0,0;QS=3,0;MQSB=0.700784;MQ0F=0	PL:DP:DV	0,24,225:8:0	0,21,163:7:0	0,33,241:11:0
-X	1384	.	C	<*>	0	.	DP=28;I16=11,17,0,0,980,35558,0,0,1618,95282,0,0,529,11885,0,0;QS=3,0;MQSB=0.726331;MQ0F=0	PL:DP:DV	0,27,248:9:0	0,24,184:8:0	0,33,239:11:0
-X	1385	.	A	<*>	0	.	DP=30;I16=11,18,0,0,949,33215,0,0,1678,98882,0,0,508,11356,0,0;QS=3,0;MQSB=0.720887;MQ0F=0	PL:DP:DV	0,30,232:10:0	0,27,185:9:0	0,30,234:10:0
-X	1386	.	C	<*>	0	.	DP=30;I16=11,19,0,0,1088,39938,0,0,1738,102482,0,0,537,12011,0,0;QS=3,0;MQSB=0.715831;MQ0F=0	PL:DP:DV	0,30,248:10:0	0,27,218:9:0	0,33,255:11:0
-X	1387	.	C	<*>	0	.	DP=31;I16=12,19,0,0,1101,40297,0,0,1798,106082,0,0,540,12022,0,0;QS=3,0;MQSB=0.743137;MQ0F=0	PL:DP:DV	0,33,250:11:0	0,27,219:9:0	0,33,252:11:0
-X	1388	.	C	<*>	0	.	DP=31;I16=11,19,0,0,999,34081,0,0,1769,105241,0,0,519,11439,0,0;QS=3,0;MQSB=0.91982;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,24,185:8:0	0,33,211:11:0
-X	1389	.	G	<*>	0	.	DP=31;I16=11,19,0,0,1065,39119,0,0,1738,102482,0,0,535,11941,0,0;QS=3,0;MQSB=0.715831;MQ0F=0	PL:DP:DV	0,27,234:9:0	0,30,234:10:0	0,33,255:11:0
-X	1390	.	G	<*>	0	.	DP=31;I16=12,19,0,0,1152,43744,0,0,1798,106082,0,0,555,12241,0,0;QS=3,0;MQSB=0.743137;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,30,245:10:0	0,33,255:11:0
-X	1391	.	A	<*>	0	.	DP=31;I16=12,19,0,0,1241,50255,0,0,1798,106082,0,0,560,12326,0,0;QS=3,0;MQSB=0.743137;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,30,255:10:0	0,33,255:11:0
-X	1392	.	G	<*>	0	.	DP=31;I16=12,19,0,0,1160,44364,0,0,1798,106082,0,0,564,12392,0,0;QS=3,0;MQSB=0.743137;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,30,250:10:0	0,33,255:11:0
-X	1393	.	A	<*>	0	.	DP=31;I16=12,19,0,0,1123,41811,0,0,1798,106082,0,0,568,12490,0,0;QS=3,0;MQSB=0.743137;MQ0F=0	PL:DP:DV	0,30,228:10:0	0,30,255:10:0	0,33,255:11:0
-X	1394	.	C	<*>	0	.	DP=31;I16=12,19,0,0,1139,42555,0,0,1798,106082,0,0,571,12569,0,0;QS=3,0;MQSB=0.743137;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,30,244:10:0	0,33,255:11:0
-X	1395	.	A	<*>	0	.	DP=31;I16=12,19,0,0,1206,48048,0,0,1798,106082,0,0,575,12677,0,0;QS=3,0;MQSB=0.743137;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,240:9:0	0,33,255:11:0
-X	1396	.	G	<*>	0	.	DP=31;I16=12,19,0,0,1196,46882,0,0,1798,106082,0,0,579,12763,0,0;QS=3,0;MQSB=0.743137;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,249:9:0	0,33,255:11:0
-X	1397	.	C	<*>	0	.	DP=31;I16=12,18,0,0,993,33339,0,0,1738,102482,0,0,579,12775,0,0;QS=3,0;MQSB=0.748022;MQ0F=0	PL:DP:DV	0,30,231:10:0	0,27,205:9:0	0,33,217:11:0
-X	1398	.	G	<*>	0	.	DP=30;I16=12,18,0,0,1055,38309,0,0,1738,102482,0,0,584,12826,0,0;QS=3,0;MQSB=0.748022;MQ0F=0	PL:DP:DV	0,33,250:11:0	0,27,229:9:0	0,30,244:10:0
-X	1399	.	G	<*>	0	.	DP=30;I16=12,18,0,0,1132,43666,0,0,1738,102482,0,0,586,12854,0,0;QS=3,0;MQSB=0.748022;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,239:9:0	0,30,255:10:0
-X	1400	.	A	<*>	0	.	DP=30;I16=11,18,0,0,1101,42271,0,0,1678,98882,0,0,563,12289,0,0;QS=3,0;MQSB=0.720887;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,27,239:9:0	0,30,246:10:0
-X	1401	.	T	<*>	0	.	DP=30;I16=12,18,0,0,1130,44170,0,0,1738,102482,0,0,589,12955,0,0;QS=3,0;MQSB=0.748022;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,251:9:0	0,30,255:10:0
-X	1402	.	T	<*>	0	.	DP=31;I16=13,18,0,0,1152,44058,0,0,1798,106082,0,0,589,12977,0,0;QS=3,0;MQSB=0.771348;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,244:9:0	0,30,255:10:0
-X	1403	.	T	<*>	0	.	DP=31;I16=13,18,0,0,1178,45296,0,0,1798,106082,0,0,590,13032,0,0;QS=3,0;MQSB=0.771348;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,249:9:0	0,30,255:10:0
-X	1404	.	C	<*>	0	.	DP=31;I16=13,18,0,0,1102,40838,0,0,1798,106082,0,0,591,13121,0,0;QS=3,0;MQSB=0.771348;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,236:9:0	0,30,244:10:0
-X	1405	.	C	<*>	0	.	DP=30;I16=12,18,0,0,1154,45216,0,0,1738,102482,0,0,593,13243,0,0;QS=3,0;MQSB=0.748022;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,241:9:0	0,27,229:9:0
-X	1406	.	T	<*>	0	.	DP=30;I16=12,18,0,0,1153,44919,0,0,1738,102482,0,0,595,13397,0,0;QS=3,0;MQSB=0.748022;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,248:9:0	0,27,223:9:0
-X	1407	.	T	<*>	0	.	DP=30;I16=11,18,0,0,1074,40182,0,0,1678,98882,0,0,570,12856,0,0;QS=3,0;MQSB=0.720887;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,231:9:0	0,27,215:9:0
-X	1408	.	A	<*>	0	.	DP=30;I16=12,18,0,0,1131,43363,0,0,1738,102482,0,0,596,13592,0,0;QS=3,0;MQSB=0.748022;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,30,244:10:0	0,27,234:9:0
-X	1409	.	G	<*>	0	.	DP=29;I16=12,17,0,0,1082,40752,0,0,1678,98882,0,0,599,13729,0,0;QS=3,0;MQSB=0.753269;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,237:9:0	0,27,204:9:0
-X	1410	.	T	<*>	0	.	DP=29;I16=12,17,0,0,1084,41030,0,0,1678,98882,0,0,601,13841,0,0;QS=3,0;MQSB=0.753269;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,239:9:0	0,27,218:9:0
-X	1411	.	T	<*>	0	.	DP=29;I16=12,17,0,0,958,32550,0,0,1678,98882,0,0,600,13826,0,0;QS=3,0;MQSB=0.753269;MQ0F=0	PL:DP:DV	0,33,250:11:0	0,27,206:9:0	0,27,194:9:0
-X	1412	.	A	T,<*>	0	.	DP=29;I16=11,17,1,0,924,31586,25,625,1649,98041,29,841,573,13159,24,576;QS=2.90842,0.0915751,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.753269;BQB=1;MQ0F=0	PL:DP:DV	0,33,245,33,245,245:11:0	0,2,171,24,174,187:9:1	0,27,192,27,192,192:9:0
-X	1413	.	C	<*>	0	.	DP=29;I16=12,17,0,0,1067,39941,0,0,1678,98882,0,0,591,13521,0,0;QS=3,0;MQSB=0.753269;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,230:9:0	0,27,209:9:0
-X	1414	.	T	<*>	0	.	DP=29;I16=12,17,0,0,1123,44271,0,0,1678,98882,0,0,585,13335,0,0;QS=3,0;MQSB=0.753269;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,27,236:9:0	0,27,221:9:0
-X	1415	.	T	<*>	0	.	DP=29;I16=12,17,0,0,1000,35254,0,0,1678,98882,0,0,577,13077,0,0;QS=3,0;MQSB=0.753269;MQ0F=0	PL:DP:DV	0,33,246:11:0	0,27,216:9:0	0,27,208:9:0
-X	1416	.	A	<*>	0	.	DP=30;I16=13,17,0,0,1026,36124,0,0,1738,102482,0,0,569,12847,0,0;QS=3,0;MQSB=0.776389;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,208:9:0	0,27,199:9:0
-X	1417	.	C	<*>	0	.	DP=29;I16=13,16,0,0,1111,42941,0,0,1678,98882,0,0,563,12645,0,0;QS=3,0;MQSB=0.781802;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,235:9:0	0,24,211:8:0
-X	1418	.	T	<*>	0	.	DP=29;I16=13,16,0,0,1111,43021,0,0,1678,98882,0,0,557,12471,0,0;QS=3,0;MQSB=0.781802;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,231:9:0	0,24,207:8:0
-X	1419	.	A	<*>	0	.	DP=29;I16=13,16,0,0,1039,38191,0,0,1678,98882,0,0,551,12325,0,0;QS=3,0;MQSB=0.781802;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,222:9:0	0,24,199:8:0
-X	1420	.	T	<*>	0	.	DP=29;I16=13,16,0,0,1039,37885,0,0,1678,98882,0,0,544,12158,0,0;QS=3,0;MQSB=0.781802;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,27,234:9:0	0,24,185:8:0
-X	1421	.	G	<*>	0	.	DP=31;I16=13,18,0,0,1129,41649,0,0,1798,106082,0,0,536,11970,0,0;QS=3,0;MQSB=0.771348;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,30,247:10:0	0,24,191:8:0
-X	1422	.	C	<*>	0	.	DP=29;I16=13,16,0,0,1075,40645,0,0,1678,98882,0,0,532,11810,0,0;QS=3,0;MQSB=0.781802;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,30,239:10:0	0,18,180:6:0
-X	1423	.	T	<*>	0	.	DP=31;I16=14,17,0,0,1179,45767,0,0,1798,106082,0,0,528,11678,0,0;QS=3,0;MQSB=0.79638;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,36,255:12:0	0,18,183:6:0
-X	1424	.	C	<*>	0	.	DP=30;I16=13,17,0,0,1086,40448,0,0,1738,102482,0,0,527,11575,0,0;QS=3,0;MQSB=0.776389;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,36,255:12:0	0,18,174:6:0
-X	1425	.	C	<*>	0	.	DP=30;I16=13,17,0,0,1124,42974,0,0,1738,102482,0,0,525,11453,0,0;QS=3,0;MQSB=0.776389;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,36,255:12:0	0,18,180:6:0
-X	1426	.	T	<*>	0	.	DP=32;I16=15,17,0,0,1218,47130,0,0,1858,109682,0,0,523,11363,0,0;QS=3,0;MQSB=0.813784;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,36,255:12:0	0,18,188:6:0
-X	1427	.	T	<*>	0	.	DP=32;I16=14,18,0,0,1126,40772,0,0,1827,106923,0,0,524,11306,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,36,255:12:0	0,18,176:6:0
-X	1428	.	G	<*>	0	.	DP=33;I16=15,18,0,0,1188,43596,0,0,1887,110523,0,0,525,11233,0,0;QS=3,0;MQSB=0.930476;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,36,255:12:0	0,18,166:6:0
-X	1429	.	G	<*>	0	.	DP=33;I16=14,18,0,0,1070,37720,0,0,1858,109682,0,0,507,10795,0,0;QS=3,0;MQSB=0.997118;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,33,243:11:0	0,18,148:6:0
-X	1430	.	C	<*>	0	.	DP=33;I16=15,18,0,0,1145,40795,0,0,1887,110523,0,0,529,11193,0,0;QS=3,0;MQSB=0.930476;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,36,247:12:0	0,18,157:6:0
-X	1431	.	C	<*>	0	.	DP=33;I16=15,18,0,0,1160,41686,0,0,1887,110523,0,0,531,11227,0,0;QS=3,0;MQSB=0.930476;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,36,253:12:0	0,18,167:6:0
-X	1432	.	A	<*>	0	.	DP=33;I16=15,18,0,0,1118,39032,0,0,1887,110523,0,0,533,11297,0,0;QS=3,0;MQSB=0.930476;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,36,255:12:0	0,18,169:6:0
-X	1433	.	T	<*>	0	.	DP=34;I16=15,19,0,0,1238,45602,0,0,1947,114123,0,0,535,11403,0,0;QS=3,0;MQSB=0.923533;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,36,255:12:0	0,18,174:6:0
-X	1434	.	T	<*>	0	.	DP=35;I16=15,20,0,0,1269,46757,0,0,2007,117723,0,0,537,11495,0,0;QS=3,0;MQSB=0.916855;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,36,255:12:0	0,18,179:6:0
-X	1435	.	T	<*>	0	.	DP=35;I16=14,20,0,0,1256,46868,0,0,1947,114123,0,0,515,10999,0,0;QS=3,0;MQSB=0.901704;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,36,255:12:0	0,18,180:6:0
-X	1436	.	C	<*>	0	.	DP=34;I16=14,20,0,0,1250,46978,0,0,1947,114123,0,0,544,11790,0,0;QS=3,0;MQSB=0.901704;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,36,255:12:0	0,18,165:6:0
-X	1437	.	T	<*>	0	.	DP=32;I16=13,19,0,0,1222,47206,0,0,1858,109682,0,0,548,11892,0,0;QS=3,0;MQSB=0.993397;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,33,255:11:0	0,15,161:5:0
-X	1438	.	C	<*>	0	.	DP=30;I16=13,17,0,0,1132,43284,0,0,1738,102482,0,0,554,12028,0,0;QS=3,0;MQSB=0.996503;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,30,251:10:0	0,15,159:5:0
-X	1439	.	T	<*>	0	.	DP=30;I16=13,17,0,0,1110,41602,0,0,1738,102482,0,0,560,12196,0,0;QS=3,0;MQSB=0.996503;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,30,255:10:0	0,15,156:5:0
-X	1440	.	A	<*>	0	.	DP=30;I16=12,16,0,0,1062,41028,0,0,1618,95282,0,0,550,12106,0,0;QS=3,0;MQSB=0.995699;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,27,255:9:0	0,12,144:4:0
-X	1441	.	G	<*>	0	.	DP=30;I16=13,17,0,0,1138,44104,0,0,1738,102482,0,0,574,12576,0,0;QS=3,0;MQSB=0.996503;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,30,244:10:0	0,12,137:4:0
-X	1442	.	G	<*>	0	.	DP=30;I16=13,17,0,0,1064,38534,0,0,1738,102482,0,0,580,12740,0,0;QS=3,0;MQSB=0.996503;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,30,242:10:0	0,12,128:4:0
-X	1443	.	T	<*>	0	.	DP=30;I16=12,17,0,0,1013,36225,0,0,1678,98882,0,0,568,12598,0,0;QS=3,0;MQSB=0.993891;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,30,230:10:0	0,12,133:4:0
-X	1444	.	A	<*>	0	.	DP=30;I16=12,17,0,0,968,33936,0,0,1678,98882,0,0,569,12627,0,0;QS=3,0;MQSB=0.993891;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,27,205:9:0	0,12,132:4:0
-X	1445	.	T	<*>	0	.	DP=30;I16=14,15,0,0,1053,39129,0,0,1678,98882,0,0,585,13161,0,0;QS=3,0;MQSB=0.999762;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,27,237:9:0	0,15,169:5:0
-X	1446	.	T	<*>	0	.	DP=30;I16=13,16,0,0,1051,38675,0,0,1678,98882,0,0,579,12951,0,0;QS=3,0;MQSB=0.997839;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,229:8:0	0,15,164:5:0
-X	1447	.	G	<*>	0	.	DP=30;I16=14,16,0,0,1110,42692,0,0,1738,102482,0,0,606,13612,0,0;QS=3,0;MQSB=0.999136;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,27,229:9:0	0,15,157:5:0
-X	1448	.	G	<*>	0	.	DP=30;I16=13,16,0,0,1037,37759,0,0,1678,98882,0,0,585,13151,0,0;QS=3,0;MQSB=0.997839;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,217:8:0	0,15,150:5:0
-X	1449	.	T	<*>	0	.	DP=30;I16=14,16,0,0,1051,37869,0,0,1738,102482,0,0,612,13870,0,0;QS=3,0;MQSB=0.999136;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,27,230:9:0	0,15,152:5:0
-X	1450	.	A	<*>	0	.	DP=29;I16=13,15,0,0,1039,38785,0,0,1649,98041,0,0,604,13842,0,0;QS=3,0;MQSB=0.956162;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,224:8:0	0,15,165:5:0
-X	1451	.	T	<*>	0	.	DP=29;I16=13,16,0,0,1046,38586,0,0,1709,101641,0,0,616,14042,0,0;QS=3,0;MQSB=0.960189;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,228:8:0	0,15,158:5:0
-X	1452	.	A	<*>	0	.	DP=31;I16=14,16,0,0,1066,38696,0,0,1769,105241,0,0,604,13924,0,0;QS=3,0;MQSB=0.958545;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,218:8:0	0,15,147:5:0
-X	1453	.	T	<*>	0	.	DP=31;I16=13,17,0,0,1107,42059,0,0,1769,105241,0,0,592,13444,0,0;QS=3,0;MQSB=0.963674;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,199:7:0	0,15,165:5:0
-X	1454	.	T	<*>	0	.	DP=31;I16=14,17,0,0,1139,42711,0,0,1829,108841,0,0,617,14045,0,0;QS=3,0;MQSB=0.962133;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,24,234:8:0	0,15,166:5:0
-X	1455	.	G	<*>	0	.	DP=31;I16=13,17,0,0,1107,41765,0,0,1769,105241,0,0,592,13420,0,0;QS=3,0;MQSB=0.963674;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,197:7:0	0,15,148:5:0
-X	1456	.	T	<*>	0	.	DP=31;I16=14,17,0,0,1139,42717,0,0,1829,108841,0,0,617,14069,0,0;QS=3,0;MQSB=0.962133;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,24,215:8:0	0,15,170:5:0
-X	1457	.	G	<*>	0	.	DP=31;I16=14,17,0,0,1129,42071,0,0,1829,108841,0,0,615,14019,0,0;QS=3,0;MQSB=0.962133;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,24,212:8:0	0,15,164:5:0
-X	1458	.	T	<*>	0	.	DP=31;I16=14,17,0,0,1101,40243,0,0,1829,108841,0,0,613,13997,0,0;QS=3,0;MQSB=0.962133;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,24,220:8:0	0,15,165:5:0
-X	1459	.	C	A,<*>	0	.	DP=31;I16=14,16,0,1,1164,45842,24,576,1769,105241,60,3600,608,13948,2,4;QS=2.87234,0.12766,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.962133;BQB=1;MQ0F=0	PL:DP:DV	0,54,255,54,255,255:18:0	0,24,224,24,224,224:8:0	9,0,135,21,138,152:5:1
-X	1460	.	T	<*>	0	.	DP=32;I16=15,17,0,0,1243,48813,0,0,1889,112441,0,0,605,13833,0,0;QS=3,0;MQSB=0.960687;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,24,240:8:0	0,15,170:5:0
-X	1461	.	G	<*>	0	.	DP=32;I16=15,17,0,0,1171,44033,0,0,1889,112441,0,0,600,13692,0,0;QS=3,0;MQSB=0.960687;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,24,224:8:0	0,15,157:5:0
-X	1462	.	C	<*>	0	.	DP=30;I16=14,15,0,0,1102,42216,0,0,1709,101641,0,0,579,13241,0,0;QS=3,0;MQSB=0.954405;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,202:7:0	0,9,112:3:0
-X	1463	.	T	<*>	0	.	DP=30;I16=15,15,0,0,1128,43348,0,0,1769,105241,0,0,592,13396,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,209:7:0	0,12,139:4:0
-X	1464	.	G	<*>	0	.	DP=31;I16=14,16,0,0,1095,40557,0,0,1769,105241,0,0,563,12665,0,0;QS=3,0;MQSB=0.958545;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,18,186:6:0	0,15,144:5:0
-X	1465	.	T	<*>	0	.	DP=31;I16=15,16,0,0,1143,42557,0,0,1829,108841,0,0,584,13164,0,0;QS=3,0;MQSB=0.957006;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,204:7:0	0,15,166:5:0
-X	1466	.	G	<*>	0	.	DP=31;I16=15,16,0,0,1122,42294,0,0,1829,108841,0,0,580,13018,0,0;QS=3,0;MQSB=0.957006;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,206:7:0	0,15,163:5:0
-X	1467	.	A	<*>	0	.	DP=31;I16=14,16,0,0,1031,36341,0,0,1769,105241,0,0,569,12803,0,0;QS=3,0;MQSB=0.958545;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,195:7:0	0,15,155:5:0
-X	1468	.	A	<*>	0	.	DP=30;I16=15,15,0,0,991,34477,0,0,1769,105241,0,0,573,12717,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,177:7:0	0,15,158:5:0
-X	1469	.	C	T,<*>	0	.	DP=31;I16=13,15,1,0,1013,37887,38,1444,1649,98041,60,3600,536,12106,9,81;QS=2.94025,0.0597484,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.954405;BQB=1;MQ0F=0	PL:DP:DV	0,16,255,51,255,255:18:1	0,18,178,18,178,178:6:0	0,15,160,15,160,160:5:0
-X	1470	.	T	<*>	0	.	DP=31;I16=16,15,0,0,1110,41070,0,0,1829,108841,0,0,567,12489,0,0;QS=3,0;MQSB=0.951229;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,210:7:0	0,15,165:5:0
-X	1471	.	G	<*>	0	.	DP=30;I16=16,14,0,0,1051,38425,0,0,1769,105241,0,0,564,12348,0,0;QS=3,0;MQSB=0.946202;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,192:7:0	0,12,128:4:0
-X	1472	.	T	<*>	0	.	DP=30;I16=16,14,0,0,1049,38097,0,0,1769,105241,0,0,561,12237,0,0;QS=3,0;MQSB=0.946202;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,200:7:0	0,12,134:4:0
-X	1473	.	C	<*>	0	.	DP=30;I16=16,14,0,0,1058,38526,0,0,1769,105241,0,0,558,12156,0,0;QS=3,0;MQSB=0.946202;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,175:7:0	0,12,140:4:0
-X	1474	.	C	<*>	0	.	DP=30;I16=16,14,0,0,1120,42756,0,0,1769,105241,0,0,555,12105,0,0;QS=3,0;MQSB=0.946202;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,202:7:0	0,12,141:4:0
-X	1475	.	T	<*>	0	.	DP=29;I16=14,14,0,0,1047,40395,0,0,1649,98041,0,0,537,11827,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,208:7:0	0,12,155:4:0
-X	1476	.	T	G,<*>	0	.	DP=31;I16=15,15,1,0,1056,37884,14,196,1769,105241,60,3600,566,12614,10,100;QS=2.944,0.056,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.951229;BQB=1;MQ0F=0	PL:DP:DV	0,57,255,57,255,255:19:0	0,9,177,21,180,183:8:1	0,12,140,12,140,140:4:0
-X	1477	.	G	<*>	0	.	DP=31;I16=16,15,0,0,1150,43390,0,0,1829,108841,0,0,574,12700,0,0;QS=3,0;MQSB=0.951229;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,24,217:8:0	0,12,138:4:0
-X	1478	.	G	<*>	0	.	DP=31;I16=14,15,0,0,1008,36638,0,0,1709,101641,0,0,542,11982,0,0;QS=3,0;MQSB=0.954405;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,24,208:8:0	0,9,109:3:0
-X	1479	.	C	<*>	0	.	DP=30;I16=15,15,0,0,1061,38671,0,0,1769,105241,0,0,564,12556,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,24,211:8:0	0,9,106:3:0
-X	1480	.	C	<*>	0	.	DP=30;I16=15,15,0,0,1083,40355,0,0,1769,105241,0,0,561,12531,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,24,220:8:0	0,9,103:3:0
-X	1481	.	T	<*>	0	.	DP=30;I16=15,15,0,0,1102,41308,0,0,1769,105241,0,0,558,12532,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,24,235:8:0	0,9,105:3:0
-X	1482	.	G	<*>	0	.	DP=29;I16=15,14,0,0,1044,38550,0,0,1709,101641,0,0,556,12558,0,0;QS=3,0;MQSB=0.947838;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,24,210:8:0	0,6,75:2:0
-X	1483	.	T	<*>	0	.	DP=31;I16=14,16,0,0,1042,37190,0,0,1769,105241,0,0,521,11919,0,0;QS=3,0;MQSB=0.958545;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,21,215:7:0	0,9,100:3:0
-X	1484	.	T	<*>	0	.	DP=31;I16=15,16,0,0,1067,37837,0,0,1829,108841,0,0,547,12587,0,0;QS=3,0;MQSB=0.957006;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,24,216:8:0	0,9,106:3:0
-X	1485	.	T	<*>	0	.	DP=30;I16=15,15,0,0,1027,35863,0,0,1769,105241,0,0,549,12659,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,24,209:8:0	0,9,93:3:0
-X	1486	.	G	<*>	0	.	DP=29;I16=15,14,0,0,1089,41679,0,0,1709,101641,0,0,551,12707,0,0;QS=3,0;MQSB=0.947838;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,198:7:0	0,9,108:3:0
-X	1487	.	G	<*>	0	.	DP=28;I16=14,14,0,0,973,34723,0,0,1649,98041,0,0,554,12778,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,196:7:0	0,9,97:3:0
-X	1488	.	T	<*>	0	.	DP=28;I16=13,14,0,0,928,32432,0,0,1589,94441,0,0,532,12246,0,0;QS=3,0;MQSB=0.951472;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,176:6:0	0,9,102:3:0
-X	1489	.	G	<*>	0	.	DP=27;I16=13,14,0,0,958,35292,0,0,1589,94441,0,0,535,12361,0,0;QS=3,0;MQSB=0.951472;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,174:6:0	0,9,93:3:0
-X	1490	.	A	<*>	0	.	DP=27;I16=13,14,0,0,928,33108,0,0,1589,94441,0,0,538,12446,0,0;QS=3,0;MQSB=0.951472;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,160:5:0	0,9,94:3:0
-X	1491	.	C	<*>	0	.	DP=27;I16=12,13,0,0,798,26812,0,0,1469,87241,0,0,499,11587,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,12,108:4:0	0,9,79:3:0
-X	1492	.	G	<*>	0	.	DP=27;I16=13,14,0,0,893,30927,0,0,1589,94441,0,0,543,12527,0,0;QS=3,0;MQSB=0.951472;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,136:5:0	0,9,100:3:0
-X	1493	.	G	<*>	0	.	DP=27;I16=13,13,0,0,907,32761,0,0,1529,90841,0,0,520,11948,0,0;QS=3,0;MQSB=0.945959;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,155:5:0	0,9,106:3:0
-X	1494	.	G	<*>	0	.	DP=27;I16=13,14,0,0,939,33599,0,0,1589,94441,0,0,547,12639,0,0;QS=3,0;MQSB=0.951472;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,156:5:0	0,9,107:3:0
-X	1495	.	T	<*>	0	.	DP=26;I16=12,13,0,0,814,27700,0,0,1469,87241,0,0,524,12048,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,143:5:0	0,9,105:3:0
-X	1496	.	G	<*>	0	.	DP=26;I16=13,13,0,0,969,36751,0,0,1529,90841,0,0,550,12674,0,0;QS=3,0;MQSB=0.945959;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,157:5:0	0,9,107:3:0
-X	1497	.	A	<*>	0	.	DP=27;I16=12,14,0,0,904,32740,0,0,1529,90841,0,0,525,12019,0,0;QS=3,0;MQSB=0.953497;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,166:5:0	0,9,113:3:0
-X	1498	.	G	<*>	0	.	DP=27;I16=13,14,0,0,1002,37852,0,0,1589,94441,0,0,551,12635,0,0;QS=3,0;MQSB=0.951472;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,153:5:0	0,9,112:3:0
-X	1499	.	G	<*>	0	.	DP=28;I16=14,14,0,0,973,34891,0,0,1649,98041,0,0,551,12599,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,15,146:5:0	0,9,108:3:0
-X	1500	.	A	<*>	0	.	DP=28;I16=14,14,0,0,1023,38115,0,0,1649,98041,0,0,552,12588,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,15,165:5:0	0,9,115:3:0
-X	1501	.	G	<*>	0	.	DP=28;I16=14,14,0,0,1051,40105,0,0,1649,98041,0,0,551,12505,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,15,163:5:0	0,9,100:3:0
-X	1502	.	C	<*>	0	.	DP=27;I16=13,14,0,0,963,35241,0,0,1589,94441,0,0,549,12351,0,0;QS=3,0;MQSB=0.951472;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,140:5:0	0,9,105:3:0
-X	1503	.	A	<*>	0	.	DP=28;I16=14,14,0,0,1026,38252,0,0,1649,98041,0,0,546,12176,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,15,171:5:0	0,9,109:3:0
-X	1504	.	G	<*>	0	.	DP=28;I16=13,14,0,0,1052,41226,0,0,1589,94441,0,0,523,11591,0,0;QS=3,0;MQSB=0.951472;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,163:5:0	0,9,111:3:0
-X	1505	.	G	<*>	0	.	DP=28;I16=14,13,0,0,959,35545,0,0,1589,94441,0,0,517,11295,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,155:5:0	0,9,114:3:0
-X	1506	.	G	<*>	0	.	DP=28;I16=14,14,0,0,1013,37355,0,0,1649,98041,0,0,540,11840,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,15,139:5:0	0,9,112:3:0
-X	1507	.	A	<*>	0	.	DP=28;I16=14,14,0,0,987,35217,0,0,1649,98041,0,0,538,11792,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,15,162:5:0	0,9,114:3:0
-X	1508	.	C	<*>	0	.	DP=28;I16=14,14,0,0,1033,38663,0,0,1649,98041,0,0,535,11727,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,15,137:5:0	0,9,112:3:0
-X	1509	.	A	<*>	0	.	DP=28;I16=15,13,0,0,1028,38610,0,0,1649,98041,0,0,529,11493,0,0;QS=3,0;MQSB=0.942064;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,12,128:4:0	0,9,122:3:0
-X	1510	.	G	<*>	0	.	DP=28;I16=15,13,0,0,1064,40824,0,0,1649,98041,0,0,524,11288,0,0;QS=3,0;MQSB=0.942064;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,12,132:4:0	0,9,111:3:0
-X	1511	.	A	<*>	0	.	DP=28;I16=15,13,0,0,976,34794,0,0,1649,98041,0,0,519,11113,0,0;QS=3,0;MQSB=0.942064;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,12,136:4:0	0,9,110:3:0
-X	1512	.	A	<*>	0	.	DP=28;I16=15,12,0,0,998,37460,0,0,1589,94441,0,0,489,10343,0,0;QS=3,0;MQSB=0.935229;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,12,142:4:0	0,9,110:3:0
-X	1513	.	G	<*>	0	.	DP=28;I16=14,13,0,0,1014,38940,0,0,1589,94441,0,0,497,10709,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,12,134:4:0	0,9,108:3:0
-X	1514	.	G	<*>	0	.	DP=28;I16=15,13,0,0,1054,39954,0,0,1649,98041,0,0,504,10768,0,0;QS=3,0;MQSB=0.942064;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,12,134:4:0	0,9,108:3:0
-X	1515	.	G	<*>	0	.	DP=28;I16=14,13,0,0,948,34152,0,0,1589,94441,0,0,488,10564,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,12,133:4:0	0,9,101:3:0
-X	1516	.	T	<*>	0	.	DP=27;I16=12,13,0,0,811,27385,0,0,1469,87241,0,0,472,10338,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,12,117:4:0	0,9,106:3:0
-X	1517	.	C	<*>	0	.	DP=27;I16=13,13,0,0,943,35153,0,0,1529,90841,0,0,478,10380,0,0;QS=3,0;MQSB=0.945959;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,12,134:4:0	0,9,97:3:0
-X	1518	.	C	<*>	0	.	DP=28;I16=13,12,0,0,908,33852,0,0,1469,87241,0,0,427,9261,0,0;QS=3,0;MQSB=0.939413;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,12,132:4:0	0,9,96:3:0
-X	1519	.	T	<*>	0	.	DP=28;I16=15,13,0,0,988,35808,0,0,1649,98041,0,0,475,10337,0,0;QS=3,0;MQSB=0.942064;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,15,154:5:0	0,9,110:3:0
-X	1520	.	G	<*>	0	.	DP=29;I16=16,13,0,0,1005,36307,0,0,1709,101641,0,0,470,10328,0,0;QS=3,0;MQSB=0.940317;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,18,150:6:0	0,9,104:3:0
-X	1521	.	C	<*>	0	.	DP=28;I16=16,12,0,0,900,30324,0,0,1649,98041,0,0,466,10300,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,18,164:6:0	0,9,88:3:0
-X	1522	.	G	<*>	0	.	DP=27;I16=15,10,0,0,784,25144,0,0,1469,87241,0,0,442,9956,0,0;QS=3,0;MQSB=0.9171;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,110:5:0	0,9,91:3:0
-X	1523	.	T	<*>	0	.	DP=27;I16=16,11,0,0,921,32001,0,0,1589,94441,0,0,457,10189,0,0;QS=3,0;MQSB=0.925036;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,136:5:0	0,9,108:3:0
-X	1524	.	G	<*>	0	.	DP=27;I16=16,10,0,0,932,34140,0,0,1529,90841,0,0,453,10153,0,0;QS=3,0;MQSB=0.914947;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,12,108:4:0	0,9,103:3:0
-X	1525	.	C	<*>	0	.	DP=27;I16=16,11,0,0,972,35704,0,0,1589,94441,0,0,473,10719,0,0;QS=3,0;MQSB=0.925036;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,12,113:4:0	0,9,112:3:0
-X	1526	.	C	<*>	0	.	DP=25;I16=14,11,0,0,883,31843,0,0,1469,87241,0,0,470,10684,0,0;QS=3,0;MQSB=0.929204;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,12,109:4:0	0,9,106:3:0
-X	1527	.	C	<*>	0	.	DP=24;I16=14,10,0,0,867,31999,0,0,1440,86400,0,0,466,10572,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,107:4:0	0,9,112:3:0
-X	1528	.	T	<*>	0	.	DP=23;I16=13,10,0,0,869,33133,0,0,1380,82800,0,0,463,10483,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,114:4:0	0,9,113:3:0
-X	1529	.	G	<*>	0	.	DP=23;I16=13,10,0,0,812,29432,0,0,1380,82800,0,0,459,10365,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,108:4:0	0,9,104:3:0
-X	1530	.	C	<*>	0	.	DP=24;I16=13,10,0,0,819,30073,0,0,1380,82800,0,0,446,10186,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,137:5:0	0,9,106:3:0
-X	1531	.	C	<*>	0	.	DP=24;I16=13,11,0,0,877,32969,0,0,1440,86400,0,0,452,10190,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,144:5:0	0,9,105:3:0
-X	1532	.	T	<*>	0	.	DP=24;I16=13,11,0,0,887,33721,0,0,1440,86400,0,0,449,10135,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,165:5:0	0,9,120:3:0
-X	1533	.	T	<*>	0	.	DP=23;I16=13,10,0,0,793,27987,0,0,1380,82800,0,0,447,10101,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,146:5:0	0,9,107:3:0
-X	1534	.	C	<*>	0	.	DP=23;I16=14,9,0,0,847,31627,0,0,1380,82800,0,0,446,10086,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,153:5:0	0,9,109:3:0
-X	1535	.	A	<*>	0	.	DP=23;I16=14,9,0,0,770,26604,0,0,1380,82800,0,0,444,9990,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,144:5:0	0,9,99:3:0
-X	1536	.	C	<*>	0	.	DP=24;I16=15,9,0,0,826,28984,0,0,1440,86400,0,0,442,9914,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,138:5:0	0,9,110:3:0
-X	1537	.	A	<*>	0	.	DP=24;I16=14,9,0,0,844,31384,0,0,1380,82800,0,0,416,9234,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,149:5:0	0,9,115:3:0
-X	1538	.	A	<*>	0	.	DP=24;I16=15,9,0,0,909,34727,0,0,1440,86400,0,0,440,9826,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,154:5:0	0,9,112:3:0
-X	1539	.	G	<*>	0	.	DP=24;I16=15,9,0,0,913,35327,0,0,1440,86400,0,0,439,9815,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,149:5:0	0,9,117:3:0
-X	1540	.	C	<*>	0	.	DP=23;I16=15,8,0,0,828,30260,0,0,1380,82800,0,0,438,9776,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,146:5:0	0,9,102:3:0
-X	1541	.	C	<*>	0	.	DP=23;I16=15,8,0,0,823,30615,0,0,1380,82800,0,0,437,9759,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,142:5:0	0,9,108:3:0
-X	1542	.	C	<*>	0	.	DP=25;I16=16,8,0,0,893,33843,0,0,1440,86400,0,0,435,9715,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,147:5:0	0,12,131:4:0
-X	1543	.	C	<*>	0	.	DP=25;I16=16,8,0,0,880,33206,0,0,1440,86400,0,0,434,9696,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,141:5:0	0,12,136:4:0
-X	1544	.	T	<*>	0	.	DP=25;I16=16,8,0,0,899,34405,0,0,1440,86400,0,0,431,9603,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,150:5:0	0,12,148:4:0
-X	1545	.	G	<*>	0	.	DP=25;I16=16,8,0,0,874,32636,0,0,1440,86400,0,0,428,9536,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,146:5:0	0,12,129:4:0
-X	1546	.	G	<*>	0	.	DP=24;I16=15,8,0,0,796,28796,0,0,1380,82800,0,0,425,9443,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,130:5:0	0,9,110:3:0
-X	1547	.	A	<*>	0	.	DP=23;I16=15,8,0,0,837,30945,0,0,1380,82800,0,0,448,9996,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,176:6:0	0,9,112:3:0
-X	1548	.	A	<*>	0	.	DP=23;I16=14,8,0,0,812,30830,0,0,1320,79200,0,0,421,9319,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,173:5:0	0,9,115:3:0
-X	1549	.	G	<*>	0	.	DP=23;I16=15,8,0,0,870,33642,0,0,1380,82800,0,0,444,9912,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,174:6:0	0,9,114:3:0
-X	1550	.	G	<*>	0	.	DP=23;I16=15,8,0,0,790,28502,0,0,1380,82800,0,0,442,9900,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,154:6:0	0,9,109:3:0
-X	1551	.	A	<*>	0	.	DP=23;I16=15,8,0,0,802,28596,0,0,1380,82800,0,0,440,9908,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,173:6:0	0,9,107:3:0
-X	1552	.	A	<*>	0	.	DP=21;I16=14,7,0,0,792,30156,0,0,1260,75600,0,0,438,9836,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,196:6:0	0,9,110:3:0
-X	1553	.	A	<*>	0	.	DP=21;I16=13,7,0,0,738,28112,0,0,1200,72000,0,0,411,9159,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,251:11:0	0,18,192:6:0	0,9,115:3:0
-X	1554	.	G	<*>	0	.	DP=21;I16=14,7,0,0,763,28221,0,0,1260,75600,0,0,434,9752,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,171:6:0	0,9,101:3:0
-X	1555	.	T	<*>	0	.	DP=21;I16=14,7,0,0,726,26234,0,0,1260,75600,0,0,432,9740,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,252:12:0	0,18,169:6:0	0,9,108:3:0
-X	1556	.	T	<*>	0	.	DP=21;I16=14,7,0,0,745,26971,0,0,1260,75600,0,0,429,9697,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,253:12:0	0,18,177:6:0	0,9,110:3:0
-X	1557	.	G	<*>	0	.	DP=22;I16=15,7,0,0,801,29689,0,0,1320,79200,0,0,426,9672,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,166:6:0	0,9,101:3:0
-X	1558	.	T	<*>	0	.	DP=22;I16=15,6,0,0,720,25620,0,0,1260,75600,0,0,404,9244,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,131:5:0	0,9,112:3:0
-X	1559	.	T	<*>	0	.	DP=22;I16=15,7,0,0,712,24690,0,0,1320,79200,0,0,417,9439,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,248:13:0	0,18,158:6:0	0,9,103:3:0
-X	1560	.	T	<*>	0	.	DP=21;I16=14,7,0,0,736,26560,0,0,1260,75600,0,0,412,9284,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,251:12:0	0,18,170:6:0	0,9,112:3:0
-X	1561	.	T	<*>	0	.	DP=21;I16=14,7,0,0,706,24776,0,0,1260,75600,0,0,406,9102,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,241:12:0	0,18,174:6:0	0,9,106:3:0
-X	1562	.	G	<*>	0	.	DP=21;I16=14,7,0,0,765,28655,0,0,1260,75600,0,0,399,8893,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,181:6:0	0,9,108:3:0
-X	1563	.	G	<*>	0	.	DP=22;I16=13,7,0,0,713,26255,0,0,1200,72000,0,0,360,8176,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,147:5:0	0,9,108:3:0
-X	1564	.	G	<*>	0	.	DP=22;I16=13,8,0,0,721,25457,0,0,1260,75600,0,0,368,8218,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,173:6:0	0,9,95:3:0
-X	1565	.	A	<*>	0	.	DP=21;I16=14,7,0,0,724,25888,0,0,1260,75600,0,0,380,8352,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,162:6:0	0,6,71:2:0
-X	1566	.	T	<*>	0	.	DP=21;I16=13,7,0,0,698,25286,0,0,1200,72000,0,0,364,8086,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,143:5:0	0,6,78:2:0
-X	1567	.	C	<*>	0	.	DP=20;I16=12,6,0,0,652,24422,0,0,1080,64800,0,0,351,7881,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,104:3:0	0,6,72:2:0
-X	1568	.	T	<*>	0	.	DP=20;I16=13,7,0,0,711,26125,0,0,1200,72000,0,0,363,7871,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,157:5:0	0,6,74:2:0
-X	1569	.	C	<*>	0	.	DP=19;I16=12,6,0,0,676,25850,0,0,1080,64800,0,0,351,7669,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,128:4:0	0,6,76:2:0
-X	1570	.	T	<*>	0	.	DP=19;I16=12,7,0,0,700,26750,0,0,1140,68400,0,0,353,7583,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,149:5:0	0,6,71:2:0
-X	1571	.	G	<*>	0	.	DP=19;I16=12,6,0,0,639,23361,0,0,1080,64800,0,0,343,7441,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,125:4:0	0,6,70:2:0
-X	1572	.	C	<*>	0	.	DP=19;I16=11,6,0,0,640,24568,0,0,1020,61200,0,0,328,7202,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,125:4:0	0,6,70:2:0
-X	1573	.	A	<*>	0	.	DP=19;I16=11,4,0,0,565,21475,0,0,900,54000,0,0,304,6900,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,132:4:0	0,3,40:1:0
-X	1574	.	C	<*>	0	.	DP=19;I16=12,5,0,0,636,24076,0,0,1020,61200,0,0,318,6948,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,128:4:0	0,3,38:1:0
-X	1575	.	C	<*>	0	.	DP=19;I16=11,6,0,0,610,22742,0,0,1020,61200,0,0,296,6272,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,125:4:0	0,6,71:2:0
-X	1576	.	C	<*>	0	.	DP=19;I16=12,6,0,0,675,25821,0,0,1080,64800,0,0,315,6785,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,133:4:0	0,6,78:2:0
-X	1577	.	T	<*>	0	.	DP=17;I16=11,6,0,0,650,25330,0,0,1020,61200,0,0,310,6692,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,118:3:0	0,6,77:2:0
-X	1578	.	C	<*>	0	.	DP=17;I16=10,6,0,0,622,24364,0,0,960,57600,0,0,279,5943,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,84:2:0	0,6,77:2:0
-X	1579	.	A	<*>	0	.	DP=17;I16=11,6,0,0,596,22326,0,0,1020,61200,0,0,298,6464,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,116:3:0	0,6,80:2:0
-X	1580	.	G	<*>	0	.	DP=17;I16=11,6,0,0,651,25195,0,0,1020,61200,0,0,292,6380,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,109:3:0	0,6,77:2:0
-X	1581	.	C	<*>	0	.	DP=17;I16=11,6,0,0,586,21418,0,0,1020,61200,0,0,286,6316,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,103:3:0	0,6,71:2:0
-X	1582	.	C	<*>	0	.	DP=18;I16=11,7,0,0,639,23491,0,0,1080,64800,0,0,280,6272,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,109:3:0	0,6,75:2:0
-X	1583	.	T	<*>	0	.	DP=16;I16=10,6,0,0,591,22349,0,0,960,57600,0,0,276,6196,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,112:3:0	0,6,74:2:0
-X	1584	.	G	<*>	0	.	DP=15;I16=10,5,0,0,563,21283,0,0,900,54000,0,0,272,6086,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,105:3:0	0,3,39:1:0
-X	1585	.	G	<*>	0	.	DP=16;I16=10,5,0,0,494,17160,0,0,900,54000,0,0,251,5703,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,244:11:0	0,9,103:3:0	0,3,30:1:0
-X	1586	.	A	<*>	0	.	DP=15;I16=10,3,0,0,470,17200,0,0,780,46800,0,0,237,5273,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,223:10:0	0,6,79:2:0	0,3,42:1:0
-X	1587	.	C	<*>	0	.	DP=15;I16=11,4,0,0,508,17900,0,0,900,54000,0,0,264,5852,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,247:11:0	0,9,94:3:0	0,3,31:1:0
-X	1588	.	A	<*>	0	.	DP=15;I16=11,4,0,0,511,17939,0,0,900,54000,0,0,262,5806,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,232:11:0	0,9,105:3:0	0,3,41:1:0
-X	1589	.	A	<*>	0	.	DP=15;I16=11,4,0,0,536,19584,0,0,900,54000,0,0,259,5725,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,249:11:0	0,9,106:3:0	0,3,42:1:0
-X	1590	.	C	<*>	0	.	DP=15;I16=10,5,0,0,514,18228,0,0,900,54000,0,0,257,5657,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,231:10:0	0,9,104:3:0	0,6,71:2:0
-X	1591	.	T	<*>	0	.	DP=15;I16=10,5,0,0,515,18559,0,0,900,54000,0,0,256,5602,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,241:10:0	0,9,85:3:0	0,6,73:2:0
-X	1592	.	T	<*>	0	.	DP=15;I16=10,5,0,0,503,17345,0,0,900,54000,0,0,255,5561,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,225:10:0	0,9,107:3:0	0,6,62:2:0
-X	1593	.	G	<*>	0	.	DP=15;I16=10,5,0,0,540,19930,0,0,900,54000,0,0,254,5534,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,250:10:0	0,9,106:3:0	0,6,60:2:0
-X	1594	.	T	<*>	0	.	DP=15;I16=10,5,0,0,535,19445,0,0,900,54000,0,0,252,5472,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,234:10:0	0,9,106:3:0	0,6,80:2:0
-X	1595	.	G	<*>	0	.	DP=15;I16=10,4,0,0,494,17940,0,0,840,50400,0,0,225,4801,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,213:9:0	0,9,105:3:0	0,6,69:2:0
-X	1596	.	C	<*>	0	.	DP=15;I16=10,4,0,0,479,17011,0,0,840,50400,0,0,233,5151,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,200:9:0	0,9,111:3:0	0,6,74:2:0
-X	1597	.	C	<*>	0	.	DP=15;I16=10,5,0,0,489,16941,0,0,900,54000,0,0,245,5285,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,195:9:0	0,12,127:4:0	0,6,73:2:0
-X	1598	.	C	<*>	0	.	DP=15;I16=10,5,0,0,514,18282,0,0,900,54000,0,0,244,5240,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,207:9:0	0,12,133:4:0	0,6,68:2:0
-X	1599	.	A	<*>	0	.	DP=14;I16=8,5,0,0,436,15330,0,0,780,46800,0,0,225,4851,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,182:8:0	0,9,103:3:0	0,6,76:2:0
-X	1600	.	T	<*>	0	.	DP=13;I16=8,5,0,0,456,16430,0,0,780,46800,0,0,226,4876,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,193:8:0	0,9,105:3:0	0,6,79:2:0
-X	1601	.	C	<*>	0	.	DP=13;I16=8,4,0,0,431,15861,0,0,720,43200,0,0,208,4554,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,171:7:0	0,9,108:3:0	0,6,78:2:0
-X	1602	.	T	<*>	0	.	DP=13;I16=7,5,0,0,439,16867,0,0,720,43200,0,0,228,4968,0,0;QS=3,0;MQSB=0.95494;MQ0F=0	PL:DP:DV	0,21,179:7:0	0,9,115:3:0	0,6,85:2:0
-X	1603	.	G	<*>	0	.	DP=12;I16=7,5,0,0,455,17407,0,0,720,43200,0,0,230,5034,0,0;QS=3,0;MQSB=0.95494;MQ0F=0	PL:DP:DV	0,21,202:7:0	0,9,111:3:0	0,6,75:2:0
-X	1604	.	G	<*>	0	.	DP=12;I16=7,5,0,0,362,11620,0,0,720,43200,0,0,232,5112,0,0;QS=3,0;MQSB=0.95494;MQ0F=0	PL:DP:DV	0,21,163:7:0	0,9,84:3:0	0,6,66:2:0
-X	1605	.	T	<*>	0	.	DP=12;I16=7,5,0,0,410,14230,0,0,720,43200,0,0,234,5202,0,0;QS=3,0;MQSB=0.95494;MQ0F=0	PL:DP:DV	0,21,190:7:0	0,9,97:3:0	0,6,61:2:0
-X	1606	.	G	<*>	0	.	DP=12;I16=7,4,0,0,370,12738,0,0,660,39600,0,0,211,4679,0,0;QS=3,0;MQSB=0.964642;MQ0F=0	PL:DP:DV	0,18,165:6:0	0,9,91:3:0	0,6,56:2:0
-X	1607	.	A	<*>	0	.	DP=12;I16=7,4,0,0,337,11369,0,0,660,39600,0,0,226,5222,0,0;QS=3,0;MQSB=0.964642;MQ0F=0	PL:DP:DV	0,21,161:7:0	0,6,70:2:0	0,6,55:2:0
-X	1608	.	C	<*>	0	.	DP=12;I16=7,4,0,0,366,12898,0,0,660,39600,0,0,211,4727,0,0;QS=3,0;MQSB=0.964642;MQ0F=0	PL:DP:DV	0,18,141:6:0	0,9,111:3:0	0,6,62:2:0
-X	1609	.	C	<*>	0	.	DP=11;I16=6,5,0,0,365,12889,0,0,660,39600,0,0,237,5393,0,0;QS=3,0;MQSB=0.950952;MQ0F=0	PL:DP:DV	0,18,149:6:0	0,9,110:3:0	0,6,71:2:0
-X	1610	.	C	<*>	0	.	DP=11;I16=5,5,0,0,313,10713,0,0,600,36000,0,0,213,4819,0,0;QS=3,0;MQSB=0.952347;MQ0F=0	PL:DP:DV	0,15,127:5:0	0,9,106:3:0	0,6,57:2:0
-X	1611	.	C	<*>	0	.	DP=11;I16=6,5,0,0,398,14904,0,0,660,39600,0,0,238,5454,0,0;QS=3,0;MQSB=0.950952;MQ0F=0	PL:DP:DV	0,18,180:6:0	0,9,110:3:0	0,6,67:2:0
-X	1612	.	T	<*>	0	.	DP=11;I16=6,5,0,0,409,15421,0,0,660,39600,0,0,238,5472,0,0;QS=3,0;MQSB=0.950952;MQ0F=0	PL:DP:DV	0,18,174:6:0	0,9,107:3:0	0,6,83:2:0
-X	1613	.	C	<*>	0	.	DP=11;I16=6,5,0,0,372,12904,0,0,660,39600,0,0,238,5498,0,0;QS=3,0;MQSB=0.950952;MQ0F=0	PL:DP:DV	0,18,169:6:0	0,9,99:3:0	0,6,63:2:0
-X	1614	.	A	<*>	0	.	DP=11;I16=6,5,0,0,353,12139,0,0,660,39600,0,0,238,5532,0,0;QS=3,0;MQSB=0.950952;MQ0F=0	PL:DP:DV	0,18,147:6:0	0,9,98:3:0	0,6,69:2:0
-X	1615	.	C	<*>	0	.	DP=11;I16=6,5,0,0,366,13080,0,0,660,39600,0,0,238,5574,0,0;QS=3,0;MQSB=0.950952;MQ0F=0	PL:DP:DV	0,18,171:6:0	0,9,105:3:0	0,6,51:2:0
-X	1616	.	T	<*>	0	.	DP=11;I16=6,3,0,0,348,13606,0,0,540,32400,0,0,187,4323,0,0;QS=3,0;MQSB=0.924584;MQ0F=0	PL:DP:DV	0,15,159:5:0	0,9,105:3:0	0,3,42:1:0
-X	1617	.	C	<*>	0	.	DP=12;I16=6,3,0,0,330,12316,0,0,540,32400,0,0,185,4279,0,0;QS=3,0;MQSB=0.924584;MQ0F=0	PL:DP:DV	0,15,146:5:0	0,9,105:3:0	0,3,42:1:0
-X	1618	.	A	<*>	0	.	DP=12;I16=5,6,0,0,385,14199,0,0,629,36841,0,0,244,5636,0,0;QS=3,0;MQSB=0.891517;MQ0F=0	PL:DP:DV	0,18,151:6:0	0,9,93:3:0	0,6,81:2:0
-X	1619	.	G	<*>	0	.	DP=11;I16=5,6,0,0,377,13119,0,0,629,36841,0,0,242,5544,0,0;QS=3,0;MQSB=0.891517;MQ0F=0	PL:DP:DV	0,18,166:6:0	0,9,84:3:0	0,6,67:2:0
-X	1620	.	C	<*>	0	.	DP=11;I16=5,5,0,0,323,10965,0,0,569,33241,0,0,215,4839,0,0;QS=3,0;MQSB=0.857112;MQ0F=0	PL:DP:DV	0,15,142:5:0	0,9,78:3:0	0,6,56:2:0
-X	1621	.	C	<*>	0	.	DP=12;I16=5,7,0,0,363,11779,0,0,689,40441,0,0,263,6021,0,0;QS=3,0;MQSB=0.896474;MQ0F=0	PL:DP:DV	0,21,174:7:0	0,9,80:3:0	0,6,56:2:0
-X	1622	.	A	<*>	0	.	DP=12;I16=5,7,0,0,365,12105,0,0,689,40441,0,0,261,5965,0,0;QS=3,0;MQSB=0.896474;MQ0F=0	PL:DP:DV	0,21,176:7:0	0,9,81:3:0	0,6,52:2:0
-X	1623	.	C	<*>	0	.	DP=12;I16=5,5,0,0,325,10979,0,0,569,33241,0,0,208,4620,0,0;QS=3,0;MQSB=0.857112;MQ0F=0	PL:DP:DV	0,18,155:6:0	0,9,84:3:0	0,3,37:1:0
-X	1624	.	C	<*>	0	.	DP=12;I16=4,6,0,0,336,11718,0,0,569,33241,0,0,211,4799,0,0;QS=3,0;MQSB=0.895781;MQ0F=0	PL:DP:DV	0,18,162:6:0	0,9,88:3:0	0,3,39:1:0
-X	1625	.	A	<*>	0	.	DP=12;I16=4,7,0,0,375,13503,0,0,629,36841,0,0,234,5386,0,0;QS=3,0;MQSB=0.924449;MQ0F=0	PL:DP:DV	0,18,158:6:0	0,9,93:3:0	0,6,80:2:0
-X	1626	.	G	<*>	0	.	DP=12;I16=5,7,0,0,358,11490,0,0,689,40441,0,0,249,5645,0,0;QS=3,0;MQSB=0.896474;MQ0F=0	PL:DP:DV	0,21,158:7:0	0,9,83:3:0	0,6,63:2:0
-X	1627	.	A	<*>	0	.	DP=12;I16=5,7,0,0,363,11609,0,0,689,40441,0,0,246,5590,0,0;QS=3,0;MQSB=0.896474;MQ0F=0	PL:DP:DV	0,21,165:7:0	0,9,75:3:0	0,6,72:2:0
-X	1628	.	C	<*>	0	.	DP=12;I16=5,7,0,0,357,11583,0,0,689,40441,0,0,243,5545,0,0;QS=3,0;MQSB=0.896474;MQ0F=0	PL:DP:DV	0,21,165:7:0	0,9,80:3:0	0,6,57:2:0
-X	1629	.	T	<*>	0	.	DP=13;I16=6,7,0,0,451,16079,0,0,749,44041,0,0,240,5510,0,0;QS=3,0;MQSB=0.899815;MQ0F=0	PL:DP:DV	0,21,187:7:0	0,12,120:4:0	0,6,79:2:0
-X	1630	.	T	<*>	0	.	DP=13;I16=6,7,0,0,403,13323,0,0,749,44041,0,0,237,5435,0,0;QS=3,0;MQSB=0.899815;MQ0F=0	PL:DP:DV	0,21,169:7:0	0,12,111:4:0	0,6,73:2:0
-X	1631	.	C	<*>	0	.	DP=12;I16=6,5,0,0,354,12046,0,0,660,39600,0,0,210,4744,0,0;QS=3,0;MQSB=0.950952;MQ0F=0	PL:DP:DV	0,21,184:7:0	0,6,67:2:0	0,6,61:2:0
-X	1632	.	C	<*>	0	.	DP=13;I16=6,7,0,0,387,12175,0,0,749,44041,0,0,232,5262,0,0;QS=3,0;MQSB=0.899815;MQ0F=0	PL:DP:DV	0,24,188:8:0	0,9,82:3:0	0,6,61:2:0
-X	1633	.	A	<*>	0	.	DP=13;I16=6,7,0,0,404,13272,0,0,749,44041,0,0,230,5166,0,0;QS=3,0;MQSB=0.899815;MQ0F=0	PL:DP:DV	0,24,183:8:0	0,9,86:3:0	0,6,73:2:0
-X	1634	.	C	<*>	0	.	DP=13;I16=6,6,0,0,328,9716,0,0,689,40441,0,0,203,4457,0,0;QS=3,0;MQSB=0.864013;MQ0F=0	PL:DP:DV	0,21,151:7:0	0,9,80:3:0	0,6,59:2:0
-X	1635	.	G	<*>	0	.	DP=14;I16=6,8,0,0,419,12831,0,0,809,47641,0,0,226,5010,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,24,180:8:0	0,12,108:4:0	0,6,59:2:0
-X	1636	.	A	<*>	0	.	DP=14;I16=6,8,0,0,418,13400,0,0,809,47641,0,0,225,4951,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,24,179:8:0	0,12,110:4:0	0,6,66:2:0
-X	1637	.	C	<*>	0	.	DP=14;I16=6,8,0,0,422,13498,0,0,809,47641,0,0,224,4906,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,24,185:8:0	0,12,110:4:0	0,6,60:2:0
-X	1638	.	A	<*>	0	.	DP=17;I16=9,7,0,0,513,17167,0,0,929,54841,0,0,216,4790,0,0;QS=3,0;MQSB=0.892753;MQ0F=0	PL:DP:DV	0,24,191:8:0	0,18,149:6:0	0,6,78:2:0
-X	1639	.	G	<*>	0	.	DP=17;I16=9,8,0,0,552,18844,0,0,989,58441,0,0,223,4765,0,0;QS=3,0;MQSB=0.91051;MQ0F=0	PL:DP:DV	0,27,228:9:0	0,18,150:6:0	0,6,68:2:0
-X	1640	.	G	<*>	0	.	DP=17;I16=8,6,0,0,414,13296,0,0,809,47641,0,0,171,3467,0,0;QS=3,0;MQSB=0.875173;MQ0F=0	PL:DP:DV	0,18,150:6:0	0,18,151:6:0	0,6,51:2:0
-X	1641	.	C	<*>	0	.	DP=18;I16=9,8,0,0,511,16289,0,0,989,58441,0,0,225,4709,0,0;QS=3,0;MQSB=0.91051;MQ0F=0	PL:DP:DV	0,27,188:9:0	0,18,167:6:0	0,6,65:2:0
-X	1642	.	T	<*>	0	.	DP=17;I16=8,7,0,0,519,18513,0,0,869,51241,0,0,217,4613,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,18,170:6:0	0,18,168:6:0	0,9,102:3:0
-X	1643	.	C	<*>	0	.	DP=16;I16=7,9,0,0,508,16910,0,0,929,54841,0,0,255,5361,0,0;QS=3,0;MQSB=0.933674;MQ0F=0	PL:DP:DV	0,24,193:8:0	0,18,169:6:0	0,6,56:2:0
-X	1644	.	C	<*>	0	.	DP=15;I16=6,9,0,0,514,18056,0,0,869,51241,0,0,259,5401,0,0;QS=3,0;MQSB=0.939413;MQ0F=0	PL:DP:DV	0,21,209:7:0	0,18,165:6:0	0,6,54:2:0
-X	1645	.	A	<*>	0	.	DP=15;I16=6,9,0,0,520,18852,0,0,869,51241,0,0,263,5457,0,0;QS=3,0;MQSB=0.939413;MQ0F=0	PL:DP:DV	0,21,213:7:0	0,18,173:6:0	0,6,49:2:0
-X	1646	.	G	<*>	0	.	DP=15;I16=6,7,0,0,440,15526,0,0,780,46800,0,0,217,4279,0,0;QS=3,0;MQSB=0.961166;MQ0F=0	PL:DP:DV	0,18,185:6:0	0,15,148:5:0	0,6,48:2:0
-X	1647	.	C	<*>	0	.	DP=15;I16=6,9,0,0,433,13883,0,0,869,51241,0,0,271,5617,0,0;QS=3,0;MQSB=0.939413;MQ0F=0	PL:DP:DV	0,21,190:7:0	0,18,139:6:0	0,6,35:2:0
-X	1648	.	C	<*>	0	.	DP=15;I16=6,9,0,0,495,16965,0,0,869,51241,0,0,275,5721,0,0;QS=3,0;MQSB=0.939413;MQ0F=0	PL:DP:DV	0,21,203:7:0	0,18,159:6:0	0,6,44:2:0
-X	1649	.	T	<*>	0	.	DP=15;I16=6,9,0,0,516,18122,0,0,869,51241,0,0,279,5841,0,0;QS=3,0;MQSB=0.939413;MQ0F=0	PL:DP:DV	0,21,187:7:0	0,18,182:6:0	0,6,56:2:0
-X	1650	.	C	<*>	0	.	DP=15;I16=6,7,0,0,405,13551,0,0,749,44041,0,0,240,5028,0,0;QS=3,0;MQSB=0.899815;MQ0F=0	PL:DP:DV	0,18,161:6:0	0,18,169:6:0	0,3,13:1:0
-X	1651	.	G	<*>	0	.	DP=17;I16=5,9,0,0,424,13328,0,0,778,44882,0,0,249,5335,0,0;QS=3,0;MQSB=0.965069;MQ0F=0	PL:DP:DV	0,18,150:6:0	0,15,128:5:0	0,9,86:3:0
-X	1652	.	G	<*>	0	.	DP=18;I16=7,9,0,0,532,18602,0,0,898,52082,0,0,267,5673,0,0;QS=3,0;MQSB=0.994413;MQ0F=0	PL:DP:DV	0,24,212:8:0	0,18,168:6:0	0,6,54:2:0
-X	1653	.	C	<*>	0	.	DP=18;I16=8,10,0,0,581,19565,0,0,1018,59282,0,0,300,6490,0,0;QS=3,0;MQSB=0.99606;MQ0F=0	PL:DP:DV	0,24,208:8:0	0,21,175:7:0	0,9,82:3:0
-X	1654	.	A	T,<*>	0	.	DP=18;I16=8,9,0,1,516,16718,15,225,958,55682,60,3600,285,6219,22,484;QS=2.93213,0.0678733,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.99606;BQB=1;MQ0F=0	PL:DP:DV	0,9,155,21,158,162:8:1	0,21,179,21,179,179:7:0	0,9,78,9,78,78:3:0
-X	1655	.	C	<*>	0	.	DP=18;I16=8,10,0,0,565,19017,0,0,1018,59282,0,0,313,6887,0,0;QS=3,0;MQSB=0.99606;MQ0F=0	PL:DP:DV	0,24,198:8:0	0,21,180:7:0	0,9,79:3:0
-X	1656	.	C	<*>	0	.	DP=19;I16=9,9,0,0,557,18013,0,0,1018,59282,0,0,295,6515,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,202:8:0	0,21,165:7:0	0,9,80:3:0
-X	1657	.	T	A,<*>	0	.	DP=18;I16=8,9,0,1,580,20362,15,225,989,58441,29,841,301,6641,25,625;QS=2.93243,0.0675676,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.99606;BQB=1;MQ0F=0	PL:DP:DV	0,24,206,24,206,206:8:0	0,6,158,18,161,165:7:1	0,9,85,9,85,85:3:0
-X	1658	.	T	<*>	0	.	DP=19;I16=8,10,0,0,573,19127,0,0,1018,59282,0,0,332,7412,0,0;QS=3,0;MQSB=0.99606;MQ0F=0	PL:DP:DV	0,24,187:8:0	0,21,189:7:0	0,9,91:3:0
-X	1659	.	C	<*>	0	.	DP=20;I16=8,10,0,0,609,21517,0,0,1049,62041,0,0,338,7578,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,24,219:8:0	0,21,189:7:0	0,9,80:3:0
-X	1660	.	A	<*>	0	.	DP=21;I16=8,11,0,0,641,23219,0,0,1078,62882,0,0,385,8901,0,0;QS=3,0;MQSB=0.992359;MQ0F=0	PL:DP:DV	0,21,172:7:0	0,24,219:8:0	0,12,127:4:0
-X	1661	.	G	<*>	0	.	DP=21;I16=7,13,0,0,639,21739,0,0,1107,63723,0,0,412,9598,0,0;QS=3,0;MQSB=0.999215;MQ0F=0	PL:DP:DV	0,24,209:8:0	0,24,193:8:0	0,12,98:4:0
-X	1662	.	C	<*>	0	.	DP=21;I16=8,12,0,0,641,21423,0,0,1107,63723,0,0,407,9465,0,0;QS=3,0;MQSB=0.988166;MQ0F=0	PL:DP:DV	0,21,192:7:0	0,27,211:9:0	0,12,100:4:0
-X	1663	.	C	<*>	0	.	DP=20;I16=7,11,0,0,577,19507,0,0,1018,59282,0,0,394,9204,0,0;QS=3,0;MQSB=0.983729;MQ0F=0	PL:DP:DV	0,21,178:7:0	0,21,192:7:0	0,12,101:4:0
-X	1664	.	A	C,<*>	0	.	DP=20;I16=6,10,0,1,530,17982,13,169,898,52082,29,841,358,8422,25,625;QS=2.93953,0.0604651,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.998738;BQB=1;MQ0F=0	PL:DP:DV	0,18,167,18,167,167:6:0	0,7,154,18,157,159:7:1	0,12,109,12,109,109:4:0
-X	1665	.	T	C,<*>	0	.	DP=20;I16=7,11,1,1,592,20170,58,1924,1018,59282,89,4441,396,9188,39,821;QS=2.5913,0.408696,0;VDB=0.1;SGB=0.346553;RPB=0.222222;MQB=0.611111;MQSB=0.988166;BQB=0.944444;MQ0F=0	PL:DP:DV	0,21,185,21,185,185:7:0	0,27,222,27,222,222:9:0	35,0,51,41,57,90:4:2
-X	1666	.	G	<*>	0	.	DP=20;I16=8,12,0,0,614,19760,0,0,1107,63723,0,0,435,9947,0,0;QS=3,0;MQSB=0.988166;MQ0F=0	PL:DP:DV	0,21,173:7:0	0,27,206:9:0	0,12,111:4:0
-X	1667	.	G	<*>	0	.	DP=20;I16=8,11,0,0,617,21033,0,0,1078,62882,0,0,410,9276,0,0;QS=3,0;MQSB=0.992359;MQ0F=0	PL:DP:DV	0,21,183:7:0	0,24,195:8:0	0,12,115:4:0
-X	1668	.	A	<*>	0	.	DP=20;I16=7,10,0,0,570,19908,0,0,958,55682,0,0,369,8365,0,0;QS=3,0;MQSB=0.989343;MQ0F=0	PL:DP:DV	0,18,158:6:0	0,21,186:7:0	0,12,124:4:0
-X	1669	.	C	<*>	0	.	DP=20;I16=8,12,0,0,640,21336,0,0,1107,63723,0,0,435,9857,0,0;QS=3,0;MQSB=0.988166;MQ0F=0	PL:DP:DV	0,21,172:7:0	0,27,216:9:0	0,12,115:4:0
-X	1670	.	A	<*>	0	.	DP=23;I16=9,13,0,0,765,27363,0,0,1258,73682,0,0,410,9234,0,0;QS=3,0;MQSB=0.991121;MQ0F=0	PL:DP:DV	0,27,215:9:0	0,27,233:9:0	0,12,129:4:0
-X	1671	.	G	<*>	0	.	DP=23;I16=9,13,0,0,703,23631,0,0,1258,73682,0,0,412,9206,0,0;QS=3,0;MQSB=0.991121;MQ0F=0	PL:DP:DV	0,27,214:9:0	0,27,210:9:0	0,12,106:4:0
-X	1672	.	T	<*>	0	.	DP=23;I16=9,13,0,0,724,24700,0,0,1258,73682,0,0,414,9202,0,0;QS=3,0;MQSB=0.991121;MQ0F=0	PL:DP:DV	0,27,203:9:0	0,27,232:9:0	0,12,111:4:0
-X	1673	.	T	<*>	0	.	DP=25;I16=8,13,0,0,719,25183,0,0,1198,70082,0,0,372,8248,0,0;QS=3,0;MQSB=0.983744;MQ0F=0	PL:DP:DV	0,27,221:9:0	0,24,212:8:0	0,12,112:4:0
-X	1674	.	C	<*>	0	.	DP=25;I16=8,14,0,0,755,26561,0,0,1289,76441,0,0,389,8417,0,0;QS=3,0;MQSB=0.892142;MQ0F=0	PL:DP:DV	0,33,244:11:0	0,21,206:7:0	0,12,96:4:0
-X	1675	.	C	<*>	0	.	DP=25;I16=9,15,0,0,705,22355,0,0,1347,78123,0,0,447,9897,0,0;QS=3,0;MQSB=0.996008;MQ0F=0	PL:DP:DV	0,33,222:11:0	0,30,212:10:0	0,9,65:3:0
-X	1676	.	G	<*>	0	.	DP=25;I16=6,15,0,0,660,21708,0,0,1167,67323,0,0,383,8265,0,0;QS=3,0;MQSB=0.993205;MQ0F=0	PL:DP:DV	0,33,222:11:0	0,21,170:7:0	0,9,96:3:0
-X	1677	.	C	<*>	0	.	DP=25;I16=9,13,0,0,681,22869,0,0,1289,76441,0,0,394,8510,0,0;QS=3,0;MQSB=0.910098;MQ0F=0	PL:DP:DV	0,33,225:11:0	0,24,198:8:0	0,9,74:3:0
-X	1678	.	C	<*>	0	.	DP=25;I16=9,15,0,0,775,26785,0,0,1347,78123,0,0,438,9496,0,0;QS=3,0;MQSB=0.996008;MQ0F=0	PL:DP:DV	0,33,235:11:0	0,30,231:10:0	0,9,83:3:0
-X	1679	.	A	<*>	0	.	DP=25;I16=8,15,0,0,762,27552,0,0,1287,74523,0,0,412,8858,0,0;QS=3,0;MQSB=0.999479;MQ0F=0	PL:DP:DV	0,33,235:11:0	0,27,219:9:0	0,9,106:3:0
-X	1680	.	G	<*>	0	.	DP=26;I16=9,17,0,0,843,29213,0,0,1467,85323,0,0,459,10021,0,0;QS=3,0;MQSB=0.999637;MQ0F=0	PL:DP:DV	0,33,253:11:0	0,33,232:11:0	0,12,108:4:0
-X	1681	.	C	<*>	0	.	DP=26;I16=8,15,0,0,681,21293,0,0,1318,77282,0,0,407,8999,0,0;QS=3,0;MQSB=0.974802;MQ0F=0	PL:DP:DV	0,33,223:11:0	0,27,191:9:0	0,9,69:3:0
-X	1682	.	G	<*>	0	.	DP=25;I16=9,16,0,0,728,22560,0,0,1407,81723,0,0,455,9877,0,0;QS=3,0;MQSB=0.998399;MQ0F=0	PL:DP:DV	0,30,222:10:0	0,33,208:11:0	0,12,98:4:0
-X	1683	.	T	<*>	0	.	DP=25;I16=8,15,0,0,807,29159,0,0,1287,74523,0,0,403,8567,0,0;QS=3,0;MQSB=0.999479;MQ0F=0	PL:DP:DV	0,30,250:10:0	0,30,235:10:0	0,9,91:3:0
-X	1684	.	T	<*>	0	.	DP=25;I16=8,15,0,0,802,28774,0,0,1318,77282,0,0,438,9612,0,0;QS=3,0;MQSB=0.974802;MQ0F=0	PL:DP:DV	0,27,227:9:0	0,30,237:10:0	0,12,107:4:0
-X	1685	.	G	<*>	0	.	DP=24;I16=8,14,0,0,759,27319,0,0,1258,73682,0,0,413,8999,0,0;QS=3,0;MQSB=0.979255;MQ0F=0	PL:DP:DV	0,24,216:8:0	0,30,242:10:0	0,12,110:4:0
-X	1686	.	C	<*>	0	.	DP=24;I16=8,15,0,0,793,28073,0,0,1318,77282,0,0,438,9656,0,0;QS=3,0;MQSB=0.974802;MQ0F=0	PL:DP:DV	0,27,225:9:0	0,30,241:10:0	0,12,103:4:0
-X	1687	.	C	<*>	0	.	DP=24;I16=7,14,0,0,741,26765,0,0,1198,70082,0,0,388,8458,0,0;QS=3,0;MQSB=0.966484;MQ0F=0	PL:DP:DV	0,24,221:8:0	0,27,229:9:0	0,12,106:4:0
-X	1688	.	C	<*>	0	.	DP=24;I16=8,15,0,0,794,28736,0,0,1318,77282,0,0,431,9605,0,0;QS=3,0;MQSB=0.974802;MQ0F=0	PL:DP:DV	0,27,239:9:0	0,30,221:10:0	0,12,120:4:0
-X	1689	.	T	A,<*>	0	.	DP=24;I16=8,15,0,1,805,29443,33,1089,1287,74523,60,3600,421,9311,25,625;QS=2.74419,0.255814,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=1;BQB=1;MQ0F=0	PL:DP:DV	0,27,224,27,224,224:9:0	0,33,255,33,255,255:11:0	21,0,79,30,82,106:4:1
-X	1690	.	C	<*>	0	.	DP=24;I16=8,16,0,0,864,32420,0,0,1347,78123,0,0,445,10033,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,242:9:0	0,33,255:11:0	0,12,95:4:0
-X	1691	.	T	<*>	0	.	DP=22;I16=7,14,0,0,734,27150,0,0,1167,67323,0,0,421,9525,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,225:9:0	0,30,242:10:0	0,6,57:2:0
-X	1692	.	G	<*>	0	.	DP=22;I16=7,13,0,0,678,24110,0,0,1107,63723,0,0,400,9176,0,0;QS=3,0;MQSB=0.999215;MQ0F=0	PL:DP:DV	0,24,218:8:0	0,30,218:10:0	0,6,61:2:0
-X	1693	.	T	<*>	0	.	DP=24;I16=10,13,0,0,795,28363,0,0,1318,77282,0,0,444,10422,0,0;QS=3,0;MQSB=0.995682;MQ0F=0	PL:DP:DV	0,27,227:9:0	0,30,235:10:0	0,12,104:4:0
-X	1694	.	T	<*>	0	.	DP=24;I16=10,13,0,0,771,26775,0,0,1318,77282,0,0,448,10602,0,0;QS=3,0;MQSB=0.995682;MQ0F=0	PL:DP:DV	0,27,221:9:0	0,30,232:10:0	0,12,114:4:0
-X	1695	.	C	<*>	0	.	DP=24;I16=10,14,0,0,811,28517,0,0,1347,78123,0,0,454,10806,0,0;QS=3,0;MQSB=0.98469;MQ0F=0	PL:DP:DV	0,27,227:9:0	0,33,239:11:0	0,12,121:4:0
-X	1696	.	T	<*>	0	.	DP=23;I16=10,13,0,0,825,30819,0,0,1287,74523,0,0,455,10869,0,0;QS=3,0;MQSB=0.976718;MQ0F=0	PL:DP:DV	0,24,219:8:0	0,33,255:11:0	0,12,108:4:0
-X	1697	.	G	<*>	0	.	DP=23;I16=10,13,0,0,767,26757,0,0,1287,74523,0,0,455,10897,0,0;QS=3,0;MQSB=0.976718;MQ0F=0	PL:DP:DV	0,24,208:8:0	0,33,246:11:0	0,12,112:4:0
-X	1698	.	C	A,<*>	0	.	DP=21;I16=10,10,0,1,726,27088,27,729,1169,69241,29,841,451,10903,6,36;QS=2.91148,0.0885246,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.99938;BQB=1;MQ0F=0	PL:DP:DV	0,24,229,24,229,229:8:0	0,0,190,24,193,207:9:1	0,12,111,12,111,111:4:0
-X	1699	.	T	<*>	0	.	DP=21;I16=9,10,0,0,698,25826,0,0,1078,62882,0,0,408,9692,0,0;QS=3,0;MQSB=0.999167;MQ0F=0	PL:DP:DV	0,21,203:7:0	0,24,219:8:0	0,12,115:4:0
-X	1700	.	G	<*>	0	.	DP=20;I16=9,10,0,0,696,25850,0,0,1078,62882,0,0,409,9705,0,0;QS=3,0;MQSB=0.999167;MQ0F=0	PL:DP:DV	0,21,216:7:0	0,24,215:8:0	0,12,110:4:0
-X	1701	.	T	<*>	0	.	DP=20;I16=9,11,0,0,711,25539,0,0,1138,66482,0,0,435,10353,0,0;QS=3,0;MQSB=0.997118;MQ0F=0	PL:DP:DV	0,24,207:8:0	0,24,210:8:0	0,12,125:4:0
-X	1702	.	T	<*>	0	.	DP=20;I16=8,11,0,0,671,24367,0,0,1078,62882,0,0,410,9712,0,0;QS=3,0;MQSB=0.992359;MQ0F=0	PL:DP:DV	0,24,214:8:0	0,21,193:7:0	0,12,115:4:0
-X	1703	.	T	<*>	0	.	DP=20;I16=9,10,0,0,648,22696,0,0,1078,62882,0,0,410,9708,0,0;QS=3,0;MQSB=0.999167;MQ0F=0	PL:DP:DV	0,21,197:7:0	0,24,195:8:0	0,12,114:4:0
-X	1704	.	T	<*>	0	.	DP=20;I16=10,10,0,0,711,25771,0,0,1169,69241,0,0,435,10341,0,0;QS=3,0;MQSB=0.931063;MQ0F=0	PL:DP:DV	0,24,208:8:0	0,21,208:7:0	0,15,128:5:0
-X	1705	.	C	<*>	0	.	DP=20;I16=10,10,0,0,744,28388,0,0,1169,69241,0,0,436,10312,0,0;QS=3,0;MQSB=0.931063;MQ0F=0	PL:DP:DV	0,24,232:8:0	0,21,213:7:0	0,15,120:5:0
-X	1706	.	T	<*>	0	.	DP=20;I16=10,10,0,0,775,30329,0,0,1169,69241,0,0,436,10246,0,0;QS=3,0;MQSB=0.931063;MQ0F=0	PL:DP:DV	0,24,221:8:0	0,21,219:7:0	0,15,145:5:0
-X	1707	.	C	<*>	0	.	DP=21;I16=9,11,0,0,724,26998,0,0,1169,69241,0,0,410,9518,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,27,235:9:0	0,18,180:6:0	0,15,134:5:0
-X	1708	.	T	<*>	0	.	DP=21;I16=9,12,0,0,740,27282,0,0,1229,72841,0,0,410,9430,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,30,229:10:0	0,18,187:6:0	0,15,132:5:0
-X	1709	.	A	<*>	0	.	DP=21;I16=9,11,0,0,675,23509,0,0,1169,69241,0,0,386,8734,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,27,210:9:0	0,18,166:6:0	0,15,131:5:0
-X	1710	.	C	<*>	0	.	DP=22;I16=9,13,0,0,755,26817,0,0,1289,76441,0,0,412,9306,0,0;QS=3,0;MQSB=0.910098;MQ0F=0	PL:DP:DV	0,33,236:11:0	0,18,181:6:0	0,15,128:5:0
-X	1711	.	C	<*>	0	.	DP=22;I16=9,13,0,0,786,28790,0,0,1289,76441,0,0,413,9223,0,0;QS=3,0;MQSB=0.910098;MQ0F=0	PL:DP:DV	0,33,250:11:0	0,18,169:6:0	0,15,138:5:0
-X	1712	.	A	<*>	0	.	DP=22;I16=9,13,0,0,824,31342,0,0,1289,76441,0,0,414,9162,0,0;QS=3,0;MQSB=0.910098;MQ0F=0	PL:DP:DV	0,33,252:11:0	0,18,198:6:0	0,15,136:5:0
-X	1713	.	G	<*>	0	.	DP=23;I16=8,14,0,0,823,31285,0,0,1289,76441,0,0,405,8993,0,0;QS=3,0;MQSB=0.892142;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,189:6:0	0,12,118:4:0
-X	1714	.	A	<*>	0	.	DP=23;I16=9,13,0,0,763,27439,0,0,1289,76441,0,0,402,8818,0,0;QS=3,0;MQSB=0.910098;MQ0F=0	PL:DP:DV	0,36,234:12:0	0,18,190:6:0	0,12,101:4:0
-X	1715	.	A	<*>	0	.	DP=23;I16=9,14,0,0,900,35416,0,0,1349,80041,0,0,414,8878,0,0;QS=3,0;MQSB=0.907354;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,206:6:0	0,15,145:5:0
-X	1716	.	G	<*>	0	.	DP=23;I16=9,14,0,0,844,31500,0,0,1349,80041,0,0,414,8822,0,0;QS=3,0;MQSB=0.907354;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,188:6:0	0,15,129:5:0
-X	1717	.	T	<*>	0	.	DP=24;I16=9,15,0,0,854,30878,0,0,1409,83641,0,0,414,8794,0,0;QS=3,0;MQSB=0.904837;MQ0F=0	PL:DP:DV	0,39,253:13:0	0,18,185:6:0	0,15,122:5:0
-X	1718	.	G	<*>	0	.	DP=24;I16=9,14,0,0,806,29332,0,0,1349,80041,0,0,390,8170,0,0;QS=3,0;MQSB=0.907354;MQ0F=0	PL:DP:DV	0,36,249:12:0	0,18,188:6:0	0,15,124:5:0
-X	1719	.	C	<*>	0	.	DP=26;I16=11,14,0,0,857,30717,0,0,1469,87241,0,0,407,8675,0,0;QS=3,0;MQSB=0.929204;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,173:6:0	0,12,98:4:0
-X	1720	.	C	<*>	0	.	DP=26;I16=11,14,0,0,898,33274,0,0,1469,87241,0,0,409,8645,0,0;QS=3,0;MQSB=0.929204;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,166:6:0	0,12,99:4:0
-X	1721	.	C	<*>	0	.	DP=26;I16=10,14,0,0,846,30642,0,0,1409,83641,0,0,388,8258,0,0;QS=3,0;MQSB=0.919431;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,187:6:0	0,12,119:4:0
-X	1722	.	T	<*>	0	.	DP=25;I16=11,13,0,0,876,33054,0,0,1409,83641,0,0,406,8540,0,0;QS=3,0;MQSB=0.931547;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,174:5:0	0,15,123:5:0
-X	1723	.	T	<*>	0	.	DP=25;I16=11,14,0,0,835,28861,0,0,1469,87241,0,0,420,8728,0,0;QS=3,0;MQSB=0.929204;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,167:5:0	0,15,130:5:0
-X	1724	.	C	<*>	0	.	DP=25;I16=11,14,0,0,903,33735,0,0,1469,87241,0,0,422,8800,0,0;QS=3,0;MQSB=0.929204;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,164:5:0	0,15,139:5:0
-X	1725	.	C	G,<*>	0	.	DP=25;I16=11,13,0,1,835,29699,25,625,1409,83641,60,3600,406,8576,18,324;QS=2.95164,0.0483559,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.929204;BQB=1;MQ0F=0	PL:DP:DV	0,20,255,42,255,255:15:1	0,15,153,15,153,153:5:0	0,15,132,15,132,132:5:0
-X	1726	.	C	<*>	0	.	DP=25;I16=11,14,0,0,932,35588,0,0,1469,87241,0,0,426,9028,0,0;QS=3,0;MQSB=0.929204;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,165:5:0	0,15,122:5:0
-X	1727	.	T	<*>	0	.	DP=25;I16=10,14,0,0,862,32080,0,0,1409,83641,0,0,404,8556,0,0;QS=3,0;MQSB=0.919431;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,167:5:0	0,12,120:4:0
-X	1728	.	C	<*>	0	.	DP=25;I16=11,14,0,0,915,33845,0,0,1469,87241,0,0,429,9173,0,0;QS=3,0;MQSB=0.929204;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,156:5:0	0,15,144:5:0
-X	1729	.	C	<*>	0	.	DP=25;I16=10,14,0,0,919,35797,0,0,1409,83641,0,0,406,8668,0,0;QS=3,0;MQSB=0.919431;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,142:5:0	0,12,128:4:0
-X	1730	.	T	<*>	0	.	DP=24;I16=10,14,0,0,849,30711,0,0,1409,83641,0,0,433,9393,0,0;QS=3,0;MQSB=0.919431;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,138:4:0	0,15,148:5:0
-X	1731	.	C	<*>	0	.	DP=24;I16=10,14,0,0,907,34875,0,0,1409,83641,0,0,434,9472,0,0;QS=3,0;MQSB=0.919431;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,123:4:0	0,15,140:5:0
-X	1732	.	A	<*>	0	.	DP=24;I16=11,13,0,0,816,28582,0,0,1409,83641,0,0,436,9580,0,0;QS=3,0;MQSB=0.931547;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,123:4:0	0,15,143:5:0
-X	1733	.	C	<*>	0	.	DP=25;I16=12,13,0,0,869,31451,0,0,1469,87241,0,0,438,9666,0,0;QS=3,0;MQSB=0.939413;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,116:4:0	0,15,136:5:0
-X	1734	.	C	<*>	0	.	DP=25;I16=12,13,0,0,926,35482,0,0,1469,87241,0,0,440,9730,0,0;QS=3,0;MQSB=0.939413;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,122:4:0	0,15,141:5:0
-X	1735	.	T	<*>	0	.	DP=26;I16=13,13,0,0,935,35169,0,0,1529,90841,0,0,442,9822,0,0;QS=3,0;MQSB=0.945959;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,112:4:0	0,15,148:5:0
-X	1736	.	G	<*>	0	.	DP=25;I16=11,11,0,0,829,31469,0,0,1289,76441,0,0,380,8416,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,72:2:0	0,12,118:4:0
-X	1737	.	A	<*>	0	.	DP=25;I16=12,12,0,0,842,30606,0,0,1409,83641,0,0,422,9312,0,0;QS=3,0;MQSB=0.941765;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,76:2:0	0,15,131:5:0
-X	1738	.	C	<*>	0	.	DP=24;I16=12,12,0,0,835,30251,0,0,1409,83641,0,0,450,10010,0,0;QS=3,0;MQSB=0.941765;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,78:3:0	0,15,130:5:0
-X	1739	.	C	<*>	0	.	DP=23;I16=10,12,0,0,831,32123,0,0,1289,76441,0,0,428,9432,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,55:2:0	0,12,135:4:0
-X	1740	.	A	<*>	0	.	DP=23;I16=11,12,0,0,774,27126,0,0,1349,80041,0,0,456,10126,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,56:2:0	0,15,139:5:0
-X	1741	.	C	<*>	0	.	DP=23;I16=11,12,0,0,850,32314,0,0,1349,80041,0,0,459,10217,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,70:2:0	0,15,136:5:0
-X	1742	.	T	<*>	0	.	DP=23;I16=11,12,0,0,866,33204,0,0,1349,80041,0,0,462,10330,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,72:2:0	0,15,144:5:0
-X	1743	.	C	<*>	0	.	DP=23;I16=11,12,0,0,894,35176,0,0,1349,80041,0,0,464,10414,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,74:2:0	0,15,138:5:0
-X	1744	.	T	<*>	0	.	DP=23;I16=11,11,0,0,857,33579,0,0,1289,76441,0,0,459,10469,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,80:2:0	0,15,156:5:0
-X	1745	.	G	<*>	0	.	DP=23;I16=11,12,0,0,882,34572,0,0,1349,80041,0,0,464,10442,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,78:2:0	0,15,142:5:0
-X	1746	.	G	<*>	0	.	DP=24;I16=12,11,0,0,836,31102,0,0,1349,80041,0,0,456,10312,0,0;QS=3,0;MQSB=0.944319;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,69:2:0	0,18,151:6:0
-X	1747	.	G	<*>	0	.	DP=24;I16=12,11,0,0,839,31729,0,0,1349,80041,0,0,455,10239,0,0;QS=3,0;MQSB=0.944319;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,75:2:0	0,18,154:6:0
-X	1748	.	G	<*>	0	.	DP=24;I16=11,12,0,0,843,31857,0,0,1349,80041,0,0,434,9664,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,3,42:1:0	0,18,154:6:0
-X	1749	.	A	<*>	0	.	DP=25;I16=13,11,0,0,864,31748,0,0,1409,83641,0,0,451,10063,0,0;QS=3,0;MQSB=0.950498;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,72:2:0	0,21,172:7:0
-X	1750	.	A	<*>	0	.	DP=25;I16=13,12,0,0,905,33667,0,0,1469,87241,0,0,451,10013,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,56:2:0	0,21,187:7:0
-X	1751	.	A	<*>	0	.	DP=25;I16=13,12,0,0,908,33658,0,0,1469,87241,0,0,449,9987,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,67:2:0	0,21,183:7:0
-X	1752	.	T	<*>	0	.	DP=23;I16=12,11,0,0,838,31088,0,0,1380,82800,0,0,449,9987,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,71:2:0	0,18,170:6:0
-X	1753	.	C	<*>	0	.	DP=23;I16=12,11,0,0,869,33595,0,0,1380,82800,0,0,448,9960,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,77:2:0	0,18,163:6:0
-X	1754	.	C	<*>	0	.	DP=23;I16=11,11,0,0,830,31628,0,0,1320,79200,0,0,431,9699,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,3,42:1:0	0,18,163:6:0
-X	1755	.	C	<*>	0	.	DP=23;I16=12,11,0,0,856,33082,0,0,1380,82800,0,0,446,9972,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,61:2:0	0,18,165:6:0
-X	1756	.	T	<*>	0	.	DP=22;I16=11,11,0,0,858,33720,0,0,1320,79200,0,0,445,9961,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,77:2:0	0,18,179:6:0
-X	1757	.	C	<*>	0	.	DP=22;I16=11,11,0,0,869,34651,0,0,1320,79200,0,0,444,9972,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,78:2:0	0,18,176:6:0
-X	1758	.	A	<*>	0	.	DP=22;I16=11,11,0,0,865,34205,0,0,1320,79200,0,0,442,9954,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,81:2:0	0,18,177:6:0
-X	1759	.	G	<*>	0	.	DP=22;I16=11,11,0,0,833,31965,0,0,1320,79200,0,0,439,9905,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,77:2:0	0,18,159:6:0
-X	1760	.	C	<*>	0	.	DP=22;I16=11,11,0,0,849,33441,0,0,1320,79200,0,0,436,9874,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,79:2:0	0,18,159:6:0
-X	1761	.	A	<*>	0	.	DP=22;I16=11,11,0,0,730,25766,0,0,1320,79200,0,0,432,9810,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,75:2:0	0,18,153:6:0
-X	1762	.	C	<*>	0	.	DP=21;I16=11,10,0,0,767,28667,0,0,1260,75600,0,0,429,9761,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,76:2:0	0,18,160:6:0
-X	1763	.	C	<*>	0	.	DP=21;I16=11,10,0,0,789,30115,0,0,1260,75600,0,0,426,9726,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,72:2:0	0,18,162:6:0
-X	1764	.	C	<*>	0	.	DP=21;I16=11,10,0,0,821,32443,0,0,1260,75600,0,0,423,9705,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,72:2:0	0,18,167:6:0
-X	1765	.	T	<*>	0	.	DP=21;I16=11,10,0,0,814,31746,0,0,1260,75600,0,0,420,9698,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,83:2:0	0,18,179:6:0
-X	1766	.	C	<*>	0	.	DP=21;I16=11,10,0,0,796,30564,0,0,1260,75600,0,0,417,9705,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,71:2:0	0,18,162:6:0
-X	1767	.	C	<*>	0	.	DP=21;I16=11,10,0,0,779,29559,0,0,1260,75600,0,0,414,9726,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,73:2:0	0,18,163:6:0
-X	1768	.	C	<*>	0	.	DP=21;I16=11,10,0,0,798,30670,0,0,1260,75600,0,0,411,9761,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,68:2:0	0,18,160:6:0
-X	1769	.	T	<*>	0	.	DP=21;I16=11,10,0,0,819,32179,0,0,1260,75600,0,0,406,9712,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,77:2:0	0,18,184:6:0
-X	1770	.	G	<*>	0	.	DP=19;I16=11,8,0,0,699,26453,0,0,1140,68400,0,0,403,9679,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,68:2:0	0,18,158:6:0
-X	1771	.	A	<*>	0	.	DP=18;I16=10,8,0,0,707,27853,0,0,1080,64800,0,0,401,9659,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,42:1:0	0,18,177:6:0
-X	1772	.	G	<*>	0	.	DP=18;I16=10,8,0,0,669,25513,0,0,1080,64800,0,0,398,9600,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,38:1:0	0,18,159:6:0
-X	1773	.	C	<*>	0	.	DP=17;I16=10,7,0,0,675,26897,0,0,1020,61200,0,0,396,9550,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,3,39:1:0	0,18,172:6:0
-X	1774	.	A	<*>	0	.	DP=17;I16=10,7,0,0,653,25153,0,0,1020,61200,0,0,394,9508,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,3,39:1:0	0,18,172:6:0
-X	1775	.	T	<*>	0	.	DP=17;I16=10,7,0,0,605,22253,0,0,1020,61200,0,0,391,9423,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,3,38:1:0	0,18,156:6:0
-X	1776	.	A	<*>	0	.	DP=17;I16=10,7,0,0,610,22124,0,0,1020,61200,0,0,388,9344,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,254:10:0	0,3,35:1:0	0,18,166:6:0
-X	1777	.	C	<*>	0	.	DP=18;I16=11,7,0,0,661,24975,0,0,1080,64800,0,0,385,9271,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,35:1:0	0,18,158:6:0
-X	1778	.	C	<*>	0	.	DP=18;I16=11,7,0,0,680,25970,0,0,1080,64800,0,0,383,9205,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,31:1:0	0,18,172:6:0
-X	1779	.	C	<*>	0	.	DP=18;I16=11,7,0,0,703,27663,0,0,1080,64800,0,0,381,9147,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,34:1:0	0,18,174:6:0
-X	1780	.	T	<*>	0	.	DP=18;I16=11,7,0,0,672,26000,0,0,1080,64800,0,0,378,9048,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,33:1:0	0,18,177:6:0
-X	1781	.	A	<*>	0	.	DP=19;I16=10,6,0,0,579,21377,0,0,960,57600,0,0,328,7804,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,0,0:0:0	0,15,160:5:0
-X	1782	.	C	<*>	0	.	DP=20;I16=11,9,0,0,715,26603,0,0,1200,72000,0,0,382,8892,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,47:2:0	0,18,156:6:0
-X	1783	.	T	<*>	0	.	DP=20;I16=11,9,0,0,755,29057,0,0,1200,72000,0,0,381,8743,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,68:2:0	0,18,184:6:0
-X	1784	.	C	<*>	0	.	DP=20;I16=10,9,0,0,723,28017,0,0,1140,68400,0,0,360,8212,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,62:2:0	0,15,151:5:0
-X	1785	.	T	<*>	0	.	DP=20;I16=10,10,0,0,766,29878,0,0,1200,72000,0,0,359,8089,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,66:2:0	0,15,168:5:0
-X	1786	.	G	<*>	0	.	DP=22;I16=11,11,0,0,841,32323,0,0,1320,79200,0,0,359,7985,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,68:2:0	0,15,158:5:0
-X	1787	.	G	<*>	0	.	DP=22;I16=11,11,0,0,806,30294,0,0,1320,79200,0,0,361,7903,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,68:2:0	0,15,148:5:0
-X	1788	.	C	<*>	0	.	DP=22;I16=11,11,0,0,858,33674,0,0,1320,79200,0,0,362,7796,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,67:2:0	0,15,158:5:0
-X	1789	.	A	<*>	0	.	DP=23;I16=11,12,0,0,797,28705,0,0,1380,82800,0,0,363,7715,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,69:2:0	0,15,157:5:0
-X	1790	.	C	<*>	0	.	DP=23;I16=11,12,0,0,852,31816,0,0,1380,82800,0,0,365,7661,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,63:2:0	0,15,153:5:0
-X	1791	.	A	<*>	0	.	DP=23;I16=11,12,0,0,830,30484,0,0,1380,82800,0,0,367,7635,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,61:2:0	0,15,155:5:0
-X	1792	.	A	<*>	0	.	DP=23;I16=11,12,0,0,862,32760,0,0,1380,82800,0,0,368,7588,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,67:2:0	0,15,161:5:0
-X	1793	.	G	<*>	0	.	DP=23;I16=11,12,0,0,813,29603,0,0,1380,82800,0,0,369,7571,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,61:2:0	0,15,126:5:0
-X	1794	.	C	<*>	0	.	DP=21;I16=9,12,0,0,736,26472,0,0,1260,75600,0,0,370,7484,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,48:2:0	0,9,96:3:0
-X	1795	.	C	<*>	0	.	DP=21;I16=9,12,0,0,763,28807,0,0,1260,75600,0,0,371,7427,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,45:2:0	0,9,100:3:0
-X	1796	.	C	<*>	0	.	DP=21;I16=9,12,0,0,782,29718,0,0,1260,75600,0,0,372,7400,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,52:2:0	0,9,102:3:0
-X	1797	.	A	<*>	0	.	DP=21;I16=9,12,0,0,704,25190,0,0,1260,75600,0,0,373,7403,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,59:2:0	0,9,92:3:0
-X	1798	.	C	<*>	0	.	DP=21;I16=9,12,0,0,759,28119,0,0,1260,75600,0,0,374,7436,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,49:2:0	0,9,99:3:0
-X	1799	.	C	<*>	0	.	DP=22;I16=9,13,0,0,796,29520,0,0,1320,79200,0,0,375,7499,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,56:2:0	0,12,131:4:0
-X	1800	.	C	<*>	0	.	DP=22;I16=9,13,0,0,866,34352,0,0,1320,79200,0,0,376,7542,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,63:2:0	0,12,138:4:0
-X	1801	.	T	<*>	0	.	DP=22;I16=9,13,0,0,838,32282,0,0,1320,79200,0,0,377,7615,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,63:2:0	0,12,150:4:0
-X	1802	.	G	<*>	0	.	DP=22;I16=9,13,0,0,844,32894,0,0,1320,79200,0,0,378,7718,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,60:2:0	0,12,137:4:0
-X	1803	.	C	<*>	0	.	DP=22;I16=9,13,0,0,837,32691,0,0,1320,79200,0,0,377,7751,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,60:2:0	0,12,143:4:0
-X	1804	.	A	<*>	0	.	DP=23;I16=9,14,0,0,793,28517,0,0,1380,82800,0,0,376,7814,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,54:2:0	0,12,144:4:0
-X	1805	.	A	<*>	0	.	DP=23;I16=9,14,0,0,810,29148,0,0,1380,82800,0,0,376,7908,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,67:2:0	0,12,138:4:0
-X	1806	.	A	<*>	0	.	DP=23;I16=9,14,0,0,816,29932,0,0,1380,82800,0,0,376,8034,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,61:2:0	0,12,139:4:0
-X	1807	.	G	<*>	0	.	DP=22;I16=9,13,0,0,837,32299,0,0,1320,79200,0,0,375,8091,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,67:2:0	0,12,142:4:0
-X	1808	.	C	<*>	0	.	DP=21;I16=9,11,0,0,705,25519,0,0,1200,72000,0,0,354,7716,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,53:2:0	0,12,140:4:0
-X	1809	.	C	<*>	0	.	DP=22;I16=10,12,0,0,789,29123,0,0,1320,79200,0,0,371,8091,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,55:2:0	0,12,143:4:0
-X	1810	.	C	<*>	0	.	DP=21;I16=10,11,0,0,754,27902,0,0,1260,75600,0,0,370,8084,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,51:2:0	0,12,145:4:0
-X	1811	.	C	<*>	0	.	DP=22;I16=11,11,0,0,837,32353,0,0,1320,79200,0,0,368,8056,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,61:2:0	0,12,146:4:0
-X	1812	.	T	<*>	0	.	DP=22;I16=11,11,0,0,830,31782,0,0,1320,79200,0,0,365,7955,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,60:2:0	0,12,151:4:0
-X	1813	.	G	<*>	0	.	DP=21;I16=11,10,0,0,789,29971,0,0,1260,75600,0,0,363,7879,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,63:2:0	0,12,135:4:0
-X	1814	.	A	<*>	0	.	DP=21;I16=11,10,0,0,780,29356,0,0,1260,75600,0,0,361,7827,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,63:2:0	0,12,148:4:0
-X	1815	.	G	<*>	0	.	DP=21;I16=11,10,0,0,742,27064,0,0,1260,75600,0,0,358,7748,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,56:2:0	0,12,135:4:0
-X	1816	.	G	<*>	0	.	DP=21;I16=11,10,0,0,702,24670,0,0,1260,75600,0,0,355,7691,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,49:2:0	0,12,124:4:0
-X	1817	.	C	<*>	0	.	DP=20;I16=11,9,0,0,701,25263,0,0,1200,72000,0,0,353,7655,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,58:2:0	0,12,134:4:0
-X	1818	.	C	<*>	0	.	DP=20;I16=11,8,0,0,665,23987,0,0,1140,68400,0,0,326,7014,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,53:2:0	0,12,132:4:0
-X	1819	.	C	<*>	0	.	DP=18;I16=9,9,0,0,580,20092,0,0,1080,64800,0,0,351,7641,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,38:2:0	0,12,124:4:0
-X	1820	.	G	<*>	0	.	DP=18;I16=9,9,0,0,589,19883,0,0,1080,64800,0,0,351,7659,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,58:2:0	0,12,117:4:0
-X	1821	.	C	<*>	0	.	DP=18;I16=9,9,0,0,619,22131,0,0,1080,64800,0,0,351,7693,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,60:2:0	0,12,131:4:0
-X	1822	.	C	<*>	0	.	DP=18;I16=9,9,0,0,655,24177,0,0,1080,64800,0,0,350,7694,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,58:2:0	0,12,131:4:0
-X	1823	.	C	<*>	0	.	DP=19;I16=10,9,0,0,703,26765,0,0,1140,68400,0,0,349,7713,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,62:2:0	0,12,138:4:0
-X	1824	.	T	<*>	0	.	DP=19;I16=10,9,0,0,714,27628,0,0,1140,68400,0,0,349,7751,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,69:2:0	0,12,149:4:0
-X	1825	.	G	<*>	0	.	DP=19;I16=10,9,0,0,682,24804,0,0,1140,68400,0,0,347,7709,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,61:2:0	0,12,129:4:0
-X	1826	.	T	<*>	0	.	DP=19;I16=10,9,0,0,643,22525,0,0,1140,68400,0,0,345,7687,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,62:2:0	0,12,141:4:0
-X	1827	.	G	<*>	0	.	DP=19;I16=10,9,0,0,722,27844,0,0,1140,68400,0,0,343,7685,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,66:2:0	0,12,134:4:0
-X	1828	.	G	<*>	0	.	DP=18;I16=10,8,0,0,619,21719,0,0,1080,64800,0,0,342,7702,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,61:2:0	0,9,100:3:0
-X	1829	.	C	<*>	0	.	DP=19;I16=9,9,0,0,576,19228,0,0,1080,64800,0,0,323,7413,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,59:3:0	0,9,103:3:0
-X	1830	.	G	<*>	0	.	DP=19;I16=9,9,0,0,582,19586,0,0,1080,64800,0,0,321,7379,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,82:3:0	0,9,80:3:0
-X	1831	.	T	<*>	0	.	DP=20;I16=10,8,0,0,605,21015,0,0,1080,64800,0,0,294,6736,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,106:4:0	0,9,101:3:0
-X	1832	.	C	<*>	0	.	DP=19;I16=9,9,0,0,675,25747,0,0,1080,64800,0,0,319,7359,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,110:4:0	0,9,105:3:0
-X	1833	.	T	<*>	0	.	DP=18;I16=8,8,0,0,565,20733,0,0,960,57600,0,0,295,6747,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,248:10:0	0,9,105:3:0	0,9,106:3:0
-X	1834	.	C	<*>	0	.	DP=19;I16=9,9,0,0,654,24424,0,0,1037,61489,0,0,321,7399,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,104:4:0	0,9,107:3:0
-X	1835	.	T	<*>	0	.	DP=18;I16=9,9,0,0,641,23505,0,0,1037,61489,0,0,347,7965,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,123:4:0	0,9,115:3:0
-X	1836	.	C	<*>	0	.	DP=18;I16=9,9,0,0,657,24427,0,0,1037,61489,0,0,350,8016,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,127:4:0	0,9,108:3:0
-X	1837	.	C	<*>	0	.	DP=18;I16=9,9,0,0,586,20044,0,0,1037,61489,0,0,352,8030,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,233:11:0	0,12,114:4:0	0,9,108:3:0
-X	1838	.	C	<*>	0	.	DP=18;I16=9,9,0,0,655,24607,0,0,1037,61489,0,0,354,8056,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,120:4:0	0,9,107:3:0
-X	1839	.	T	<*>	0	.	DP=18;I16=9,7,0,0,557,20543,0,0,917,54289,0,0,321,7369,0,0;QS=3,0;MQSB=0.933674;MQ0F=0	PL:DP:DV	0,30,231:10:0	0,9,103:3:0	0,9,119:3:0
-X	1840	.	C	<*>	0	.	DP=18;I16=9,9,0,0,637,23295,0,0,1037,61489,0,0,358,8144,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,116:4:0	0,9,109:3:0
-X	1841	.	C	<*>	0	.	DP=18;I16=9,9,0,0,622,22458,0,0,1037,61489,0,0,360,8206,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,252:11:0	0,12,121:4:0	0,9,108:3:0
-X	1842	.	C	<*>	0	.	DP=18;I16=9,9,0,0,672,26064,0,0,1037,61489,0,0,362,8280,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,124:4:0	0,9,108:3:0
-X	1843	.	T	<*>	0	.	DP=18;I16=9,9,0,0,630,22746,0,0,1037,61489,0,0,364,8366,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,243:11:0	0,12,131:4:0	0,9,107:3:0
-X	1844	.	T	<*>	0	.	DP=18;I16=9,9,0,0,618,21618,0,0,1037,61489,0,0,366,8464,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,240:11:0	0,12,137:4:0	0,9,98:3:0
-X	1845	.	G	<*>	0	.	DP=18;I16=9,9,0,0,644,23976,0,0,1037,61489,0,0,368,8574,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,138:4:0	0,9,82:3:0
-X	1846	.	C	<*>	0	.	DP=18;I16=9,9,0,0,687,26809,0,0,1037,61489,0,0,370,8696,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,129:4:0	0,9,100:3:0
-X	1847	.	T	<*>	0	.	DP=18;I16=9,9,0,0,675,25529,0,0,1037,61489,0,0,373,8829,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,132:4:0	0,6,76:2:0
-X	1848	.	G	<*>	0	.	DP=18;I16=9,9,0,0,597,20845,0,0,1037,61489,0,0,377,8973,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,118:4:0	0,6,64:2:0
-X	1849	.	T	<*>	0	.	DP=20;I16=9,10,0,0,614,20770,0,0,1097,65089,0,0,380,9078,0,0;QS=3,0;MQSB=0.920044;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,119:4:0	0,6,71:2:0
-X	1850	.	C	<*>	0	.	DP=19;I16=8,11,0,0,684,25154,0,0,1097,65089,0,0,409,9769,0,0;QS=3,0;MQSB=0.902014;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,120:4:0	0,3,37:1:0
-X	1851	.	A	<*>	0	.	DP=20;I16=9,11,0,0,738,27838,0,0,1157,68689,0,0,413,9847,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,143:4:0	0,3,41:1:0
-X	1852	.	G	<*>	0	.	DP=19;I16=8,11,0,0,639,22239,0,0,1097,65089,0,0,392,9264,0,0;QS=3,0;MQSB=0.902014;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,117:4:0	0,3,36:1:0
-X	1853	.	G	<*>	0	.	DP=20;I16=9,11,0,0,627,20873,0,0,1157,68689,0,0,396,9322,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,127:5:0	0,3,38:1:0
-X	1854	.	A	<*>	0	.	DP=22;I16=10,11,0,0,674,22428,0,0,1217,72289,0,0,401,9397,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,145:5:0	0,3,38:1:0
-X	1855	.	C	<*>	0	.	DP=22;I16=10,12,0,0,771,27949,0,0,1277,75889,0,0,407,9441,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,132:5:0	0,3,37:1:0
-X	1856	.	A	<*>	0	.	DP=22;I16=10,12,0,0,806,30230,0,0,1277,75889,0,0,412,9456,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,146:5:0	0,3,41:1:0
-X	1857	.	G	<*>	0	.	DP=22;I16=10,12,0,0,699,23919,0,0,1277,75889,0,0,416,9442,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,134:5:0	0,3,35:1:0
-X	1858	.	T	<*>	0	.	DP=23;I16=10,13,0,0,773,26797,0,0,1337,79489,0,0,419,9399,0,0;QS=3,0;MQSB=0.921963;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,148:5:0	0,3,37:1:0
-X	1859	.	G	<*>	0	.	DP=23;I16=10,13,0,0,798,28594,0,0,1337,79489,0,0,423,9379,0,0;QS=3,0;MQSB=0.921963;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,146:5:0	0,3,36:1:0
-X	1860	.	G	<*>	0	.	DP=23;I16=10,13,0,0,726,23842,0,0,1337,79489,0,0,425,9283,0,0;QS=3,0;MQSB=0.921963;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,126:5:0	0,3,33:1:0
-X	1861	.	T	<*>	0	.	DP=23;I16=10,13,0,0,741,24793,0,0,1337,79489,0,0,425,9113,0,0;QS=3,0;MQSB=0.921963;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,143:5:0	0,3,39:1:0
-X	1862	.	C	<*>	0	.	DP=23;I16=10,12,0,0,738,25732,0,0,1277,75889,0,0,403,8487,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,135:5:0	0,3,34:1:0
-X	1863	.	C	<*>	0	.	DP=24;I16=10,13,0,0,804,29186,0,0,1337,79489,0,0,400,8232,0,0;QS=3,0;MQSB=0.921963;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,133:5:0	0,3,36:1:0
-X	1864	.	T	<*>	0	.	DP=24;I16=11,11,0,0,766,27572,0,0,1277,75889,0,0,392,8174,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,125:4:0	0,3,37:1:0
-X	1865	.	G	<*>	0	.	DP=24;I16=11,13,0,0,860,31394,0,0,1397,83089,0,0,425,8621,0,0;QS=3,0;MQSB=0.931547;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,154:5:0	0,3,38:1:0
-X	1866	.	G	<*>	0	.	DP=24;I16=11,13,0,0,795,27503,0,0,1397,83089,0,0,425,8551,0,0;QS=3,0;MQSB=0.931547;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,152:5:0	0,3,36:1:0
-X	1867	.	C	<*>	0	.	DP=24;I16=9,13,0,0,726,24886,0,0,1320,79200,0,0,375,7263,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,122:5:0	0,3,38:1:0
-X	1868	.	C	<*>	0	.	DP=24;I16=11,12,0,0,857,32293,0,0,1337,79489,0,0,411,8311,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,12,118:4:0	0,3,41:1:0
-X	1869	.	A	T,<*>	0	.	DP=24;I16=6,9,5,4,531,19001,268,8660,857,50689,540,32400,273,5667,152,2866;QS=1.4724,1.5276,0;VDB=0.928022;SGB=-11.9537;RPB=0.984127;MQB=0.96464;MQSB=0.931547;BQB=0.359155;MQ0F=0	PL:DP:DV	115,0,224,148,245,255:18:7	16,0,104,28,107,128:5:1	42,3,0,42,3,42:1:1
-X	1870	.	C	<*>	0	.	DP=25;I16=11,13,0,0,804,27826,0,0,1397,83089,0,0,425,8591,0,0;QS=3,0;MQSB=0.931547;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,127:5:0	0,3,36:1:0
-X	1871	.	C	<*>	0	.	DP=25;I16=11,14,0,0,761,24187,0,0,1457,86689,0,0,428,8690,0,0;QS=3,0;MQSB=0.929204;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,128:6:0	0,3,29:1:0
-X	1872	.	G	<*>	0	.	DP=25;I16=10,14,0,0,763,25437,0,0,1397,83089,0,0,425,8803,0,0;QS=3,0;MQSB=0.919431;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,132:6:0	0,3,43:1:0
-X	1873	.	G	<*>	0	.	DP=26;I16=11,15,0,0,790,25548,0,0,1517,90289,0,0,429,8931,0,0;QS=3,0;MQSB=0.927041;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,151:7:0	0,3,43:1:0
-X	1874	.	G	<*>	0	.	DP=27;I16=11,16,0,0,861,29013,0,0,1577,93889,0,0,430,9076,0,0;QS=3,0;MQSB=0.925036;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,24,172:8:0	0,3,43:1:0
-X	1875	.	G	<*>	0	.	DP=26;I16=11,15,0,0,800,26216,0,0,1517,90289,0,0,431,9155,0,0;QS=3,0;MQSB=0.927041;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,168:7:0	0,3,42:1:0
-X	1876	.	C	<*>	0	.	DP=26;I16=10,15,0,0,894,32714,0,0,1457,86689,0,0,432,9268,0,0;QS=3,0;MQSB=0.9171;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,171:7:0	0,3,41:1:0
-X	1877	.	T	<*>	0	.	DP=25;I16=9,15,0,0,848,30804,0,0,1397,83089,0,0,409,8787,0,0;QS=3,0;MQSB=0.904837;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,163:6:0	0,3,42:1:0
-X	1878	.	C	<*>	0	.	DP=25;I16=10,15,0,0,906,33478,0,0,1457,86689,0,0,434,9488,0,0;QS=3,0;MQSB=0.9171;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,166:7:0	0,3,40:1:0
-X	1879	.	A	<*>	0	.	DP=26;I16=10,16,0,0,911,32761,0,0,1517,90289,0,0,433,9543,0,0;QS=3,0;MQSB=0.914947;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,191:8:0	0,3,40:1:0
-X	1880	.	C	<*>	0	.	DP=26;I16=10,16,0,0,790,24876,0,0,1517,90289,0,0,431,9527,0,0;QS=3,0;MQSB=0.914947;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,152:8:0	0,3,31:1:0
-X	1881	.	G	<*>	0	.	DP=27;I16=10,15,0,0,782,25352,0,0,1500,90000,0,0,380,8288,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,144:7:0	0,3,42:1:0
-X	1882	.	G	<*>	0	.	DP=28;I16=12,15,0,0,937,33215,0,0,1577,93889,0,0,406,8952,0,0;QS=3,0;MQSB=0.935229;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,164:7:0	0,3,42:1:0
-X	1883	.	A	<*>	0	.	DP=29;I16=14,15,0,0,998,35394,0,0,1697,101089,0,0,434,9646,0,0;QS=3,0;MQSB=0.947838;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,24,180:8:0	0,3,43:1:0
-X	1884	.	G	<*>	0	.	DP=29;I16=14,15,0,0,1036,37926,0,0,1697,101089,0,0,437,9647,0,0;QS=3,0;MQSB=0.947838;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,24,202:8:0	0,3,42:1:0
-X	1885	.	C	<*>	0	.	DP=28;I16=14,13,0,0,925,32305,0,0,1577,93889,0,0,430,9560,0,0;QS=3,0;MQSB=0.951472;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,182:7:0	0,3,42:1:0
-X	1886	.	C	<*>	0	.	DP=26;I16=13,13,0,0,826,27194,0,0,1517,90289,0,0,447,9745,0,0;QS=3,0;MQSB=0.945959;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,166:8:0	0,3,32:1:0
-X	1887	.	G	<*>	0	.	DP=26;I16=12,13,0,0,798,26554,0,0,1500,90000,0,0,428,9212,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,185:8:0	0,3,40:1:0
-X	1888	.	C	<*>	0	.	DP=26;I16=13,13,0,0,901,32343,0,0,1517,90289,0,0,459,9957,0,0;QS=3,0;MQSB=0.945959;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,178:8:0	0,3,39:1:0
-X	1889	.	C	<*>	0	.	DP=25;I16=13,11,0,0,825,29127,0,0,1397,83089,0,0,444,9612,0,0;QS=3,0;MQSB=0.950498;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,187:7:0	0,3,37:1:0
-X	1890	.	C	<*>	0	.	DP=25;I16=13,12,0,0,913,34029,0,0,1457,86689,0,0,471,10173,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,198:8:0	0,3,40:1:0
-X	1891	.	T	<*>	0	.	DP=25;I16=13,12,0,0,912,34028,0,0,1457,86689,0,0,477,10317,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,212:8:0	0,3,39:1:0
-X	1892	.	G	<*>	0	.	DP=25;I16=12,12,0,0,885,33149,0,0,1397,83089,0,0,458,9860,0,0;QS=3,0;MQSB=0.941765;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,166:7:0	0,3,37:1:0
-X	1893	.	T	<*>	0	.	DP=26;I16=14,12,0,0,920,33494,0,0,1517,90289,0,0,489,10677,0,0;QS=3,0;MQSB=0.953497;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,205:8:0	0,6,72:2:0
-X	1894	.	G	<*>	0	.	DP=26;I16=14,12,0,0,934,35048,0,0,1517,90289,0,0,495,10843,0,0;QS=3,0;MQSB=0.953497;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,188:8:0	0,6,75:2:0
-X	1895	.	C	<*>	0	.	DP=26;I16=13,12,0,0,882,31980,0,0,1500,90000,0,0,476,10408,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,180:8:0	0,6,73:2:0
-X	1896	.	C	<*>	0	.	DP=26;I16=14,11,0,0,827,28179,0,0,1457,86689,0,0,482,10622,0,0;QS=3,0;MQSB=0.955682;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,154:7:0	0,6,72:2:0
-X	1897	.	G	<*>	0	.	DP=26;I16=13,11,0,0,763,25169,0,0,1397,83089,0,0,486,10856,0,0;QS=3,0;MQSB=0.950498;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,164:7:0	0,3,27:1:0
-X	1898	.	T	<*>	0	.	DP=27;I16=14,11,0,0,846,29526,0,0,1500,90000,0,0,492,11072,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,187:8:0	0,6,62:2:0
-X	1899	.	G	<*>	0	.	DP=27;I16=14,11,0,0,875,32007,0,0,1500,90000,0,0,497,11213,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,188:8:0	0,6,61:2:0
-X	1900	.	T	<*>	0	.	DP=26;I16=14,11,0,0,850,29882,0,0,1500,90000,0,0,501,11329,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,185:8:0	0,6,69:2:0
-X	1901	.	A	<*>	0	.	DP=27;I16=15,10,0,0,842,29298,0,0,1457,86689,0,0,505,11469,0,0;QS=3,0;MQSB=0.962269;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,190:7:0	0,6,68:2:0
-X	1902	.	C	<*>	0	.	DP=27;I16=15,12,0,0,912,31970,0,0,1577,93889,0,0,537,12267,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,184:8:0	0,6,60:2:0
-X	1903	.	C	<*>	0	.	DP=27;I16=15,12,0,0,959,34645,0,0,1577,93889,0,0,542,12462,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,201:8:0	0,6,63:2:0
-X	1904	.	T	<*>	0	.	DP=27;I16=16,11,0,0,1017,38757,0,0,1577,93889,0,0,548,12682,0,0;QS=3,0;MQSB=0.96384;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,221:8:0	0,6,77:2:0
-X	1905	.	C	<*>	0	.	DP=27;I16=16,11,0,0,985,36561,0,0,1577,93889,0,0,553,12827,0,0;QS=3,0;MQSB=0.96384;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,211:8:0	0,6,69:2:0
-X	1906	.	T	<*>	0	.	DP=27;I16=16,11,0,0,1018,39242,0,0,1577,93889,0,0,558,12998,0,0;QS=3,0;MQSB=0.96384;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,207:8:0	0,6,75:2:0
-X	1907	.	G	<*>	0	.	DP=27;I16=15,11,0,0,935,34679,0,0,1517,90289,0,0,535,12419,0,0;QS=3,0;MQSB=0.960078;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,187:7:0	0,6,68:2:0
-X	1908	.	A	<*>	0	.	DP=28;I16=16,12,0,0,1023,38221,0,0,1637,97489,0,0,561,13063,0,0;QS=3,0;MQSB=0.96195;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,24,215:8:0	0,6,67:2:0
-X	1909	.	G	<*>	0	.	DP=27;I16=15,12,0,0,1002,38398,0,0,1577,93889,0,0,561,12953,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,206:8:0	0,6,73:2:0
-X	1910	.	C	<*>	0	.	DP=27;I16=14,10,0,0,855,31251,0,0,1440,86400,0,0,502,11588,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,179:7:0	0,6,71:2:0
-X	1911	.	C	<*>	0	.	DP=27;I16=15,12,0,0,967,35429,0,0,1577,93889,0,0,561,12793,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,206:8:0	0,6,71:2:0
-X	1912	.	C	<*>	0	.	DP=27;I16=15,12,0,0,1024,39272,0,0,1577,93889,0,0,561,12743,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,217:8:0	0,6,73:2:0
-X	1913	.	T	<*>	0	.	DP=27;I16=15,12,0,0,1028,39768,0,0,1577,93889,0,0,561,12713,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,228:8:0	0,6,77:2:0
-X	1914	.	C	<*>	0	.	DP=27;I16=15,12,0,0,1010,38762,0,0,1577,93889,0,0,561,12703,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,221:8:0	0,6,75:2:0
-X	1915	.	T	C,<*>	0	.	DP=27;I16=14,12,1,0,974,37184,16,256,1560,93600,17,289,543,12389,18,324;QS=2.97351,0.0264901,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.958048;BQB=1;MQ0F=0	PL:DP:DV	0,34,255,48,255,255:17:1	0,24,231,24,231,231:8:0	0,6,60,6,60,60:2:0
-X	1916	.	G	T,<*>	0	.	DP=27;I16=14,12,1,0,991,38291,15,225,1560,93600,17,289,544,12454,17,289;QS=2.97581,0.0241935,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.958048;BQB=1;MQ0F=0	PL:DP:DV	0,35,255,48,255,255:17:1	0,24,226,24,226,226:8:0	0,6,69,6,69,69:2:0
-X	1917	.	C	<*>	0	.	DP=27;I16=15,12,0,0,1030,39740,0,0,1577,93889,0,0,561,12793,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,214:8:0	0,6,73:2:0
-X	1918	.	A	<*>	0	.	DP=27;I16=15,11,0,0,963,36201,0,0,1517,90289,0,0,542,12502,0,0;QS=3,0;MQSB=0.960078;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,217:8:0	0,6,72:2:0
-X	1919	.	C	<*>	0	.	DP=27;I16=15,12,0,0,987,36651,0,0,1577,93889,0,0,560,12902,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,214:8:0	0,6,72:2:0
-X	1920	.	A	T,<*>	0	.	DP=29;I16=15,12,0,1,1007,38337,14,196,1546,91130,60,3600,538,12518,21,441;QS=2.97647,0.0235294,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.999735;BQB=1;MQ0F=0	PL:DP:DV	0,36,255,48,255,255:17:1	0,24,225,24,225,225:8:0	0,9,101,9,101,101:3:0
-X	1921	.	G	<*>	0	.	DP=30;I16=15,14,0,0,1059,39815,0,0,1666,98330,0,0,542,12474,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,182:7:0	0,12,132:4:0
-X	1922	.	T	<*>	0	.	DP=29;I16=14,14,0,0,1013,37513,0,0,1649,98041,0,0,532,12418,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,197:7:0	0,12,134:4:0
-X	1923	.	G	<*>	0	.	DP=28;I16=14,14,0,0,1034,38974,0,0,1606,94730,0,0,545,12629,0,0;QS=3,0;MQSB=0.999736;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,188:7:0	0,12,126:4:0
-X	1924	.	C	<*>	0	.	DP=27;I16=13,13,0,0,965,36587,0,0,1486,87530,0,0,521,12017,0,0;QS=3,0;MQSB=0.999671;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,183:7:0	0,12,116:4:0
-X	1925	.	C	<*>	0	.	DP=27;I16=14,13,0,0,987,37021,0,0,1546,91130,0,0,546,12626,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,187:7:0	0,12,124:4:0
-X	1926	.	T	<*>	0	.	DP=27;I16=14,13,0,0,1031,40057,0,0,1546,91130,0,0,545,12581,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,197:7:0	0,12,141:4:0
-X	1927	.	T	<*>	0	.	DP=27;I16=13,13,0,0,959,35773,0,0,1529,90841,0,0,538,12522,0,0;QS=3,0;MQSB=0.945959;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,191:7:0	0,12,133:4:0
-X	1928	.	C	<*>	0	.	DP=27;I16=13,13,0,0,986,38264,0,0,1529,90841,0,0,538,12532,0,0;QS=3,0;MQSB=0.945959;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,189:7:0	0,12,125:4:0
-X	1929	.	T	<*>	0	.	DP=27;I16=13,13,0,0,990,38630,0,0,1529,90841,0,0,538,12562,0,0;QS=3,0;MQSB=0.945959;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,189:7:0	0,12,139:4:0
-X	1930	.	G	<*>	0	.	DP=26;I16=13,11,0,0,905,34865,0,0,1409,83641,0,0,521,12271,0,0;QS=3,0;MQSB=0.931547;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,179:6:0	0,9,99:3:0
-X	1931	.	C	<*>	0	.	DP=27;I16=15,12,0,0,967,36293,0,0,1546,91130,0,0,540,12578,0,0;QS=3,0;MQSB=0.99881;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,165:6:0	0,12,121:4:0
-X	1932	.	T	<*>	0	.	DP=27;I16=14,13,0,0,998,38154,0,0,1546,91130,0,0,541,12605,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,143:5:0	0,15,146:5:0
-X	1933	.	T	<*>	0	.	DP=27;I16=14,13,0,0,962,35344,0,0,1546,91130,0,0,542,12602,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,142:5:0	0,15,158:5:0
-X	1934	.	G	<*>	0	.	DP=27;I16=13,13,0,0,987,38219,0,0,1529,90841,0,0,543,12569,0,0;QS=3,0;MQSB=0.945959;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,134:5:0	0,15,143:5:0
-X	1935	.	C	<*>	0	.	DP=27;I16=14,12,0,0,963,36627,0,0,1529,90841,0,0,520,11930,0,0;QS=3,0;MQSB=0.937241;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,162:6:0	0,15,154:5:0
-X	1936	.	C	<*>	0	.	DP=27;I16=14,13,0,0,1018,39406,0,0,1589,94441,0,0,547,12561,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,177:6:0	0,15,159:5:0
-X	1937	.	T	<*>	0	.	DP=27;I16=14,13,0,0,1036,40636,0,0,1589,94441,0,0,547,12489,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,182:6:0	0,15,170:5:0
-X	1938	.	G	<*>	0	.	DP=27;I16=14,13,0,0,1001,38377,0,0,1589,94441,0,0,546,12392,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,166:6:0	0,15,155:5:0
-X	1939	.	T	<*>	0	.	DP=27;I16=14,12,0,0,964,36430,0,0,1560,93600,0,0,525,11909,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,167:6:0	0,12,144:4:0
-X	1940	.	G	<*>	0	.	DP=27;I16=14,13,0,0,1003,37937,0,0,1589,94441,0,0,542,12172,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,159:6:0	0,15,155:5:0
-X	1941	.	G	<*>	0	.	DP=27;I16=14,13,0,0,1004,38072,0,0,1589,94441,0,0,540,12098,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,176:6:0	0,15,156:5:0
-X	1942	.	C	<*>	0	.	DP=27;I16=14,12,0,0,996,38790,0,0,1560,93600,0,0,516,11564,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,174:6:0	0,12,140:4:0
-X	1943	.	T	<*>	0	.	DP=27;I16=14,13,0,0,1044,40952,0,0,1589,94441,0,0,536,12022,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,184:6:0	0,15,167:5:0
-X	1944	.	T	<*>	0	.	DP=27;I16=14,13,0,0,987,37237,0,0,1589,94441,0,0,533,11971,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,175:6:0	0,15,170:5:0
-X	1945	.	T	<*>	0	.	DP=27;I16=14,13,0,0,993,37067,0,0,1589,94441,0,0,530,11946,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,174:6:0	0,15,171:5:0
-X	1946	.	G	<*>	0	.	DP=27;I16=14,13,0,0,1013,38617,0,0,1589,94441,0,0,526,11896,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,162:6:0	0,15,162:5:0
-X	1947	.	A	<*>	0	.	DP=26;I16=13,13,0,0,950,35522,0,0,1529,90841,0,0,522,11818,0,0;QS=3,0;MQSB=0.945959;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,167:6:0	0,15,160:5:0
-X	1948	.	G	C,<*>	0	.	DP=27;I16=14,12,0,1,966,36912,16,256,1560,93600,29,841,493,11135,25,625;QS=2.90361,0.0963855,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.94394;BQB=1;MQ0F=0	PL:DP:DV	0,45,255,45,255,255:15:0	0,21,190,21,190,190:7:0	1,0,123,13,126,132:5:1
-X	1949	.	A	<*>	0	.	DP=26;I16=14,11,0,0,871,31325,0,0,1469,87241,0,0,490,11048,0,0;QS=3,0;MQSB=0.929204;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,174:7:0	0,15,155:5:0
-X	1950	.	A	<*>	0	.	DP=27;I16=14,13,0,0,1007,38049,0,0,1589,94441,0,0,511,11559,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,21,205:7:0	0,18,176:6:0
-X	1951	.	G	<*>	0	.	DP=27;I16=14,13,0,0,960,35536,0,0,1589,94441,0,0,509,11469,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,21,180:7:0	0,18,181:6:0
-X	1952	.	A	<*>	0	.	DP=27;I16=14,12,0,0,924,33366,0,0,1529,90841,0,0,483,10779,0,0;QS=3,0;MQSB=0.937241;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,184:7:0	0,18,182:6:0
-X	1953	.	A	<*>	0	.	DP=28;I16=15,12,0,0,925,32719,0,0,1589,94441,0,0,482,10740,0,0;QS=3,0;MQSB=0.935229;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,21,189:7:0	0,18,168:6:0
-X	1954	.	A	C,<*>	0	.	DP=29;I16=14,13,0,1,929,33219,18,324,1620,97200,29,841,475,10679,25,625;QS=2.90217,0.0978261,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.949591;BQB=1;MQ0F=0	PL:DP:DV	0,45,255,45,255,255:15:0	0,21,198,21,198,198:7:0	0,0,130,15,133,141:6:1
-X	1955	.	C	<*>	0	.	DP=29;I16=14,12,0,0,961,36067,0,0,1560,93600,0,0,451,10035,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,21,206:7:0	0,15,165:5:0
-X	1956	.	C	<*>	0	.	DP=29;I16=14,13,0,0,964,35402,0,0,1620,97200,0,0,475,10573,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,196:7:0	0,15,164:5:0
-X	1957	.	C	<*>	0	.	DP=29;I16=14,13,0,0,980,36212,0,0,1620,97200,0,0,472,10420,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,183:7:0	0,15,167:5:0
-X	1958	.	C	<*>	0	.	DP=29;I16=15,13,0,0,1003,37293,0,0,1649,98041,0,0,493,10825,0,0;QS=3,0;MQSB=0.942064;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,191:7:0	0,18,190:6:0
-X	1959	.	T	<*>	0	.	DP=29;I16=16,13,0,0,1112,43258,0,0,1709,101641,0,0,491,10593,0,0;QS=3,0;MQSB=0.940317;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,213:7:0	0,18,193:6:0
-X	1960	.	T	<*>	0	.	DP=30;I16=17,13,0,0,1053,37939,0,0,1769,105241,0,0,485,10339,0,0;QS=3,0;MQSB=0.938685;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,196:7:0	0,18,186:6:0
-X	1961	.	C	<*>	0	.	DP=30;I16=17,13,0,0,1101,41737,0,0,1769,105241,0,0,480,10122,0,0;QS=3,0;MQSB=0.938685;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,195:7:0	0,18,183:6:0
-X	1962	.	T	<*>	0	.	DP=29;I16=17,12,0,0,1134,44582,0,0,1709,101641,0,0,477,9941,0,0;QS=3,0;MQSB=0.931617;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,208:7:0	0,18,198:6:0
-X	1963	.	G	<*>	0	.	DP=28;I16=16,12,0,0,1066,41050,0,0,1649,98041,0,0,476,9794,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,192:7:0	0,18,188:6:0
-X	1964	.	G	<*>	0	.	DP=28;I16=16,12,0,0,970,34764,0,0,1649,98041,0,0,475,9681,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,178:7:0	0,18,169:6:0
-X	1965	.	T	<*>	0	.	DP=29;I16=16,12,0,0,964,34772,0,0,1649,98041,0,0,449,8977,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,196:7:0	0,18,171:6:0
-X	1966	.	T	<*>	0	.	DP=29;I16=16,13,0,0,1029,37027,0,0,1709,101641,0,0,474,9558,0,0;QS=3,0;MQSB=0.940317;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,191:7:0	0,18,181:6:0
-X	1967	.	A	<*>	0	.	DP=29;I16=16,13,0,0,1030,37234,0,0,1709,101641,0,0,474,9550,0,0;QS=3,0;MQSB=0.940317;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,187:7:0	0,18,182:6:0
-X	1968	.	T	<*>	0	.	DP=29;I16=16,13,0,0,1075,40173,0,0,1709,101641,0,0,474,9578,0,0;QS=3,0;MQSB=0.940317;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,195:7:0	0,18,190:6:0
-X	1969	.	A	<*>	0	.	DP=28;I16=16,12,0,0,992,35828,0,0,1649,98041,0,0,474,9592,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,175:6:0	0,18,186:6:0
-X	1970	.	C	<*>	0	.	DP=28;I16=16,12,0,0,1015,37503,0,0,1649,98041,0,0,474,9642,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,170:6:0	0,18,180:6:0
-X	1971	.	A	<*>	0	.	DP=29;I16=16,13,0,0,1073,40273,0,0,1709,101641,0,0,474,9728,0,0;QS=3,0;MQSB=0.940317;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,178:6:0	0,21,206:7:0
-X	1972	.	T	<*>	0	.	DP=30;I16=16,14,0,0,1068,38978,0,0,1769,105241,0,0,475,9851,0,0;QS=3,0;MQSB=0.946202;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,176:6:0	0,21,203:7:0
-X	1973	.	A	<*>	0	.	DP=30;I16=16,13,0,0,1046,38070,0,0,1740,104400,0,0,452,9388,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,172:6:0	0,18,196:6:0
-X	1974	.	A	<*>	0	.	DP=29;I16=16,13,0,0,1086,41474,0,0,1709,101641,0,0,477,10065,0,0;QS=3,0;MQSB=0.940317;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,157:5:0	0,21,214:7:0
-X	1975	.	G	<*>	0	.	DP=28;I16=16,12,0,0,1067,41171,0,0,1649,98041,0,0,478,10156,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,133:4:0	0,21,195:7:0
-X	1976	.	A	<*>	0	.	DP=28;I16=16,12,0,0,981,34839,0,0,1649,98041,0,0,478,10234,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,125:4:0	0,21,199:7:0
-X	1977	.	C	<*>	0	.	DP=28;I16=16,12,0,0,1009,37471,0,0,1649,98041,0,0,477,10297,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,132:4:0	0,21,194:7:0
-X	1978	.	A	<*>	0	.	DP=28;I16=16,12,0,0,1082,42132,0,0,1649,98041,0,0,476,10394,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,144:4:0	0,21,220:7:0
-X	1979	.	G	<*>	0	.	DP=28;I16=16,11,0,0,1019,38927,0,0,1589,94441,0,0,454,10064,0,0;QS=3,0;MQSB=0.925036;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,122:4:0	0,21,208:7:0
-X	1980	.	C	<*>	0	.	DP=27;I16=16,10,0,0,932,34456,0,0,1529,90841,0,0,452,10114,0,0;QS=3,0;MQSB=0.914947;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,107:3:0	0,21,197:7:0
-X	1981	.	C	<*>	0	.	DP=28;I16=16,12,0,0,998,36510,0,0,1649,98041,0,0,469,10479,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,9,101:3:0	0,24,219:8:0
-X	1982	.	A	<*>	0	.	DP=29;I16=16,12,0,0,1035,38815,0,0,1649,98041,0,0,472,10548,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,110:3:0	0,27,254:9:0
-X	1983	.	G	<*>	0	.	DP=28;I16=16,12,0,0,1048,40322,0,0,1649,98041,0,0,477,10599,0,0;QS=3,0;MQSB=0.933359;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,96:3:0	0,27,249:9:0
-X	1984	.	A	<*>	0	.	DP=27;I16=16,11,0,0,1024,39232,0,0,1589,94441,0,0,482,10632,0,0;QS=3,0;MQSB=0.925036;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,70:2:0	0,27,255:9:0
-X	1985	.	G	<*>	0	.	DP=27;I16=16,11,0,0,1009,38449,0,0,1589,94441,0,0,487,10695,0,0;QS=3,0;MQSB=0.925036;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,66:2:0	0,27,231:9:0
-X	1986	.	A	<*>	0	.	DP=27;I16=16,10,0,0,926,33696,0,0,1560,93600,0,0,466,10112,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,76:2:0	0,24,223:8:0
-X	1987	.	A	<*>	0	.	DP=28;I16=17,11,0,0,1034,39088,0,0,1649,98041,0,0,495,10807,0,0;QS=3,0;MQSB=0.923174;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,78:2:0	0,27,247:9:0
-X	1988	.	G	<*>	0	.	DP=28;I16=17,11,0,0,1050,39980,0,0,1649,98041,0,0,499,10855,0,0;QS=3,0;MQSB=0.923174;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,63:2:0	0,27,239:9:0
-X	1989	.	G	<*>	0	.	DP=28;I16=17,10,0,0,994,37610,0,0,1589,94441,0,0,493,10801,0,0;QS=3,0;MQSB=0.912952;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,73:2:0	0,27,237:9:0
-X	1990	.	G	T,<*>	0	.	DP=28;I16=17,9,0,1,965,36359,33,1089,1560,93600,29,841,472,10250,25,625;QS=2.90675,0.0932476,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.912952;BQB=1;MQ0F=0	PL:DP:DV	0,48,255,48,255,255:16:0	0,6,71,6,71,71:2:0	2,0,195,26,198,215:9:1
-X	1991	.	A	<*>	0	.	DP=28;I16=17,11,0,0,1017,38203,0,0,1649,98041,0,0,507,10975,0,0;QS=3,0;MQSB=0.923174;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,60:2:0	0,27,250:9:0
-X	1992	.	G	<*>	0	.	DP=28;I16=17,11,0,0,1028,38852,0,0,1649,98041,0,0,509,11039,0,0;QS=3,0;MQSB=0.923174;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,62:2:0	0,27,231:9:0
-X	1993	.	T	<*>	0	.	DP=28;I16=17,11,0,0,1015,37325,0,0,1649,98041,0,0,511,11131,0,0;QS=3,0;MQSB=0.923174;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,59:2:0	0,27,243:9:0
-X	1994	.	T	<*>	0	.	DP=27;I16=16,11,0,0,942,33698,0,0,1589,94441,0,0,514,11250,0,0;QS=3,0;MQSB=0.925036;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,54:2:0	0,24,216:8:0
-X	1995	.	G	<*>	0	.	DP=28;I16=16,11,0,0,960,35432,0,0,1620,97200,0,0,492,10770,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,66:2:0	0,21,188:7:0
-X	1996	.	C	<*>	0	.	DP=29;I16=17,12,0,0,1022,37426,0,0,1709,101641,0,0,519,11469,0,0;QS=3,0;MQSB=0.931617;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,64:2:0	0,24,192:8:0
-X	1997	.	C	<*>	0	.	DP=29;I16=17,11,0,0,934,32858,0,0,1649,98041,0,0,520,11524,0,0;QS=3,0;MQSB=0.923174;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,70:2:0	0,24,193:8:0
-X	1998	.	C	<*>	0	.	DP=29;I16=17,12,0,0,1027,37843,0,0,1709,101641,0,0,522,11562,0,0;QS=3,0;MQSB=0.931617;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,69:2:0	0,24,222:8:0
-X	1999	.	A	<*>	0	.	DP=28;I16=17,11,0,0,1073,41493,0,0,1649,98041,0,0,525,11627,0,0;QS=3,0;MQSB=0.923174;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,72:2:0	0,21,206:7:0
-X	2000	.	G	<*>	0	.	DP=28;I16=16,11,0,0,1036,40576,0,0,1589,94441,0,0,511,11395,0,0;QS=3,0;MQSB=0.925036;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,72:2:0	0,18,168:6:0
-X	2001	.	G	<*>	0	.	DP=28;I16=15,11,0,0,955,35661,0,0,1529,90841,0,0,489,10853,0,0;QS=3,0;MQSB=0.927041;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,62:2:0	0,18,172:6:0
-X	2002	.	G	<*>	0	.	DP=28;I16=17,10,0,0,907,32227,0,0,1620,97200,0,0,519,11663,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,53:2:0	0,18,163:6:0
-X	2003	.	T	<*>	0	.	DP=28;I16=17,11,0,0,920,31866,0,0,1649,98041,0,0,541,12163,0,0;QS=3,0;MQSB=0.923174;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,49:2:0	0,21,190:7:0
-X	2004	.	G	<*>	0	.	DP=27;I16=16,10,0,0,970,36928,0,0,1560,93600,0,0,530,12110,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,57:2:0	0,18,178:6:0
-X	2005	.	G	<*>	0	.	DP=27;I16=16,10,0,0,868,30936,0,0,1560,93600,0,0,536,12370,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,59:2:0	0,18,153:6:0
-X	2006	.	C	<*>	0	.	DP=27;I16=16,10,0,0,968,37046,0,0,1560,93600,0,0,541,12605,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,73:2:0	0,18,166:6:0
-X	2007	.	A	<*>	0	.	DP=27;I16=16,11,0,0,1000,37396,0,0,1589,94441,0,0,556,12882,0,0;QS=3,0;MQSB=0.925036;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,76:2:0	0,21,193:7:0
-X	2008	.	C	<*>	0	.	DP=26;I16=16,10,0,0,964,36892,0,0,1529,90841,0,0,555,12833,0,0;QS=3,0;MQSB=0.914947;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,73:2:0	0,21,183:7:0
-X	2009	.	A	<*>	0	.	DP=26;I16=16,10,0,0,997,38955,0,0,1529,90841,0,0,554,12802,0,0;QS=3,0;MQSB=0.914947;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,74:2:0	0,21,210:7:0
-X	2010	.	G	<*>	0	.	DP=26;I16=16,9,0,0,936,36208,0,0,1500,90000,0,0,542,12640,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,73:2:0	0,18,169:6:0
-X	2011	.	C	<*>	0	.	DP=26;I16=16,9,0,0,966,37960,0,0,1500,90000,0,0,541,12617,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,74:2:0	0,18,175:6:0
-X	2012	.	A	<*>	0	.	DP=27;I16=16,11,0,0,956,35018,0,0,1589,94441,0,0,548,12676,0,0;QS=3,0;MQSB=0.925036;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,74:2:0	0,21,189:7:0
-X	2013	.	C	<*>	0	.	DP=27;I16=15,10,0,0,876,31370,0,0,1500,90000,0,0,514,11950,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,69:2:0	0,18,160:6:0
-X	2014	.	G	<*>	0	.	DP=27;I16=17,10,0,0,903,31239,0,0,1589,94441,0,0,545,12591,0,0;QS=3,0;MQSB=0.912952;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,9,80:3:0	0,18,160:6:0
-X	2015	.	T	<*>	0	.	DP=27;I16=17,10,0,0,999,37507,0,0,1589,94441,0,0,545,12577,0,0;QS=3,0;MQSB=0.912952;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,9,95:3:0	0,18,178:6:0
-X	2016	.	T	<*>	0	.	DP=27;I16=17,10,0,0,971,35649,0,0,1589,94441,0,0,545,12583,0,0;QS=3,0;MQSB=0.912952;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,9,93:3:0	0,18,178:6:0
-X	2017	.	G	<*>	0	.	DP=28;I16=17,11,0,0,1013,37849,0,0,1649,98041,0,0,545,12609,0,0;QS=3,0;MQSB=0.923174;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,9,91:3:0	0,18,172:6:0
-X	2018	.	C	<*>	0	.	DP=28;I16=17,11,0,0,1060,41414,0,0,1649,98041,0,0,546,12656,0,0;QS=3,0;MQSB=0.923174;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,9,97:3:0	0,18,169:6:0
-X	2019	.	T	<*>	0	.	DP=28;I16=17,11,0,0,1083,42253,0,0,1649,98041,0,0,547,12725,0,0;QS=3,0;MQSB=0.923174;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,9,106:3:0	0,18,187:6:0
-X	2020	.	G	<*>	0	.	DP=29;I16=18,11,0,0,1095,42063,0,0,1678,98882,0,0,548,12816,0,0;QS=3,0;MQSB=0.987702;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,9,85:3:0	0,18,175:6:0
-X	2021	.	C	<*>	0	.	DP=29;I16=18,11,0,0,1081,41535,0,0,1709,101641,0,0,551,12877,0,0;QS=3,0;MQSB=0.969907;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,9,97:3:0	0,15,167:5:0
-X	2022	.	C	<*>	0	.	DP=30;I16=19,11,0,0,1115,42003,0,0,1769,105241,0,0,555,12907,0,0;QS=3,0;MQSB=0.972375;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,9,92:3:0	0,18,177:6:0
-X	2023	.	A	<*>	0	.	DP=30;I16=19,10,0,0,1063,39991,0,0,1709,101641,0,0,549,12837,0,0;QS=3,0;MQSB=0.974027;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,9,96:3:0	0,18,186:6:0
-X	2024	.	G	<*>	0	.	DP=32;I16=20,12,0,0,1168,43872,0,0,1889,112441,0,0,564,12982,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,9,92:3:0	0,24,203:8:0
-X	2025	.	T	<*>	0	.	DP=32;I16=20,12,0,0,1150,42122,0,0,1889,112441,0,0,569,12981,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,9,87:3:0	0,24,226:8:0
-X	2026	.	T	<*>	0	.	DP=32;I16=20,12,0,0,1130,40724,0,0,1889,112441,0,0,572,12908,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,9,94:3:0	0,24,208:8:0
-X	2027	.	A	<*>	0	.	DP=32;I16=19,12,0,0,1121,40871,0,0,1829,108841,0,0,550,12240,0,0;QS=3,0;MQSB=0.970829;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,9,84:3:0	0,21,207:7:0
-X	2028	.	C	<*>	0	.	DP=32;I16=20,12,0,0,1242,48548,0,0,1889,112441,0,0,577,12803,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,9,94:3:0	0,24,228:8:0
-X	2029	.	T	<*>	0	.	DP=32;I16=20,12,0,0,1229,47605,0,0,1889,112441,0,0,578,12724,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,9,102:3:0	0,24,236:8:0
-X	2030	.	G	<*>	0	.	DP=32;I16=20,12,0,0,1222,47140,0,0,1889,112441,0,0,579,12679,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,9,93:3:0	0,24,216:8:0
-X	2031	.	C	<*>	0	.	DP=31;I16=19,12,0,0,1150,43656,0,0,1829,108841,0,0,581,12667,0,0;QS=3,0;MQSB=0.970829;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,9,96:3:0	0,24,204:8:0
-X	2032	.	C	<*>	0	.	DP=31;I16=19,12,0,0,1157,44035,0,0,1829,108841,0,0,583,12687,0,0;QS=3,0;MQSB=0.970829;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,9,90:3:0	0,24,210:8:0
-X	2033	.	A	<*>	0	.	DP=30;I16=19,11,0,0,1091,40223,0,0,1769,105241,0,0,585,12689,0,0;QS=3,0;MQSB=0.972375;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,9,93:3:0	0,21,203:7:0
-X	2034	.	T	<*>	0	.	DP=30;I16=19,11,0,0,1104,41498,0,0,1769,105241,0,0,587,12723,0,0;QS=3,0;MQSB=0.972375;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,9,91:3:0	0,21,208:7:0
-X	2035	.	T	<*>	0	.	DP=29;I16=18,11,0,0,1084,41024,0,0,1709,101641,0,0,589,12739,0,0;QS=3,0;MQSB=0.969907;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,6,69:2:0	0,21,211:7:0
-X	2036	.	T	<*>	0	.	DP=29;I16=18,11,0,0,1080,40612,0,0,1709,101641,0,0,591,12787,0,0;QS=3,0;MQSB=0.969907;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,6,67:2:0	0,21,216:7:0
-X	2037	.	T	<*>	0	.	DP=29;I16=18,11,0,0,1082,40956,0,0,1709,101641,0,0,592,12818,0,0;QS=3,0;MQSB=0.969907;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,6,69:2:0	0,21,217:7:0
-X	2038	.	C	<*>	0	.	DP=29;I16=18,11,0,0,1117,43573,0,0,1709,101641,0,0,592,12832,0,0;QS=3,0;MQSB=0.969907;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,6,69:2:0	0,21,211:7:0
-X	2039	.	A	<*>	0	.	DP=29;I16=18,11,0,0,1067,39581,0,0,1709,101641,0,0,592,12878,0,0;QS=3,0;MQSB=0.969907;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,6,72:2:0	0,21,212:7:0
-X	2040	.	C	<*>	0	.	DP=29;I16=18,11,0,0,1077,40469,0,0,1709,101641,0,0,590,12856,0,0;QS=3,0;MQSB=0.969907;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,6,69:2:0	0,21,196:7:0
-X	2041	.	G	A,<*>	0	.	DP=31;I16=6,5,12,7,389,14023,721,28149,660,39600,1109,65641,235,5607,353,7259;QS=0.917304,2.0827,0;VDB=0.816435;SGB=-4.18892;RPB=0.88473;MQB=0.972375;MQSB=0.968257;BQB=0.311275;MQ0F=0	PL:DP:DV	229,0,212,255,245,255:21:11	32,0,24,35,27,59:2:1	223,21,0,223,21,223:7:7
-X	2042	.	G	<*>	0	.	DP=32;I16=18,14,0,0,1189,45617,0,0,1889,112441,0,0,588,12910,0,0;QS=3,0;MQSB=0.965264;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,9,86:3:0	0,21,206:7:0
-X	2043	.	G	<*>	0	.	DP=32;I16=17,14,0,0,1115,41585,0,0,1829,108841,0,0,581,12891,0,0;QS=3,0;MQSB=0.962133;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,9,90:3:0	0,21,197:7:0
-X	2044	.	C	<*>	0	.	DP=32;I16=18,14,0,0,1213,47029,0,0,1889,112441,0,0,588,13006,0,0;QS=3,0;MQSB=0.965264;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,9,85:3:0	0,21,207:7:0
-X	2045	.	A	<*>	0	.	DP=32;I16=18,14,0,0,1181,44527,0,0,1889,112441,0,0,588,13108,0,0;QS=3,0;MQSB=0.965264;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,9,83:3:0	0,21,213:7:0
-X	2046	.	T	<*>	0	.	DP=32;I16=18,14,0,0,1197,45135,0,0,1889,112441,0,0,587,13195,0,0;QS=3,0;MQSB=0.965264;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,9,103:3:0	0,21,216:7:0
-X	2047	.	G	<*>	0	.	DP=34;I16=17,16,0,0,1248,47798,0,0,1949,116041,0,0,557,12491,0,0;QS=3,0;MQSB=0.959328;MQ0F=0	PL:DP:DV	0,72,255:24:0	0,9,88:3:0	0,18,195:6:0
-X	2048	.	A	<*>	0	.	DP=34;I16=18,16,0,0,1230,45184,0,0,2009,119641,0,0,578,13022,0,0;QS=3,0;MQSB=0.962621;MQ0F=0	PL:DP:DV	0,72,255:24:0	0,9,87:3:0	0,21,206:7:0
-X	2049	.	A	<*>	0	.	DP=33;I16=17,16,0,0,1207,44567,0,0,1949,116041,0,0,575,12963,0,0;QS=3,0;MQSB=0.959328;MQ0F=0	PL:DP:DV	0,72,255:24:0	0,6,74:2:0	0,21,208:7:0
-X	2050	.	A	<*>	0	.	DP=33;I16=16,16,0,0,1169,43313,0,0,1889,112441,0,0,545,12211,0,0;QS=3,0;MQSB=0.955563;MQ0F=0	PL:DP:DV	0,72,255:24:0	0,6,77:2:0	0,18,188:6:0
-X	2051	.	T	<*>	0	.	DP=31;I16=16,15,0,0,1134,42164,0,0,1829,108841,0,0,567,12737,0,0;QS=3,0;MQSB=0.957006;MQ0F=0	PL:DP:DV	0,69,255:23:0	0,6,69:2:0	0,18,170:6:0
-X	2052	.	G	<*>	0	.	DP=31;I16=16,15,0,0,1180,45546,0,0,1829,108841,0,0,564,12664,0,0;QS=3,0;MQSB=0.957006;MQ0F=0	PL:DP:DV	0,69,255:23:0	0,6,74:2:0	0,18,175:6:0
-X	2053	.	G	T,<*>	0	.	DP=31;I16=15,15,0,1,1126,42672,23,529,1769,105241,60,3600,537,11991,25,625;QS=2.97307,0.0269321,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.951229;BQB=1;MQ0F=0	PL:DP:DV	0,46,255,66,255,255:23:1	0,6,71,6,71,71:2:0	0,18,180,18,180,180:6:0
-X	2054	.	A	<*>	0	.	DP=30;I16=15,15,0,0,1123,43027,0,0,1769,105241,0,0,562,12592,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,6,78:2:0	0,18,171:6:0
-X	2055	.	G	<*>	0	.	DP=30;I16=15,15,0,0,1156,45206,0,0,1769,105241,0,0,562,12592,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,6,66:2:0	0,18,168:6:0
-X	2056	.	A	<*>	0	.	DP=30;I16=15,15,0,0,1124,42416,0,0,1769,105241,0,0,560,12518,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,6,71:2:0	0,18,179:6:0
-X	2057	.	T	<*>	0	.	DP=30;I16=15,15,0,0,1094,40082,0,0,1769,105241,0,0,556,12374,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,6,72:2:0	0,18,178:6:0
-X	2058	.	A	<*>	0	.	DP=29;I16=14,15,0,0,1035,37517,0,0,1709,101641,0,0,552,12212,0,0;QS=3,0;MQSB=0.947838;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,6,57:2:0	0,18,179:6:0
-X	2059	.	A	<*>	0	.	DP=29;I16=14,15,0,0,1063,39615,0,0,1709,101641,0,0,548,12082,0,0;QS=3,0;MQSB=0.947838;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,6,66:2:0	0,18,188:6:0
-X	2060	.	C	<*>	0	.	DP=28;I16=12,15,0,0,1015,39057,0,0,1589,94441,0,0,523,11499,0,0;QS=3,0;MQSB=0.935229;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,6,62:2:0	0,15,143:5:0
-X	2061	.	A	<*>	0	.	DP=27;I16=12,14,0,0,950,35084,0,0,1529,90841,0,0,501,11073,0,0;QS=3,0;MQSB=0.937241;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,3,41:1:0	0,15,163:5:0
-X	2062	.	A	<*>	0	.	DP=26;I16=11,15,0,0,973,37349,0,0,1529,90841,0,0,519,11425,0,0;QS=3,0;MQSB=0.927041;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,57:2:0	0,15,164:5:0
-X	2063	.	C	<*>	0	.	DP=26;I16=11,15,0,0,1017,40149,0,0,1529,90841,0,0,517,11405,0,0;QS=3,0;MQSB=0.927041;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,74:2:0	0,15,158:5:0
-X	2064	.	A	<*>	0	.	DP=26;I16=11,15,0,0,1002,38980,0,0,1529,90841,0,0,515,11413,0,0;QS=3,0;MQSB=0.927041;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,75:2:0	0,15,164:5:0
-X	2065	.	G	<*>	0	.	DP=26;I16=12,14,0,0,1030,41232,0,0,1529,90841,0,0,514,11448,0,0;QS=3,0;MQSB=0.937241;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,78:2:0	0,18,167:6:0
-X	2066	.	G	<*>	0	.	DP=26;I16=12,14,0,0,973,37055,0,0,1529,90841,0,0,514,11510,0,0;QS=3,0;MQSB=0.937241;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,75:2:0	0,18,152:6:0
-X	2067	.	A	<*>	0	.	DP=26;I16=12,14,0,0,1005,39095,0,0,1529,90841,0,0,512,11498,0,0;QS=3,0;MQSB=0.937241;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,69:2:0	0,18,187:6:0
-X	2068	.	G	<*>	0	.	DP=26;I16=12,14,0,0,993,39005,0,0,1529,90841,0,0,509,11459,0,0;QS=3,0;MQSB=0.937241;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,53:2:0	0,18,167:6:0
-X	2069	.	C	<*>	0	.	DP=26;I16=12,14,0,0,873,29879,0,0,1529,90841,0,0,506,11442,0,0;QS=3,0;MQSB=0.937241;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,59:2:0	0,18,156:6:0
-X	2070	.	G	<*>	0	.	DP=27;I16=13,14,0,0,932,33090,0,0,1589,94441,0,0,502,11398,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,62:2:0	0,18,145:6:0
-X	2071	.	A	<*>	0	.	DP=27;I16=13,14,0,0,946,33884,0,0,1589,94441,0,0,498,11330,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,53:2:0	0,18,177:6:0
-X	2072	.	C	<*>	0	.	DP=25;I16=13,12,0,0,897,32897,0,0,1469,87241,0,0,496,11288,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,59:2:0	0,15,128:5:0
-X	2073	.	C	<*>	0	.	DP=26;I16=14,12,0,0,874,30184,0,0,1529,90841,0,0,492,11168,0,0;QS=3,0;MQSB=0.953497;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,53:2:0	0,15,133:5:0
-X	2074	.	G	<*>	0	.	DP=26;I16=13,12,0,0,835,29219,0,0,1469,87241,0,0,463,10395,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,67:2:0	0,12,83:4:0
-X	2075	.	C	<*>	0	.	DP=27;I16=15,12,0,0,989,37027,0,0,1589,94441,0,0,484,10896,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,6,69:2:0	0,15,115:5:0
-X	2076	.	A	<*>	0	.	DP=27;I16=14,12,0,0,929,33551,0,0,1529,90841,0,0,470,10676,0,0;QS=3,0;MQSB=0.953497;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,6,76:2:0	0,12,114:4:0
-X	2077	.	C	<*>	0	.	DP=27;I16=15,12,0,0,990,37252,0,0,1589,94441,0,0,478,10724,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,6,65:2:0	0,15,125:5:0
-X	2078	.	A	<*>	0	.	DP=27;I16=15,12,0,0,1023,39089,0,0,1589,94441,0,0,475,10677,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,6,72:2:0	0,15,148:5:0
-X	2079	.	G	<*>	0	.	DP=28;I16=15,13,0,0,1042,39694,0,0,1649,98041,0,0,471,10605,0,0;QS=3,0;MQSB=0.956162;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,6,72:2:0	0,15,133:5:0
-X	2080	.	G	<*>	0	.	DP=28;I16=14,13,0,0,968,35328,0,0,1589,94441,0,0,453,10333,0,0;QS=3,0;MQSB=0.951472;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,6,67:2:0	0,12,108:4:0
-X	2081	.	C	<*>	0	.	DP=26;I16=14,12,0,0,937,35303,0,0,1529,90841,0,0,467,10535,0,0;QS=3,0;MQSB=0.953497;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,63:2:0	0,15,110:5:0
-X	2082	.	T	<*>	0	.	DP=24;I16=12,12,0,0,901,34287,0,0,1409,83641,0,0,468,10532,0,0;QS=3,0;MQSB=0.941765;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,71:2:0	0,12,112:4:0
-X	2083	.	G	<*>	0	.	DP=24;I16=12,12,0,0,887,33597,0,0,1409,83641,0,0,469,10547,0,0;QS=3,0;MQSB=0.941765;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,68:2:0	0,12,113:4:0
-X	2084	.	C	<*>	0	.	DP=25;I16=13,12,0,0,938,35868,0,0,1469,87241,0,0,470,10580,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,61:2:0	0,12,115:4:0
-X	2085	.	T	<*>	0	.	DP=25;I16=13,12,0,0,932,35282,0,0,1469,87241,0,0,472,10632,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,64:2:0	0,12,130:4:0
-X	2086	.	G	<*>	0	.	DP=25;I16=13,12,0,0,932,35400,0,0,1469,87241,0,0,474,10704,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,6,61:2:0	0,12,129:4:0
-X	2087	.	A	<*>	0	.	DP=24;I16=12,12,0,0,903,34391,0,0,1409,83641,0,0,476,10746,0,0;QS=3,0;MQSB=0.941765;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,66:2:0	0,12,126:4:0
-X	2088	.	G	<*>	0	.	DP=24;I16=12,12,0,0,880,33116,0,0,1409,83641,0,0,478,10808,0,0;QS=3,0;MQSB=0.941765;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,70:2:0	0,12,121:4:0
-X	2089	.	C	<*>	0	.	DP=25;I16=13,12,0,0,817,27419,0,0,1469,87241,0,0,480,10890,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,64:2:0	0,15,138:5:0
-X	2090	.	G	<*>	0	.	DP=25;I16=12,12,0,0,802,27940,0,0,1409,83641,0,0,457,10319,0,0;QS=3,0;MQSB=0.941765;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,63:2:0	0,12,99:4:0
-X	2091	.	C	<*>	0	.	DP=25;I16=12,12,0,0,800,27346,0,0,1440,86400,0,0,458,10346,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,61:2:0	0,15,125:5:0
-X	2092	.	G	<*>	0	.	DP=26;I16=13,12,0,0,838,29188,0,0,1469,87241,0,0,461,10487,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,64:2:0	0,18,133:6:0
-X	2093	.	T	G,<*>	0	.	DP=26;I16=13,12,1,0,905,33415,17,289,1500,90000,29,841,459,10371,25,625;QS=2.97424,0.0257576,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.953497;BQB=1;MQ0F=0	PL:DP:DV	0,36,255,51,255,255:18:1	0,6,67,6,67,67:2:0	0,18,153,18,153,153:6:0
-X	2094	.	C	<*>	0	.	DP=26;I16=14,12,0,0,949,35501,0,0,1529,90841,0,0,485,11047,0,0;QS=3,0;MQSB=0.953497;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,69:2:0	0,18,142:6:0
-X	2095	.	A	<*>	0	.	DP=25;I16=14,11,0,0,879,31219,0,0,1469,87241,0,0,487,11123,0,0;QS=3,0;MQSB=0.955682;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,72:2:0	0,18,154:6:0
-X	2096	.	C	<*>	0	.	DP=24;I16=13,11,0,0,878,32734,0,0,1409,83641,0,0,487,11073,0,0;QS=3,0;MQSB=0.950498;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,65:2:0	0,18,161:6:0
-X	2097	.	A	<*>	0	.	DP=24;I16=13,11,0,0,849,30671,0,0,1409,83641,0,0,487,11047,0,0;QS=3,0;MQSB=0.950498;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,56:2:0	0,18,172:6:0
-X	2098	.	C	<*>	0	.	DP=24;I16=13,11,0,0,781,26113,0,0,1409,83641,0,0,486,10996,0,0;QS=3,0;MQSB=0.950498;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,58:2:0	0,18,139:6:0
-X	2099	.	G	<*>	0	.	DP=23;I16=12,10,0,0,719,25109,0,0,1289,76441,0,0,460,10294,0,0;QS=3,0;MQSB=0.947103;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,3,24:1:0	0,18,129:6:0
-X	2100	.	C	<*>	0	.	DP=25;I16=13,11,0,0,873,32759,0,0,1409,83641,0,0,457,10141,0,0;QS=3,0;MQSB=0.950498;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,87:3:0	0,18,160:6:0
-X	2101	.	A	<*>	0	.	DP=25;I16=12,12,0,0,907,34671,0,0,1440,86400,0,0,455,9965,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,135:4:0	0,18,161:6:0
-X	2102	.	G	<*>	0	.	DP=25;I16=13,12,0,0,930,35596,0,0,1469,87241,0,0,478,10442,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,118:4:0	0,18,151:6:0
-X	2103	.	C	<*>	0	.	DP=25;I16=11,12,0,0,842,31630,0,0,1380,82800,0,0,432,9336,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,106:4:0	0,15,146:5:0
-X	2104	.	C	<*>	0	.	DP=24;I16=12,12,0,0,869,32463,0,0,1409,83641,0,0,454,9810,0,0;QS=3,0;MQSB=0.941765;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,126:4:0	0,15,147:5:0
-X	2105	.	A	<*>	0	.	DP=25;I16=11,12,0,0,836,30696,0,0,1380,82800,0,0,429,9201,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,138:4:0	0,15,130:5:0
-X	2106	.	T	<*>	0	.	DP=25;I16=12,13,0,0,897,33087,0,0,1469,87241,0,0,473,10211,0,0;QS=3,0;MQSB=0.939413;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,129:4:0	0,15,146:5:0
-X	2107	.	C	<*>	0	.	DP=25;I16=11,12,0,0,783,27185,0,0,1380,82800,0,0,425,9113,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,100:3:0	0,15,133:5:0
-X	2108	.	G	<*>	0	.	DP=25;I16=11,13,0,0,829,29703,0,0,1440,86400,0,0,448,9730,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,122:4:0	0,15,111:5:0
-X	2109	.	C	<*>	0	.	DP=25;I16=11,13,0,0,781,26717,0,0,1440,86400,0,0,446,9746,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,109:4:0	0,15,125:5:0
-X	2110	.	G	<*>	0	.	DP=25;I16=12,12,0,0,804,28134,0,0,1440,86400,0,0,418,9110,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,92:3:0	0,15,117:5:0
-X	2111	.	C	<*>	0	.	DP=25;I16=12,13,0,0,925,35081,0,0,1500,90000,0,0,441,9747,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,134:4:0	0,15,140:5:0
-X	2112	.	A	<*>	0	.	DP=24;I16=12,12,0,0,885,33445,0,0,1440,86400,0,0,440,9782,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,129:4:0	0,15,140:5:0
-X	2113	.	G	<*>	0	.	DP=24;I16=12,12,0,0,871,32641,0,0,1440,86400,0,0,439,9839,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,128:4:0	0,15,134:5:0
-X	2114	.	C	<*>	0	.	DP=24;I16=12,11,0,0,844,32052,0,0,1380,82800,0,0,413,9293,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,103:3:0	0,15,126:5:0
-X	2115	.	T	<*>	0	.	DP=23;I16=11,11,0,0,821,30869,0,0,1320,79200,0,0,412,9342,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,78:2:0	0,15,143:5:0
-X	2116	.	C	<*>	0	.	DP=23;I16=11,12,0,0,890,34892,0,0,1380,82800,0,0,435,9985,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,102:3:0	0,15,152:5:0
-X	2117	.	A	<*>	0	.	DP=23;I16=11,11,0,0,833,32121,0,0,1320,79200,0,0,432,9924,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,118:3:0	0,15,156:5:0
-X	2118	.	G	<*>	0	.	DP=23;I16=12,11,0,0,842,31502,0,0,1380,82800,0,0,429,9835,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,125:4:0	0,15,147:5:0
-X	2119	.	G	<*>	0	.	DP=23;I16=12,11,0,0,823,30553,0,0,1380,82800,0,0,426,9768,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,135:4:0	0,15,137:5:0
-X	2120	.	G	<*>	0	.	DP=24;I16=13,11,0,0,864,32028,0,0,1440,86400,0,0,423,9723,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,137:4:0	0,15,140:5:0
-X	2121	.	A	<*>	0	.	DP=22;I16=11,10,0,0,734,26712,0,0,1260,75600,0,0,398,9074,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,135:4:0	0,12,122:4:0
-X	2122	.	T	<*>	0	.	DP=22;I16=11,10,0,0,752,27278,0,0,1260,75600,0,0,396,8972,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,136:4:0	0,12,123:4:0
-X	2123	.	A	<*>	0	.	DP=22;I16=12,10,0,0,758,27024,0,0,1320,79200,0,0,419,9519,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,120:4:0	0,15,137:5:0
-X	2124	.	T	<*>	0	.	DP=22;I16=12,10,0,0,789,28741,0,0,1320,79200,0,0,417,9465,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,128:4:0	0,15,136:5:0
-X	2125	.	T	<*>	0	.	DP=20;I16=11,8,0,0,696,25704,0,0,1140,68400,0,0,401,9177,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,106:3:0	0,9,93:3:0
-X	2126	.	A	<*>	0	.	DP=20;I16=11,9,0,0,717,25979,0,0,1200,72000,0,0,415,9319,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,133:4:0	0,9,95:3:0
-X	2127	.	C	<*>	0	.	DP=21;I16=11,10,0,0,706,24426,0,0,1260,75600,0,0,413,9221,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,107:4:0	0,9,95:3:0
-X	2128	.	G	<*>	0	.	DP=21;I16=11,10,0,0,677,22633,0,0,1260,75600,0,0,411,9091,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,116:4:0	0,9,72:3:0
-X	2129	.	T	<*>	0	.	DP=21;I16=11,10,0,0,782,29386,0,0,1260,75600,0,0,409,8981,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,140:4:0	0,9,83:3:0
-X	2130	.	G	<*>	0	.	DP=21;I16=11,10,0,0,766,28562,0,0,1260,75600,0,0,407,8891,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,135:4:0	0,9,87:3:0
-X	2131	.	T	<*>	0	.	DP=21;I16=11,10,0,0,732,26216,0,0,1260,75600,0,0,405,8821,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,136:4:0	0,9,79:3:0
-X	2132	.	A	<*>	0	.	DP=21;I16=11,10,0,0,743,26733,0,0,1260,75600,0,0,403,8771,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,135:4:0	0,9,88:3:0
-X	2133	.	A	<*>	0	.	DP=21;I16=11,10,0,0,787,29651,0,0,1260,75600,0,0,401,8741,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,141:4:0	0,9,96:3:0
-X	2134	.	C	<*>	0	.	DP=21;I16=11,10,0,0,804,31100,0,0,1260,75600,0,0,399,8731,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,138:4:0	0,9,86:3:0
-X	2135	.	T	<*>	0	.	DP=22;I16=11,11,0,0,831,32197,0,0,1320,79200,0,0,397,8741,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,153:4:0	0,12,119:4:0
-X	2136	.	C	<*>	0	.	DP=22;I16=11,11,0,0,760,26892,0,0,1320,79200,0,0,395,8721,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,124:4:0	0,12,127:4:0
-X	2137	.	G	<*>	0	.	DP=22;I16=11,11,0,0,745,26047,0,0,1320,79200,0,0,393,8721,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,121:4:0	0,12,102:4:0
-X	2138	.	A	<*>	0	.	DP=22;I16=11,11,0,0,816,30934,0,0,1320,79200,0,0,391,8741,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,128:4:0	0,12,139:4:0
-X	2139	.	C	<*>	0	.	DP=22;I16=11,11,0,0,839,32237,0,0,1320,79200,0,0,389,8781,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,138:4:0	0,12,125:4:0
-X	2140	.	A	<*>	0	.	DP=22;I16=11,11,0,0,826,31300,0,0,1320,79200,0,0,387,8841,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,140:4:0	0,12,138:4:0
-X	2141	.	T	<*>	0	.	DP=21;I16=11,10,0,0,792,30156,0,0,1260,75600,0,0,385,8871,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,137:4:0	0,12,137:4:0
-X	2142	.	G	<*>	0	.	DP=19;I16=11,8,0,0,724,27784,0,0,1140,68400,0,0,385,8919,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,113:3:0	0,12,129:4:0
-X	2143	.	T	<*>	0	.	DP=19;I16=11,8,0,0,650,23454,0,0,1140,68400,0,0,384,8932,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,113:3:0	0,12,120:4:0
-X	2144	.	C	<*>	0	.	DP=19;I16=11,8,0,0,739,29003,0,0,1140,68400,0,0,383,8959,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,108:3:0	0,12,125:4:0
-X	2145	.	A	<*>	0	.	DP=20;I16=12,8,0,0,760,29304,0,0,1200,72000,0,0,381,8951,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,133:4:0	0,12,139:4:0
-X	2146	.	G	<*>	0	.	DP=20;I16=12,8,0,0,745,28105,0,0,1200,72000,0,0,379,8909,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,139:4:0	0,12,127:4:0
-X	2147	.	C	<*>	0	.	DP=20;I16=13,6,0,0,674,24296,0,0,1140,68400,0,0,379,8881,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,127:4:0	0,12,130:4:0
-X	2148	.	G	<*>	0	.	DP=20;I16=12,7,0,0,630,21274,0,0,1140,68400,0,0,365,8537,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,250:11:0	0,12,112:4:0	0,12,120:4:0
-X	2149	.	A	<*>	0	.	DP=20;I16=12,7,0,0,702,26212,0,0,1140,68400,0,0,367,8529,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,138:4:0	0,12,127:4:0
-X	2150	.	T	<*>	0	.	DP=20;I16=13,7,0,0,675,23943,0,0,1200,72000,0,0,383,8713,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,247:11:0	0,12,138:4:0	0,15,139:5:0
-X	2151	.	T	<*>	0	.	DP=20;I16=13,7,0,0,690,24274,0,0,1200,72000,0,0,383,8661,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,251:11:0	0,12,133:4:0	0,15,142:5:0
-X	2152	.	G	<*>	0	.	DP=20;I16=13,7,0,0,693,24713,0,0,1200,72000,0,0,383,8629,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,131:4:0	0,15,146:5:0
-X	2153	.	T	<*>	0	.	DP=19;I16=13,6,0,0,671,24571,0,0,1140,68400,0,0,383,8565,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,230:10:0	0,12,134:4:0	0,15,162:5:0
-X	2154	.	C	<*>	0	.	DP=19;I16=13,6,0,0,703,26955,0,0,1140,68400,0,0,382,8468,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,251:10:0	0,12,131:4:0	0,15,159:5:0
-X	2155	.	A	<*>	0	.	DP=19;I16=13,6,0,0,693,25727,0,0,1140,68400,0,0,381,8389,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,245:10:0	0,12,135:4:0	0,15,156:5:0
-X	2156	.	C	<*>	0	.	DP=19;I16=13,6,0,0,702,26214,0,0,1140,68400,0,0,380,8328,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,125:4:0	0,15,154:5:0
-X	2157	.	A	<*>	0	.	DP=19;I16=13,6,0,0,722,28058,0,0,1140,68400,0,0,379,8285,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,250:10:0	0,12,141:4:0	0,15,173:5:0
-X	2158	.	G	<*>	0	.	DP=19;I16=13,6,0,0,713,27567,0,0,1140,68400,0,0,378,8260,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,136:4:0	0,15,144:5:0
-X	2159	.	G	<*>	0	.	DP=19;I16=12,6,0,0,662,24744,0,0,1080,64800,0,0,366,8104,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,247:9:0	0,12,126:4:0	0,15,153:5:0
-X	2160	.	C	<*>	0	.	DP=19;I16=12,6,0,0,651,24005,0,0,1080,64800,0,0,364,8038,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,244:9:0	0,12,119:4:0	0,15,154:5:0
-X	2161	.	A	<*>	0	.	DP=19;I16=13,6,0,0,695,25883,0,0,1140,68400,0,0,369,8005,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,248:10:0	0,12,121:4:0	0,15,164:5:0
-X	2162	.	C	<*>	0	.	DP=20;I16=13,7,0,0,742,27834,0,0,1200,72000,0,0,365,7911,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,127:4:0	0,15,155:5:0
-X	2163	.	T	<*>	0	.	DP=20;I16=13,7,0,0,763,29517,0,0,1200,72000,0,0,362,7838,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,131:4:0	0,15,175:5:0
-X	2164	.	G	<*>	0	.	DP=20;I16=13,7,0,0,715,26301,0,0,1200,72000,0,0,359,7787,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,116:4:0	0,15,156:5:0
-X	2165	.	C	<*>	0	.	DP=20;I16=13,7,0,0,753,28781,0,0,1200,72000,0,0,355,7709,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,136:4:0	0,15,151:5:0
-X	2166	.	T	<*>	0	.	DP=19;I16=12,7,0,0,711,27211,0,0,1140,68400,0,0,352,7654,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,142:4:0	0,12,140:4:0
-X	2167	.	A	<*>	0	.	DP=19;I16=12,6,0,0,650,23760,0,0,1080,64800,0,0,327,7137,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,254:11:0	0,12,133:4:0	0,9,111:3:0
-X	2168	.	C	<*>	0	.	DP=19;I16=12,7,0,0,685,25039,0,0,1140,68400,0,0,345,7561,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,130:4:0	0,12,124:4:0
-X	2169	.	T	<*>	0	.	DP=19;I16=12,7,0,0,702,26940,0,0,1140,68400,0,0,341,7525,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,140:4:0	0,12,142:4:0
-X	2170	.	C	<*>	0	.	DP=18;I16=11,7,0,0,665,24861,0,0,1080,64800,0,0,338,7512,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,132:4:0	0,12,135:4:0
-X	2171	.	C	<*>	0	.	DP=20;I16=11,9,0,0,750,28368,0,0,1200,72000,0,0,333,7419,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,136:4:0	0,12,138:4:0
-X	2172	.	T	<*>	0	.	DP=20;I16=11,9,0,0,732,27540,0,0,1200,72000,0,0,330,7346,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,149:4:0	0,12,147:4:0
-X	2173	.	G	<*>	0	.	DP=19;I16=10,9,0,0,704,26534,0,0,1140,68400,0,0,327,7243,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,142:4:0	0,12,133:4:0
-X	2174	.	G	<*>	0	.	DP=19;I16=10,9,0,0,674,24372,0,0,1140,68400,0,0,324,7158,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,126:4:0	0,12,129:4:0
-X	2175	.	G	<*>	0	.	DP=18;I16=9,9,0,0,639,23059,0,0,1080,64800,0,0,322,7090,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,123:4:0	0,12,126:4:0
-X	2176	.	G	<*>	0	.	DP=18;I16=9,9,0,0,621,21815,0,0,1080,64800,0,0,318,6940,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,247:10:0	0,12,121:4:0	0,12,123:4:0
-X	2177	.	T	<*>	0	.	DP=18;I16=9,9,0,0,547,18051,0,0,1080,64800,0,0,314,6810,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,239:10:0	0,12,83:4:0	0,12,108:4:0
-X	2178	.	T	<*>	0	.	DP=18;I16=9,9,0,0,579,19659,0,0,1080,64800,0,0,310,6700,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,234:10:0	0,12,110:4:0	0,12,118:4:0
-X	2179	.	T	<*>	0	.	DP=18;I16=9,9,0,0,591,20403,0,0,1080,64800,0,0,307,6609,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,239:10:0	0,12,97:4:0	0,12,135:4:0
-X	2180	.	T	<*>	0	.	DP=18;I16=9,9,0,0,616,21524,0,0,1080,64800,0,0,305,6537,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,236:10:0	0,12,122:4:0	0,12,133:4:0
-X	2181	.	C	<*>	0	.	DP=18;I16=9,8,0,0,611,22485,0,0,1020,61200,0,0,293,6385,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,224:9:0	0,12,129:4:0	0,12,150:4:0
-X	2182	.	C	<*>	0	.	DP=18;I16=9,9,0,0,665,24877,0,0,1080,64800,0,0,301,6453,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,125:4:0	0,12,145:4:0
-X	2183	.	A	<*>	0	.	DP=18;I16=9,9,0,0,646,23624,0,0,1080,64800,0,0,299,6441,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,247:10:0	0,12,123:4:0	0,12,144:4:0
-X	2184	.	T	<*>	0	.	DP=17;I16=8,9,0,0,610,22250,0,0,1020,61200,0,0,298,6448,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,224:9:0	0,12,134:4:0	0,12,136:4:0
-X	2185	.	C	<*>	0	.	DP=16;I16=8,8,0,0,569,20761,0,0,960,57600,0,0,297,6423,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,211:8:0	0,12,128:4:0	0,12,137:4:0
-X	2186	.	A	<*>	0	.	DP=16;I16=8,8,0,0,576,21314,0,0,960,57600,0,0,296,6416,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,204:8:0	0,12,134:4:0	0,12,145:4:0
-X	2187	.	A	<*>	0	.	DP=16;I16=8,8,0,0,562,20396,0,0,960,57600,0,0,295,6427,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,201:8:0	0,12,136:4:0	0,12,135:4:0
-X	2188	.	A	<*>	0	.	DP=17;I16=9,8,0,0,569,19925,0,0,1020,61200,0,0,293,6405,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,214:9:0	0,12,133:4:0	0,12,123:4:0
-X	2189	.	C	<*>	0	.	DP=19;I16=9,10,0,0,645,22647,0,0,1097,65089,0,0,292,6400,0,0;QS=3,0;MQSB=0.934728;MQ0F=0	PL:DP:DV	0,30,230:10:0	0,12,133:4:0	0,15,142:5:0
-X	2190	.	C	<*>	0	.	DP=19;I16=9,10,0,0,604,20072,0,0,1097,65089,0,0,294,6414,0,0;QS=3,0;MQSB=0.934728;MQ0F=0	PL:DP:DV	0,33,238:11:0	0,12,119:4:0	0,12,107:4:0
-X	2191	.	C	<*>	0	.	DP=19;I16=9,10,0,0,647,23007,0,0,1097,65089,0,0,297,6449,0,0;QS=3,0;MQSB=0.934728;MQ0F=0	PL:DP:DV	0,33,251:11:0	0,12,129:4:0	0,12,119:4:0
-X	2192	.	T	<*>	0	.	DP=19;I16=9,10,0,0,659,23723,0,0,1097,65089,0,0,300,6506,0,0;QS=3,0;MQSB=0.934728;MQ0F=0	PL:DP:DV	0,33,253:11:0	0,12,136:4:0	0,12,120:4:0
-X	2193	.	C	<*>	0	.	DP=18;I16=8,10,0,0,642,23934,0,0,1037,61489,0,0,303,6535,0,0;QS=3,0;MQSB=0.938795;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,128:4:0	0,9,87:3:0
-X	2194	.	A	<*>	0	.	DP=18;I16=8,9,0,0,617,22683,0,0,1020,61200,0,0,301,6561,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,247:10:0	0,12,134:4:0	0,9,98:3:0
-X	2195	.	A	<*>	0	.	DP=18;I16=8,10,0,0,635,23271,0,0,1037,61489,0,0,309,6659,0,0;QS=3,0;MQSB=0.938795;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,128:4:0	0,9,101:3:0
-X	2196	.	G	<*>	0	.	DP=19;I16=8,11,0,0,703,26383,0,0,1097,65089,0,0,312,6754,0,0;QS=3,0;MQSB=0.946915;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,117:4:0	0,12,120:4:0
-X	2197	.	A	<*>	0	.	DP=19;I16=8,11,0,0,735,28599,0,0,1097,65089,0,0,314,6770,0,0;QS=3,0;MQSB=0.946915;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,141:4:0	0,12,125:4:0
-X	2198	.	G	<*>	0	.	DP=19;I16=8,10,0,0,650,24206,0,0,1080,64800,0,0,307,6725,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,129:4:0	0,12,107:4:0
-X	2199	.	C	<*>	0	.	DP=19;I16=8,11,0,0,701,26735,0,0,1097,65089,0,0,318,6862,0,0;QS=3,0;MQSB=0.946915;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,128:4:0	0,12,116:4:0
-X	2200	.	T	<*>	0	.	DP=19;I16=8,11,0,0,710,26768,0,0,1097,65089,0,0,320,6938,0,0;QS=3,0;MQSB=0.946915;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,129:4:0	0,12,114:4:0
-X	2201	.	G	<*>	0	.	DP=17;I16=7,10,0,0,628,23764,0,0,977,57889,0,0,324,7032,0,0;QS=3,0;MQSB=0.943335;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,66:2:0	0,12,119:4:0
-X	2202	.	G	<*>	0	.	DP=17;I16=7,10,0,0,557,19249,0,0,977,57889,0,0,327,7093,0,0;QS=3,0;MQSB=0.943335;MQ0F=0	PL:DP:DV	0,33,245:11:0	0,6,57:2:0	0,12,115:4:0
-X	2203	.	G	<*>	0	.	DP=17;I16=7,10,0,0,588,21184,0,0,977,57889,0,0,329,7123,0,0;QS=3,0;MQSB=0.943335;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,47:2:0	0,12,116:4:0
-X	2204	.	C	<*>	0	.	DP=17;I16=7,10,0,0,538,18568,0,0,977,57889,0,0,331,7173,0,0;QS=3,0;MQSB=0.943335;MQ0F=0	PL:DP:DV	0,33,246:11:0	0,6,61:2:0	0,12,99:4:0
-X	2205	.	C	<*>	0	.	DP=18;I16=7,11,0,0,628,22918,0,0,1037,61489,0,0,332,7192,0,0;QS=3,0;MQSB=0.951002;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,68:2:0	0,12,109:4:0
-X	2206	.	T	<*>	0	.	DP=19;I16=7,12,0,0,677,25237,0,0,1097,65089,0,0,334,7230,0,0;QS=3,0;MQSB=0.957193;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,77:2:0	0,12,115:4:0
-X	2207	.	G	<*>	0	.	DP=19;I16=7,11,0,0,663,24717,0,0,1080,64800,0,0,319,6965,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,67:2:0	0,12,110:4:0
-X	2208	.	G	<*>	0	.	DP=21;I16=7,14,0,0,726,26038,0,0,1217,72289,0,0,340,7370,0,0;QS=3,0;MQSB=0.966484;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,110:4:0	0,12,122:4:0
-X	2209	.	G	<*>	0	.	DP=22;I16=8,13,0,0,715,25133,0,0,1237,73369,0,0,325,7075,0,0;QS=3,0;MQSB=0.895122;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,128:5:0	0,12,117:4:0
-X	2210	.	G	C,<*>	0	.	DP=21;I16=7,13,0,1,648,22186,25,625,1177,69769,17,289,331,7165,21,441;QS=2.95442,0.0455764,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.975265;BQB=1;MQ0F=0	PL:DP:DV	0,19,234,33,237,241:12:1	0,15,127,15,127,127:5:0	0,12,113,12,113,113:4:0
-X	2211	.	T	<*>	0	.	DP=21;I16=7,13,0,0,724,27000,0,0,1177,69769,0,0,336,7230,0,0;QS=3,0;MQSB=0.875769;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,141:5:0	0,12,124:4:0
-X	2212	.	C	<*>	0	.	DP=22;I16=8,14,0,0,791,29201,0,0,1254,73658,0,0,364,7850,0,0;QS=3,0;MQSB=0.985548;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,148:5:0	0,12,111:4:0
-X	2213	.	A	<*>	0	.	DP=22;I16=8,14,0,0,767,27327,0,0,1254,73658,0,0,371,8015,0,0;QS=3,0;MQSB=0.985548;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,153:5:0	0,12,112:4:0
-X	2214	.	A	<*>	0	.	DP=22;I16=8,14,0,0,756,26836,0,0,1254,73658,0,0,377,8159,0,0;QS=3,0;MQSB=0.985548;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,153:5:0	0,12,117:4:0
-X	2215	.	C	<*>	0	.	DP=22;I16=8,14,0,0,815,31121,0,0,1254,73658,0,0,381,8229,0,0;QS=3,0;MQSB=0.985548;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,162:5:0	0,12,124:4:0
-X	2216	.	T	<*>	0	.	DP=22;I16=8,14,0,0,815,31233,0,0,1254,73658,0,0,384,8272,0,0;QS=3,0;MQSB=0.985548;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,166:5:0	0,12,124:4:0
-X	2217	.	T	<*>	0	.	DP=22;I16=8,13,0,0,741,26855,0,0,1237,73369,0,0,362,7712,0,0;QS=3,0;MQSB=0.895122;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,155:5:0	0,12,118:4:0
-X	2218	.	C	<*>	0	.	DP=21;I16=7,14,0,0,753,27973,0,0,1194,70058,0,0,391,8423,0,0;QS=3,0;MQSB=0.975265;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,138:4:0	0,12,119:4:0
-X	2219	.	C	<*>	0	.	DP=21;I16=7,13,0,0,757,29125,0,0,1177,69769,0,0,370,7904,0,0;QS=3,0;MQSB=0.875769;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,141:4:0	0,12,122:4:0
-X	2220	.	G	A,<*>	0	.	DP=21;I16=6,2,1,11,256,8364,474,19128,457,26569,720,43200,141,2959,233,5071;QS=0.886504,2.1135,0;VDB=0.532753;SGB=-3.51597;RPB=0.964198;MQB=0.898397;MQSB=0.875769;BQB=0.0354359;MQ0F=0	PL:DP:DV	139,0,130,157,148,255:12:6	69,0,46,75,52,119:4:2	131,12,0,131,12,131:4:4
-X	2221	.	G	<*>	0	.	DP=21;I16=7,13,0,0,738,27922,0,0,1177,69769,0,0,376,8078,0,0;QS=3,0;MQSB=0.875769;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,132:4:0	0,12,120:4:0
-X	2222	.	C	<*>	0	.	DP=21;I16=7,14,0,0,746,28098,0,0,1194,70058,0,0,401,8675,0,0;QS=3,0;MQSB=0.975265;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,135:4:0	0,12,107:4:0
-X	2223	.	C	<*>	0	.	DP=21;I16=7,14,0,0,796,30632,0,0,1194,70058,0,0,401,8671,0,0;QS=3,0;MQSB=0.975265;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,135:4:0	0,12,122:4:0
-X	2224	.	T	<*>	0	.	DP=21;I16=7,14,0,0,811,31599,0,0,1194,70058,0,0,401,8691,0,0;QS=3,0;MQSB=0.975265;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,144:4:0	0,12,123:4:0
-X	2225	.	G	<*>	0	.	DP=21;I16=7,14,0,0,778,29396,0,0,1194,70058,0,0,401,8735,0,0;QS=3,0;MQSB=0.975265;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,133:4:0	0,12,121:4:0
-X	2226	.	G	<*>	0	.	DP=21;I16=7,14,0,0,727,26485,0,0,1194,70058,0,0,401,8803,0,0;QS=3,0;MQSB=0.975265;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,128:4:0	0,12,113:4:0
-X	2227	.	G	<*>	0	.	DP=20;I16=7,12,0,0,663,23985,0,0,1117,66169,0,0,377,8269,0,0;QS=3,0;MQSB=0.879351;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,123:4:0	0,12,114:4:0
-X	2228	.	G	C,<*>	0	.	DP=19;I16=5,12,0,1,643,24791,16,256,1020,61200,17,289,360,8020,25,625;QS=2.9603,0.0397022,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.970092;BQB=1;MQ0F=0	PL:DP:DV	0,17,255,30,255,255:11:1	0,9,95,9,95,95:3:0	0,12,121,12,121,121:4:0
-X	2229	.	A	<*>	0	.	DP=20;I16=6,14,0,0,757,28857,0,0,1134,66458,0,0,406,9138,0,0;QS=3,0;MQSB=0.959189;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,138:4:0	0,12,122:4:0
-X	2230	.	A	<*>	0	.	DP=20;I16=6,14,0,0,729,26985,0,0,1134,66458,0,0,409,9291,0,0;QS=3,0;MQSB=0.959189;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,141:4:0	0,12,119:4:0
-X	2231	.	A	<*>	0	.	DP=20;I16=6,13,0,0,712,26990,0,0,1117,66169,0,0,386,8790,0,0;QS=3,0;MQSB=0.850016;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,144:4:0	0,12,124:4:0
-X	2232	.	C	<*>	0	.	DP=20;I16=6,14,0,0,751,28657,0,0,1134,66458,0,0,412,9508,0,0;QS=3,0;MQSB=0.959189;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,130:4:0	0,12,107:4:0
-X	2233	.	T	<*>	0	.	DP=20;I16=6,14,0,0,774,30432,0,0,1134,66458,0,0,413,9619,0,0;QS=3,0;MQSB=0.959189;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,150:4:0	0,12,117:4:0
-X	2234	.	G	<*>	0	.	DP=20;I16=6,14,0,0,719,26621,0,0,1134,66458,0,0,412,9646,0,0;QS=3,0;MQSB=0.959189;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,145:4:0	0,12,107:4:0
-X	2235	.	G	<*>	0	.	DP=20;I16=6,14,0,0,728,27036,0,0,1134,66458,0,0,410,9636,0,0;QS=3,0;MQSB=0.959189;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,139:4:0	0,12,104:4:0
-X	2236	.	G	<*>	0	.	DP=19;I16=6,13,0,0,705,26985,0,0,1074,62858,0,0,409,9637,0,0;QS=3,0;MQSB=0.965977;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,142:4:0	0,9,84:3:0
-X	2237	.	G	<*>	0	.	DP=19;I16=6,12,0,0,684,26576,0,0,1057,62569,0,0,383,9023,0,0;QS=3,0;MQSB=0.85394;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,141:4:0	0,9,86:3:0
-X	2238	.	C	<*>	0	.	DP=19;I16=5,13,0,0,648,24496,0,0,1037,61489,0,0,381,8993,0,0;QS=3,0;MQSB=0.970092;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,108:3:0	0,9,78:3:0
-X	2239	.	A	<*>	0	.	DP=19;I16=6,11,0,0,634,24178,0,0,997,58969,0,0,373,8935,0,0;QS=3,0;MQSB=0.85832;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,133:4:0	0,6,77:2:0
-X	2240	.	A	<*>	0	.	DP=19;I16=6,13,0,0,731,28595,0,0,1074,62858,0,0,402,9582,0,0;QS=3,0;MQSB=0.965977;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,135:4:0	0,9,101:3:0
-X	2241	.	G	<*>	0	.	DP=19;I16=6,12,0,0,683,26433,0,0,1057,62569,0,0,375,8951,0,0;QS=3,0;MQSB=0.85394;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,126:4:0	0,9,88:3:0
-X	2242	.	T	<*>	0	.	DP=20;I16=5,13,0,0,635,22949,0,0,1057,62569,0,0,370,8944,0,0;QS=3,0;MQSB=0.814433;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,91:3:0	0,9,95:3:0
-X	2243	.	A	<*>	0	.	DP=19;I16=5,14,0,0,704,26274,0,0,1074,62858,0,0,395,9585,0,0;QS=3,0;MQSB=0.933727;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,107:3:0	0,9,99:3:0
-X	2244	.	T	<*>	0	.	DP=19;I16=5,14,0,0,681,25263,0,0,1074,62858,0,0,395,9609,0,0;QS=3,0;MQSB=0.933727;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,89:3:0	0,9,98:3:0
-X	2245	.	C	<*>	0	.	DP=19;I16=5,14,0,0,722,27846,0,0,1074,62858,0,0,394,9592,0,0;QS=3,0;MQSB=0.933727;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,98:3:0	0,9,88:3:0
-X	2246	.	A	<*>	0	.	DP=18;I16=5,12,0,0,597,21693,0,0,997,58969,0,0,367,8861,0,0;QS=3,0;MQSB=0.818731;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,95:3:0	0,6,72:2:0
-X	2247	.	C	<*>	0	.	DP=17;I16=4,13,0,0,639,24373,0,0,954,55658,0,0,391,9391,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,105:3:0	0,6,71:2:0
-X	2248	.	C	<*>	0	.	DP=17;I16=4,13,0,0,669,26863,0,0,954,55658,0,0,390,9306,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,90:3:0	0,6,75:2:0
-X	2249	.	A	<*>	0	.	DP=17;I16=4,13,0,0,677,27371,0,0,954,55658,0,0,389,9231,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,116:3:0	0,6,80:2:0
-X	2250	.	G	<*>	0	.	DP=17;I16=4,13,0,0,654,25800,0,0,954,55658,0,0,388,9166,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,100:3:0	0,6,78:2:0
-X	2251	.	A	<*>	0	.	DP=17;I16=4,13,0,0,673,27327,0,0,954,55658,0,0,387,9111,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,112:3:0	0,6,80:2:0
-X	2252	.	G	<*>	0	.	DP=17;I16=4,12,0,0,647,26249,0,0,937,55369,0,0,361,8441,0,0;QS=3,0;MQSB=0.767432;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,113:3:0	0,6,73:2:0
-X	2253	.	A	<*>	0	.	DP=17;I16=4,13,0,0,641,24643,0,0,954,55658,0,0,385,9031,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,111:3:0	0,6,73:2:0
-X	2254	.	T	<*>	0	.	DP=17;I16=4,12,0,0,615,23821,0,0,937,55369,0,0,358,8332,0,0;QS=3,0;MQSB=0.767432;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,112:3:0	0,6,73:2:0
-X	2255	.	G	<*>	0	.	DP=17;I16=4,13,0,0,677,27243,0,0,954,55658,0,0,380,8844,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,115:3:0	0,6,71:2:0
-X	2256	.	A	<*>	0	.	DP=17;I16=4,13,0,0,656,26088,0,0,954,55658,0,0,377,8741,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,110:3:0	0,6,78:2:0
-X	2257	.	G	<*>	0	.	DP=17;I16=4,12,0,0,627,24863,0,0,937,55369,0,0,349,8023,0,0;QS=3,0;MQSB=0.767432;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,115:3:0	0,6,74:2:0
-X	2258	.	C	<*>	0	.	DP=17;I16=4,13,0,0,667,26403,0,0,954,55658,0,0,371,8565,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,109:3:0	0,6,70:2:0
-X	2259	.	T	<*>	0	.	DP=17;I16=4,13,0,0,646,25334,0,0,954,55658,0,0,368,8492,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,116:3:0	0,6,79:2:0
-X	2260	.	T	<*>	0	.	DP=17;I16=4,13,0,0,638,24178,0,0,954,55658,0,0,365,8429,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,115:3:0	0,6,72:2:0
-X	2261	.	T	<*>	0	.	DP=17;I16=4,13,0,0,633,23799,0,0,954,55658,0,0,362,8376,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,105:3:0	0,6,73:2:0
-X	2262	.	A	<*>	0	.	DP=17;I16=4,13,0,0,628,23438,0,0,954,55658,0,0,359,8333,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,253:12:0	0,9,112:3:0	0,6,74:2:0
-X	2263	.	T	<*>	0	.	DP=17;I16=4,13,0,0,631,23673,0,0,954,55658,0,0,355,8251,0,0;QS=3,0;MQSB=0.90252;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,112:3:0	0,6,74:2:0
-X	2264	.	A	<*>	0	.	DP=17;I16=4,12,0,0,623,24371,0,0,937,55369,0,0,326,7556,0,0;QS=3,0;MQSB=0.767432;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,114:3:0	0,6,75:2:0
-X	2265	.	A	<*>	0	.	DP=18;I16=4,13,0,0,642,24718,0,0,997,58969,0,0,320,7400,0,0;QS=3,0;MQSB=0.762744;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,113:3:0	0,6,75:2:0
-X	2266	.	A	<*>	0	.	DP=19;I16=5,14,0,0,656,23962,0,0,1074,62858,0,0,337,7745,0,0;QS=3,0;MQSB=0.933727;MQ0F=0	PL:DP:DV	0,39,252:13:0	0,12,128:4:0	0,6,75:2:0
-X	2267	.	A	<*>	0	.	DP=20;I16=6,14,0,0,712,26052,0,0,1134,66458,0,0,332,7582,0,0;QS=3,0;MQSB=0.959189;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,134:4:0	0,9,102:3:0
-X	2268	.	A	<*>	0	.	DP=20;I16=6,14,0,0,741,27841,0,0,1134,66458,0,0,327,7391,0,0;QS=3,0;MQSB=0.959189;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,135:4:0	0,9,100:3:0
-X	2269	.	T	<*>	0	.	DP=20;I16=6,13,0,0,681,24751,0,0,1074,62858,0,0,318,7206,0,0;QS=3,0;MQSB=0.965977;MQ0F=0	PL:DP:DV	0,36,246:12:0	0,12,137:4:0	0,9,111:3:0
-X	2270	.	A	<*>	0	.	DP=19;I16=6,12,0,0,652,24154,0,0,1057,62569,0,0,300,6750,0,0;QS=3,0;MQSB=0.85394;MQ0F=0	PL:DP:DV	0,33,244:11:0	0,12,134:4:0	0,9,112:3:0
-X	2271	.	A	<*>	0	.	DP=17;I16=6,11,0,0,654,25406,0,0,954,55658,0,0,316,6944,0,0;QS=3,0;MQSB=0.980001;MQ0F=0	PL:DP:DV	0,30,243:10:0	0,12,142:4:0	0,9,111:3:0
-X	2272	.	T	<*>	0	.	DP=17;I16=6,10,0,0,604,22908,0,0,937,55369,0,0,297,6525,0,0;QS=3,0;MQSB=0.863243;MQ0F=0	PL:DP:DV	0,27,238:9:0	0,12,137:4:0	0,9,111:3:0
-X	2273	.	G	<*>	0	.	DP=17;I16=6,10,0,0,581,22129,0,0,937,55369,0,0,295,6411,0,0;QS=3,0;MQSB=0.863243;MQ0F=0	PL:DP:DV	0,27,240:9:0	0,12,123:4:0	0,9,115:3:0
-X	2274	.	G	<*>	0	.	DP=18;I16=6,11,0,0,621,23109,0,0,997,58969,0,0,293,6313,0,0;QS=3,0;MQSB=0.85832;MQ0F=0	PL:DP:DV	0,30,248:10:0	0,12,132:4:0	0,9,110:3:0
-X	2275	.	T	<*>	0	.	DP=18;I16=6,11,0,0,624,23152,0,0,997,58969,0,0,292,6232,0,0;QS=3,0;MQSB=0.85832;MQ0F=0	PL:DP:DV	0,30,249:10:0	0,12,126:4:0	0,9,113:3:0
-X	2276	.	G	<*>	0	.	DP=20;I16=7,12,0,0,710,26848,0,0,1074,62858,0,0,303,6313,0,0;QS=3,0;MQSB=0.985816;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,129:4:0	0,9,110:3:0
-X	2277	.	C	<*>	0	.	DP=21;I16=8,13,0,0,797,30699,0,0,1194,70058,0,0,303,6247,0,0;QS=3,0;MQSB=0.989565;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,151:5:0	0,12,143:4:0
-X	2278	.	T	<*>	0	.	DP=21;I16=7,13,0,0,736,27790,0,0,1157,68689,0,0,279,5581,0,0;QS=3,0;MQSB=0.962269;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,133:4:0	0,12,148:4:0
-X	2279	.	A	<*>	0	.	DP=20;I16=8,12,0,0,723,27047,0,0,1134,66458,0,0,306,6190,0,0;QS=3,0;MQSB=0.993326;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,155:5:0	0,12,144:4:0
-X	2280	.	G	<*>	0	.	DP=21;I16=8,12,0,0,766,29776,0,0,1177,69769,0,0,299,6085,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,166:5:0	0,12,144:4:0
-X	2281	.	C	<*>	0	.	DP=22;I16=8,13,0,0,784,29748,0,0,1237,73369,0,0,301,6037,0,0;QS=3,0;MQSB=0.895122;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,165:5:0	0,12,140:4:0
-X	2282	.	T	<*>	0	.	DP=22;I16=8,14,0,0,789,29699,0,0,1254,73658,0,0,310,6054,0,0;QS=3,0;MQSB=0.985548;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,162:5:0	0,12,150:4:0
-X	2283	.	G	<*>	0	.	DP=22;I16=8,14,0,0,798,29774,0,0,1254,73658,0,0,312,6054,0,0;QS=3,0;MQSB=0.985548;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,158:5:0	0,12,142:4:0
-X	2284	.	G	<*>	0	.	DP=22;I16=7,14,0,0,760,28408,0,0,1194,70058,0,0,294,5664,0,0;QS=3,0;MQSB=0.975265;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,130:4:0	0,12,141:4:0
-X	2285	.	G	<*>	0	.	DP=23;I16=9,14,0,0,844,31592,0,0,1314,77258,0,0,311,5909,0,0;QS=3,0;MQSB=0.992095;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,152:5:0	0,12,144:4:0
-X	2286	.	C	<*>	0	.	DP=23;I16=9,14,0,0,854,32244,0,0,1314,77258,0,0,311,5869,0,0;QS=3,0;MQSB=0.992095;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,155:5:0	0,12,130:4:0
-X	2287	.	A	<*>	0	.	DP=23;I16=9,14,0,0,818,30288,0,0,1314,77258,0,0,311,5869,0,0;QS=3,0;MQSB=0.992095;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,166:5:0	0,12,143:4:0
-X	2288	.	T	<*>	0	.	DP=22;I16=8,14,0,0,794,29190,0,0,1254,73658,0,0,312,5908,0,0;QS=3,0;MQSB=0.985548;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,158:5:0	0,12,142:4:0
-X	2289	.	G	<*>	0	.	DP=21;I16=8,13,0,0,723,25835,0,0,1237,73369,0,0,314,5984,0,0;QS=3,0;MQSB=0.895122;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,154:5:0	0,12,126:4:0
-X	2290	.	G	<*>	0	.	DP=20;I16=7,13,0,0,748,28318,0,0,1177,69769,0,0,318,6094,0,0;QS=3,0;MQSB=0.875769;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,149:5:0	0,9,114:3:0
-X	2291	.	T	<*>	0	.	DP=20;I16=7,13,0,0,731,27165,0,0,1177,69769,0,0,322,6186,0,0;QS=3,0;MQSB=0.875769;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,151:5:0	0,9,112:3:0
-X	2292	.	G	<*>	0	.	DP=20;I16=7,13,0,0,749,28747,0,0,1177,69769,0,0,325,6259,0,0;QS=3,0;MQSB=0.875769;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,156:5:0	0,9,109:3:0
-X	2293	.	G	<*>	0	.	DP=20;I16=7,13,0,0,739,27903,0,0,1177,69769,0,0,327,6311,0,0;QS=3,0;MQSB=0.875769;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,156:5:0	0,9,112:3:0
-X	2294	.	C	<*>	0	.	DP=21;I16=7,14,0,0,775,29453,0,0,1237,73369,0,0,329,6391,0,0;QS=3,0;MQSB=0.872525;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,169:5:0	0,9,114:3:0
-X	2295	.	T	<*>	0	.	DP=21;I16=7,14,0,0,773,29209,0,0,1237,73369,0,0,331,6451,0,0;QS=3,0;MQSB=0.872525;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,164:5:0	0,9,115:3:0
-X	2296	.	T	<*>	0	.	DP=21;I16=7,14,0,0,756,27780,0,0,1237,73369,0,0,333,6543,0,0;QS=3,0;MQSB=0.872525;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,160:5:0	0,9,106:3:0
-X	2297	.	G	<*>	0	.	DP=20;I16=7,13,0,0,736,27692,0,0,1177,69769,0,0,336,6666,0,0;QS=3,0;MQSB=0.875769;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,165:5:0	0,6,74:2:0
-X	2298	.	C	<*>	0	.	DP=21;I16=7,14,0,0,778,29300,0,0,1237,73369,0,0,339,6819,0,0;QS=3,0;MQSB=0.872525;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,139:5:0	0,9,106:3:0
-X	2299	.	A	<*>	0	.	DP=21;I16=7,14,0,0,714,25282,0,0,1237,73369,0,0,343,7003,0,0;QS=3,0;MQSB=0.872525;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,128:5:0	0,9,110:3:0
-X	2300	.	C	<*>	0	.	DP=21;I16=7,13,0,0,687,24749,0,0,1177,69769,0,0,326,6768,0,0;QS=3,0;MQSB=0.875769;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,148:5:0	0,9,109:3:0
-X	2301	.	C	<*>	0	.	DP=23;I16=7,15,0,0,802,30292,0,0,1266,74210,0,0,349,7363,0,0;QS=3,0;MQSB=0.970024;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,147:5:0	0,9,116:3:0
-X	2302	.	T	<*>	0	.	DP=23;I16=7,16,0,0,860,32956,0,0,1326,77810,0,0,354,7496,0,0;QS=3,0;MQSB=0.964916;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,166:5:0	0,12,150:4:0
-X	2303	.	G	<*>	0	.	DP=23;I16=7,16,0,0,817,29823,0,0,1326,77810,0,0,356,7604,0,0;QS=3,0;MQSB=0.964916;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,151:5:0	0,12,139:4:0
-X	2304	.	T	<*>	0	.	DP=23;I16=7,16,0,0,802,28628,0,0,1326,77810,0,0,357,7691,0,0;QS=3,0;MQSB=0.964916;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,148:5:0	0,12,140:4:0
-X	2305	.	A	<*>	0	.	DP=22;I16=7,14,0,0,725,25585,0,0,1237,73369,0,0,355,7791,0,0;QS=3,0;MQSB=0.872525;MQ0F=0	PL:DP:DV	0,36,248:12:0	0,15,155:5:0	0,12,129:4:0
-X	2306	.	A	<*>	0	.	DP=21;I16=7,14,0,0,727,26841,0,0,1206,70610,0,0,361,7899,0,0;QS=3,0;MQSB=0.975265;MQ0F=0	PL:DP:DV	0,36,246:12:0	0,15,168:5:0	0,12,130:4:0
-X	2307	.	T	<*>	0	.	DP=21;I16=7,14,0,0,751,27427,0,0,1206,70610,0,0,362,7964,0,0;QS=3,0;MQSB=0.975265;MQ0F=0	PL:DP:DV	0,36,251:12:0	0,15,165:5:0	0,12,141:4:0
-X	2308	.	C	<*>	0	.	DP=21;I16=7,14,0,0,735,26675,0,0,1206,70610,0,0,363,8051,0,0;QS=3,0;MQSB=0.975265;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,144:5:0	0,12,146:4:0
-X	2309	.	C	A,<*>	0	.	DP=19;I16=7,11,0,1,604,21364,16,256,1057,62569,29,841,358,8094,8,64;QS=2.95676,0.0432432,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.985816;BQB=1;MQ0F=0	PL:DP:DV	0,20,224,33,227,230:12:1	0,9,94,9,94,94:3:0	0,12,138,12,138,138:4:0
-X	2310	.	C	<*>	0	.	DP=18;I16=6,12,0,0,668,25392,0,0,1049,62041,0,0,370,8282,0,0;QS=3,0;MQSB=0.961295;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,80:2:0	0,12,139:4:0
-X	2311	.	A	<*>	0	.	DP=19;I16=7,12,0,0,707,26855,0,0,1109,65641,0,0,373,8371,0,0;QS=3,0;MQSB=0.957193;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,78:2:0	0,12,137:4:0
-X	2312	.	G	<*>	0	.	DP=20;I16=7,12,0,0,736,29118,0,0,1109,65641,0,0,364,8306,0,0;QS=3,0;MQSB=0.957193;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,82:2:0	0,9,122:3:0
-X	2313	.	C	<*>	0	.	DP=20;I16=7,13,0,0,723,27231,0,0,1169,69241,0,0,382,8596,0,0;QS=3,0;MQSB=0.962269;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,76:2:0	0,12,130:4:0
-X	2314	.	A	<*>	0	.	DP=21;I16=7,12,0,0,630,22184,0,0,1109,65641,0,0,372,8510,0,0;QS=3,0;MQSB=0.957193;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,78:2:0	0,9,115:3:0
-X	2315	.	C	<*>	0	.	DP=23;I16=7,14,0,0,739,26861,0,0,1229,72841,0,0,392,8892,0,0;QS=3,0;MQSB=0.966484;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,71:2:0	0,12,135:4:0
-X	2316	.	T	<*>	0	.	DP=23;I16=8,15,0,0,826,30690,0,0,1349,80041,0,0,408,9102,0,0;QS=3,0;MQSB=0.967216;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,105:3:0	0,15,170:5:0
-X	2317	.	T	<*>	0	.	DP=24;I16=7,16,0,0,766,27014,0,0,1349,80041,0,0,411,9211,0,0;QS=3,0;MQSB=0.973027;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,78:2:0	0,15,170:5:0
-X	2318	.	T	<*>	0	.	DP=24;I16=8,14,0,0,757,27433,0,0,1320,79200,0,0,379,8449,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,91:3:0	0,15,165:5:0
-X	2319	.	G	<*>	0	.	DP=24;I16=6,16,0,0,827,31577,0,0,1289,76441,0,0,398,8882,0,0;QS=3,0;MQSB=0.97584;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,3,43:1:0	0,15,167:5:0
-X	2320	.	G	<*>	0	.	DP=23;I16=7,16,0,0,803,29077,0,0,1349,80041,0,0,435,9675,0,0;QS=3,0;MQSB=0.973027;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,87:3:0	0,15,157:5:0
-X	2321	.	G	<*>	0	.	DP=23;I16=7,16,0,0,804,29368,0,0,1349,80041,0,0,442,9840,0,0;QS=3,0;MQSB=0.973027;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,79:3:0	0,15,169:5:0
-X	2322	.	A	<*>	0	.	DP=24;I16=7,17,0,0,860,32116,0,0,1409,83641,0,0,449,10027,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,95:3:0	0,15,178:5:0
-X	2323	.	G	<*>	0	.	DP=24;I16=7,17,0,0,863,31887,0,0,1409,83641,0,0,457,10237,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,88:3:0	0,15,153:5:0
-X	2324	.	G	<*>	0	.	DP=24;I16=7,16,0,0,786,27932,0,0,1349,80041,0,0,462,10416,0,0;QS=3,0;MQSB=0.973027;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,88:3:0	0,15,161:5:0
-X	2325	.	C	<*>	0	.	DP=24;I16=7,15,0,0,730,25576,0,0,1289,76441,0,0,427,9625,0,0;QS=3,0;MQSB=0.970024;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,102:3:0	0,12,130:4:0
-X	2326	.	C	<*>	0	.	DP=24;I16=7,15,0,0,709,23523,0,0,1320,79200,0,0,426,9498,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,241:15:0	0,9,95:3:0	0,12,133:4:0
-X	2327	.	G	<*>	0	.	DP=24;I16=7,17,0,0,817,29275,0,0,1409,83641,0,0,481,10891,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,81:3:0	0,15,158:5:0
-X	2328	.	A	<*>	0	.	DP=24;I16=6,17,0,0,814,29804,0,0,1349,80041,0,0,461,10427,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,82:3:0	0,15,172:5:0
-X	2329	.	G	<*>	0	.	DP=23;I16=6,16,0,0,755,27641,0,0,1289,76441,0,0,477,11005,0,0;QS=3,0;MQSB=0.97584;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,63:2:0	0,15,160:5:0
-X	2330	.	C	<*>	0	.	DP=24;I16=7,17,0,0,875,33131,0,0,1409,83641,0,0,498,11424,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,87:3:0	0,18,181:6:0
-X	2331	.	T	<*>	0	.	DP=24;I16=7,17,0,0,862,31882,0,0,1409,83641,0,0,505,11635,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,106:3:0	0,18,200:6:0
-X	2332	.	A	<*>	0	.	DP=25;I16=8,17,0,0,926,35412,0,0,1469,87241,0,0,512,11864,0,0;QS=3,0;MQSB=0.973216;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,97:3:0	0,18,204:6:0
-X	2333	.	G	<*>	0	.	DP=26;I16=8,17,0,0,923,35129,0,0,1469,87241,0,0,494,11436,0,0;QS=3,0;MQSB=0.973216;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,97:3:0	0,18,189:6:0
-X	2334	.	G	<*>	0	.	DP=26;I16=8,18,0,0,928,34574,0,0,1529,90841,0,0,527,12277,0,0;QS=3,0;MQSB=0.975611;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,93:3:0	0,21,202:7:0
-X	2335	.	A	<*>	0	.	DP=26;I16=8,18,0,0,967,36793,0,0,1529,90841,0,0,535,12513,0,0;QS=3,0;MQSB=0.975611;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,105:3:0	0,21,214:7:0
-X	2336	.	G	<*>	0	.	DP=26;I16=8,18,0,0,962,36346,0,0,1529,90841,0,0,543,12769,0,0;QS=3,0;MQSB=0.975611;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,92:3:0	0,21,204:7:0
-X	2337	.	G	<*>	0	.	DP=26;I16=7,18,0,0,895,32981,0,0,1469,87241,0,0,527,12465,0,0;QS=3,0;MQSB=0.977814;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,74:2:0	0,21,204:7:0
-X	2338	.	A	<*>	0	.	DP=26;I16=8,18,0,0,892,31758,0,0,1529,90841,0,0,556,13186,0,0;QS=3,0;MQSB=0.975611;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,87:3:0	0,21,194:7:0
-X	2339	.	T	<*>	0	.	DP=26;I16=7,18,0,0,827,28921,0,0,1469,87241,0,0,537,12769,0,0;QS=3,0;MQSB=0.977814;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,55:2:0	0,21,200:7:0
-X	2340	.	C	<*>	0	.	DP=25;I16=7,18,0,0,792,25816,0,0,1469,87241,0,0,541,12893,0,0;QS=3,0;MQSB=0.977814;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,57:2:0	0,21,173:7:0
-X	2341	.	G	<*>	0	.	DP=25;I16=6,17,0,0,771,26477,0,0,1349,80041,0,0,494,11732,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,3,41:1:0	0,21,186:7:0
-X	2342	.	T	<*>	0	.	DP=24;I16=6,17,0,0,863,32711,0,0,1349,80041,0,0,523,12459,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,3,43:1:0	0,21,214:7:0
-X	2343	.	T	<*>	0	.	DP=24;I16=6,16,0,0,770,28230,0,0,1289,76441,0,0,504,12032,0,0;QS=3,0;MQSB=0.97584;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,3,44:1:0	0,21,213:7:0
-X	2344	.	T	<*>	0	.	DP=24;I16=7,17,0,0,843,30483,0,0,1409,83641,0,0,552,13124,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,56:2:0	0,21,202:7:0
-X	2345	.	G	<*>	0	.	DP=24;I16=7,17,0,0,897,34121,0,0,1409,83641,0,0,554,13162,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,77:2:0	0,21,206:7:0
-X	2346	.	A	<*>	0	.	DP=24;I16=7,17,0,0,908,34818,0,0,1409,83641,0,0,556,13212,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,68:2:0	0,21,220:7:0
-X	2347	.	G	<*>	0	.	DP=24;I16=6,17,0,0,824,30406,0,0,1349,80041,0,0,533,12649,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,3,39:1:0	0,21,190:7:0
-X	2348	.	T	<*>	0	.	DP=24;I16=7,16,0,0,745,25653,0,0,1349,80041,0,0,544,13072,0,0;QS=3,0;MQSB=0.973027;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,64:2:0	0,18,183:6:0
-X	2349	.	C	<*>	0	.	DP=24;I16=6,17,0,0,804,29224,0,0,1349,80041,0,0,534,12656,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,3,36:1:0	0,21,200:7:0
-X	2350	.	C	<*>	0	.	DP=25;I16=7,17,0,0,869,31905,0,0,1409,83641,0,0,534,12652,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,63:2:0	0,21,198:7:0
-X	2351	.	A	<*>	0	.	DP=25;I16=8,17,0,0,945,36169,0,0,1469,87241,0,0,559,13237,0,0;QS=3,0;MQSB=0.973216;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,74:2:0	0,21,222:7:0
-X	2352	.	G	<*>	0	.	DP=25;I16=7,17,0,0,893,34005,0,0,1409,83641,0,0,533,12539,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,3,41:1:0	0,21,207:7:0
-X	2353	.	C	<*>	0	.	DP=24;I16=7,17,0,0,866,31864,0,0,1409,83641,0,0,531,12435,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,3,41:1:0	0,21,205:7:0
-X	2354	.	A	<*>	0	.	DP=24;I16=7,17,0,0,880,33206,0,0,1409,83641,0,0,529,12351,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,3,43:1:0	0,21,214:7:0
-X	2355	.	G	<*>	0	.	DP=24;I16=7,17,0,0,871,32261,0,0,1409,83641,0,0,526,12238,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,3,39:1:0	0,21,195:7:0
-X	2356	.	T	<*>	0	.	DP=24;I16=7,17,0,0,887,33305,0,0,1409,83641,0,0,521,12047,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,3,43:1:0	0,21,219:7:0
-X	2357	.	T	<*>	0	.	DP=24;I16=7,17,0,0,899,34225,0,0,1409,83641,0,0,516,11878,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,3,43:1:0	0,21,220:7:0
-X	2358	.	T	<*>	0	.	DP=24;I16=7,17,0,0,913,34891,0,0,1409,83641,0,0,510,11680,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,3,40:1:0	0,21,218:7:0
-X	2359	.	G	<*>	0	.	DP=25;I16=7,17,0,0,898,34048,0,0,1409,83641,0,0,503,11451,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,3,39:1:0	0,21,209:7:0
-X	2360	.	A	<*>	0	.	DP=25;I16=7,18,0,0,959,37113,0,0,1469,87241,0,0,514,11552,0,0;QS=3,0;MQSB=0.977814;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,72:2:0	0,21,222:7:0
-X	2361	.	G	<*>	0	.	DP=25;I16=7,17,0,0,850,30946,0,0,1409,83641,0,0,482,10726,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,67:2:0	0,18,168:6:0
-X	2362	.	A	<*>	0	.	DP=25;I16=7,17,0,0,762,25482,0,0,1409,83641,0,0,475,10547,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,51:2:0	0,18,159:6:0
-X	2363	.	C	<*>	0	.	DP=25;I16=7,18,0,0,875,31837,0,0,1469,87241,0,0,493,11015,0,0;QS=3,0;MQSB=0.977814;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,65:2:0	0,21,187:7:0
-X	2364	.	C	<*>	0	.	DP=25;I16=7,18,0,0,927,34965,0,0,1469,87241,0,0,486,10880,0,0;QS=3,0;MQSB=0.977814;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,64:2:0	0,21,201:7:0
-X	2365	.	A	<*>	0	.	DP=24;I16=7,17,0,0,908,34754,0,0,1409,83641,0,0,479,10717,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,65:2:0	0,21,221:7:0
-X	2366	.	G	<*>	0	.	DP=25;I16=7,17,0,0,912,35074,0,0,1440,86400,0,0,447,9951,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,58:2:0	0,21,206:7:0
-X	2367	.	C	<*>	0	.	DP=25;I16=7,17,0,0,872,32088,0,0,1409,83641,0,0,440,9782,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,3,36:1:0	0,21,197:7:0
-X	2368	.	C	<*>	0	.	DP=24;I16=6,17,0,0,871,33801,0,0,1349,80041,0,0,434,9634,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,3,39:1:0	0,18,180:6:0
-X	2369	.	T	<*>	0	.	DP=24;I16=6,18,0,0,877,33009,0,0,1409,83641,0,0,452,10082,0,0;QS=3,0;MQSB=0.980199;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,49:2:0	0,18,179:6:0
-X	2370	.	G	<*>	0	.	DP=24;I16=6,18,0,0,899,34289,0,0,1409,83641,0,0,445,9927,0,0;QS=3,0;MQSB=0.980199;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,56:2:0	0,18,179:6:0
-X	2371	.	G	<*>	0	.	DP=24;I16=6,18,0,0,880,33088,0,0,1409,83641,0,0,438,9794,0,0;QS=3,0;MQSB=0.980199;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,51:2:0	0,18,177:6:0
-X	2372	.	C	<*>	0	.	DP=24;I16=6,18,0,0,827,29615,0,0,1409,83641,0,0,431,9683,0,0;QS=3,0;MQSB=0.980199;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,47:2:0	0,18,163:6:0
-X	2373	.	C	<*>	0	.	DP=24;I16=6,18,0,0,886,33212,0,0,1409,83641,0,0,424,9594,0,0;QS=3,0;MQSB=0.980199;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,58:2:0	0,18,166:6:0
-X	2374	.	A	<*>	0	.	DP=23;I16=6,17,0,0,844,31230,0,0,1349,80041,0,0,417,9477,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,66:2:0	0,18,177:6:0
-X	2375	.	A	<*>	0	.	DP=23;I16=5,17,0,0,788,28340,0,0,1289,76441,0,0,409,9333,0,0;QS=3,0;MQSB=0.981001;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,64:2:0	0,18,171:6:0
-X	2376	.	T	<*>	0	.	DP=22;I16=5,17,0,0,778,27804,0,0,1289,76441,0,0,401,9161,0,0;QS=3,0;MQSB=0.981001;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,62:2:0	0,18,162:6:0
-X	2377	.	A	<*>	0	.	DP=21;I16=4,17,0,0,704,24488,0,0,1229,72841,0,0,394,9008,0,0;QS=3,0;MQSB=0.984085;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,49:2:0	0,15,135:5:0
-X	2378	.	C	<*>	0	.	DP=20;I16=4,16,0,0,626,20138,0,0,1169,69241,0,0,388,8872,0,0;QS=3,0;MQSB=0.982301;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,3,15:1:0	0,15,108:5:0
-X	2379	.	G	<*>	0	.	DP=20;I16=4,16,0,0,714,25924,0,0,1169,69241,0,0,382,8752,0,0;QS=3,0;MQSB=0.982301;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,3,34:1:0	0,15,140:5:0
-X	2380	.	G	<*>	0	.	DP=19;I16=4,14,0,0,672,25672,0,0,1049,62041,0,0,352,8022,0,0;QS=3,0;MQSB=0.977696;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,18:1:0	0,15,134:5:0
-X	2381	.	C	<*>	0	.	DP=18;I16=4,14,0,0,676,25626,0,0,1049,62041,0,0,373,8555,0,0;QS=3,0;MQSB=0.977696;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,28:1:0	0,15,133:5:0
-X	2382	.	A	<*>	0	.	DP=19;I16=5,14,0,0,669,23995,0,0,1109,65641,0,0,369,8475,0,0;QS=3,0;MQSB=0.97357;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,3,28:1:0	0,15,131:5:0
-X	2383	.	A	<*>	0	.	DP=19;I16=5,14,0,0,686,25162,0,0,1109,65641,0,0,365,8359,0,0;QS=3,0;MQSB=0.97357;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,3,26:1:0	0,15,140:5:0
-X	2384	.	A	<*>	0	.	DP=19;I16=5,14,0,0,649,22943,0,0,1109,65641,0,0,360,8210,0,0;QS=3,0;MQSB=0.97357;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,3,13:1:0	0,15,132:5:0
-X	2385	.	A	<*>	0	.	DP=18;I16=4,14,0,0,643,23235,0,0,1049,62041,0,0,356,8078,0,0;QS=3,0;MQSB=0.977696;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,38:1:0	0,15,134:5:0
-X	2386	.	C	<*>	0	.	DP=18;I16=4,14,0,0,652,24008,0,0,1049,62041,0,0,351,7913,0,0;QS=3,0;MQSB=0.977696;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,25:1:0	0,15,130:5:0
-X	2387	.	C	<*>	0	.	DP=18;I16=4,14,0,0,667,25007,0,0,1049,62041,0,0,345,7717,0,0;QS=3,0;MQSB=0.977696;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,25:1:0	0,15,128:5:0
-X	2388	.	C	<*>	0	.	DP=18;I16=4,14,0,0,691,26659,0,0,1049,62041,0,0,339,7541,0,0;QS=3,0;MQSB=0.977696;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,39:1:0	0,15,134:5:0
-X	2389	.	A	<*>	0	.	DP=19;I16=5,14,0,0,682,24912,0,0,1109,65641,0,0,333,7385,0,0;QS=3,0;MQSB=0.97357;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,3,35:1:0	0,15,140:5:0
-X	2390	.	G	<*>	0	.	DP=18;I16=5,13,0,0,642,23418,0,0,1049,62041,0,0,328,7200,0,0;QS=3,0;MQSB=0.970092;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,27:1:0	0,15,126:5:0
-X	2391	.	T	<*>	0	.	DP=18;I16=5,12,0,0,624,23122,0,0,989,58441,0,0,298,6412,0,0;QS=2,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,0,0:0:0	0,15,140:5:0
-X	2392	.	C	<*>	0	.	DP=18;I16=5,12,0,0,660,25910,0,0,989,58441,0,0,291,6171,0,0;QS=2,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,0,0:0:0	0,15,131:5:0
-X	2393	.	T	<*>	0	.	DP=18;I16=5,13,0,0,669,25099,0,0,1049,62041,0,0,309,6577,0,0;QS=3,0;MQSB=0.970092;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,38:1:0	0,15,134:5:0
-X	2394	.	C	<*>	0	.	DP=17;I16=5,12,0,0,653,25323,0,0,989,58441,0,0,303,6379,0,0;QS=3,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,29:1:0	0,15,133:5:0
-X	2395	.	T	<*>	0	.	DP=17;I16=5,12,0,0,613,22621,0,0,989,58441,0,0,297,6201,0,0;QS=3,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,19:1:0	0,15,128:5:0
-X	2396	.	A	<*>	0	.	DP=17;I16=5,11,0,0,584,21426,0,0,929,54841,0,0,266,5418,0,0;QS=2,0;MQSB=0.960687;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,0,0:0:0	0,15,130:5:0
-X	2397	.	C	<*>	0	.	DP=18;I16=5,13,0,0,650,24046,0,0,1049,62041,0,0,284,5856,0,0;QS=3,0;MQSB=0.970092;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,18:1:0	0,15,129:5:0
-X	2398	.	A	<*>	0	.	DP=18;I16=5,13,0,0,617,21907,0,0,1049,62041,0,0,278,5692,0,0;QS=3,0;MQSB=0.970092;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,19:1:0	0,15,128:5:0
-X	2399	.	A	<*>	0	.	DP=17;I16=5,11,0,0,592,22176,0,0,929,54841,0,0,248,4926,0,0;QS=2,0;MQSB=0.960687;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,0,0:0:0	0,12,115:4:0
-X	2400	.	A	<*>	0	.	DP=16;I16=5,11,0,0,576,21010,0,0,929,54841,0,0,269,5431,0,0;QS=3,0;MQSB=0.960687;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,26:1:0	0,9,99:3:0
-X	2401	.	A	<*>	0	.	DP=17;I16=6,11,0,0,594,21126,0,0,989,58441,0,0,265,5331,0,0;QS=3,0;MQSB=0.955563;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,3,23:1:0	0,9,98:3:0
-X	2402	.	A	<*>	0	.	DP=17;I16=6,11,0,0,606,21986,0,0,989,58441,0,0,262,5252,0,0;QS=3,0;MQSB=0.955563;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,3,27:1:0	0,9,99:3:0
-X	2403	.	A	<*>	0	.	DP=17;I16=6,11,0,0,608,22130,0,0,989,58441,0,0,259,5195,0,0;QS=3,0;MQSB=0.955563;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,3,21:1:0	0,9,97:3:0
-X	2404	.	T	<*>	0	.	DP=17;I16=6,11,0,0,567,19449,0,0,989,58441,0,0,256,5160,0,0;QS=3,0;MQSB=0.955563;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,3,14:1:0	0,9,87:3:0
-X	2405	.	A	<*>	0	.	DP=18;I16=7,11,0,0,618,21666,0,0,1049,62041,0,0,253,5147,0,0;QS=3,0;MQSB=0.951002;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,3,17:1:0	0,9,88:3:0
-X	2406	.	C	<*>	0	.	DP=18;I16=7,11,0,0,676,25664,0,0,1049,62041,0,0,250,5108,0,0;QS=3,0;MQSB=0.951002;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,3,27:1:0	0,9,90:3:0
-X	2407	.	A	<*>	0	.	DP=19;I16=8,11,0,0,673,24197,0,0,1109,65641,0,0,246,5046,0,0;QS=3,0;MQSB=0.946915;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,3,34:1:0	0,9,89:3:0
-X	2408	.	A	<*>	0	.	DP=18;I16=8,10,0,0,619,21951,0,0,1049,62041,0,0,243,4961,0,0;QS=3,0;MQSB=0.938795;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,3,22:1:0	0,6,73:2:0
-X	2409	.	A	<*>	0	.	DP=17;I16=8,9,0,0,615,22687,0,0,1020,61200,0,0,240,4852,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,3,39:1:0	0,6,74:2:0
-X	2410	.	A	<*>	0	.	DP=17;I16=8,9,0,0,604,21938,0,0,1020,61200,0,0,237,4769,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,3,39:1:0	0,6,73:2:0
-X	2411	.	A	<*>	0	.	DP=16;I16=7,9,0,0,567,20551,0,0,960,57600,0,0,235,4711,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,3,25:1:0	0,6,70:2:0
-X	2412	.	A	<*>	0	.	DP=15;I16=7,8,0,0,527,18903,0,0,900,54000,0,0,234,4676,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,21:1:0	0,6,70:2:0
-X	2413	.	C	<*>	0	.	DP=15;I16=7,8,0,0,559,21161,0,0,900,54000,0,0,233,4663,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,22:1:0	0,6,72:2:0
-X	2414	.	A	<*>	0	.	DP=16;I16=8,8,0,0,570,20822,0,0,929,54841,0,0,232,4672,0,0;QS=3,0;MQSB=0.915545;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,3,25:1:0	0,6,73:2:0
-X	2415	.	A	<*>	0	.	DP=16;I16=9,7,0,0,574,20768,0,0,929,54841,0,0,232,4652,0,0;QS=3,0;MQSB=0.933674;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,3,30:1:0	0,6,64:2:0
-X	2416	.	C	<*>	0	.	DP=17;I16=8,8,0,0,576,21424,0,0,960,57600,0,0,231,4649,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,42:2:0	0,6,68:2:0
-X	2417	.	T	<*>	0	.	DP=17;I16=10,7,0,0,612,22740,0,0,958,55682,0,0,235,4627,0,0;QS=3,0;MQSB=0.79189;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,57:2:0	0,9,92:3:0
-X	2418	.	A	<*>	0	.	DP=17;I16=10,7,0,0,624,23210,0,0,958,55682,0,0,238,4626,0,0;QS=3,0;MQSB=0.79189;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,62:2:0	0,9,105:3:0
-X	2419	.	G	<*>	0	.	DP=19;I16=11,7,0,0,651,24113,0,0,1018,59282,0,0,241,4651,0,0;QS=3,0;MQSB=0.817948;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,51:2:0	0,12,126:4:0
-X	2420	.	C	<*>	0	.	DP=19;I16=11,8,0,0,663,23999,0,0,1078,62882,0,0,246,4704,0,0;QS=3,0;MQSB=0.803979;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,44:2:0	0,12,127:4:0
-X	2421	.	C	<*>	0	.	DP=19;I16=10,8,0,0,657,24779,0,0,1049,62041,0,0,244,4738,0,0;QS=3,0;MQSB=0.938795;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,45:2:0	0,12,126:4:0
-X	2422	.	A	<*>	0	.	DP=18;I16=11,6,0,0,647,24747,0,0,958,55682,0,0,238,4538,0,0;QS=3,0;MQSB=0.833753;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,33:1:0	0,12,137:4:0
-X	2423	.	G	<*>	0	.	DP=18;I16=11,6,0,0,634,24250,0,0,958,55682,0,0,258,4972,0,0;QS=3,0;MQSB=0.833753;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,54:2:0	0,12,126:4:0
-X	2424	.	G	<*>	0	.	DP=18;I16=10,6,0,0,595,22361,0,0,929,54841,0,0,240,4714,0,0;QS=3,0;MQSB=0.948436;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,36:1:0	0,12,126:4:0
-X	2425	.	C	<*>	0	.	DP=18;I16=10,7,0,0,596,21716,0,0,989,58441,0,0,260,5074,0,0;QS=3,0;MQSB=0.943335;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,45:2:0	0,12,114:4:0
-X	2426	.	G	<*>	0	.	DP=18;I16=10,7,0,0,550,18088,0,0,989,58441,0,0,263,5171,0,0;QS=3,0;MQSB=0.943335;MQ0F=0	PL:DP:DV	0,33,232:11:0	0,6,59:2:0	0,12,113:4:0
-X	2427	.	T	<*>	0	.	DP=18;I16=11,6,0,0,618,22654,0,0,958,55682,0,0,275,5403,0,0;QS=3,0;MQSB=0.833753;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,62:2:0	0,9,99:3:0
-X	2428	.	G	<*>	0	.	DP=18;I16=11,7,0,0,649,24633,0,0,1018,59282,0,0,281,5535,0,0;QS=3,0;MQSB=0.817948;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,48:2:0	0,12,128:4:0
-X	2429	.	G	<*>	0	.	DP=18;I16=10,7,0,0,553,19057,0,0,989,58441,0,0,269,5459,0,0;QS=3,0;MQSB=0.943335;MQ0F=0	PL:DP:DV	0,33,241:11:0	0,6,55:2:0	0,12,117:4:0
-X	2430	.	T	A,<*>	0	.	DP=18;I16=10,7,1,0,552,18556,21,441,989,58441,29,841,271,5603,16,256;QS=2.94278,0.0572207,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.817948;BQB=1;MQ0F=0	PL:DP:DV	0,15,212,33,215,222:12:1	0,6,60,6,60,60:2:0	0,12,125,12,125,125:4:0
-X	2431	.	G	<*>	0	.	DP=18;I16=11,5,0,0,580,21766,0,0,898,52082,0,0,268,5764,0,0;QS=3,0;MQSB=0.851779;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,37:1:0	0,9,98:3:0
-X	2432	.	G	<*>	0	.	DP=17;I16=10,7,0,0,593,21479,0,0,958,55682,0,0,295,6179,0,0;QS=3,0;MQSB=0.79189;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,53:2:0	0,9,97:3:0
-X	2433	.	T	<*>	0	.	DP=17;I16=10,7,0,0,577,20425,0,0,958,55682,0,0,299,6321,0,0;QS=3,0;MQSB=0.79189;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,57:2:0	0,9,94:3:0
-X	2434	.	G	<*>	0	.	DP=17;I16=10,6,0,0,546,19340,0,0,929,54841,0,0,284,6082,0,0;QS=3,0;MQSB=0.948436;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,46:2:0	0,6,62:2:0
-X	2435	.	C	<*>	0	.	DP=18;I16=12,5,0,0,597,21843,0,0,958,55682,0,0,304,6626,0,0;QS=3,0;MQSB=0.870325;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,6,58:2:0	0,6,60:2:0
-X	2436	.	A	<*>	0	.	DP=18;I16=11,6,0,0,545,18599,0,0,989,58441,0,0,295,6379,0,0;QS=3,0;MQSB=0.955563;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,64:3:0	0,6,61:2:0
-X	2437	.	C	<*>	0	.	DP=18;I16=11,5,0,0,573,21195,0,0,929,54841,0,0,297,6541,0,0;QS=3,0;MQSB=0.960687;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,63:2:0	0,6,63:2:0
-X	2438	.	A	<*>	0	.	DP=19;I16=12,6,0,0,583,20111,0,0,1018,59282,0,0,328,7322,0,0;QS=3,0;MQSB=0.85394;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,65:2:0	0,6,65:2:0
-X	2439	.	C	<*>	0	.	DP=19;I16=11,7,0,0,635,22997,0,0,1049,62041,0,0,314,6974,0,0;QS=3,0;MQSB=0.951002;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,91:3:0	0,6,57:2:0
-X	2440	.	C	<*>	0	.	DP=21;I16=13,7,0,0,701,26195,0,0,1138,66482,0,0,346,7840,0,0;QS=3,0;MQSB=0.857404;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,114:4:0	0,6,66:2:0
-X	2441	.	T	<*>	0	.	DP=21;I16=13,8,0,0,788,29910,0,0,1198,70082,0,0,360,8068,0,0;QS=3,0;MQSB=0.845496;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,164:5:0	0,6,67:2:0
-X	2442	.	G	<*>	0	.	DP=20;I16=12,7,0,0,695,25957,0,0,1109,65641,0,0,342,7596,0,0;QS=3,0;MQSB=0.957193;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,128:4:0	0,6,66:2:0
-X	2443	.	T	<*>	0	.	DP=20;I16=13,7,0,0,697,24685,0,0,1138,66482,0,0,373,8345,0,0;QS=3,0;MQSB=0.857404;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,130:4:0	0,6,64:2:0
-X	2444	.	A	<*>	0	.	DP=21;I16=13,8,0,0,755,27981,0,0,1198,70082,0,0,379,8489,0,0;QS=3,0;MQSB=0.845496;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,140:4:0	0,6,64:2:0
-X	2445	.	G	<*>	0	.	DP=21;I16=12,8,0,0,731,27427,0,0,1169,69241,0,0,359,7927,0,0;QS=3,0;MQSB=0.953497;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,130:4:0	0,6,65:2:0
-X	2446	.	T	<*>	0	.	DP=21;I16=13,8,0,0,723,25707,0,0,1198,70082,0,0,389,8633,0,0;QS=3,0;MQSB=0.845496;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,128:4:0	0,6,65:2:0
-X	2447	.	C	<*>	0	.	DP=22;I16=14,8,0,0,770,27950,0,0,1258,73682,0,0,394,8732,0,0;QS=3,0;MQSB=0.86151;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,127:4:0	0,6,64:2:0
-X	2448	.	C	<*>	0	.	DP=23;I16=14,7,0,0,727,26165,0,0,1167,67323,0,0,388,8674,0,0;QS=3,0;MQSB=0.735784;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,129:5:0	0,6,66:2:0
-X	2449	.	C	<*>	0	.	DP=23;I16=13,8,0,0,727,26415,0,0,1198,70082,0,0,363,7787,0,0;QS=3,0;MQSB=0.845496;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,128:5:0	0,6,62:2:0
-X	2450	.	A	<*>	0	.	DP=22;I16=12,8,0,0,673,24267,0,0,1138,66482,0,0,371,7959,0,0;QS=3,0;MQSB=0.826565;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,143:5:0	0,6,65:2:0
-X	2451	.	G	<*>	0	.	DP=22;I16=14,8,0,0,821,31595,0,0,1227,70923,0,0,429,9401,0,0;QS=3,0;MQSB=0.715049;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,151:5:0	0,6,67:2:0
-X	2452	.	C	<*>	0	.	DP=22;I16=14,8,0,0,743,26557,0,0,1227,70923,0,0,437,9613,0,0;QS=3,0;MQSB=0.715049;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,137:5:0	0,6,66:2:0
-X	2453	.	T	<*>	0	.	DP=22;I16=14,8,0,0,775,28215,0,0,1227,70923,0,0,445,9845,0,0;QS=3,0;MQSB=0.715049;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,143:5:0	0,6,68:2:0
-X	2454	.	A	<*>	0	.	DP=22;I16=14,8,0,0,721,24545,0,0,1227,70923,0,0,453,10097,0,0;QS=3,0;MQSB=0.715049;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,145:5:0	0,6,64:2:0
-X	2455	.	C	<*>	0	.	DP=22;I16=14,8,0,0,776,28212,0,0,1227,70923,0,0,461,10369,0,0;QS=3,0;MQSB=0.715049;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,138:5:0	0,6,65:2:0
-X	2456	.	T	<*>	0	.	DP=24;I16=14,9,0,0,834,30902,0,0,1318,77282,0,0,444,10036,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,168:6:0	0,6,60:2:0
-X	2457	.	C	<*>	0	.	DP=24;I16=15,9,0,0,816,29244,0,0,1347,78123,0,0,478,10924,0,0;QS=3,0;MQSB=0.72325;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,159:6:0	0,6,65:2:0
-X	2458	.	A	<*>	0	.	DP=24;I16=15,9,0,0,869,32555,0,0,1347,78123,0,0,487,11209,0,0;QS=3,0;MQSB=0.72325;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,166:6:0	0,6,65:2:0
-X	2459	.	G	T,<*>	0	.	DP=24;I16=13,9,1,0,822,31186,13,169,1289,76441,29,841,453,10551,17,289;QS=2.92973,0.0702703,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.851535;BQB=1;MQ0F=0	PL:DP:DV	0,45,255,45,255,255:15:0	0,5,138,15,141,144:6:1	0,6,64,6,64,64:2:0
-X	2460	.	G	<*>	0	.	DP=24;I16=14,9,0,0,834,31432,0,0,1318,77282,0,0,477,11065,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,160:6:0	0,6,65:2:0
-X	2461	.	A	G,<*>	0	.	DP=24;I16=14,9,1,0,839,31487,13,169,1318,77282,29,841,489,11521,19,361;QS=2.93401,0.0659898,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.72325;BQB=1;MQ0F=0	PL:DP:DV	0,48,255,48,255,255:16:0	0,5,148,15,151,154:6:1	0,6,67,6,67,67:2:0
-X	2462	.	G	<*>	0	.	DP=25;I16=15,10,0,0,893,33155,0,0,1407,81723,0,0,514,12090,0,0;QS=3,0;MQSB=0.707404;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,165:6:0	0,6,66:2:0
-X	2463	.	G	T,<*>	0	.	DP=25;I16=12,10,1,0,777,28525,14,196,1289,76441,29,841,452,10720,25,625;QS=2.975,0.025,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.825053;BQB=1;MQ0F=0	PL:DP:DV	0,36,255,48,255,255:17:1	0,12,133,12,133,133:4:0	0,6,68,6,68,68:2:0
-X	2464	.	C	<*>	0	.	DP=25;I16=15,10,0,0,904,34194,0,0,1407,81723,0,0,526,12458,0,0;QS=3,0;MQSB=0.707404;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,149:6:0	0,6,67:2:0
-X	2465	.	T	<*>	0	.	DP=25;I16=14,10,0,0,857,32235,0,0,1347,78123,0,0,506,11994,0,0;QS=3,0;MQSB=0.679965;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,163:6:0	0,6,69:2:0
-X	2466	.	G	<*>	0	.	DP=24;I16=14,9,0,0,852,32336,0,0,1318,77282,0,0,509,12025,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,157:6:0	0,6,63:2:0
-X	2467	.	A	<*>	0	.	DP=24;I16=14,9,0,0,829,30725,0,0,1318,77282,0,0,513,12121,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,168:6:0	0,6,67:2:0
-X	2468	.	G	<*>	0	.	DP=24;I16=15,9,0,0,890,34034,0,0,1347,78123,0,0,541,12807,0,0;QS=3,0;MQSB=0.72325;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,169:6:0	0,6,64:2:0
-X	2469	.	G	<*>	0	.	DP=24;I16=15,9,0,0,865,32303,0,0,1347,78123,0,0,544,12882,0,0;QS=3,0;MQSB=0.72325;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,174:6:0	0,6,58:2:0
-X	2470	.	G	<*>	0	.	DP=24;I16=14,9,0,0,829,30785,0,0,1318,77282,0,0,521,12295,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,178:6:0	0,6,58:2:0
-X	2471	.	G	<*>	0	.	DP=24;I16=14,9,0,0,833,31429,0,0,1318,77282,0,0,523,12345,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,170:5:0	0,6,64:2:0
-X	2472	.	G	<*>	0	.	DP=24;I16=13,9,0,0,774,28428,0,0,1289,76441,0,0,499,11733,0,0;QS=3,0;MQSB=0.955854;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,154:5:0	0,6,56:2:0
-X	2473	.	A	<*>	0	.	DP=24;I16=13,9,0,0,775,28137,0,0,1258,73682,0,0,508,12078,0,0;QS=3,0;MQSB=0.834768;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,160:5:0	0,6,63:2:0
-X	2474	.	A	<*>	0	.	DP=25;I16=15,9,0,0,851,31665,0,0,1378,80882,0,0,524,12322,0,0;QS=3,0;MQSB=0.865888;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,160:5:0	0,9,80:3:0
-X	2475	.	G	<*>	0	.	DP=25;I16=15,9,0,0,913,35239,0,0,1378,80882,0,0,525,12323,0,0;QS=3,0;MQSB=0.865888;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,167:5:0	0,9,84:3:0
-X	2476	.	G	<*>	0	.	DP=25;I16=13,9,0,0,776,28584,0,0,1289,76441,0,0,488,11544,0,0;QS=3,0;MQSB=0.955854;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,138:5:0	0,9,82:3:0
-X	2477	.	A	<*>	0	.	DP=25;I16=14,9,0,0,867,34329,0,0,1318,77282,0,0,515,12223,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,178:5:0	0,9,91:3:0
-X	2478	.	C	<*>	0	.	DP=25;I16=14,9,0,0,897,36911,0,0,1318,77282,0,0,517,12289,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,175:5:0	0,9,87:3:0
-X	2479	.	T	<*>	0	.	DP=25;I16=15,9,0,0,921,37957,0,0,1378,80882,0,0,529,12467,0,0;QS=3,0;MQSB=0.865888;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,176:5:0	0,9,97:3:0
-X	2480	.	G	<*>	0	.	DP=25;I16=14,9,0,0,877,35485,0,0,1349,80041,0,0,504,11864,0,0;QS=3,0;MQSB=0.960618;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,176:5:0	0,9,88:3:0
-X	2481	.	C	<*>	0	.	DP=25;I16=13,9,0,0,848,34542,0,0,1289,76441,0,0,496,11838,0,0;QS=3,0;MQSB=0.955854;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,183:5:0	0,9,88:3:0
-X	2482	.	T	<*>	0	.	DP=25;I16=15,9,0,0,905,37331,0,0,1378,80882,0,0,526,12430,0,0;QS=3,0;MQSB=0.865888;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,178:5:0	0,9,96:3:0
-X	2483	.	T	<*>	0	.	DP=25;I16=14,9,0,0,879,36187,0,0,1318,77282,0,0,517,12311,0,0;QS=3,0;MQSB=0.851535;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,180:5:0	0,9,89:3:0
-X	2484	.	G	<*>	0	.	DP=25;I16=14,9,0,0,884,35142,0,0,1349,80041,0,0,494,11604,0,0;QS=3,0;MQSB=0.960618;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,174:5:0	0,9,84:3:0
-X	2485	.	A	T,<*>	0	.	DP=25;I16=14,9,1,0,891,36757,17,289,1349,80041,29,841,490,11502,25,625;QS=2.96926,0.0307414,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.865888;BQB=1;MQ0F=0	PL:DP:DV	0,31,255,45,255,255:16:1	0,15,193,15,193,193:5:0	0,9,93,9,93,93:3:0
-X	2486	.	G	<*>	0	.	DP=25;I16=15,9,0,0,898,36230,0,0,1378,80882,0,0,511,12041,0,0;QS=3,0;MQSB=0.865888;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,153:5:0	0,9,90:3:0
-X	2487	.	C	<*>	0	.	DP=25;I16=14,9,0,0,793,30695,0,0,1349,80041,0,0,482,11346,0,0;QS=3,0;MQSB=0.960618;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,175:5:0	0,9,91:3:0
-X	2488	.	C	<*>	0	.	DP=25;I16=13,9,0,0,841,34597,0,0,1289,76441,0,0,457,10841,0,0;QS=3,0;MQSB=0.955854;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,174:5:0	0,9,93:3:0
-X	2489	.	C	<*>	0	.	DP=23;I16=11,9,0,0,801,34227,0,0,1169,69241,0,0,454,10788,0,0;QS=3,0;MQSB=0.943233;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,187:5:0	0,9,93:3:0
-X	2490	.	A	<*>	0	.	DP=23;I16=11,10,0,0,818,34642,0,0,1229,72841,0,0,451,10695,0,0;QS=3,0;MQSB=0.939898;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,175:5:0	0,12,128:4:0
-X	2491	.	G	<*>	0	.	DP=23;I16=12,10,0,0,845,35143,0,0,1258,73682,0,0,471,11097,0,0;QS=3,0;MQSB=0.804615;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,178:5:0	0,12,121:4:0
-X	2492	.	G	A,<*>	0	.	DP=23;I16=11,10,1,0,845,36207,16,256,1229,72841,29,841,446,10494,21,441;QS=2.96708,0.0329218,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.804615;BQB=1;MQ0F=0	PL:DP:DV	0,22,255,36,255,255:13:1	0,15,187,15,187,187:5:0	0,12,124,12,124,124:4:0
-X	2493	.	A	G,<*>	0	.	DP=23;I16=11,10,1,0,855,37007,13,169,1229,72841,29,841,442,10340,20,400;QS=2.97269,0.0273109,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.804615;BQB=1;MQ0F=0	PL:DP:DV	0,25,255,36,255,255:13:1	0,15,191,15,191,191:5:0	0,12,127,12,127,127:4:0
-X	2494	.	G	<*>	0	.	DP=23;I16=11,10,0,0,802,32720,0,0,1229,72841,0,0,437,10153,0,0;QS=3,0;MQSB=0.939898;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,179:5:0	0,12,118:4:0
-X	2495	.	T	<*>	0	.	DP=23;I16=10,10,0,0,737,29861,0,0,1138,66482,0,0,413,9513,0,0;QS=3,0;MQSB=0.751477;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,172:5:0	0,12,113:4:0
-X	2496	.	T	<*>	0	.	DP=23;I16=12,10,0,0,815,32793,0,0,1258,73682,0,0,442,10026,0,0;QS=3,0;MQSB=0.804615;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,183:5:0	0,12,123:4:0
-X	2497	.	T	<*>	0	.	DP=22;I16=12,9,0,0,807,33723,0,0,1198,70082,0,0,436,9814,0,0;QS=3,0;MQSB=0.815018;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,177:5:0	0,12,131:4:0
-X	2498	.	G	<*>	0	.	DP=22;I16=12,9,0,0,808,33264,0,0,1198,70082,0,0,430,9622,0,0;QS=3,0;MQSB=0.815018;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,173:5:0	0,12,127:4:0
-X	2499	.	A	<*>	0	.	DP=22;I16=12,9,0,0,847,36803,0,0,1198,70082,0,0,424,9450,0,0;QS=3,0;MQSB=0.815018;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,185:5:0	0,12,133:4:0
-X	2500	.	G	<*>	0	.	DP=22;I16=11,9,0,0,772,32546,0,0,1169,69241,0,0,404,9078,0,0;QS=3,0;MQSB=0.943233;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,168:5:0	0,12,129:4:0
-X	2501	.	G	<*>	0	.	DP=22;I16=11,8,0,0,768,33120,0,0,1109,65641,0,0,373,8293,0,0;QS=3,0;MQSB=0.946915;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,146:4:0	0,12,118:4:0
-X	2502	.	C	<*>	0	.	DP=22;I16=12,8,0,0,798,33902,0,0,1138,66482,0,0,378,8270,0,0;QS=3,0;MQSB=0.826565;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,155:4:0	0,12,125:4:0
-X	2503	.	T	<*>	0	.	DP=22;I16=12,9,0,0,851,36841,0,0,1198,70082,0,0,396,8746,0,0;QS=3,0;MQSB=0.815018;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,180:5:0	0,12,139:4:0
-X	2504	.	G	<*>	0	.	DP=22;I16=12,9,0,0,787,31955,0,0,1198,70082,0,0,389,8615,0,0;QS=3,0;MQSB=0.815018;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,171:5:0	0,12,129:4:0
-X	2505	.	C	<*>	0	.	DP=21;I16=11,9,0,0,792,33440,0,0,1138,66482,0,0,383,8501,0,0;QS=3,0;MQSB=0.791547;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,169:5:0	0,12,132:4:0
-X	2506	.	T	<*>	0	.	DP=22;I16=11,10,0,0,798,32868,0,0,1198,70082,0,0,376,8354,0,0;QS=3,0;MQSB=0.780412;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,175:5:0	0,15,169:5:0
-X	2507	.	G	<*>	0	.	DP=21;I16=9,10,0,0,716,30074,0,0,1109,65641,0,0,365,8189,0,0;QS=3,0;MQSB=0.920044;MQ0F=0	PL:DP:DV	0,27,241:9:0	0,15,163:5:0	0,15,153:5:0
-X	2508	.	T	<*>	0	.	DP=21;I16=9,10,0,0,724,30396,0,0,1109,65641,0,0,361,8089,0,0;QS=3,0;MQSB=0.920044;MQ0F=0	PL:DP:DV	0,27,241:9:0	0,15,158:5:0	0,15,162:5:0
-X	2509	.	G	T,<*>	0	.	DP=21;I16=8,10,1,0,710,30408,35,1225,1049,62041,60,3600,330,7282,25,625;QS=2.80663,0.19337,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.920044;BQB=1;MQ0F=0	PL:DP:DV	0,27,253,27,253,253:9:0	20,0,122,32,125,150:5:1	0,15,163,15,163,163:5:0
-X	2510	.	A	<*>	0	.	DP=21;I16=10,10,0,0,778,33128,0,0,1138,66482,0,0,352,7754,0,0;QS=3,0;MQSB=0.751477;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,174:5:0	0,15,161:5:0
-X	2511	.	G	<*>	0	.	DP=21;I16=10,10,0,0,771,32165,0,0,1138,66482,0,0,344,7558,0,0;QS=3,0;MQSB=0.751477;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,161:5:0	0,15,159:5:0
-X	2512	.	C	<*>	0	.	DP=21;I16=10,10,0,0,790,33406,0,0,1138,66482,0,0,336,7386,0,0;QS=3,0;MQSB=0.751477;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,175:5:0	0,15,160:5:0
-X	2513	.	T	<*>	0	.	DP=21;I16=10,10,0,0,755,31503,0,0,1138,66482,0,0,327,7189,0,0;QS=3,0;MQSB=0.751477;MQ0F=0	PL:DP:DV	0,30,246:10:0	0,15,180:5:0	0,15,156:5:0
-X	2514	.	G	<*>	0	.	DP=20;I16=9,10,0,0,702,28002,0,0,1109,65641,0,0,319,7017,0,0;QS=3,0;MQSB=0.920044;MQ0F=0	PL:DP:DV	0,27,228:9:0	0,15,171:5:0	0,15,155:5:0
-X	2515	.	T	<*>	0	.	DP=19;I16=8,10,0,0,642,25888,0,0,1049,62041,0,0,312,6868,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,24,182:8:0	0,15,172:5:0	0,15,141:5:0
-X	2516	.	G	<*>	0	.	DP=19;I16=8,10,0,0,685,28155,0,0,1049,62041,0,0,303,6641,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,24,211:8:0	0,15,175:5:0	0,15,147:5:0
-X	2517	.	A	<*>	0	.	DP=18;I16=8,9,0,0,660,27600,0,0,989,58441,0,0,295,6435,0,0;QS=3,0;MQSB=0.91051;MQ0F=0	PL:DP:DV	0,24,215:8:0	0,12,139:4:0	0,15,161:5:0
-X	2518	.	T	<*>	0	.	DP=17;I16=6,9,0,0,611,26911,0,0,900,54000,0,0,273,6023,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,188:7:0	0,12,144:4:0	0,12,146:4:0
-X	2519	.	C	<*>	0	.	DP=16;I16=7,8,0,0,531,20111,0,0,900,54000,0,0,282,6078,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,175:7:0	0,12,141:4:0	0,12,125:4:0
-X	2520	.	G	<*>	0	.	DP=15;I16=6,8,0,0,501,19731,0,0,840,50400,0,0,277,5923,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,187:7:0	0,12,129:4:0	0,9,101:3:0
-X	2521	.	C	<*>	0	.	DP=15;I16=6,8,0,0,583,25777,0,0,840,50400,0,0,272,5782,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,214:7:0	0,12,149:4:0	0,9,111:3:0
-X	2522	.	A	<*>	0	.	DP=16;I16=6,8,0,0,516,20930,0,0,840,50400,0,0,266,5606,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,173:7:0	0,12,139:4:0	0,9,114:3:0
-X	2523	.	T	<*>	0	.	DP=16;I16=6,9,0,0,588,25538,0,0,900,54000,0,0,270,5546,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,207:7:0	0,15,157:5:0	0,9,117:3:0
-X	2524	.	C	<*>	0	.	DP=16;I16=5,9,0,0,548,23502,0,0,840,50400,0,0,256,5342,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,182:6:0	0,15,156:5:0	0,9,112:3:0
-X	2525	.	A	C,<*>	0	.	DP=17;I16=6,9,0,1,550,23138,28,784,900,54000,60,3600,248,5174,12,144;QS=2.86,0.14,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=1;BQB=1;MQ0F=0	PL:DP:DV	0,24,168,24,168,168:8:0	13,0,138,25,141,159:5:1	0,9,117,9,117,117:3:0
-X	2526	.	C	<*>	0	.	DP=18;I16=6,11,0,0,677,28649,0,0,1020,61200,0,0,256,5232,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,229:9:0	0,15,183:5:0	0,9,113:3:0
-X	2527	.	T	<*>	0	.	DP=18;I16=6,11,0,0,674,29286,0,0,1020,61200,0,0,252,5118,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,217:9:0	0,15,183:5:0	0,9,119:3:0
-X	2528	.	G	<*>	0	.	DP=18;I16=6,11,0,0,701,30729,0,0,1020,61200,0,0,248,5028,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,234:9:0	0,15,184:5:0	0,9,119:3:0
-X	2529	.	C	<*>	0	.	DP=18;I16=6,11,0,0,676,28974,0,0,1020,61200,0,0,244,4962,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,228:9:0	0,15,175:5:0	0,9,117:3:0
-X	2530	.	A	<*>	0	.	DP=18;I16=6,10,0,0,624,26620,0,0,960,57600,0,0,223,4631,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,209:9:0	0,12,153:4:0	0,9,116:3:0
-X	2531	.	T	<*>	0	.	DP=17;I16=6,10,0,0,641,27911,0,0,960,57600,0,0,236,4852,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,210:8:0	0,15,175:5:0	0,9,122:3:0
-X	2532	.	T	<*>	0	.	DP=17;I16=6,10,0,0,634,27460,0,0,960,57600,0,0,230,4708,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,212:8:0	0,15,173:5:0	0,9,117:3:0
-X	2533	.	C	<*>	0	.	DP=18;I16=6,11,0,0,614,24196,0,0,1020,61200,0,0,224,4588,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,212:9:0	0,15,159:5:0	0,9,104:3:0
-X	2534	.	C	<*>	0	.	DP=16;I16=5,10,0,0,595,25141,0,0,900,54000,0,0,221,4491,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,202:8:0	0,12,144:4:0	0,9,110:3:0
-X	2535	.	A	<*>	0	.	DP=16;I16=5,10,0,0,617,27711,0,0,900,54000,0,0,218,4416,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,204:8:0	0,12,136:4:0	0,9,123:3:0
-X	2536	.	G	<*>	0	.	DP=15;I16=4,10,0,0,543,23023,0,0,840,50400,0,0,216,4362,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,195:8:0	0,9,102:3:0	0,9,117:3:0
-X	2537	.	C	<*>	0	.	DP=15;I16=4,10,0,0,555,24075,0,0,840,50400,0,0,213,4279,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,195:8:0	0,9,113:3:0	0,9,115:3:0
-X	2538	.	C	<*>	0	.	DP=15;I16=5,9,0,0,510,21070,0,0,840,50400,0,0,211,4217,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,157:7:0	0,9,129:3:0	0,12,126:4:0
-X	2539	.	C	<*>	0	.	DP=15;I16=5,9,0,0,464,16896,0,0,840,50400,0,0,209,4125,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,146:7:0	0,9,122:3:0	0,12,111:4:0
-X	2540	.	G	<*>	0	.	DP=16;I16=6,9,0,0,548,21860,0,0,900,54000,0,0,207,4053,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,189:7:0	0,12,139:4:0	0,12,110:4:0
-X	2541	.	G	<*>	0	.	DP=15;I16=5,9,0,0,535,22527,0,0,840,50400,0,0,207,4001,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,170:7:0	0,9,117:3:0	0,12,140:4:0
-X	2542	.	T	<*>	0	.	DP=15;I16=4,9,0,0,527,23207,0,0,780,46800,0,0,203,3953,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,183:7:0	0,9,125:3:0	0,9,109:3:0
-X	2543	.	G	<*>	0	.	DP=15;I16=5,9,0,0,540,23004,0,0,840,50400,0,0,207,3957,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,196:7:0	0,9,117:3:0	0,12,117:4:0
-X	2544	.	A	<*>	0	.	DP=16;I16=6,9,0,0,569,24139,0,0,900,54000,0,0,207,3965,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,202:8:0	0,9,119:3:0	0,12,132:4:0
-X	2545	.	C	<*>	0	.	DP=16;I16=6,9,0,0,583,24657,0,0,900,54000,0,0,208,3994,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,217:8:0	0,9,118:3:0	0,12,130:4:0
-X	2546	.	A	<*>	0	.	DP=16;I16=6,9,0,0,608,27290,0,0,900,54000,0,0,209,4045,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,206:8:0	0,9,133:3:0	0,12,144:4:0
-X	2547	.	G	<*>	0	.	DP=16;I16=6,9,0,0,597,26215,0,0,900,54000,0,0,211,4117,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,191:7:0	0,9,131:3:0	0,15,150:5:0
-X	2548	.	A	<*>	0	.	DP=16;I16=6,9,0,0,632,28806,0,0,900,54000,0,0,214,4210,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,196:7:0	0,9,131:3:0	0,15,171:5:0
-X	2549	.	G	<*>	0	.	DP=16;I16=6,9,0,0,594,25254,0,0,900,54000,0,0,217,4325,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,180:7:0	0,9,132:3:0	0,15,160:5:0
-X	2550	.	T	<*>	0	.	DP=16;I16=6,9,0,0,572,24134,0,0,900,54000,0,0,219,4413,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,182:7:0	0,9,122:3:0	0,15,148:5:0
-X	2551	.	G	<*>	0	.	DP=16;I16=6,9,0,0,578,24606,0,0,900,54000,0,0,220,4474,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,181:7:0	0,9,131:3:0	0,15,151:5:0
-X	2552	.	A	<*>	0	.	DP=15;I16=6,8,0,0,585,26419,0,0,840,50400,0,0,221,4505,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,178:6:0	0,9,129:3:0	0,15,168:5:0
-X	2553	.	G	<*>	0	.	DP=15;I16=6,8,0,0,528,21944,0,0,840,50400,0,0,222,4554,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,170:6:0	0,9,117:3:0	0,15,142:5:0
-X	2554	.	T	<*>	0	.	DP=15;I16=6,8,0,0,543,23015,0,0,840,50400,0,0,223,4621,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,156:6:0	0,9,129:3:0	0,15,160:5:0
-X	2555	.	C	<*>	0	.	DP=15;I16=6,8,0,0,566,24416,0,0,840,50400,0,0,224,4706,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,173:6:0	0,9,131:3:0	0,15,159:5:0
-X	2556	.	A	<*>	0	.	DP=14;I16=6,7,0,0,487,20095,0,0,780,46800,0,0,226,4808,0,0;QS=3,0;MQSB=0.961166;MQ0F=0	PL:DP:DV	0,15,141:5:0	0,9,125:3:0	0,15,146:5:0
-X	2557	.	C	<*>	0	.	DP=13;I16=5,8,0,0,471,17481,0,0,780,46800,0,0,249,5325,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,15,161:5:0	0,9,96:3:0	0,15,151:5:0
-X	2558	.	T	<*>	0	.	DP=14;I16=5,9,0,0,535,20597,0,0,840,50400,0,0,251,5417,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,173:6:0	0,9,99:3:0	0,15,174:5:0
-X	2559	.	G	<*>	0	.	DP=14;I16=5,9,0,0,509,18693,0,0,840,50400,0,0,253,5475,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,172:6:0	0,9,98:3:0	0,15,156:5:0
-X	2560	.	T	<*>	0	.	DP=14;I16=5,9,0,0,489,17587,0,0,840,50400,0,0,255,5549,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,160:6:0	0,9,106:3:0	0,15,144:5:0
-X	2561	.	C	<*>	0	.	DP=14;I16=5,9,0,0,489,17477,0,0,840,50400,0,0,257,5639,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,164:6:0	0,9,96:3:0	0,15,153:5:0
-X	2562	.	T	<*>	0	.	DP=13;I16=5,8,0,0,460,17016,0,0,780,46800,0,0,260,5744,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,15,139:5:0	0,9,99:3:0	0,15,167:5:0
-X	2563	.	C	<*>	0	.	DP=14;I16=5,8,0,0,433,15133,0,0,780,46800,0,0,263,5863,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,15,149:5:0	0,9,83:3:0	0,15,142:5:0
-X	2564	.	A	G,<*>	0	.	DP=15;I16=1,4,4,5,174,6124,316,11352,300,18000,540,32400,61,1311,184,4034;QS=0.988263,2.01174,0;VDB=0.690812;SGB=-3.20711;RPB=0.197899;MQB=1;MQSB=1;BQB=0.965069;MQ0F=0	PL:DP:DV	88,0,78,98,87,171:6:3	57,0,56,63,62,117:4:2	124,12,0,124,12,124:4:4
-X	2565	.	A	<*>	0	.	DP=15;I16=6,9,0,0,562,21216,0,0,900,54000,0,0,274,6076,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,178:6:0	0,12,134:4:0	0,15,166:5:0
-X	2566	.	A	<*>	0	.	DP=15;I16=6,9,0,0,545,20019,0,0,900,54000,0,0,276,6098,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,181:6:0	0,12,120:4:0	0,15,162:5:0
-X	2567	.	A	<*>	0	.	DP=16;I16=7,9,0,0,580,21342,0,0,960,57600,0,0,278,6136,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,177:6:0	0,15,151:5:0	0,15,166:5:0
-X	2568	.	A	<*>	0	.	DP=16;I16=7,8,0,0,555,20795,0,0,900,54000,0,0,256,5566,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,180:6:0	0,12,132:4:0	0,15,167:5:0
-X	2569	.	A	<*>	0	.	DP=17;I16=7,10,0,0,661,25943,0,0,1020,61200,0,0,284,6264,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,213:7:0	0,15,163:5:0	0,15,172:5:0
-X	2570	.	G	<*>	0	.	DP=18;I16=8,10,0,0,664,24968,0,0,1080,64800,0,0,287,6305,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,213:7:0	0,15,152:5:0	0,18,176:6:0
-X	2571	.	A	<*>	0	.	DP=18;I16=8,10,0,0,618,21870,0,0,1080,64800,0,0,291,6365,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,195:7:0	0,15,155:5:0	0,18,155:6:0
-X	2572	.	A	<*>	0	.	DP=18;I16=8,10,0,0,631,22829,0,0,1080,64800,0,0,295,6445,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,194:7:0	0,15,150:5:0	0,18,173:6:0
-X	2573	.	A	<*>	0	.	DP=18;I16=8,10,0,0,690,26830,0,0,1080,64800,0,0,298,6494,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,210:7:0	0,15,170:5:0	0,18,183:6:0
-X	2574	.	G	<*>	0	.	DP=18;I16=8,10,0,0,664,24884,0,0,1080,64800,0,0,301,6561,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,211:7:0	0,15,152:5:0	0,18,176:6:0
-X	2575	.	G	<*>	0	.	DP=18;I16=8,10,0,0,642,23904,0,0,1080,64800,0,0,305,6645,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,242:8:0	0,15,145:5:0	0,15,140:5:0
-X	2576	.	A	<*>	0	.	DP=18;I16=7,10,0,0,595,21311,0,0,1020,61200,0,0,285,6121,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,210:8:0	0,15,153:5:0	0,12,131:4:0
-X	2577	.	A	<*>	0	.	DP=19;I16=8,10,0,0,682,26398,0,0,1080,64800,0,0,290,6240,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,244:8:0	0,15,161:5:0	0,15,155:5:0
-X	2578	.	G	<*>	0	.	DP=18;I16=9,9,0,0,643,24115,0,0,1080,64800,0,0,322,7002,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,249:8:0	0,12,114:4:0	0,18,161:6:0
-X	2579	.	A	<*>	0	.	DP=18;I16=9,8,0,0,634,23870,0,0,1020,61200,0,0,304,6532,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,229:8:0	0,9,110:3:0	0,18,176:6:0
-X	2580	.	A	<*>	0	.	DP=18;I16=9,9,0,0,629,22593,0,0,1080,64800,0,0,336,7330,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,223:8:0	0,12,117:4:0	0,18,169:6:0
-X	2581	.	A	<*>	0	.	DP=19;I16=10,9,0,0,691,25669,0,0,1140,68400,0,0,343,7521,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,12,133:4:0	0,18,166:6:0
-X	2582	.	T	<*>	0	.	DP=19;I16=10,9,0,0,674,24218,0,0,1140,68400,0,0,350,7682,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,235:9:0	0,12,138:4:0	0,18,168:6:0
-X	2583	.	A	<*>	0	.	DP=19;I16=10,9,0,0,693,25465,0,0,1140,68400,0,0,357,7865,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,247:9:0	0,12,126:4:0	0,18,178:6:0
-X	2584	.	A	<*>	0	.	DP=19;I16=10,9,0,0,702,26340,0,0,1140,68400,0,0,363,8019,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,243:9:0	0,12,134:4:0	0,18,187:6:0
-X	2585	.	A	<*>	0	.	DP=19;I16=9,9,0,0,690,26700,0,0,1080,64800,0,0,350,7818,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,250:9:0	0,9,114:3:0	0,18,190:6:0
-X	2586	.	G	<*>	0	.	DP=19;I16=10,9,0,0,714,27314,0,0,1140,68400,0,0,373,8283,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,12,127:4:0	0,18,176:6:0
-X	2587	.	A	<*>	0	.	DP=20;I16=9,9,0,0,665,24781,0,0,1049,62041,0,0,343,7717,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,137:4:0	0,12,136:4:0
-X	2588	.	A	<*>	0	.	DP=21;I16=12,9,0,0,737,26531,0,0,1229,72841,0,0,384,8620,0,0;QS=3,0;MQSB=0.950149;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,138:4:0	0,18,162:6:0
-X	2589	.	A	<*>	0	.	DP=22;I16=13,9,0,0,780,28412,0,0,1289,76441,0,0,390,8770,0,0;QS=3,0;MQSB=0.955854;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,142:4:0	0,18,170:6:0
-X	2590	.	A	<*>	0	.	DP=22;I16=13,9,0,0,774,28352,0,0,1289,76441,0,0,396,8894,0,0;QS=3,0;MQSB=0.955854;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,135:4:0	0,18,160:6:0
-X	2591	.	C	<*>	0	.	DP=21;I16=13,8,0,0,765,28617,0,0,1229,72841,0,0,403,9041,0,0;QS=3,0;MQSB=0.95891;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,136:4:0	0,15,136:5:0
-X	2592	.	A	<*>	0	.	DP=21;I16=13,8,0,0,763,28325,0,0,1229,72841,0,0,410,9210,0,0;QS=3,0;MQSB=0.95891;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,140:4:0	0,15,139:5:0
-X	2593	.	A	<*>	0	.	DP=21;I16=13,8,0,0,754,27888,0,0,1229,72841,0,0,416,9350,0,0;QS=3,0;MQSB=0.95891;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,141:4:0	0,15,147:5:0
-X	2594	.	A	<*>	0	.	DP=21;I16=13,8,0,0,775,29179,0,0,1229,72841,0,0,422,9510,0,0;QS=3,0;MQSB=0.95891;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,130:4:0	0,15,153:5:0
-X	2595	.	T	<*>	0	.	DP=22;I16=14,8,0,0,766,27472,0,0,1289,76441,0,0,427,9639,0,0;QS=3,0;MQSB=0.963419;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,119:4:0	0,15,143:5:0
-X	2596	.	A	<*>	0	.	DP=22;I16=13,8,0,0,751,27409,0,0,1229,72841,0,0,407,9111,0,0;QS=3,0;MQSB=0.95891;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,123:4:0	0,12,129:4:0
-X	2597	.	A	<*>	0	.	DP=22;I16=14,8,0,0,811,30147,0,0,1289,76441,0,0,437,9851,0,0;QS=3,0;MQSB=0.963419;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,145:4:0	0,15,145:5:0
-X	2598	.	A	<*>	0	.	DP=22;I16=14,8,0,0,817,30915,0,0,1289,76441,0,0,442,9984,0,0;QS=3,0;MQSB=0.963419;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,136:4:0	0,15,159:5:0
-X	2599	.	A	<*>	0	.	DP=22;I16=14,8,0,0,800,29912,0,0,1289,76441,0,0,447,10135,0,0;QS=3,0;MQSB=0.963419;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,126:4:0	0,15,150:5:0
-X	2600	.	A	<*>	0	.	DP=22;I16=14,8,0,0,784,29138,0,0,1289,76441,0,0,451,10255,0,0;QS=3,0;MQSB=0.963419;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,113:4:0	0,15,150:5:0
-X	2601	.	T	<*>	0	.	DP=22;I16=14,8,0,0,770,27820,0,0,1289,76441,0,0,454,10344,0,0;QS=3,0;MQSB=0.963419;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,118:4:0	0,15,142:5:0
-X	2602	.	A	<*>	0	.	DP=23;I16=15,8,0,0,825,29971,0,0,1349,80041,0,0,457,10451,0,0;QS=3,0;MQSB=0.967216;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,143:4:0	0,18,154:6:0
-X	2603	.	A	<*>	0	.	DP=23;I16=15,8,0,0,862,32840,0,0,1349,80041,0,0,460,10526,0,0;QS=3,0;MQSB=0.967216;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,138:4:0	0,18,172:6:0
-X	2604	.	T	<*>	0	.	DP=23;I16=15,8,0,0,822,29902,0,0,1349,80041,0,0,463,10619,0,0;QS=3,0;MQSB=0.967216;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,129:4:0	0,18,154:6:0
-X	2605	.	A	<*>	0	.	DP=23;I16=14,8,0,0,845,32617,0,0,1289,76441,0,0,441,10105,0,0;QS=3,0;MQSB=0.963419;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,143:4:0	0,15,157:5:0
-X	2606	.	G	<*>	0	.	DP=23;I16=14,8,0,0,812,30796,0,0,1289,76441,0,0,444,10234,0,0;QS=3,0;MQSB=0.963419;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,129:4:0	0,15,142:5:0
-X	2607	.	T	<*>	0	.	DP=22;I16=15,7,0,0,782,28440,0,0,1289,76441,0,0,472,10954,0,0;QS=3,0;MQSB=0.970024;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,119:4:0	0,15,132:5:0
-X	2608	.	G	<*>	0	.	DP=22;I16=15,7,0,0,851,33169,0,0,1289,76441,0,0,474,11014,0,0;QS=3,0;MQSB=0.970024;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,132:4:0	0,15,127:5:0
-X	2609	.	C	<*>	0	.	DP=22;I16=15,7,0,0,796,29454,0,0,1289,76441,0,0,475,11041,0,0;QS=3,0;MQSB=0.970024;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,137:4:0	0,15,124:5:0
-X	2610	.	A	<*>	0	.	DP=22;I16=15,7,0,0,830,31684,0,0,1289,76441,0,0,476,11086,0,0;QS=3,0;MQSB=0.970024;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,146:4:0	0,15,121:5:0
-X	2611	.	G	<*>	0	.	DP=22;I16=15,7,0,0,824,32048,0,0,1289,76441,0,0,477,11149,0,0;QS=3,0;MQSB=0.970024;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,129:4:0	0,15,122:5:0
-X	2612	.	A	<*>	0	.	DP=22;I16=14,7,0,0,771,29035,0,0,1229,72841,0,0,453,10605,0,0;QS=3,0;MQSB=0.966484;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,130:4:0	0,12,117:4:0
-X	2613	.	C	<*>	0	.	DP=22;I16=15,7,0,0,832,31926,0,0,1289,76441,0,0,478,11278,0,0;QS=3,0;MQSB=0.970024;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,138:4:0	0,15,120:5:0
-X	2614	.	A	<*>	0	.	DP=21;I16=15,6,0,0,791,30065,0,0,1229,72841,0,0,477,11241,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,110:3:0	0,15,140:5:0
-X	2615	.	A	<*>	0	.	DP=21;I16=15,6,0,0,777,29101,0,0,1229,72841,0,0,475,11167,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,99:3:0	0,15,142:5:0
-X	2616	.	A	<*>	0	.	DP=21;I16=15,6,0,0,734,26922,0,0,1229,72841,0,0,472,11056,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,90:3:0	0,15,144:5:0
-X	2617	.	A	<*>	0	.	DP=21;I16=15,6,0,0,810,31654,0,0,1229,72841,0,0,469,10959,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,95:3:0	0,15,140:5:0
-X	2618	.	G	<*>	0	.	DP=23;I16=16,6,0,0,863,34219,0,0,1289,76441,0,0,441,10251,0,0;QS=3,0;MQSB=0.97584;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,74:2:0	0,15,132:5:0
-X	2619	.	G	<*>	0	.	DP=23;I16=16,6,0,0,807,30109,0,0,1289,76441,0,0,439,10135,0,0;QS=3,0;MQSB=0.97584;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,66:2:0	0,15,127:5:0
-X	2620	.	C	<*>	0	.	DP=23;I16=16,7,0,0,780,28242,0,0,1349,80041,0,0,462,10664,0,0;QS=3,0;MQSB=0.973027;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,87:3:0	0,15,115:5:0
-X	2621	.	C	<*>	0	.	DP=23;I16=16,7,0,0,860,32944,0,0,1349,80041,0,0,459,10537,0,0;QS=3,0;MQSB=0.973027;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,112:3:0	0,15,124:5:0
-X	2622	.	T	<*>	0	.	DP=24;I16=17,7,0,0,908,35474,0,0,1409,83641,0,0,456,10428,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,115:3:0	0,15,134:5:0
-X	2623	.	T	<*>	0	.	DP=24;I16=17,7,0,0,850,30978,0,0,1409,83641,0,0,453,10289,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,114:3:0	0,15,129:5:0
-X	2624	.	G	<*>	0	.	DP=24;I16=17,7,0,0,882,33332,0,0,1409,83641,0,0,450,10172,0,0;QS=3,0;MQSB=0.975597;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,101:3:0	0,15,133:5:0
-X	2625	.	A	<*>	0	.	DP=23;I16=17,6,0,0,855,32593,0,0,1349,80041,0,0,448,10076,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,114:3:0	0,15,135:5:0
-X	2626	.	C	<*>	0	.	DP=23;I16=17,6,0,0,847,31625,0,0,1349,80041,0,0,446,10000,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,100:3:0	0,15,122:5:0
-X	2627	.	C	<*>	0	.	DP=23;I16=17,6,0,0,863,32865,0,0,1349,80041,0,0,444,9944,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,104:3:0	0,15,129:5:0
-X	2628	.	C	<*>	0	.	DP=24;I16=17,6,0,0,793,28559,0,0,1349,80041,0,0,431,9757,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,95:3:0	0,15,127:5:0
-X	2629	.	A	<*>	0	.	DP=24;I16=18,6,0,0,893,33537,0,0,1409,83641,0,0,439,9789,0,0;QS=3,0;MQSB=0.980199;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,101:3:0	0,18,148:6:0
-X	2630	.	T	<*>	0	.	DP=24;I16=17,6,0,0,836,31094,0,0,1380,82800,0,0,412,9116,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,112:3:0	0,18,140:6:0
-X	2631	.	C	<*>	0	.	DP=24;I16=18,6,0,0,900,34378,0,0,1409,83641,0,0,435,9713,0,0;QS=3,0;MQSB=0.980199;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,104:3:0	0,18,142:6:0
-X	2632	.	T	<*>	0	.	DP=24;I16=18,6,0,0,937,37097,0,0,1409,83641,0,0,433,9705,0,0;QS=3,0;MQSB=0.980199;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,113:3:0	0,18,164:6:0
-X	2633	.	A	<*>	0	.	DP=23;I16=18,5,0,0,801,28913,0,0,1349,80041,0,0,431,9667,0,0;QS=3,0;MQSB=0.982789;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,95:3:0	0,18,148:6:0
-X	2634	.	G	<*>	0	.	DP=23;I16=19,3,0,0,861,34125,0,0,1289,76441,0,0,405,9023,0,0;QS=3,0;MQSB=0.989755;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,74:2:0	0,18,149:6:0
-X	2635	.	C	<*>	0	.	DP=23;I16=19,4,0,0,848,32154,0,0,1349,80041,0,0,429,9599,0,0;QS=3,0;MQSB=0.986928;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,107:3:0	0,18,148:6:0
-X	2636	.	T	<*>	0	.	DP=24;I16=19,4,0,0,871,33973,0,0,1349,80041,0,0,428,9572,0,0;QS=3,0;MQSB=0.986928;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,98:3:0	0,18,160:6:0
-X	2637	.	T	<*>	0	.	DP=24;I16=19,5,0,0,871,32073,0,0,1409,83641,0,0,428,9568,0,0;QS=3,0;MQSB=0.984335;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,111:3:0	0,18,144:6:0
-X	2638	.	T	<*>	0	.	DP=24;I16=19,5,0,0,821,28851,0,0,1409,83641,0,0,428,9588,0,0;QS=3,0;MQSB=0.984335;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,103:3:0	0,18,135:6:0
-X	2639	.	G	<*>	0	.	DP=24;I16=18,6,0,0,842,30840,0,0,1409,83641,0,0,428,9582,0,0;QS=3,0;MQSB=0.980199;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,106:3:0	0,15,125:5:0
-X	2640	.	G	<*>	0	.	DP=24;I16=17,6,0,0,749,25957,0,0,1380,82800,0,0,404,8976,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,84:3:0	0,15,117:5:0
-X	2641	.	C	<*>	0	.	DP=23;I16=17,6,0,0,834,31792,0,0,1349,80041,0,0,431,9645,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,61:2:0	0,15,129:5:0
-X	2642	.	C	<*>	0	.	DP=23;I16=17,6,0,0,809,30033,0,0,1349,80041,0,0,433,9713,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,58:2:0	0,15,131:5:0
-X	2643	.	C	<*>	0	.	DP=23;I16=17,6,0,0,856,33004,0,0,1349,80041,0,0,434,9756,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,57:2:0	0,15,133:5:0
-X	2644	.	T	<*>	0	.	DP=22;I16=16,5,0,0,805,31419,0,0,1229,72841,0,0,428,9648,0,0;QS=3,0;MQSB=0.978919;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,73:2:0	0,15,143:5:0
-X	2645	.	C	<*>	0	.	DP=22;I16=15,6,0,0,823,32499,0,0,1229,72841,0,0,415,9323,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,78:2:0	0,12,122:4:0
-X	2646	.	A	<*>	0	.	DP=22;I16=16,6,0,0,826,31566,0,0,1289,76441,0,0,430,9524,0,0;QS=3,0;MQSB=0.97584;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,79:2:0	0,15,129:5:0
-X	2647	.	G	<*>	0	.	DP=22;I16=16,6,0,0,803,30643,0,0,1289,76441,0,0,428,9460,0,0;QS=3,0;MQSB=0.97584;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,77:2:0	0,15,129:5:0
-X	2648	.	C	<*>	0	.	DP=21;I16=15,6,0,0,811,31709,0,0,1229,72841,0,0,426,9368,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,80:2:0	0,12,118:4:0
-X	2649	.	A	<*>	0	.	DP=23;I16=16,6,0,0,789,29215,0,0,1258,73682,0,0,414,9196,0,0;QS=3,0;MQSB=0.934321;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,93:3:0	0,12,105:4:0
-X	2650	.	T	<*>	0	.	DP=23;I16=16,7,0,0,856,32340,0,0,1318,77282,0,0,423,9197,0,0;QS=3,0;MQSB=0.955805;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,103:3:0	0,12,118:4:0
-X	2651	.	C	<*>	0	.	DP=23;I16=16,7,0,0,871,33599,0,0,1318,77282,0,0,422,9124,0,0;QS=3,0;MQSB=0.955805;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,95:3:0	0,12,121:4:0
-X	2652	.	A	<*>	0	.	DP=23;I16=16,7,0,0,820,30324,0,0,1318,77282,0,0,421,9077,0,0;QS=3,0;MQSB=0.955805;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,87:3:0	0,12,126:4:0
-X	2653	.	A	<*>	0	.	DP=23;I16=15,6,0,0,759,28489,0,0,1198,70082,0,0,389,8395,0,0;QS=3,0;MQSB=0.940481;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,73:2:0	0,9,109:3:0
-X	2654	.	C	<*>	0	.	DP=23;I16=16,7,0,0,836,31006,0,0,1318,77282,0,0,393,8385,0,0;QS=3,0;MQSB=0.955805;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,9,88:3:0	0,9,99:3:0
-X	2655	.	C	<*>	0	.	DP=23;I16=16,7,0,0,774,27190,0,0,1318,77282,0,0,392,8364,0,0;QS=3,0;MQSB=0.955805;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,9,83:3:0	0,9,95:3:0
-X	2656	.	G	<*>	0	.	DP=24;I16=17,7,0,0,781,25689,0,0,1378,80882,0,0,390,8320,0,0;QS=3,0;MQSB=0.95083;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,116:4:0	0,9,74:3:0
-X	2657	.	C	<*>	0	.	DP=24;I16=17,6,0,0,871,33435,0,0,1349,80041,0,0,381,8241,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,9,98:3:0	0,9,99:3:0
-X	2658	.	T	<*>	0	.	DP=23;I16=17,6,0,0,897,35255,0,0,1318,77282,0,0,389,8319,0,0;QS=3,0;MQSB=0.92854;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,133:4:0	0,9,107:3:0
-X	2659	.	A	<*>	0	.	DP=23;I16=17,6,0,0,817,29729,0,0,1318,77282,0,0,389,8361,0,0;QS=3,0;MQSB=0.92854;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,120:4:0	0,9,93:3:0
-X	2660	.	G	<*>	0	.	DP=23;I16=17,6,0,0,900,35462,0,0,1318,77282,0,0,389,8379,0,0;QS=3,0;MQSB=0.92854;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,126:4:0	0,9,94:3:0
-X	2661	.	A	<*>	0	.	DP=24;I16=18,6,0,0,871,32185,0,0,1378,80882,0,0,390,8422,0,0;QS=3,0;MQSB=0.923116;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,127:4:0	0,9,104:3:0
-X	2662	.	T	<*>	0	.	DP=24;I16=17,6,0,0,836,30812,0,0,1349,80041,0,0,366,7816,0,0;QS=3,0;MQSB=0.83771;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,122:4:0	0,9,99:3:0
-X	2663	.	A	<*>	0	.	DP=24;I16=17,6,0,0,827,30583,0,0,1318,77282,0,0,389,8341,0,0;QS=3,0;MQSB=0.92854;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,104:4:0	0,9,101:3:0
-X	2664	.	C	<*>	0	.	DP=23;I16=17,6,0,0,787,28083,0,0,1318,77282,0,0,388,8270,0,0;QS=3,0;MQSB=0.92854;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,107:4:0	0,9,91:3:0
-X	2665	.	G	<*>	0	.	DP=23;I16=17,6,0,0,728,23290,0,0,1318,77282,0,0,386,8178,0,0;QS=3,0;MQSB=0.92854;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,112:4:0	0,9,78:3:0
-X	2666	.	T	<*>	0	.	DP=23;I16=17,5,0,0,799,29273,0,0,1289,76441,0,0,367,7825,0,0;QS=3,0;MQSB=0.981001;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,105:3:0	0,9,94:3:0
-X	2667	.	C	<*>	0	.	DP=23;I16=16,5,0,0,792,30190,0,0,1260,75600,0,0,345,7393,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,96:3:0	0,9,98:3:0
-X	2668	.	C	<*>	0	.	DP=24;I16=18,6,0,0,832,29692,0,0,1378,80882,0,0,381,8069,0,0;QS=3,0;MQSB=0.923116;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,107:4:0	0,9,95:3:0
-X	2669	.	C	<*>	0	.	DP=23;I16=18,5,0,0,829,30953,0,0,1318,77282,0,0,383,8087,0,0;QS=3,0;MQSB=0.889264;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,120:4:0	0,9,88:3:0
-X	2670	.	T	<*>	0	.	DP=23;I16=17,5,0,0,841,32669,0,0,1289,76441,0,0,368,7828,0,0;QS=3,0;MQSB=0.801124;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,131:4:0	0,9,100:3:0
-X	2671	.	C	<*>	0	.	DP=22;I16=17,5,0,0,842,32448,0,0,1258,73682,0,0,386,8110,0,0;QS=3,0;MQSB=0.895399;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,128:4:0	0,6,70:2:0
-X	2672	.	C	<*>	0	.	DP=22;I16=17,5,0,0,808,30180,0,0,1258,73682,0,0,388,8164,0,0;QS=3,0;MQSB=0.895399;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,129:4:0	0,6,75:2:0
-X	2673	.	C	<*>	0	.	DP=22;I16=17,5,0,0,842,32528,0,0,1258,73682,0,0,390,8246,0,0;QS=3,0;MQSB=0.895399;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,133:4:0	0,6,75:2:0
-X	2674	.	T	<*>	0	.	DP=23;I16=17,6,0,0,860,33242,0,0,1318,77282,0,0,392,8356,0,0;QS=3,0;MQSB=0.92854;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,142:4:0	0,6,79:2:0
-X	2675	.	T	<*>	0	.	DP=22;I16=16,6,0,0,756,26986,0,0,1258,73682,0,0,394,8392,0,0;QS=3,0;MQSB=0.934321;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,134:4:0	0,6,74:2:0
-X	2676	.	T	<*>	0	.	DP=22;I16=16,6,0,0,774,28022,0,0,1258,73682,0,0,396,8452,0,0;QS=3,0;MQSB=0.934321;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,135:4:0	0,6,75:2:0
-X	2677	.	C	<*>	0	.	DP=22;I16=16,6,0,0,866,34444,0,0,1258,73682,0,0,398,8536,0,0;QS=3,0;MQSB=0.934321;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,131:4:0	0,6,77:2:0
-X	2678	.	T	<*>	0	.	DP=22;I16=16,5,0,0,818,32216,0,0,1229,72841,0,0,374,7970,0,0;QS=3,0;MQSB=0.978919;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,111:3:0	0,6,80:2:0
-X	2679	.	T	<*>	0	.	DP=22;I16=16,6,0,0,808,29912,0,0,1258,73682,0,0,400,8680,0,0;QS=3,0;MQSB=0.934321;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,137:4:0	0,6,75:2:0
-X	2680	.	C	<*>	0	.	DP=23;I16=16,7,0,0,873,33605,0,0,1318,77282,0,0,400,8740,0,0;QS=3,0;MQSB=0.955805;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,131:4:0	0,6,70:2:0
-X	2681	.	T	<*>	0	.	DP=22;I16=15,7,0,0,820,31248,0,0,1258,73682,0,0,402,8824,0,0;QS=3,0;MQSB=0.961028;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,133:4:0	0,6,75:2:0
-X	2682	.	G	<*>	0	.	DP=22;I16=15,7,0,0,831,31865,0,0,1258,73682,0,0,403,8881,0,0;QS=3,0;MQSB=0.961028;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,135:4:0	0,6,64:2:0
-X	2683	.	G	<*>	0	.	DP=22;I16=13,6,0,0,702,26368,0,0,1109,65641,0,0,394,8926,0,0;QS=3,0;MQSB=0.850016;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,136:4:0	0,6,53:2:0
-X	2684	.	G	<*>	0	.	DP=22;I16=14,7,0,0,754,27678,0,0,1229,72841,0,0,403,9057,0,0;QS=3,0;MQSB=0.872525;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,128:4:0	0,6,62:2:0
-X	2685	.	G	<*>	0	.	DP=22;I16=15,7,0,0,736,25916,0,0,1258,73682,0,0,406,9184,0,0;QS=3,0;MQSB=0.961028;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,130:4:0	0,6,45:2:0
-X	2686	.	C	<*>	0	.	DP=22;I16=15,7,0,0,803,29933,0,0,1258,73682,0,0,406,9278,0,0;QS=3,0;MQSB=0.961028;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,134:4:0	0,6,68:2:0
-X	2687	.	A	<*>	0	.	DP=21;I16=13,7,0,0,716,26356,0,0,1169,69241,0,0,406,9340,0,0;QS=3,0;MQSB=0.875769;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,136:4:0	0,6,61:2:0
-X	2688	.	C	<*>	0	.	DP=20;I16=13,7,0,0,750,28308,0,0,1169,69241,0,0,407,9417,0,0;QS=3,0;MQSB=0.875769;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,134:4:0	0,6,66:2:0
-X	2689	.	A	<*>	0	.	DP=19;I16=12,7,0,0,741,29105,0,0,1109,65641,0,0,409,9507,0,0;QS=3,0;MQSB=0.879351;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,140:4:0	0,6,73:2:0
-X	2690	.	G	<*>	0	.	DP=20;I16=12,8,0,0,751,28929,0,0,1169,69241,0,0,411,9609,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,135:4:0	0,6,61:2:0
-X	2691	.	G	<*>	0	.	DP=20;I16=12,7,0,0,682,25006,0,0,1109,65641,0,0,403,9603,0,0;QS=3,0;MQSB=0.879351;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,132:4:0	0,6,63:2:0
-X	2692	.	T	<*>	0	.	DP=20;I16=12,8,0,0,648,21758,0,0,1169,69241,0,0,417,9853,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,125:4:0	0,6,72:2:0
-X	2693	.	C	<*>	0	.	DP=20;I16=12,8,0,0,779,30645,0,0,1169,69241,0,0,418,9898,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,130:4:0	0,6,70:2:0
-X	2694	.	A	<*>	0	.	DP=21;I16=13,8,0,0,723,25649,0,0,1229,72841,0,0,417,9859,0,0;QS=3,0;MQSB=0.895122;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,126:4:0	0,6,73:2:0
-X	2695	.	C	<*>	0	.	DP=20;I16=12,8,0,0,757,28835,0,0,1169,69241,0,0,418,9834,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,130:4:0	0,6,63:2:0
-X	2696	.	A	<*>	0	.	DP=20;I16=12,8,0,0,733,27357,0,0,1169,69241,0,0,419,9823,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,130:4:0	0,6,69:2:0
-X	2697	.	C	<*>	0	.	DP=20;I16=12,8,0,0,738,27604,0,0,1169,69241,0,0,419,9777,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,128:4:0	0,6,66:2:0
-X	2698	.	T	<*>	0	.	DP=21;I16=12,8,0,0,788,31268,0,0,1169,69241,0,0,419,9747,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,144:4:0	0,6,77:2:0
-X	2699	.	C	<*>	0	.	DP=22;I16=13,9,0,0,864,34148,0,0,1258,73682,0,0,443,10309,0,0;QS=3,0;MQSB=0.686045;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,135:4:0	0,9,98:3:0
-X	2700	.	T	<*>	0	.	DP=22;I16=13,9,0,0,850,33296,0,0,1258,73682,0,0,444,10310,0,0;QS=3,0;MQSB=0.686045;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,141:4:0	0,9,105:3:0
-X	2701	.	C	<*>	0	.	DP=22;I16=13,9,0,0,863,34157,0,0,1258,73682,0,0,444,10278,0,0;QS=3,0;MQSB=0.686045;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,140:4:0	0,9,94:3:0
-X	2702	.	T	<*>	0	.	DP=22;I16=13,9,0,0,837,32525,0,0,1258,73682,0,0,444,10262,0,0;QS=3,0;MQSB=0.686045;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,143:4:0	0,9,83:3:0
-X	2703	.	T	<*>	0	.	DP=21;I16=12,8,0,0,717,25881,0,0,1169,69241,0,0,420,9636,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,130:4:0	0,3,32:1:0
-X	2704	.	C	<*>	0	.	DP=21;I16=12,9,0,0,794,30766,0,0,1198,70082,0,0,445,10225,0,0;QS=3,0;MQSB=0.695144;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,137:4:0	0,6,55:2:0
-X	2705	.	C	<*>	0	.	DP=21;I16=12,9,0,0,809,31649,0,0,1198,70082,0,0,445,10205,0,0;QS=3,0;MQSB=0.695144;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,136:4:0	0,6,56:2:0
-X	2706	.	A	<*>	0	.	DP=22;I16=12,10,0,0,820,31386,0,0,1258,73682,0,0,444,10150,0,0;QS=3,0;MQSB=0.731218;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,141:4:0	0,6,70:2:0
-X	2707	.	G	<*>	0	.	DP=22;I16=12,10,0,0,832,32104,0,0,1258,73682,0,0,444,10110,0,0;QS=3,0;MQSB=0.731218;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,139:4:0	0,6,60:2:0
-X	2708	.	G	<*>	0	.	DP=22;I16=12,10,0,0,777,28329,0,0,1258,73682,0,0,444,10086,0,0;QS=3,0;MQSB=0.731218;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,136:4:0	0,6,57:2:0
-X	2709	.	T	<*>	0	.	DP=22;I16=12,9,0,0,761,28341,0,0,1229,72841,0,0,418,9404,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,137:4:0	0,3,39:1:0
-X	2710	.	C	<*>	0	.	DP=23;I16=12,10,0,0,840,32478,0,0,1289,76441,0,0,417,9365,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,134:4:0	0,3,38:1:0
-X	2711	.	T	<*>	0	.	DP=24;I16=13,11,0,0,893,33721,0,0,1378,80882,0,0,442,9970,0,0;QS=3,0;MQSB=0.75304;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,12,138:4:0	0,6,72:2:0
-X	2712	.	A	<*>	0	.	DP=24;I16=13,11,0,0,889,33333,0,0,1378,80882,0,0,443,9971,0,0;QS=3,0;MQSB=0.75304;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,12,141:4:0	0,6,65:2:0
-X	2713	.	G	T,<*>	0	.	DP=25;I16=13,11,0,1,915,35485,14,196,1378,80882,29,841,419,9369,25,625;QS=2.72549,0.27451,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.569783;BQB=1;MQ0F=0	PL:DP:DV	0,57,255,57,255,255:19:0	0,12,131,12,131,131:4:0	8,0,31,11,34,42:2:1
-X	2714	.	G	<*>	0	.	DP=25;I16=13,11,0,0,891,33457,0,0,1378,80882,0,0,444,9990,0,0;QS=3,0;MQSB=0.75304;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,12,132:4:0	0,6,64:2:0
-X	2715	.	A	<*>	0	.	DP=25;I16=13,12,0,0,888,32012,0,0,1407,81723,0,0,446,10014,0,0;QS=3,0;MQSB=0.569783;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,12,135:4:0	0,6,63:2:0
-X	2716	.	T	<*>	0	.	DP=26;I16=13,13,0,0,937,34241,0,0,1467,85323,0,0,446,10012,0,0;QS=3,0;MQSB=0.606531;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,12,134:4:0	0,9,90:3:0
-X	2717	.	G	<*>	0	.	DP=26;I16=13,12,0,0,939,35995,0,0,1438,84482,0,0,422,9410,0,0;QS=3,0;MQSB=0.778801;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,12,134:4:0	0,6,72:2:0
-X	2718	.	C	<*>	0	.	DP=24;I16=12,11,0,0,864,33118,0,0,1318,77282,0,0,425,9457,0,0;QS=3,0;MQSB=0.7613;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,130:4:0	0,6,65:2:0
-X	2719	.	A	<*>	0	.	DP=24;I16=12,12,0,0,911,35371,0,0,1347,78123,0,0,452,10102,0,0;QS=3,0;MQSB=0.582748;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,139:4:0	0,9,99:3:0
-X	2720	.	G	<*>	0	.	DP=24;I16=12,12,0,0,940,37044,0,0,1347,78123,0,0,453,10095,0,0;QS=3,0;MQSB=0.582748;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,136:4:0	0,9,97:3:0
-X	2721	.	C	<*>	0	.	DP=24;I16=12,11,0,0,881,34499,0,0,1318,77282,0,0,429,9485,0,0;QS=3,0;MQSB=0.7613;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,131:4:0	0,6,76:2:0
-X	2722	.	T	<*>	0	.	DP=24;I16=11,13,0,0,898,34310,0,0,1347,78123,0,0,456,10146,0,0;QS=3,0;MQSB=0.633229;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,156:5:0	0,9,98:3:0
-X	2723	.	G	<*>	0	.	DP=25;I16=12,13,0,0,941,36257,0,0,1407,81723,0,0,459,10203,0,0;QS=3,0;MQSB=0.619223;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,184:6:0	0,9,76:3:0
-X	2724	.	A	<*>	0	.	DP=25;I16=12,13,0,0,917,34211,0,0,1407,81723,0,0,462,10234,0,0;QS=3,0;MQSB=0.619223;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,188:6:0	0,9,84:3:0
-X	2725	.	G	<*>	0	.	DP=25;I16=12,12,0,0,916,35656,0,0,1378,80882,0,0,438,9566,0,0;QS=3,0;MQSB=0.786628;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,185:6:0	0,6,67:2:0
-X	2726	.	G	<*>	0	.	DP=25;I16=11,12,0,0,841,31809,0,0,1287,74523,0,0,437,9545,0,0;QS=3,0;MQSB=0.597127;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,186:6:0	0,6,46:2:0
-X	2727	.	G	<*>	0	.	DP=25;I16=12,13,0,0,889,32233,0,0,1407,81723,0,0,464,10182,0,0;QS=3,0;MQSB=0.619223;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,194:7:0	0,6,56:2:0
-X	2728	.	G	<*>	0	.	DP=25;I16=12,13,0,0,883,32287,0,0,1407,81723,0,0,467,10219,0,0;QS=3,0;MQSB=0.619223;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,189:7:0	0,6,50:2:0
-X	2729	.	T	<*>	0	.	DP=25;I16=12,13,0,0,871,31019,0,0,1407,81723,0,0,469,10233,0,0;QS=3,0;MQSB=0.619223;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,189:7:0	0,6,62:2:0
-X	2730	.	G	<*>	0	.	DP=25;I16=12,13,0,0,907,34299,0,0,1407,81723,0,0,471,10275,0,0;QS=3,0;MQSB=0.619223;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,192:7:0	0,6,49:2:0
-X	2731	.	C	<*>	0	.	DP=25;I16=12,13,0,0,893,33027,0,0,1407,81723,0,0,473,10345,0,0;QS=3,0;MQSB=0.619223;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,192:7:0	0,6,52:2:0
-X	2732	.	C	<*>	0	.	DP=25;I16=12,13,0,0,882,32170,0,0,1407,81723,0,0,473,10343,0,0;QS=3,0;MQSB=0.619223;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,195:7:0	0,6,38:2:0
-X	2733	.	C	A,<*>	0	.	DP=25;I16=12,12,0,1,835,30063,13,169,1378,80882,29,841,448,9744,25,625;QS=2.64865,0.351351,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.619223;BQB=1;MQ0F=0	PL:DP:DV	0,48,255,48,255,255:16:0	0,21,187,21,187,187:7:0	7,0,18,10,21,28:2:1
-X	2734	.	C	<*>	0	.	DP=25;I16=12,12,0,0,890,33726,0,0,1378,80882,0,0,449,9797,0,0;QS=3,0;MQSB=0.786628;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,208:8:0	0,3,39:1:0
-X	2735	.	T	<*>	0	.	DP=26;I16=13,12,0,0,955,36875,0,0,1438,84482,0,0,451,9877,0,0;QS=3,0;MQSB=0.778801;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,228:8:0	0,3,41:1:0
-X	2736	.	C	<*>	0	.	DP=26;I16=13,11,0,0,921,35553,0,0,1409,83641,0,0,428,9308,0,0;QS=3,0;MQSB=0.931547;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,220:8:0	0,3,33:1:0
-X	2737	.	T	<*>	0	.	DP=26;I16=13,13,0,0,967,36581,0,0,1467,85323,0,0,475,10403,0,0;QS=3,0;MQSB=0.606531;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,228:8:0	0,6,64:2:0
-X	2738	.	T	<*>	0	.	DP=26;I16=13,13,0,0,895,31873,0,0,1467,85323,0,0,474,10374,0,0;QS=3,0;MQSB=0.606531;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,201:8:0	0,6,47:2:0
-X	2739	.	A	<*>	0	.	DP=26;I16=13,12,0,0,871,31051,0,0,1407,81723,0,0,448,9698,0,0;QS=3,0;MQSB=0.569783;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,224:8:0	0,9,78:3:0
-X	2740	.	C	<*>	0	.	DP=26;I16=14,11,0,0,952,36456,0,0,1438,84482,0,0,448,9674,0,0;QS=3,0;MQSB=0.745495;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,216:8:0	0,6,71:2:0
-X	2741	.	C	<*>	0	.	DP=26;I16=14,11,0,0,945,36141,0,0,1438,84482,0,0,448,9678,0,0;QS=3,0;MQSB=0.745495;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,24,215:8:0	0,6,75:2:0
-X	2742	.	A	<*>	0	.	DP=27;I16=15,12,0,0,949,34263,0,0,1527,88923,0,0,472,10284,0,0;QS=3,0;MQSB=0.547344;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,27,230:9:0	0,9,92:3:0
-X	2743	.	T	<*>	0	.	DP=27;I16=15,12,0,0,955,34479,0,0,1527,88923,0,0,471,10243,0,0;QS=3,0;MQSB=0.547344;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,27,224:9:0	0,9,99:3:0
-X	2744	.	C	<*>	0	.	DP=26;I16=15,10,0,0,955,36951,0,0,1438,84482,0,0,445,9557,0,0;QS=3,0;MQSB=0.707404;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,234:9:0	0,6,76:2:0
-X	2745	.	T	<*>	0	.	DP=26;I16=15,11,0,0,962,36786,0,0,1467,85323,0,0,469,10151,0,0;QS=3,0;MQSB=0.505697;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,243:9:0	0,9,104:3:0
-X	2746	.	A	<*>	0	.	DP=26;I16=15,10,0,0,912,33536,0,0,1438,84482,0,0,443,9525,0,0;QS=3,0;MQSB=0.707404;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,235:9:0	0,6,78:2:0
-X	2747	.	A	<*>	0	.	DP=26;I16=15,11,0,0,945,35117,0,0,1467,85323,0,0,467,10179,0,0;QS=3,0;MQSB=0.505697;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,238:9:0	0,9,96:3:0
-X	2748	.	T	<*>	0	.	DP=27;I16=15,12,0,0,1005,37901,0,0,1527,88923,0,0,465,10187,0,0;QS=3,0;MQSB=0.547344;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,27,246:9:0	0,9,103:3:0
-X	2749	.	C	<*>	0	.	DP=26;I16=14,12,0,0,975,37353,0,0,1467,85323,0,0,463,10123,0,0;QS=3,0;MQSB=0.558035;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,232:9:0	0,9,98:3:0
-X	2750	.	T	<*>	0	.	DP=26;I16=15,11,0,0,982,37714,0,0,1498,88082,0,0,462,10086,0,0;QS=3,0;MQSB=0.738577;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,227:8:0	0,12,130:4:0
-X	2751	.	G	<*>	0	.	DP=26;I16=15,10,0,0,945,36031,0,0,1469,87241,0,0,437,9451,0,0;QS=3,0;MQSB=0.9171;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,205:8:0	0,9,103:3:0
-X	2752	.	T	<*>	0	.	DP=26;I16=15,11,0,0,870,30288,0,0,1498,88082,0,0,460,9998,0,0;QS=3,0;MQSB=0.738577;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,189:8:0	0,12,119:4:0
-X	2753	.	G	<*>	0	.	DP=26;I16=15,11,0,0,867,30913,0,0,1498,88082,0,0,458,9948,0,0;QS=3,0;MQSB=0.738577;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,202:8:0	0,12,116:4:0
-X	2754	.	C	<*>	0	.	DP=25;I16=14,10,0,0,873,32607,0,0,1409,83641,0,0,436,9484,0,0;QS=3,0;MQSB=0.919431;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,24,205:8:0	0,9,104:3:0
-X	2755	.	C	<*>	0	.	DP=25;I16=14,10,0,0,865,32243,0,0,1409,83641,0,0,436,9528,0,0;QS=3,0;MQSB=0.919431;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,24,209:8:0	0,9,97:3:0
-X	2756	.	C	<*>	0	.	DP=25;I16=14,9,0,0,838,31276,0,0,1380,82800,0,0,411,8971,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,204:8:0	0,9,97:3:0
-X	2757	.	T	<*>	0	.	DP=25;I16=14,11,0,0,904,33980,0,0,1438,84482,0,0,455,10011,0,0;QS=3,0;MQSB=0.745495;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,212:7:0	0,15,147:5:0
-X	2758	.	T	<*>	0	.	DP=25;I16=14,10,0,0,841,30293,0,0,1409,83641,0,0,439,9801,0,0;QS=3,0;MQSB=0.919431;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,195:7:0	0,12,133:4:0
-X	2759	.	A	<*>	0	.	DP=25;I16=14,11,0,0,884,31728,0,0,1438,84482,0,0,457,10195,0,0;QS=3,0;MQSB=0.745495;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,192:7:0	0,15,147:5:0
-X	2760	.	T	<*>	0	.	DP=25;I16=14,11,0,0,907,33965,0,0,1438,84482,0,0,457,10275,0,0;QS=3,0;MQSB=0.745495;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,204:7:0	0,15,150:5:0
-X	2761	.	T	<*>	0	.	DP=23;I16=13,9,0,0,838,32530,0,0,1289,76441,0,0,444,10130,0,0;QS=3,0;MQSB=0.910098;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,185:6:0	0,12,141:4:0
-X	2762	.	T	<*>	0	.	DP=24;I16=13,11,0,0,869,32261,0,0,1378,80882,0,0,459,10395,0,0;QS=3,0;MQSB=0.75304;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,178:6:0	0,18,177:6:0
-X	2763	.	C	A,<*>	0	.	DP=24;I16=13,10,0,1,843,31711,13,169,1349,80041,29,841,448,10290,12,144;QS=2.93333,0.0666667,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.75304;BQB=1;MQ0F=0	PL:DP:DV	0,36,255,36,255,255:12:0	0,18,170,18,170,170:6:0	0,5,147,15,150,153:6:1
-X	2764	.	C	<*>	0	.	DP=24;I16=13,10,0,0,854,32376,0,0,1349,80041,0,0,450,10374,0,0;QS=3,0;MQSB=0.921963;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,163:6:0	0,15,162:5:0
-X	2765	.	T	<*>	0	.	DP=24;I16=12,11,0,0,853,32173,0,0,1318,77282,0,0,457,10469,0,0;QS=3,0;MQSB=0.7613;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,154:5:0	0,18,189:6:0
-X	2766	.	C	<*>	0	.	DP=24;I16=12,11,0,0,887,34485,0,0,1349,80041,0,0,448,10398,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,160:5:0	0,18,186:6:0
-X	2767	.	T	<*>	0	.	DP=24;I16=12,12,0,0,905,34757,0,0,1378,80882,0,0,458,10510,0,0;QS=3,0;MQSB=0.786628;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,153:5:0	0,21,217:7:0
-X	2768	.	G	<*>	0	.	DP=23;I16=11,11,0,0,852,33258,0,0,1289,76441,0,0,452,10462,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,141:5:0	0,18,197:6:0
-X	2769	.	C	<*>	0	.	DP=23;I16=11,12,0,0,832,31390,0,0,1318,77282,0,0,459,10481,0,0;QS=3,0;MQSB=0.795196;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,142:5:0	0,21,202:7:0
-X	2770	.	T	<*>	0	.	DP=23;I16=11,12,0,0,828,30854,0,0,1318,77282,0,0,459,10471,0,0;QS=3,0;MQSB=0.795196;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,152:5:0	0,21,199:7:0
-X	2771	.	T	<*>	0	.	DP=23;I16=11,11,0,0,817,30957,0,0,1258,73682,0,0,454,10456,0,0;QS=3,0;MQSB=0.770381;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,154:5:0	0,18,198:6:0
-X	2772	.	T	<*>	0	.	DP=23;I16=11,12,0,0,856,32206,0,0,1318,77282,0,0,459,10511,0,0;QS=3,0;MQSB=0.795196;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,160:5:0	0,21,210:7:0
-X	2773	.	A	<*>	0	.	DP=23;I16=11,12,0,0,828,30664,0,0,1318,77282,0,0,459,10561,0,0;QS=3,0;MQSB=0.795196;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,140:5:0	0,21,209:7:0
-X	2774	.	G	<*>	0	.	DP=22;I16=11,11,0,0,843,32715,0,0,1258,73682,0,0,458,10530,0,0;QS=3,0;MQSB=0.770381;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,154:5:0	0,21,207:7:0
-X	2775	.	T	<*>	0	.	DP=22;I16=10,11,0,0,748,27720,0,0,1198,70082,0,0,432,9892,0,0;QS=3,0;MQSB=0.780412;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,12,115:4:0	0,21,203:7:0
-X	2776	.	G	<*>	0	.	DP=22;I16=12,10,0,0,803,30251,0,0,1289,76441,0,0,456,10470,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,135:5:0	0,21,210:7:0
-X	2777	.	A	<*>	0	.	DP=22;I16=12,10,0,0,852,33524,0,0,1289,76441,0,0,456,10438,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,148:5:0	0,21,220:7:0
-X	2778	.	G	<*>	0	.	DP=23;I16=12,11,0,0,861,33049,0,0,1349,80041,0,0,456,10422,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,154:5:0	0,21,224:7:0
-X	2779	.	G	<*>	0	.	DP=23;I16=11,11,0,0,834,32014,0,0,1289,76441,0,0,432,9798,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,136:4:0	0,21,219:7:0
-X	2780	.	A	<*>	0	.	DP=23;I16=11,11,0,0,792,29162,0,0,1289,76441,0,0,433,9817,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,33,244:11:0	0,12,133:4:0	0,21,215:7:0
-X	2781	.	A	<*>	0	.	DP=23;I16=11,11,0,0,844,33092,0,0,1289,76441,0,0,441,10141,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,15,151:5:0	0,21,233:7:0
-X	2782	.	G	<*>	0	.	DP=23;I16=12,11,0,0,840,31826,0,0,1349,80041,0,0,458,10438,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,154:5:0	0,21,218:7:0
-X	2783	.	A	<*>	0	.	DP=23;I16=11,11,0,0,860,33888,0,0,1289,76441,0,0,432,9790,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,142:4:0	0,21,230:7:0
-X	2784	.	G	<*>	0	.	DP=23;I16=12,11,0,0,860,33092,0,0,1349,80041,0,0,456,10410,0,0;QS=3,0;MQSB=0.934091;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,143:5:0	0,21,212:7:0
-X	2785	.	G	<*>	0	.	DP=23;I16=11,11,0,0,797,29747,0,0,1289,76441,0,0,429,9749,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,134:4:0	0,21,204:7:0
-X	2786	.	C	<*>	0	.	DP=24;I16=12,12,0,0,831,29497,0,0,1409,83641,0,0,451,10309,0,0;QS=3,0;MQSB=0.941765;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,141:5:0	0,21,199:7:0
-X	2787	.	C	<*>	0	.	DP=24;I16=11,12,0,0,792,28454,0,0,1349,80041,0,0,424,9642,0,0;QS=3,0;MQSB=0.944319;MQ0F=0	PL:DP:DV	0,36,252:12:0	0,12,127:4:0	0,21,200:7:0
-X	2788	.	C	<*>	0	.	DP=23;I16=11,11,0,0,791,29517,0,0,1289,76441,0,0,421,9523,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,125:4:0	0,21,209:7:0
-X	2789	.	C	<*>	0	.	DP=24;I16=13,11,0,0,880,33470,0,0,1409,83641,0,0,443,10051,0,0;QS=3,0;MQSB=0.931547;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,150:5:0	0,21,226:7:0
-X	2790	.	T	<*>	0	.	DP=23;I16=13,10,0,0,886,34738,0,0,1349,80041,0,0,442,9976,0,0;QS=3,0;MQSB=0.921963;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,165:5:0	0,21,227:7:0
-X	2791	.	G	<*>	0	.	DP=23;I16=13,10,0,0,873,34037,0,0,1349,80041,0,0,441,9923,0,0;QS=3,0;MQSB=0.921963;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,155:5:0	0,21,226:7:0
-X	2792	.	G	<*>	0	.	DP=23;I16=13,10,0,0,832,30870,0,0,1349,80041,0,0,438,9792,0,0;QS=3,0;MQSB=0.921963;MQ0F=0	PL:DP:DV	0,33,254:11:0	0,15,146:5:0	0,21,221:7:0
-X	2793	.	T	<*>	0	.	DP=23;I16=13,10,0,0,827,30693,0,0,1349,80041,0,0,435,9683,0,0;QS=3,0;MQSB=0.921963;MQ0F=0	PL:DP:DV	0,33,247:11:0	0,15,157:5:0	0,21,214:7:0
-X	2794	.	C	<*>	0	.	DP=22;I16=12,10,0,0,786,29122,0,0,1289,76441,0,0,433,9595,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,145:5:0	0,21,201:7:0
-X	2795	.	C	<*>	0	.	DP=22;I16=11,10,0,0,814,31804,0,0,1229,72841,0,0,428,9518,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,27,240:9:0	0,15,159:5:0	0,21,222:7:0
-X	2796	.	A	<*>	0	.	DP=22;I16=11,10,0,0,762,28412,0,0,1229,72841,0,0,427,9475,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,27,221:9:0	0,15,156:5:0	0,21,211:7:0
-X	2797	.	T	<*>	0	.	DP=22;I16=12,10,0,0,792,29116,0,0,1289,76441,0,0,427,9451,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,30,243:10:0	0,15,148:5:0	0,21,214:7:0
-X	2798	.	G	<*>	0	.	DP=22;I16=12,10,0,0,817,31105,0,0,1289,76441,0,0,424,9394,0,0;QS=3,0;MQSB=0.924723;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,152:5:0	0,21,205:7:0
-X	2799	.	A	<*>	0	.	DP=21;I16=11,10,0,0,788,30210,0,0,1229,72841,0,0,421,9309,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,27,220:9:0	0,15,167:5:0	0,21,218:7:0
-X	2800	.	A	<*>	0	.	DP=21;I16=11,10,0,0,836,33616,0,0,1229,72841,0,0,418,9246,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,27,237:9:0	0,15,164:5:0	0,21,237:7:0
-X	2801	.	G	<*>	0	.	DP=21;I16=11,10,0,0,792,30182,0,0,1229,72841,0,0,415,9205,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,27,234:9:0	0,15,157:5:0	0,21,214:7:0
-X	2802	.	G	<*>	0	.	DP=21;I16=11,9,0,0,729,27275,0,0,1169,69241,0,0,387,8559,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,24,229:8:0	0,15,135:5:0	0,21,215:7:0
-X	2803	.	G	<*>	0	.	DP=21;I16=11,10,0,0,737,26709,0,0,1229,72841,0,0,406,9036,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,27,233:9:0	0,15,125:5:0	0,21,207:7:0
-X	2804	.	G	<*>	0	.	DP=21;I16=11,10,0,0,727,26103,0,0,1229,72841,0,0,400,8908,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,27,218:9:0	0,15,129:5:0	0,21,210:7:0
-X	2805	.	C	<*>	0	.	DP=21;I16=10,10,0,0,714,26194,0,0,1169,69241,0,0,372,8316,0,0;QS=3,0;MQSB=0.931063;MQ0F=0	PL:DP:DV	0,27,229:9:0	0,12,111:4:0	0,21,205:7:0
-X	2806	.	C	<*>	0	.	DP=20;I16=11,8,0,0,682,25074,0,0,1109,65641,0,0,379,8611,0,0;QS=3,0;MQSB=0.902014;MQ0F=0	PL:DP:DV	0,24,215:8:0	0,15,138:5:0	0,18,191:6:0
-X	2807	.	T	<*>	0	.	DP=20;I16=11,9,0,0,755,29373,0,0,1169,69241,0,0,384,8640,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,24,221:8:0	0,15,152:5:0	0,21,227:7:0
-X	2808	.	T	<*>	0	.	DP=20;I16=11,9,0,0,749,28383,0,0,1169,69241,0,0,379,8587,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,24,209:8:0	0,15,157:5:0	0,21,225:7:0
-X	2809	.	T	<*>	0	.	DP=20;I16=11,8,0,0,697,26019,0,0,1109,65641,0,0,349,7927,0,0;QS=3,0;MQSB=0.902014;MQ0F=0	PL:DP:DV	0,21,189:7:0	0,15,148:5:0	0,21,226:7:0
-X	2810	.	C	<*>	0	.	DP=20;I16=12,8,0,0,754,28900,0,0,1169,69241,0,0,368,8436,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,24,229:8:0	0,15,150:5:0	0,21,215:7:0
-X	2811	.	A	<*>	0	.	DP=19;I16=11,8,0,0,759,30405,0,0,1109,65641,0,0,364,8340,0,0;QS=3,0;MQSB=0.902014;MQ0F=0	PL:DP:DV	0,21,209:7:0	0,15,166:5:0	0,21,228:7:0
-X	2812	.	G	<*>	0	.	DP=20;I16=11,9,0,0,758,29062,0,0,1169,69241,0,0,359,8213,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,24,229:8:0	0,15,150:5:0	0,21,216:7:0
-X	2813	.	A	<*>	0	.	DP=19;I16=11,8,0,0,702,27106,0,0,1140,68400,0,0,356,8104,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,195:7:0	0,15,160:5:0	0,21,217:7:0
-X	2814	.	G	<*>	0	.	DP=19;I16=11,8,0,0,703,26579,0,0,1140,68400,0,0,353,8013,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,217:7:0	0,15,147:5:0	0,21,204:7:0
-X	2815	.	A	<*>	0	.	DP=19;I16=10,7,0,0,597,21979,0,0,1020,61200,0,0,326,7470,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,170:6:0	0,12,122:4:0	0,21,208:7:0
-X	2816	.	C	<*>	0	.	DP=19;I16=11,8,0,0,630,21880,0,0,1140,68400,0,0,343,7685,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,193:7:0	0,15,134:5:0	0,21,180:7:0
-X	2817	.	G	<*>	0	.	DP=20;I16=11,8,0,0,612,20368,0,0,1140,68400,0,0,339,7547,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,200:7:0	0,15,115:5:0	0,21,178:7:0
-X	2818	.	G	<*>	0	.	DP=20;I16=11,8,0,0,688,25280,0,0,1140,68400,0,0,335,7377,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,216:7:0	0,15,132:5:0	0,21,206:7:0
-X	2819	.	G	<*>	0	.	DP=20;I16=11,8,0,0,696,25880,0,0,1140,68400,0,0,331,7227,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,222:7:0	0,15,142:5:0	0,21,195:7:0
-X	2820	.	G	<*>	0	.	DP=20;I16=10,8,0,0,624,22228,0,0,1080,64800,0,0,320,7048,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,205:7:0	0,12,119:4:0	0,21,188:7:0
-X	2821	.	A	<*>	0	.	DP=20;I16=9,7,0,0,496,16222,0,0,960,57600,0,0,279,6157,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,159:6:0	0,9,93:3:0	0,21,171:7:0
-X	2822	.	C	<*>	0	.	DP=19;I16=8,9,0,0,543,18163,0,0,1020,61200,0,0,310,7064,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,203:7:0	0,9,79:3:0	0,21,168:7:0
-X	2823	.	C	<*>	0	.	DP=18;I16=9,7,0,0,550,19506,0,0,960,57600,0,0,300,6640,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,201:7:0	0,6,58:2:0	0,21,192:7:0
-X	2824	.	C	<*>	0	.	DP=18;I16=9,7,0,0,584,21560,0,0,960,57600,0,0,299,6567,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,219:8:0	0,3,37:1:0	0,21,210:7:0
-X	2825	.	C	<*>	0	.	DP=18;I16=9,8,0,0,606,22286,0,0,1020,61200,0,0,324,7134,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,234:8:0	0,3,37:1:0	0,24,208:8:0
-X	2826	.	T	<*>	0	.	DP=18;I16=9,8,0,0,604,21766,0,0,1020,61200,0,0,323,7043,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,222:8:0	0,3,33:1:0	0,24,220:8:0
-X	2827	.	G	<*>	0	.	DP=18;I16=9,8,0,0,597,21643,0,0,1020,61200,0,0,322,6970,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,230:8:0	0,3,28:1:0	0,24,214:8:0
-X	2828	.	A	<*>	0	.	DP=20;I16=9,9,0,0,598,20740,0,0,1080,64800,0,0,321,6915,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,213:9:0	0,3,36:1:0	0,24,219:8:0
-X	2829	.	G	<*>	0	.	DP=20;I16=9,9,0,0,649,23719,0,0,1080,64800,0,0,305,6591,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,239:8:0	0,3,31:1:0	0,27,227:9:0
-X	2830	.	G	<*>	0	.	DP=20;I16=9,10,0,0,661,23841,0,0,1140,68400,0,0,323,6867,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,248:9:0	0,3,34:1:0	0,27,222:9:0
-X	2831	.	A	<*>	0	.	DP=21;I16=10,10,0,0,682,24052,0,0,1200,72000,0,0,324,6876,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,223:9:0	0,3,34:1:0	0,30,254:10:0
-X	2832	.	G	<*>	0	.	DP=21;I16=10,8,0,0,626,22384,0,0,1080,64800,0,0,281,5883,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,230:8:0	0,3,31:1:0	0,27,223:9:0
-X	2833	.	C	<*>	0	.	DP=21;I16=10,10,0,0,712,25708,0,0,1200,72000,0,0,327,6915,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,233:9:0	0,3,37:1:0	0,30,255:10:0
-X	2834	.	C	<*>	0	.	DP=21;I16=10,9,0,0,674,24470,0,0,1140,68400,0,0,306,6464,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,230:8:0	0,3,36:1:0	0,30,243:10:0
-X	2835	.	C	<*>	0	.	DP=20;I16=9,9,0,0,617,21835,0,0,1080,64800,0,0,305,6381,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,202:8:0	0,3,39:1:0	0,27,235:9:0
-X	2836	.	C	<*>	0	.	DP=20;I16=9,9,0,0,580,19624,0,0,1080,64800,0,0,306,6412,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,206:8:0	0,3,39:1:0	0,27,200:9:0
-X	2837	.	G	<*>	0	.	DP=21;I16=9,10,0,0,558,17614,0,0,1140,68400,0,0,330,7086,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,207:9:0	0,3,31:1:0	0,27,193:9:0
-X	2838	.	A	<*>	0	.	DP=20;I16=9,10,0,0,640,22674,0,0,1140,68400,0,0,331,7065,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,245:9:0	0,3,17:1:0	0,27,220:9:0
-X	2839	.	G	<*>	0	.	DP=20;I16=9,8,0,0,623,23267,0,0,1020,61200,0,0,282,5816,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,248:8:0	0,3,26:1:0	0,24,212:8:0
-X	2840	.	C	<*>	0	.	DP=20;I16=9,10,0,0,644,22798,0,0,1140,68400,0,0,333,7089,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,233:9:0	0,3,32:1:0	0,27,227:9:0
-X	2841	.	A	<*>	0	.	DP=20;I16=9,9,0,0,675,25801,0,0,1080,64800,0,0,309,6509,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,252:9:0	0,3,35:1:0	0,24,234:8:0
-X	2842	.	G	<*>	0	.	DP=20;I16=9,10,0,0,688,25554,0,0,1140,68400,0,0,332,7056,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,3,31:1:0	0,27,233:9:0
-X	2843	.	C	<*>	0	.	DP=20;I16=8,10,0,0,651,23969,0,0,1080,64800,0,0,309,6517,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,0,0:0:0	0,24,211:8:0
-X	2844	.	A	<*>	0	.	DP=20;I16=8,11,0,0,685,25399,0,0,1140,68400,0,0,331,6969,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,0,0:0:0	0,27,231:9:0
-X	2845	.	G	<*>	0	.	DP=20;I16=8,10,0,0,673,25399,0,0,1080,64800,0,0,311,6561,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,0,0:0:0	0,24,228:8:0
-X	2846	.	C	<*>	0	.	DP=20;I16=8,10,0,0,617,22007,0,0,1080,64800,0,0,311,6577,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,243:10:0	0,0,0:0:0	0,24,218:8:0
-X	2847	.	C	<*>	0	.	DP=20;I16=7,11,0,0,580,19468,0,0,1080,64800,0,0,321,6917,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,241:10:0	0,0,0:0:0	0,24,187:8:0
-X	2848	.	G	<*>	0	.	DP=19;I16=7,10,0,0,542,17884,0,0,1020,61200,0,0,323,6999,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,218:9:0	0,0,0:0:0	0,24,191:8:0
-X	2849	.	T	<*>	0	.	DP=19;I16=7,11,0,0,609,21717,0,0,1080,64800,0,0,341,7357,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,231:9:0	0,0,0:0:0	0,27,214:9:0
-X	2850	.	C	<*>	0	.	DP=19;I16=7,11,0,0,574,18980,0,0,1080,64800,0,0,343,7461,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,234:9:0	0,0,0:0:0	0,27,188:9:0
-X	2851	.	G	<*>	0	.	DP=17;I16=6,11,0,0,589,20831,0,0,1020,61200,0,0,346,7584,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,239:9:0	0,0,0:0:0	0,24,194:8:0
-X	2852	.	T	<*>	0	.	DP=17;I16=6,11,0,0,625,23241,0,0,1020,61200,0,0,348,7676,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,244:9:0	0,0,0:0:0	0,24,214:8:0
-X	2853	.	G	<*>	0	.	DP=17;I16=6,11,0,0,635,23949,0,0,1020,61200,0,0,349,7739,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,0,0:0:0	0,24,202:8:0
-X	2854	.	T	<*>	0	.	DP=17;I16=6,11,0,0,602,21990,0,0,1020,61200,0,0,348,7722,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,238:9:0	0,0,0:0:0	0,24,207:8:0
-X	2855	.	C	<*>	0	.	DP=17;I16=6,10,0,0,577,21539,0,0,960,57600,0,0,337,7623,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,0,0:0:0	0,21,185:7:0
-X	2856	.	T	<*>	0	.	DP=17;I16=6,8,0,0,530,20570,0,0,840,50400,0,0,289,6507,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,252:9:0	0,0,0:0:0	0,15,167:5:0
-X	2857	.	C	<*>	0	.	DP=18;I16=6,10,0,0,577,21641,0,0,960,57600,0,0,336,7664,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,0,0:0:0	0,21,185:7:0
-X	2858	.	A	<*>	0	.	DP=19;I16=6,12,0,0,634,23006,0,0,1080,64800,0,0,355,8081,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,254:10:0	0,3,39:1:0	0,21,185:7:0
-X	2859	.	C	<*>	0	.	DP=19;I16=6,13,0,0,646,23056,0,0,1140,68400,0,0,361,8139,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,3,26:1:0	0,24,194:8:0
-X	2860	.	C	<*>	0	.	DP=19;I16=6,13,0,0,655,23687,0,0,1140,68400,0,0,360,8166,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,251:10:0	0,3,37:1:0	0,24,200:8:0
-X	2861	.	C	<*>	0	.	DP=20;I16=7,12,0,0,708,26756,0,0,1140,68400,0,0,333,7537,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,38:1:0	0,21,203:7:0
-X	2862	.	A	<*>	0	.	DP=20;I16=6,13,0,0,749,29753,0,0,1140,68400,0,0,332,7554,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,3,43:1:0	0,24,225:8:0
-X	2863	.	G	<*>	0	.	DP=19;I16=7,12,0,0,707,26901,0,0,1140,68400,0,0,356,8166,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,35:1:0	0,21,195:7:0
-X	2864	.	G	<*>	0	.	DP=19;I16=7,11,0,0,677,25833,0,0,1080,64800,0,0,352,8070,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,36:1:0	0,18,185:6:0
-X	2865	.	G	<*>	0	.	DP=19;I16=7,12,0,0,671,24569,0,0,1140,68400,0,0,350,7994,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,27:1:0	0,21,193:7:0
-X	2866	.	T	<*>	0	.	DP=18;I16=6,11,0,0,591,21071,0,0,1020,61200,0,0,338,7834,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,3,32:1:0	0,15,147:5:0
-X	2867	.	G	<*>	0	.	DP=18;I16=7,11,0,0,655,24279,0,0,1080,64800,0,0,347,7889,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,58:2:0	0,15,150:5:0
-X	2868	.	T	<*>	0	.	DP=18;I16=7,11,0,0,640,23702,0,0,1080,64800,0,0,347,7859,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,68:2:0	0,15,157:5:0
-X	2869	.	C	<*>	0	.	DP=18;I16=7,11,0,0,655,24737,0,0,1080,64800,0,0,346,7794,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,56:2:0	0,15,165:5:0
-X	2870	.	T	<*>	0	.	DP=18;I16=7,11,0,0,700,27480,0,0,1080,64800,0,0,345,7743,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,70:2:0	0,15,176:5:0
-X	2871	.	G	<*>	0	.	DP=18;I16=7,11,0,0,700,27554,0,0,1080,64800,0,0,344,7706,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,68:2:0	0,15,172:5:0
-X	2872	.	A	<*>	0	.	DP=18;I16=7,11,0,0,651,23869,0,0,1080,64800,0,0,343,7683,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,66:2:0	0,15,171:5:0
-X	2873	.	A	<*>	0	.	DP=18;I16=7,11,0,0,664,25000,0,0,1080,64800,0,0,342,7674,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,61:2:0	0,15,159:5:0
-X	2874	.	A	<*>	0	.	DP=18;I16=7,11,0,0,636,23286,0,0,1080,64800,0,0,341,7679,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,57:2:0	0,15,162:5:0
-X	2875	.	C	<*>	0	.	DP=18;I16=7,11,0,0,664,25148,0,0,1080,64800,0,0,340,7698,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,63:2:0	0,15,166:5:0
-X	2876	.	A	<*>	0	.	DP=18;I16=6,11,0,0,666,26684,0,0,1020,61200,0,0,314,7106,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,6,74:2:0	0,15,185:5:0
-X	2877	.	G	<*>	0	.	DP=17;I16=6,11,0,0,659,26009,0,0,1020,61200,0,0,339,7777,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,6,67:2:0	0,12,148:4:0
-X	2878	.	A	<*>	0	.	DP=17;I16=7,10,0,0,628,23656,0,0,1020,61200,0,0,340,7834,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,6,69:2:0	0,15,166:5:0
-X	2879	.	T	<*>	0	.	DP=18;I16=7,11,0,0,671,25359,0,0,1080,64800,0,0,342,7902,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,9,96:3:0	0,15,175:5:0
-X	2880	.	G	<*>	0	.	DP=19;I16=8,11,0,0,708,26694,0,0,1140,68400,0,0,345,7983,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,118:4:0	0,15,173:5:0
-X	2881	.	T	<*>	0	.	DP=19;I16=6,11,0,0,618,23304,0,0,1020,61200,0,0,299,6829,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,209:8:0	0,12,124:4:0	0,15,178:5:0
-X	2882	.	G	<*>	0	.	DP=19;I16=8,11,0,0,700,26464,0,0,1140,68400,0,0,353,8191,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,118:4:0	0,15,176:5:0
-X	2883	.	G	<*>	0	.	DP=19;I16=8,11,0,0,707,26939,0,0,1140,68400,0,0,357,8319,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,121:4:0	0,15,175:5:0
-X	2884	.	A	<*>	0	.	DP=19;I16=7,11,0,0,649,24531,0,0,1080,64800,0,0,335,7787,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,229:9:0	0,12,121:4:0	0,15,181:5:0
-X	2885	.	G	<*>	0	.	DP=19;I16=8,11,0,0,737,29253,0,0,1140,68400,0,0,362,8470,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,113:4:0	0,15,182:5:0
-X	2886	.	G	A,<*>	0	.	DP=18;I16=7,9,1,0,571,21281,20,400,960,57600,60,3600,334,7882,6,36;QS=2.76471,0.235294,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=1;BQB=1;MQ0F=0	PL:DP:DV	0,27,236,27,236,236:9:0	11,0,51,17,54,66:3:1	0,15,171,15,171,171:5:0
-X	2887	.	T	<*>	0	.	DP=19;I16=9,9,0,0,581,20407,0,0,1080,64800,0,0,341,7905,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,213:10:0	0,9,94:3:0	0,15,166:5:0
-X	2888	.	C	<*>	0	.	DP=20;I16=10,10,0,0,714,26630,0,0,1200,72000,0,0,368,8532,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,94:4:0	0,15,159:5:0
-X	2889	.	T	<*>	0	.	DP=19;I16=9,10,0,0,712,27106,0,0,1140,68400,0,0,372,8550,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,114:4:0	0,15,175:5:0
-X	2890	.	C	<*>	0	.	DP=19;I16=9,10,0,0,613,20711,0,0,1140,68400,0,0,376,8584,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,247:10:0	0,12,95:4:0	0,15,139:5:0
-X	2891	.	G	<*>	0	.	DP=20;I16=9,11,0,0,674,23754,0,0,1200,72000,0,0,380,8634,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,242:10:0	0,15,141:5:0	0,15,143:5:0
-X	2892	.	G	<*>	0	.	DP=21;I16=9,12,0,0,731,26677,0,0,1260,75600,0,0,385,8701,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,142:5:0	0,15,164:5:0
-X	2893	.	G	<*>	0	.	DP=21;I16=9,12,0,0,696,24498,0,0,1260,75600,0,0,389,8687,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,251:11:0	0,15,141:5:0	0,15,150:5:0
-X	2894	.	T	<*>	0	.	DP=21;I16=9,12,0,0,716,25490,0,0,1260,75600,0,0,393,8693,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,137:5:0	0,15,155:5:0
-X	2895	.	G	<*>	0	.	DP=22;I16=9,12,0,0,773,29225,0,0,1260,75600,0,0,372,8094,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,149:6:0	0,15,166:5:0
-X	2896	.	A	<*>	0	.	DP=22;I16=8,12,0,0,732,27684,0,0,1200,72000,0,0,361,7885,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,151:5:0	0,15,163:5:0
-X	2897	.	G	<*>	0	.	DP=22;I16=10,12,0,0,783,28783,0,0,1320,79200,0,0,407,8835,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,161:6:0	0,15,168:5:0
-X	2898	.	G	<*>	0	.	DP=22;I16=10,12,0,0,724,25596,0,0,1320,79200,0,0,412,8926,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,254:11:0	0,18,143:6:0	0,15,169:5:0
-X	2899	.	C	<*>	0	.	DP=22;I16=8,11,0,0,625,21143,0,0,1140,68400,0,0,356,7640,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,228:9:0	0,15,130:5:0	0,15,147:5:0
-X	2900	.	G	<*>	0	.	DP=24;I16=11,13,0,0,782,26700,0,0,1440,86400,0,0,420,9078,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,164:6:0	0,15,153:5:0
-X	2901	.	T	<*>	0	.	DP=24;I16=11,13,0,0,821,29195,0,0,1440,86400,0,0,426,9192,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,174:6:0	0,15,166:5:0
-X	2902	.	G	<*>	0	.	DP=24;I16=11,13,0,0,898,34176,0,0,1440,86400,0,0,432,9334,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,171:6:0	0,15,164:5:0
-X	2903	.	G	<*>	0	.	DP=24;I16=11,13,0,0,894,33764,0,0,1440,86400,0,0,437,9455,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,183:6:0	0,15,168:5:0
-X	2904	.	C	<*>	0	.	DP=24;I16=11,13,0,0,892,34010,0,0,1440,86400,0,0,440,9506,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,176:6:0	0,15,169:5:0
-X	2905	.	T	<*>	0	.	DP=25;I16=12,13,0,0,926,34994,0,0,1500,90000,0,0,442,9536,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,175:6:0	0,15,174:5:0
-X	2906	.	C	<*>	0	.	DP=25;I16=12,13,0,0,960,37070,0,0,1500,90000,0,0,444,9544,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,178:6:0	0,15,173:5:0
-X	2907	.	A	<*>	0	.	DP=25;I16=11,13,0,0,933,36707,0,0,1440,86400,0,0,429,9275,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,202:6:0	0,15,170:5:0
-X	2908	.	G	<*>	0	.	DP=25;I16=12,13,0,0,943,36315,0,0,1500,90000,0,0,446,9548,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,167:6:0	0,15,164:5:0
-X	2909	.	A	<*>	0	.	DP=25;I16=10,13,0,0,864,32764,0,0,1380,82800,0,0,425,9105,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,182:6:0	0,15,171:5:0
-X	2910	.	T	<*>	0	.	DP=25;I16=11,13,0,0,870,32054,0,0,1440,86400,0,0,447,9575,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,181:6:0	0,15,166:5:0
-X	2911	.	A	<*>	0	.	DP=25;I16=11,14,0,0,871,31227,0,0,1500,90000,0,0,473,10259,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,174:6:0	0,18,188:6:0
-X	2912	.	C	<*>	0	.	DP=24;I16=11,13,0,0,899,34121,0,0,1440,86400,0,0,474,10298,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,173:6:0	0,18,189:6:0
-X	2913	.	A	<*>	0	.	DP=24;I16=10,13,0,0,879,34357,0,0,1380,82800,0,0,449,9691,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,164:5:0	0,18,199:6:0
-X	2914	.	G	<*>	0	.	DP=24;I16=11,13,0,0,899,34575,0,0,1440,86400,0,0,472,10262,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,170:6:0	0,18,187:6:0
-X	2915	.	G	<*>	0	.	DP=24;I16=11,13,0,0,867,32523,0,0,1440,86400,0,0,470,10236,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,177:6:0	0,18,178:6:0
-X	2916	.	G	<*>	0	.	DP=24;I16=11,12,0,0,813,29935,0,0,1380,82800,0,0,443,9613,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,173:6:0	0,15,155:5:0
-X	2917	.	A	<*>	0	.	DP=25;I16=11,13,0,0,864,31926,0,0,1440,86400,0,0,459,10181,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,185:6:0	0,18,178:6:0
-X	2918	.	G	<*>	0	.	DP=25;I16=13,12,0,0,903,33489,0,0,1500,90000,0,0,462,10122,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,165:6:0	0,18,170:6:0
-X	2919	.	T	<*>	0	.	DP=25;I16=12,12,0,0,837,29647,0,0,1440,86400,0,0,443,9765,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,169:6:0	0,18,178:6:0
-X	2920	.	G	<*>	0	.	DP=25;I16=12,12,0,0,850,31266,0,0,1440,86400,0,0,433,9389,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,132:5:0	0,18,180:6:0
-X	2921	.	G	<*>	0	.	DP=25;I16=13,12,0,0,874,31518,0,0,1500,90000,0,0,455,9951,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,159:6:0	0,18,176:6:0
-X	2922	.	C	<*>	0	.	DP=26;I16=13,12,0,0,872,31374,0,0,1500,90000,0,0,438,9718,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,160:6:0	0,18,172:6:0
-X	2923	.	C	<*>	0	.	DP=26;I16=13,12,0,0,873,31687,0,0,1500,90000,0,0,437,9735,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,172:6:0	0,18,175:6:0
-X	2924	.	C	<*>	0	.	DP=25;I16=13,12,0,0,940,36016,0,0,1500,90000,0,0,449,9921,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,173:6:0	0,18,184:6:0
-X	2925	.	A	<*>	0	.	DP=25;I16=13,12,0,0,912,33580,0,0,1500,90000,0,0,448,9964,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,174:6:0	0,18,189:6:0
-X	2926	.	C	<*>	0	.	DP=25;I16=13,12,0,0,902,33224,0,0,1500,90000,0,0,445,9931,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,176:6:0	0,18,174:6:0
-X	2927	.	A	<*>	0	.	DP=25;I16=12,12,0,0,896,33828,0,0,1440,86400,0,0,417,9295,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,162:5:0	0,18,191:6:0
-X	2928	.	G	<*>	0	.	DP=24;I16=13,11,0,0,862,32078,0,0,1440,86400,0,0,440,9930,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,170:6:0	0,18,161:6:0
-X	2929	.	C	<*>	0	.	DP=23;I16=13,9,0,0,794,29716,0,0,1320,79200,0,0,430,9878,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,153:5:0	0,15,149:5:0
-X	2930	.	T	<*>	0	.	DP=23;I16=13,10,0,0,822,30260,0,0,1380,82800,0,0,438,10006,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,168:6:0	0,15,157:5:0
-X	2931	.	C	<*>	0	.	DP=23;I16=13,10,0,0,803,28963,0,0,1380,82800,0,0,436,10020,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,162:6:0	0,15,140:5:0
-X	2932	.	G	<*>	0	.	DP=22;I16=12,10,0,0,728,25158,0,0,1320,79200,0,0,435,10049,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,171:6:0	0,12,117:4:0
-X	2933	.	G	<*>	0	.	DP=22;I16=11,10,0,0,760,28336,0,0,1260,75600,0,0,430,10034,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,175:6:0	0,12,116:4:0
-X	2934	.	C	<*>	0	.	DP=21;I16=12,9,0,0,759,28241,0,0,1260,75600,0,0,432,10052,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,161:6:0	0,9,104:3:0
-X	2935	.	C	<*>	0	.	DP=21;I16=12,9,0,0,766,28494,0,0,1260,75600,0,0,431,10075,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,178:6:0	0,9,94:3:0
-X	2936	.	T	<*>	0	.	DP=21;I16=11,9,0,0,760,29284,0,0,1200,72000,0,0,429,10063,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,188:6:0	0,9,98:3:0
-X	2937	.	G	<*>	0	.	DP=20;I16=11,9,0,0,728,27374,0,0,1200,72000,0,0,428,10066,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,177:6:0	0,9,79:3:0
-X	2938	.	T	<*>	0	.	DP=20;I16=11,9,0,0,719,26217,0,0,1200,72000,0,0,427,10083,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,188:6:0	0,9,101:3:0
-X	2939	.	C	<*>	0	.	DP=19;I16=11,8,0,0,729,28277,0,0,1140,68400,0,0,427,10113,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,163:5:0	0,9,106:3:0
-X	2940	.	T	<*>	0	.	DP=19;I16=11,8,0,0,739,29133,0,0,1140,68400,0,0,427,10155,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,171:5:0	0,9,109:3:0
-X	2941	.	T	<*>	0	.	DP=19;I16=11,8,0,0,702,26358,0,0,1140,68400,0,0,427,10209,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,170:5:0	0,9,99:3:0
-X	2942	.	T	<*>	0	.	DP=19;I16=11,8,0,0,695,25671,0,0,1140,68400,0,0,427,10275,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,169:5:0	0,9,100:3:0
-X	2943	.	G	<*>	0	.	DP=18;I16=11,6,0,0,621,23187,0,0,1020,61200,0,0,401,9627,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,228:9:0	0,15,170:5:0	0,9,86:3:0
-X	2944	.	A	<*>	0	.	DP=18;I16=10,7,0,0,642,24406,0,0,1020,61200,0,0,399,9563,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,239:9:0	0,15,168:5:0	0,9,111:3:0
-X	2945	.	A	<*>	0	.	DP=18;I16=11,7,0,0,637,23199,0,0,1080,64800,0,0,422,10132,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,242:10:0	0,15,152:5:0	0,9,107:3:0
-X	2946	.	A	<*>	0	.	DP=18;I16=11,7,0,0,692,26794,0,0,1080,64800,0,0,420,10084,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,174:5:0	0,9,108:3:0
-X	2947	.	G	<*>	0	.	DP=18;I16=11,7,0,0,639,23329,0,0,1080,64800,0,0,418,10044,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,160:5:0	0,9,78:3:0
-X	2948	.	G	<*>	0	.	DP=19;I16=11,8,0,0,702,26272,0,0,1140,68400,0,0,415,9961,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,163:5:0	0,12,116:4:0
-X	2949	.	C	<*>	0	.	DP=19;I16=10,8,0,0,657,24565,0,0,1080,64800,0,0,388,9260,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,125:4:0	0,12,124:4:0
-X	2950	.	C	<*>	0	.	DP=19;I16=11,8,0,0,667,24359,0,0,1140,68400,0,0,411,9817,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,131:5:0	0,12,115:4:0
-X	2951	.	A	<*>	0	.	DP=20;I16=11,8,0,0,682,24956,0,0,1140,68400,0,0,409,9757,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,250:10:0	0,15,149:5:0	0,12,133:4:0
-X	2952	.	C	<*>	0	.	DP=20;I16=11,9,0,0,647,21709,0,0,1200,72000,0,0,408,9706,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,128:5:0	0,12,112:4:0
-X	2953	.	G	<*>	0	.	DP=21;I16=11,9,0,0,620,19954,0,0,1200,72000,0,0,407,9665,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,237:11:0	0,15,132:5:0	0,12,111:4:0
-X	2954	.	T	<*>	0	.	DP=21;I16=11,10,0,0,742,26662,0,0,1260,75600,0,0,414,9666,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,175:6:0	0,12,135:4:0
-X	2955	.	G	<*>	0	.	DP=22;I16=11,11,0,0,787,28475,0,0,1320,79200,0,0,412,9568,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,170:6:0	0,12,127:4:0
-X	2956	.	A	<*>	0	.	DP=22;I16=11,11,0,0,747,26449,0,0,1320,79200,0,0,410,9438,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,161:6:0	0,12,125:4:0
-X	2957	.	C	<*>	0	.	DP=22;I16=10,10,0,0,693,24757,0,0,1200,72000,0,0,358,8078,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,143:6:0	0,9,104:3:0
-X	2958	.	C	<*>	0	.	DP=21;I16=11,10,0,0,784,29744,0,0,1260,75600,0,0,407,9237,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,172:6:0	0,12,135:4:0
-X	2959	.	T	<*>	0	.	DP=21;I16=11,10,0,0,791,30411,0,0,1260,75600,0,0,406,9164,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,182:6:0	0,12,139:4:0
-X	2960	.	G	<*>	0	.	DP=21;I16=11,10,0,0,778,29502,0,0,1260,75600,0,0,405,9109,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,178:6:0	0,12,126:4:0
-X	2961	.	G	<*>	0	.	DP=20;I16=10,9,0,0,657,23303,0,0,1140,68400,0,0,380,8446,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,231:10:0	0,18,176:6:0	0,9,111:3:0
-X	2962	.	C	<*>	0	.	DP=21;I16=10,10,0,0,731,27459,0,0,1200,72000,0,0,385,8615,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,151:5:0	0,12,132:4:0
-X	2963	.	C	<*>	0	.	DP=21;I16=10,10,0,0,722,26502,0,0,1200,72000,0,0,378,8274,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,169:6:0	0,9,100:3:0
-X	2964	.	C	<*>	0	.	DP=22;I16=11,10,0,0,752,27740,0,0,1260,75600,0,0,379,8275,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,148:5:0	0,15,151:5:0
-X	2965	.	A	<*>	0	.	DP=22;I16=11,11,0,0,804,29606,0,0,1320,79200,0,0,397,8539,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,176:6:0	0,15,155:5:0
-X	2966	.	C	<*>	0	.	DP=22;I16=11,11,0,0,705,23557,0,0,1320,79200,0,0,396,8468,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,254:11:0	0,18,146:6:0	0,15,142:5:0
-X	2967	.	G	<*>	0	.	DP=24;I16=11,13,0,0,767,25405,0,0,1440,86400,0,0,393,8325,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,162:6:0	0,18,135:6:0
-X	2968	.	G	<*>	0	.	DP=23;I16=11,12,0,0,812,29824,0,0,1380,82800,0,0,393,8213,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,152:5:0	0,18,162:6:0
-X	2969	.	C	<*>	0	.	DP=23;I16=11,12,0,0,866,32982,0,0,1380,82800,0,0,393,8133,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,151:5:0	0,18,181:6:0
-X	2970	.	T	<*>	0	.	DP=24;I16=11,12,0,0,816,29806,0,0,1380,82800,0,0,393,8085,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,154:5:0	0,18,189:6:0
-X	2971	.	G	<*>	0	.	DP=24;I16=12,12,0,0,878,33010,0,0,1440,86400,0,0,392,7970,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,173:6:0	0,18,184:6:0
-X	2972	.	G	<*>	0	.	DP=24;I16=12,12,0,0,839,30363,0,0,1440,86400,0,0,391,7889,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,175:6:0	0,18,161:6:0
-X	2973	.	C	<*>	0	.	DP=24;I16=12,12,0,0,854,31154,0,0,1440,86400,0,0,390,7842,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,177:6:0	0,18,165:6:0
-X	2974	.	A	<*>	0	.	DP=24;I16=12,12,0,0,869,32231,0,0,1440,86400,0,0,388,7778,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,169:6:0	0,18,174:6:0
-X	2975	.	G	<*>	0	.	DP=24;I16=12,12,0,0,857,31835,0,0,1440,86400,0,0,384,7648,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,173:6:0	0,18,167:6:0
-X	2976	.	G	<*>	0	.	DP=25;I16=13,12,0,0,866,31118,0,0,1500,90000,0,0,380,7554,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,180:7:0	0,18,171:6:0
-X	2977	.	T	<*>	0	.	DP=26;I16=13,12,0,0,760,25216,0,0,1469,87241,0,0,373,7437,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,151:6:0	0,18,155:6:0
-X	2978	.	G	<*>	0	.	DP=25;I16=12,12,0,0,862,31574,0,0,1409,83641,0,0,362,7290,0,0;QS=3,0;MQSB=0.941765;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,168:6:0	0,18,167:6:0
-X	2979	.	G	<*>	0	.	DP=24;I16=12,12,0,0,816,28440,0,0,1409,83641,0,0,370,7340,0,0;QS=3,0;MQSB=0.941765;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,164:6:0	0,15,142:5:0
-X	2980	.	G	<*>	0	.	DP=23;I16=12,11,0,0,834,30882,0,0,1349,80041,0,0,369,7293,0,0;QS=3,0;MQSB=0.944319;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,144:5:0	0,15,148:5:0
-X	2981	.	A	<*>	0	.	DP=23;I16=9,11,0,0,622,20306,0,0,1169,69241,0,0,318,6244,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,30,201:10:0	0,15,145:5:0	0,15,150:5:0
-X	2982	.	C	<*>	0	.	DP=23;I16=10,11,0,0,706,24366,0,0,1229,72841,0,0,340,6884,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,93:3:0	0,15,144:5:0
-X	2983	.	C	<*>	0	.	DP=23;I16=12,11,0,0,781,27427,0,0,1349,80041,0,0,363,7197,0,0;QS=3,0;MQSB=0.944319;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,137:5:0	0,15,142:5:0
-X	2984	.	C	<*>	0	.	DP=23;I16=12,11,0,0,861,32655,0,0,1349,80041,0,0,361,7229,0,0;QS=3,0;MQSB=0.944319;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,154:5:0	0,15,157:5:0
-X	2985	.	A	<*>	0	.	DP=23;I16=12,11,0,0,798,28906,0,0,1349,80041,0,0,359,7293,0,0;QS=3,0;MQSB=0.944319;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,161:5:0	0,15,151:5:0
-X	2986	.	G	<*>	0	.	DP=21;I16=11,10,0,0,701,24335,0,0,1229,72841,0,0,358,7388,0,0;QS=3,0;MQSB=0.939898;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,129:5:0	0,12,126:4:0
-X	2987	.	C	<*>	0	.	DP=21;I16=10,10,0,0,720,26782,0,0,1169,69241,0,0,350,7448,0,0;QS=3,0;MQSB=0.931063;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,136:4:0	0,12,132:4:0
-X	2988	.	T	<*>	0	.	DP=20;I16=10,10,0,0,693,25143,0,0,1169,69241,0,0,358,7612,0,0;QS=3,0;MQSB=0.931063;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,132:5:0	0,12,136:4:0
-X	2989	.	G	<*>	0	.	DP=20;I16=10,10,0,0,708,25886,0,0,1169,69241,0,0,358,7736,0,0;QS=3,0;MQSB=0.931063;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,141:5:0	0,12,125:4:0
-X	2990	.	C	<*>	0	.	DP=20;I16=10,10,0,0,697,25083,0,0,1169,69241,0,0,357,7833,0,0;QS=3,0;MQSB=0.931063;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,149:5:0	0,12,129:4:0
-X	2991	.	A	<*>	0	.	DP=20;I16=10,10,0,0,717,26309,0,0,1169,69241,0,0,356,7952,0,0;QS=3,0;MQSB=0.931063;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,151:5:0	0,12,131:4:0
-X	2992	.	G	<*>	0	.	DP=18;I16=10,8,0,0,625,22505,0,0,1049,62041,0,0,356,8042,0,0;QS=3,0;MQSB=0.938795;MQ0F=0	PL:DP:DV	0,30,243:10:0	0,12,130:4:0	0,12,120:4:0
-X	2993	.	G	<*>	0	.	DP=18;I16=10,8,0,0,646,23620,0,0,1049,62041,0,0,354,8050,0,0;QS=3,0;MQSB=0.938795;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,118:4:0	0,12,123:4:0
-X	2994	.	G	<*>	0	.	DP=18;I16=10,8,0,0,620,21828,0,0,1049,62041,0,0,351,8025,0,0;QS=3,0;MQSB=0.938795;MQ0F=0	PL:DP:DV	0,30,254:10:0	0,12,115:4:0	0,12,116:4:0
-X	2995	.	G	<*>	0	.	DP=18;I16=10,8,0,0,628,22284,0,0,1049,62041,0,0,348,8018,0,0;QS=3,0;MQSB=0.938795;MQ0F=0	PL:DP:DV	0,30,248:10:0	0,12,110:4:0	0,12,135:4:0
-X	2996	.	T	<*>	0	.	DP=17;I16=8,8,0,0,497,16697,0,0,929,54841,0,0,323,7493,0,0;QS=3,0;MQSB=0.915545;MQ0F=0	PL:DP:DV	0,30,215:10:0	0,9,75:3:0	0,9,107:3:0
-X	2997	.	C	<*>	0	.	DP=17;I16=9,8,0,0,603,21925,0,0,989,58441,0,0,341,7901,0,0;QS=3,0;MQSB=0.928603;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,85:3:0	0,12,115:4:0
-X	2998	.	C	<*>	0	.	DP=17;I16=9,8,0,0,576,19964,0,0,989,58441,0,0,337,7841,0,0;QS=3,0;MQSB=0.928603;MQ0F=0	PL:DP:DV	0,30,247:10:0	0,9,84:3:0	0,12,123:4:0
-X	2999	.	A	<*>	0	.	DP=17;I16=9,8,0,0,599,22077,0,0,989,58441,0,0,333,7797,0,0;QS=3,0;MQSB=0.928603;MQ0F=0	PL:DP:DV	0,30,238:10:0	0,9,109:3:0	0,12,136:4:0
-X	3000	.	G	<*>	0	.	DP=15;I16=8,7,0,0,554,20620,0,0,869,51241,0,0,331,7767,0,0;QS=3,0;MQSB=0.921243;MQ0F=0	PL:DP:DV	0,24,220:8:0	0,9,102:3:0	0,12,135:4:0
-X	3001	.	C	<*>	0	.	DP=15;I16=7,7,0,0,521,19695,0,0,809,47641,0,0,309,7349,0,0;QS=3,0;MQSB=0.885987;MQ0F=0	PL:DP:DV	0,21,213:7:0	0,9,103:3:0	0,12,128:4:0
-X	3002	.	A	<*>	0	.	DP=15;I16=8,7,0,0,542,20082,0,0,869,51241,0,0,326,7692,0,0;QS=3,0;MQSB=0.921243;MQ0F=0	PL:DP:DV	0,24,224:8:0	0,9,92:3:0	0,12,139:4:0
-X	3003	.	G	<*>	0	.	DP=15;I16=8,7,0,0,540,19814,0,0,869,51241,0,0,322,7594,0,0;QS=3,0;MQSB=0.921243;MQ0F=0	PL:DP:DV	0,24,230:8:0	0,9,96:3:0	0,12,120:4:0
-X	3004	.	C	<*>	0	.	DP=15;I16=8,7,0,0,525,19113,0,0,869,51241,0,0,318,7504,0,0;QS=3,0;MQSB=0.921243;MQ0F=0	PL:DP:DV	0,24,211:8:0	0,9,100:3:0	0,12,129:4:0
-X	3005	.	A	<*>	0	.	DP=14;I16=7,7,0,0,491,17343,0,0,809,47641,0,0,315,7421,0,0;QS=3,0;MQSB=0.885987;MQ0F=0	PL:DP:DV	0,21,197:7:0	0,9,95:3:0	0,12,124:4:0
-X	3006	.	C	<*>	0	.	DP=16;I16=7,8,0,0,516,18376,0,0,869,51241,0,0,312,7344,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,24,200:8:0	0,9,95:3:0	0,12,135:4:0
-X	3007	.	C	<*>	0	.	DP=16;I16=7,8,0,0,553,20853,0,0,869,51241,0,0,310,7274,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,24,214:8:0	0,9,103:3:0	0,12,144:4:0
-X	3008	.	C	<*>	0	.	DP=16;I16=7,8,0,0,576,22238,0,0,869,51241,0,0,308,7212,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,24,228:8:0	0,9,105:3:0	0,12,145:4:0
-X	3009	.	A	<*>	0	.	DP=16;I16=7,8,0,0,493,16739,0,0,869,51241,0,0,306,7158,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,24,200:8:0	0,9,83:3:0	0,12,130:4:0
-X	3010	.	C	<*>	0	.	DP=15;I16=7,7,0,0,534,20464,0,0,809,47641,0,0,300,7096,0,0;QS=3,0;MQSB=0.885987;MQ0F=0	PL:DP:DV	0,21,211:7:0	0,9,106:3:0	0,12,135:4:0
-X	3011	.	A	<*>	0	.	DP=16;I16=7,8,0,0,559,21173,0,0,869,51241,0,0,302,7074,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,24,218:8:0	0,9,104:3:0	0,12,145:4:0
-X	3012	.	G	<*>	0	.	DP=16;I16=7,8,0,0,503,17903,0,0,869,51241,0,0,300,7044,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,24,193:8:0	0,9,93:3:0	0,12,141:4:0
-X	3013	.	C	<*>	0	.	DP=16;I16=7,9,0,0,549,19967,0,0,898,52082,0,0,305,7071,0,0;QS=3,0;MQSB=0.994413;MQ0F=0	PL:DP:DV	0,27,207:9:0	0,9,98:3:0	0,12,141:4:0
-X	3014	.	A	<*>	0	.	DP=18;I16=6,9,0,0,542,20362,0,0,838,48482,0,0,289,6959,0,0;QS=3,0;MQSB=0.984496;MQ0F=0	PL:DP:DV	0,24,195:8:0	0,9,109:3:0	0,12,141:4:0
-X	3015	.	G	<*>	0	.	DP=20;I16=7,9,0,0,549,19441,0,0,929,54841,0,0,311,7547,0,0;QS=3,0;MQSB=0.892753;MQ0F=0	PL:DP:DV	0,24,206:8:0	0,12,116:4:0	0,12,131:4:0
-X	3016	.	C	<*>	0	.	DP=20;I16=7,13,0,0,690,24374,0,0,1138,66482,0,0,337,7783,0,0;QS=3,0;MQSB=0.972138;MQ0F=0	PL:DP:DV	0,33,248:11:0	0,15,136:5:0	0,12,132:4:0
-X	3017	.	C	A,<*>	0	.	DP=20;I16=7,12,0,1,650,23264,23,529,1109,65641,29,841,329,7715,11,121;QS=2.93801,0.0619946,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.972138;BQB=1;MQ0F=0	PL:DP:DV	0,10,224,30,227,236:11:1	0,15,133,15,133,133:5:0	0,12,128,12,128,128:4:0
-X	3018	.	A	<*>	0	.	DP=21;I16=6,10,0,0,475,15057,0,0,929,54841,0,0,295,6991,0,0;QS=3,0;MQSB=0.863243;MQ0F=0	PL:DP:DV	0,27,192:9:0	0,12,111:4:0	0,9,81:3:0
-X	3019	.	C	<*>	0	.	DP=20;I16=6,12,0,0,618,21842,0,0,1049,62041,0,0,336,7818,0,0;QS=3,0;MQSB=0.85394;MQ0F=0	PL:DP:DV	0,30,242:10:0	0,15,129:5:0	0,9,104:3:0
-X	3020	.	C	<*>	0	.	DP=20;I16=6,12,0,0,588,21046,0,0,1049,62041,0,0,340,7888,0,0;QS=3,0;MQSB=0.85394;MQ0F=0	PL:DP:DV	0,30,221:10:0	0,15,129:5:0	0,9,114:3:0
-X	3021	.	T	<*>	0	.	DP=21;I16=5,13,0,0,618,22454,0,0,1049,62041,0,0,343,7921,0,0;QS=3,0;MQSB=0.814433;MQ0F=0	PL:DP:DV	0,30,216:10:0	0,15,147:5:0	0,9,109:3:0
-X	3022	.	G	<*>	0	.	DP=20;I16=5,13,0,0,672,25292,0,0,1049,62041,0,0,348,7968,0,0;QS=3,0;MQSB=0.814433;MQ0F=0	PL:DP:DV	0,30,234:10:0	0,15,153:5:0	0,9,109:3:0
-X	3023	.	T	G,<*>	0	.	DP=20;I16=5,12,0,1,554,19110,18,324,989,58441,60,3600,336,7740,17,289;QS=2.94231,0.0576923,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.814433;BQB=1;MQ0F=0	PL:DP:DV	0,12,191,27,194,199:10:1	0,15,125,15,125,125:5:0	0,9,111,9,111,111:3:0
-X	3024	.	G	<*>	0	.	DP=20;I16=5,14,0,0,684,25122,0,0,1109,65641,0,0,382,8680,0,0;QS=3,0;MQSB=0.810584;MQ0F=0	PL:DP:DV	0,30,235:10:0	0,18,152:6:0	0,9,113:3:0
-X	3025	.	G	<*>	0	.	DP=20;I16=5,14,0,0,625,21465,0,0,1109,65641,0,0,386,8722,0,0;QS=3,0;MQSB=0.810584;MQ0F=0	PL:DP:DV	0,30,225:10:0	0,18,133:6:0	0,9,109:3:0
-X	3026	.	C	<*>	0	.	DP=20;I16=5,13,0,0,632,23132,0,0,1018,59282,0,0,367,8217,0,0;QS=3,0;MQSB=0.925212;MQ0F=0	PL:DP:DV	0,33,235:11:0	0,12,105:4:0	0,9,107:3:0
-X	3027	.	A	<*>	0	.	DP=21;I16=6,15,0,0,693,24199,0,0,1198,70082,0,0,413,9199,0,0;QS=3,0;MQSB=0.940481;MQ0F=0	PL:DP:DV	0,33,222:11:0	0,21,175:7:0	0,9,108:3:0
-X	3028	.	G	<*>	0	.	DP=21;I16=6,15,0,0,753,27935,0,0,1198,70082,0,0,417,9239,0,0;QS=3,0;MQSB=0.940481;MQ0F=0	PL:DP:DV	0,33,241:11:0	0,21,192:7:0	0,9,107:3:0
-X	3029	.	G	<*>	0	.	DP=21;I16=6,15,0,0,787,29949,0,0,1198,70082,0,0,421,9303,0,0;QS=3,0;MQSB=0.940481;MQ0F=0	PL:DP:DV	0,33,251:11:0	0,21,189:7:0	0,9,109:3:0
-X	3030	.	G	<*>	0	.	DP=22;I16=6,16,0,0,720,24728,0,0,1258,73682,0,0,424,9342,0,0;QS=3,0;MQSB=0.934321;MQ0F=0	PL:DP:DV	0,36,229:12:0	0,21,174:7:0	0,9,106:3:0
-X	3031	.	A	<*>	0	.	DP=22;I16=5,16,0,0,693,24631,0,0,1198,70082,0,0,403,8783,0,0;QS=3,0;MQSB=0.902014;MQ0F=0	PL:DP:DV	0,36,222:12:0	0,18,162:6:0	0,9,113:3:0
-X	3032	.	G	<*>	0	.	DP=22;I16=6,15,0,0,727,26093,0,0,1229,72841,0,0,405,8775,0,0;QS=3,0;MQSB=0.843281;MQ0F=0	PL:DP:DV	0,33,237:11:0	0,21,180:7:0	0,9,106:3:0
-X	3033	.	G	<*>	0	.	DP=22;I16=6,15,0,0,697,24039,0,0,1198,70082,0,0,429,9407,0,0;QS=3,0;MQSB=0.940481;MQ0F=0	PL:DP:DV	0,33,235:11:0	0,21,160:7:0	0,9,106:3:0
-X	3034	.	A	<*>	0	.	DP=23;I16=6,14,0,0,617,20947,0,0,1138,66482,0,0,387,8491,0,0;QS=3,0;MQSB=0.947033;MQ0F=0	PL:DP:DV	0,33,203:11:0	0,15,134:5:0	0,12,126:4:0
-X	3035	.	G	<*>	0	.	DP=23;I16=7,13,0,0,641,22007,0,0,1138,66482,0,0,385,8379,0,0;QS=3,0;MQSB=0.972138;MQ0F=0	PL:DP:DV	0,30,208:10:0	0,18,151:6:0	0,12,128:4:0
-X	3036	.	C	<*>	0	.	DP=23;I16=6,15,0,0,688,23652,0,0,1198,70082,0,0,388,8258,0,0;QS=3,0;MQSB=0.940481;MQ0F=0	PL:DP:DV	0,36,216:12:0	0,15,132:5:0	0,12,140:4:0
-X	3037	.	T	<*>	0	.	DP=24;I16=7,16,0,0,797,28671,0,0,1318,77282,0,0,439,9521,0,0;QS=3,0;MQSB=0.955805;MQ0F=0	PL:DP:DV	0,36,242:12:0	0,21,170:7:0	0,12,143:4:0
-X	3038	.	T	<*>	0	.	DP=25;I16=8,17,0,0,815,27469,0,0,1438,84482,0,0,441,9561,0,0;QS=3,0;MQSB=0.966223;MQ0F=0	PL:DP:DV	0,42,249:14:0	0,21,190:7:0	0,12,125:4:0
-X	3039	.	G	<*>	0	.	DP=25;I16=8,17,0,0,780,25946,0,0,1438,84482,0,0,444,9630,0,0;QS=3,0;MQSB=0.966223;MQ0F=0	PL:DP:DV	0,42,249:14:0	0,21,156:7:0	0,12,127:4:0
-X	3040	.	T	<*>	0	.	DP=25;I16=7,15,0,0,701,23777,0,0,1258,73682,0,0,385,8279,0,0;QS=3,0;MQSB=0.961028;MQ0F=0	PL:DP:DV	0,36,239:12:0	0,18,154:6:0	0,12,130:4:0
-X	3041	.	G	<*>	0	.	DP=25;I16=8,16,0,0,824,29228,0,0,1378,80882,0,0,420,8982,0,0;QS=3,0;MQSB=0.970446;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,186:7:0	0,12,135:4:0
-X	3042	.	G	<*>	0	.	DP=25;I16=8,15,0,0,795,28227,0,0,1349,80041,0,0,409,8839,0,0;QS=3,0;MQSB=0.889418;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,148:6:0	0,12,120:4:0
-X	3043	.	T	<*>	0	.	DP=25;I16=8,16,0,0,723,23191,0,0,1378,80882,0,0,435,9415,0,0;QS=3,0;MQSB=0.970446;MQ0F=0	PL:DP:DV	0,39,233:13:0	0,21,151:7:0	0,12,124:4:0
-X	3044	.	A	C,<*>	0	.	DP=26;I16=8,15,0,1,665,20809,15,225,1318,77282,60,3600,392,8498,14,196;QS=2.96104,0.038961,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.970446;BQB=1;MQ0F=0	PL:DP:DV	0,26,216,39,219,220:14:1	0,18,133,18,133,133:6:0	0,12,124,12,124,124:4:0
-X	3045	.	C	<*>	0	.	DP=26;I16=8,16,0,0,754,25232,0,0,1378,80882,0,0,403,8627,0,0;QS=3,0;MQSB=0.970446;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,133:6:0	0,12,122:4:0
-X	3046	.	A	<*>	0	.	DP=25;I16=8,15,0,0,748,26170,0,0,1349,80041,0,0,400,8540,0,0;QS=3,0;MQSB=0.889418;MQ0F=0	PL:DP:DV	0,39,245:13:0	0,18,160:6:0	0,12,141:4:0
-X	3047	.	G	<*>	0	.	DP=25;I16=8,15,0,0,766,26998,0,0,1318,77282,0,0,396,8432,0,0;QS=3,0;MQSB=0.974802;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,143:6:0	0,12,129:4:0
-X	3048	.	T	<*>	0	.	DP=25;I16=8,11,0,0,608,20554,0,0,1109,65641,0,0,320,6762,0,0;QS=3,0;MQSB=0.902014;MQ0F=0	PL:DP:DV	0,30,226:10:0	0,15,128:5:0	0,12,129:4:0
-X	3049	.	G	<*>	0	.	DP=24;I16=8,16,0,0,831,29557,0,0,1378,80882,0,0,426,9068,0,0;QS=3,0;MQSB=0.970446;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,161:6:0	0,9,105:3:0
-X	3050	.	G	<*>	0	.	DP=24;I16=8,14,0,0,729,25093,0,0,1258,73682,0,0,379,8041,0,0;QS=3,0;MQSB=0.979255;MQ0F=0	PL:DP:DV	0,39,253:13:0	0,18,159:6:0	0,9,100:3:0
-X	3051	.	A	<*>	0	.	DP=23;I16=8,15,0,0,724,24200,0,0,1318,77282,0,0,423,9091,0,0;QS=3,0;MQSB=0.974802;MQ0F=0	PL:DP:DV	0,42,243:14:0	0,18,152:6:0	0,9,103:3:0
-X	3052	.	C	<*>	0	.	DP=23;I16=7,13,0,0,612,19876,0,0,1169,69241,0,0,363,7779,0,0;QS=3,0;MQSB=0.962269;MQ0F=0	PL:DP:DV	0,36,226:12:0	0,15,117:5:0	0,9,93:3:0
-X	3053	.	A	<*>	0	.	DP=22;I16=8,11,0,0,616,21288,0,0,1078,62882,0,0,360,7740,0,0;QS=3,0;MQSB=0.992359;MQ0F=0	PL:DP:DV	0,33,234:11:0	0,15,118:5:0	0,9,110:3:0
-X	3054	.	G	<*>	0	.	DP=22;I16=8,14,0,0,761,27617,0,0,1258,73682,0,0,414,8932,0,0;QS=3,0;MQSB=0.979255;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,126:5:0	0,9,99:3:0
-X	3055	.	G	<*>	0	.	DP=22;I16=8,9,0,0,566,19890,0,0,958,55682,0,0,333,7219,0,0;QS=3,0;MQSB=0.998843;MQ0F=0	PL:DP:DV	0,30,228:10:0	0,12,111:4:0	0,9,105:3:0
-X	3056	.	C	<*>	0	.	DP=22;I16=7,14,0,0,701,24685,0,0,1198,70082,0,0,420,9298,0,0;QS=3,0;MQSB=0.966484;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,125:4:0	0,12,122:4:0
-X	3057	.	C	<*>	0	.	DP=23;I16=8,13,0,0,706,24988,0,0,1198,70082,0,0,411,9253,0,0;QS=3,0;MQSB=0.983744;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,128:5:0	0,9,92:3:0
-X	3058	.	C	<*>	0	.	DP=23;I16=9,14,0,0,707,23327,0,0,1318,77282,0,0,429,9471,0,0;QS=3,0;MQSB=0.987676;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,131:5:0	0,12,116:4:0
-X	3059	.	T	G,<*>	0	.	DP=23;I16=9,11,0,1,638,21954,16,256,1169,69241,60,3600,355,7761,22,484;QS=2.95876,0.0412371,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.913101;BQB=1;MQ0F=0	PL:DP:DV	0,22,234,36,237,239:13:1	0,15,144,15,144,144:5:0	0,9,94,9,94,94:3:0
-X	3060	.	G	<*>	0	.	DP=24;I16=9,10,0,0,578,19136,0,0,1109,65641,0,0,324,6992,0,0;QS=3,0;MQSB=0.920044;MQ0F=0	PL:DP:DV	0,33,221:11:0	0,12,121:4:0	0,12,116:4:0
-X	3061	.	C	<*>	0	.	DP=24;I16=9,15,0,0,770,25918,0,0,1378,80882,0,0,446,10136,0,0;QS=3,0;MQSB=0.984127;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,138:5:0	0,15,145:5:0
-X	3062	.	C	<*>	0	.	DP=23;I16=9,13,0,0,727,25019,0,0,1289,76441,0,0,419,9551,0,0;QS=3,0;MQSB=0.910098;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,137:5:0	0,15,134:5:0
-X	3063	.	C	<*>	0	.	DP=23;I16=9,13,0,0,651,21695,0,0,1258,73682,0,0,415,9511,0,0;QS=3,0;MQSB=0.991121;MQ0F=0	PL:DP:DV	0,36,233:12:0	0,15,130:5:0	0,15,133:5:0
-X	3064	.	A	<*>	0	.	DP=23;I16=9,12,0,0,691,24125,0,0,1198,70082,0,0,385,8815,0,0;QS=3,0;MQSB=0.994334;MQ0F=0	PL:DP:DV	0,36,254:12:0	0,12,118:4:0	0,15,144:5:0
-X	3065	.	G	<*>	0	.	DP=22;I16=7,14,0,0,653,21733,0,0,1198,70082,0,0,426,9986,0,0;QS=3,0;MQSB=0.966484;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,109:4:0	0,12,118:4:0
-X	3066	.	A	<*>	0	.	DP=21;I16=7,10,0,0,501,16143,0,0,989,58441,0,0,326,7598,0,0;QS=3,0;MQSB=0.887766;MQ0F=0	PL:DP:DV	0,27,202:9:0	0,12,109:4:0	0,12,104:4:0
-X	3067	.	T	<*>	0	.	DP=21;I16=7,12,0,0,535,16779,0,0,1078,62882,0,0,373,8787,0,0;QS=3,0;MQSB=0.977926;MQ0F=0	PL:DP:DV	0,36,223:12:0	0,9,82:3:0	0,12,103:4:0
-X	3068	.	G	<*>	0	.	DP=20;I16=7,12,0,0,645,22781,0,0,1109,65641,0,0,396,9312,0,0;QS=3,0;MQSB=0.879351;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,115:4:0	0,9,84:3:0
-X	3069	.	G	<*>	0	.	DP=20;I16=7,10,0,0,468,14412,0,0,989,58441,0,0,346,8070,0,0;QS=3,0;MQSB=0.887766;MQ0F=0	PL:DP:DV	0,33,203:11:0	0,12,102:4:0	0,6,57:2:0
-X	3070	.	C	<*>	0	.	DP=20;I16=6,13,0,0,627,22135,0,0,1078,62882,0,0,414,9878,0,0;QS=3,0;MQSB=0.953977;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,98:3:0	0,9,98:3:0
-X	3071	.	C	<*>	0	.	DP=20;I16=7,13,0,0,715,26563,0,0,1138,66482,0,0,419,9893,0,0;QS=3,0;MQSB=0.972138;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,123:4:0	0,9,98:3:0
-X	3072	.	C	<*>	0	.	DP=20;I16=6,13,0,0,696,25784,0,0,1109,65641,0,0,414,9866,0,0;QS=3,0;MQSB=0.965977;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,128:4:0	0,9,106:3:0
-X	3073	.	C	<*>	0	.	DP=20;I16=6,13,0,0,706,26822,0,0,1109,65641,0,0,414,9872,0,0;QS=3,0;MQSB=0.965977;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,135:4:0	0,9,115:3:0
-X	3074	.	C	<*>	0	.	DP=20;I16=6,13,0,0,724,28052,0,0,1109,65641,0,0,414,9886,0,0;QS=3,0;MQSB=0.965977;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,135:4:0	0,9,116:3:0
-X	3075	.	C	<*>	0	.	DP=21;I16=6,13,0,0,630,21614,0,0,1109,65641,0,0,389,9283,0,0;QS=3,0;MQSB=0.965977;MQ0F=0	PL:DP:DV	0,33,239:11:0	0,15,140:5:0	0,9,94:3:0
-X	3076	.	G	<*>	0	.	DP=21;I16=6,14,0,0,645,21809,0,0,1169,69241,0,0,415,9939,0,0;QS=3,0;MQSB=0.969852;MQ0F=0	PL:DP:DV	0,36,252:12:0	0,15,126:5:0	0,9,91:3:0
-X	3077	.	C	<*>	0	.	DP=20;I16=5,15,0,0,694,25228,0,0,1169,69241,0,0,417,9979,0,0;QS=3,0;MQSB=0.976472;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,116:4:0	0,9,111:3:0
-X	3078	.	C	<*>	0	.	DP=20;I16=5,15,0,0,767,29761,0,0,1169,69241,0,0,420,10028,0,0;QS=3,0;MQSB=0.976472;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,113:4:0	0,9,111:3:0
-X	3079	.	T	<*>	0	.	DP=20;I16=5,15,0,0,749,28479,0,0,1169,69241,0,0,422,10038,0,0;QS=3,0;MQSB=0.976472;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,119:4:0	0,9,116:3:0
-X	3080	.	G	<*>	0	.	DP=21;I16=6,15,0,0,785,29901,0,0,1229,72841,0,0,424,10060,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,124:4:0	0,9,103:3:0
-X	3081	.	C	<*>	0	.	DP=21;I16=6,15,0,0,752,27438,0,0,1229,72841,0,0,425,9997,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,118:4:0	0,9,92:3:0
-X	3082	.	C	<*>	0	.	DP=21;I16=6,15,0,0,787,30211,0,0,1229,72841,0,0,426,9952,0,0;QS=3,0;MQSB=0.973096;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,118:4:0	0,9,112:3:0
-X	3083	.	T	C,<*>	0	.	DP=21;I16=6,14,0,1,764,29458,33,1089,1169,69241,60,3600,401,9249,25,625;QS=2.93666,0.0633397,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.973096;BQB=1;MQ0F=0	PL:DP:DV	0,9,255,39,255,255:14:1	0,12,130,12,130,130:4:0	0,9,113,9,113,113:3:0
-X	3084	.	G	<*>	0	.	DP=23;I16=6,17,0,0,859,32755,0,0,1349,80041,0,0,426,9812,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,118:4:0	0,12,135:4:0
-X	3085	.	T	<*>	0	.	DP=23;I16=6,16,0,0,824,31132,0,0,1289,76441,0,0,426,9718,0,0;QS=3,0;MQSB=0.97584;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,124:4:0	0,12,135:4:0
-X	3086	.	G	<*>	0	.	DP=23;I16=6,17,0,0,853,32429,0,0,1349,80041,0,0,428,9648,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,125:4:0	0,12,131:4:0
-X	3087	.	G	<*>	0	.	DP=23;I16=6,17,0,0,897,35253,0,0,1349,80041,0,0,429,9599,0,0;QS=3,0;MQSB=0.978183;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,130:4:0	0,12,137:4:0
-X	3088	.	A	<*>	0	.	DP=22;I16=6,16,0,0,834,31738,0,0,1289,76441,0,0,431,9571,0,0;QS=3,0;MQSB=0.97584;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,110:3:0	0,12,135:4:0
-X	3089	.	A	<*>	0	.	DP=23;I16=7,16,0,0,919,36903,0,0,1349,80041,0,0,432,9514,0,0;QS=3,0;MQSB=0.973027;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,113:3:0	0,15,175:5:0
-X	3090	.	G	<*>	0	.	DP=23;I16=7,16,0,0,885,34349,0,0,1349,80041,0,0,433,9431,0,0;QS=3,0;MQSB=0.973027;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,103:3:0	0,15,160:5:0
-X	3091	.	T	<*>	0	.	DP=23;I16=7,16,0,0,840,31352,0,0,1349,80041,0,0,434,9374,0,0;QS=3,0;MQSB=0.973027;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,105:3:0	0,15,153:5:0
-X	3092	.	T	<*>	0	.	DP=24;I16=8,16,0,0,895,33673,0,0,1409,83641,0,0,434,9294,0,0;QS=3,0;MQSB=0.970446;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,109:3:0	0,15,165:5:0
-X	3093	.	G	<*>	0	.	DP=25;I16=9,16,0,0,955,37033,0,0,1469,87241,0,0,434,9192,0,0;QS=3,0;MQSB=0.968069;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,133:4:0	0,15,157:5:0
-X	3094	.	A	<*>	0	.	DP=25;I16=9,15,0,0,891,33319,0,0,1409,83641,0,0,425,9019,0,0;QS=3,0;MQSB=0.96464;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,134:4:0	0,15,161:5:0
-X	3095	.	C	<*>	0	.	DP=25;I16=9,15,0,0,891,33469,0,0,1409,83641,0,0,425,8955,0,0;QS=3,0;MQSB=0.96464;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,131:4:0	0,15,163:5:0
-X	3096	.	C	<*>	0	.	DP=25;I16=9,16,0,0,952,36626,0,0,1469,87241,0,0,436,9014,0,0;QS=3,0;MQSB=0.968069;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,121:4:0	0,15,167:5:0
-X	3097	.	A	<*>	0	.	DP=25;I16=9,16,0,0,972,38200,0,0,1469,87241,0,0,436,8984,0,0;QS=3,0;MQSB=0.968069;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,144:4:0	0,15,174:5:0
-X	3098	.	G	<*>	0	.	DP=25;I16=9,16,0,0,959,37269,0,0,1469,87241,0,0,436,8986,0,0;QS=3,0;MQSB=0.968069;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,134:4:0	0,15,166:5:0
-X	3099	.	A	<*>	0	.	DP=25;I16=9,16,0,0,888,32632,0,0,1469,87241,0,0,435,8971,0,0;QS=3,0;MQSB=0.968069;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,124:4:0	0,15,165:5:0
-X	3100	.	C	<*>	0	.	DP=25;I16=9,16,0,0,870,31084,0,0,1469,87241,0,0,434,8990,0,0;QS=3,0;MQSB=0.968069;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,126:4:0	0,15,159:5:0
-X	3101	.	C	<*>	0	.	DP=25;I16=9,16,0,0,960,37090,0,0,1469,87241,0,0,432,8992,0,0;QS=3,0;MQSB=0.968069;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,134:4:0	0,15,161:5:0
-X	3102	.	A	<*>	0	.	DP=26;I16=10,16,0,0,952,35186,0,0,1529,90841,0,0,430,9026,0,0;QS=3,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,134:4:0	0,18,189:6:0
-X	3103	.	T	<*>	0	.	DP=26;I16=10,16,0,0,920,33094,0,0,1529,90841,0,0,427,8993,0,0;QS=3,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,131:4:0	0,18,187:6:0
-X	3104	.	C	T,<*>	0	.	DP=25;I16=8,15,2,0,900,35584,80,3202,1349,80041,120,7200,385,8143,40,850;QS=2.58763,0.412371,0;VDB=0.8;SGB=0.346553;RPB=0.717391;MQB=0.956522;MQSB=0.962269;BQB=0.978261;MQ0F=0	PL:DP:DV	0,48,255,48,255,255:16:0	0,12,144,12,144,144:4:0	59,0,93,68,99,157:5:2
-X	3105	.	T	<*>	0	.	DP=25;I16=10,15,0,0,959,37057,0,0,1469,87241,0,0,422,8976,0,0;QS=3,0;MQSB=0.962269;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,12,149:4:0	0,15,169:5:0
-X	3106	.	G	<*>	0	.	DP=23;I16=10,13,0,0,881,33891,0,0,1380,82800,0,0,420,8940,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,132:4:0	0,15,167:5:0
-X	3107	.	T	<*>	0	.	DP=24;I16=10,14,0,0,878,32496,0,0,1440,86400,0,0,418,8932,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,132:4:0	0,18,195:6:0
-X	3108	.	C	<*>	0	.	DP=24;I16=10,14,0,0,909,34897,0,0,1440,86400,0,0,417,8953,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,137:4:0	0,18,189:6:0
-X	3109	.	A	<*>	0	.	DP=24;I16=10,14,0,0,905,34249,0,0,1440,86400,0,0,416,9004,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,136:4:0	0,18,195:6:0
-X	3110	.	C	<*>	0	.	DP=24;I16=10,13,0,0,919,37099,0,0,1380,82800,0,0,413,8933,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,105:3:0	0,18,189:6:0
-X	3111	.	A	<*>	0	.	DP=25;I16=10,14,0,0,961,38943,0,0,1440,86400,0,0,410,8888,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,111:3:0	0,18,205:6:0
-X	3112	.	G	<*>	0	.	DP=25;I16=10,14,0,0,958,39370,0,0,1440,86400,0,0,407,8821,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,116:3:0	0,18,191:6:0
-X	3113	.	C	<*>	0	.	DP=25;I16=10,14,0,0,961,39641,0,0,1440,86400,0,0,403,8735,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,112:3:0	0,18,193:6:0
-X	3114	.	A	<*>	0	.	DP=24;I16=10,13,0,0,928,38448,0,0,1380,82800,0,0,400,8680,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,116:3:0	0,18,200:6:0
-X	3115	.	G	<*>	0	.	DP=23;I16=10,12,0,0,872,35800,0,0,1320,79200,0,0,397,8603,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,117:3:0	0,18,195:6:0
-X	3116	.	G	<*>	0	.	DP=23;I16=10,12,0,0,870,35372,0,0,1320,79200,0,0,394,8552,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,108:3:0	0,18,194:6:0
-X	3117	.	T	<*>	0	.	DP=22;I16=9,13,0,0,771,27537,0,0,1320,79200,0,0,399,8575,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,96:3:0	0,18,177:6:0
-X	3118	.	A	<*>	0	.	DP=22;I16=9,13,0,0,813,30285,0,0,1320,79200,0,0,397,8537,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,111:3:0	0,18,193:6:0
-X	3119	.	A	<*>	0	.	DP=22;I16=9,13,0,0,886,35954,0,0,1320,79200,0,0,393,8423,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,120:3:0	0,18,207:6:0
-X	3120	.	G	<*>	0	.	DP=22;I16=9,13,0,0,839,32281,0,0,1320,79200,0,0,389,8333,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,104:3:0	0,18,182:6:0
-X	3121	.	A	<*>	0	.	DP=22;I16=10,12,0,0,777,28399,0,0,1320,79200,0,0,386,8266,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,111:3:0	0,18,194:6:0
-X	3122	.	C	<*>	0	.	DP=22;I16=10,12,0,0,848,33002,0,0,1320,79200,0,0,384,8222,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,110:3:0	0,18,192:6:0
-X	3123	.	T	<*>	0	.	DP=22;I16=10,12,0,0,854,33456,0,0,1320,79200,0,0,382,8202,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,114:3:0	0,18,204:6:0
-X	3124	.	C	<*>	0	.	DP=22;I16=10,11,0,0,882,38286,0,0,1260,75600,0,0,381,8205,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,104:3:0	0,15,178:5:0
-X	3125	.	T	<*>	0	.	DP=22;I16=10,11,0,0,860,36764,0,0,1260,75600,0,0,380,8230,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,106:3:0	0,15,185:5:0
-X	3126	.	G	<*>	0	.	DP=22;I16=10,11,0,0,834,34998,0,0,1260,75600,0,0,379,8277,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,97:3:0	0,15,174:5:0
-X	3127	.	C	<*>	0	.	DP=23;I16=10,11,0,0,847,36381,0,0,1260,75600,0,0,378,8346,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,87:3:0	0,15,175:5:0
-X	3128	.	T	<*>	0	.	DP=22;I16=9,12,0,0,850,35972,0,0,1229,72841,0,0,402,9010,0,0;QS=3,0;MQSB=0.950149;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,107:3:0	0,15,182:5:0
-X	3129	.	T	<*>	0	.	DP=22;I16=9,12,0,0,809,32621,0,0,1229,72841,0,0,401,9067,0,0;QS=3,0;MQSB=0.950149;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,107:3:0	0,15,178:5:0
-X	3130	.	T	<*>	0	.	DP=21;I16=9,10,0,0,744,30322,0,0,1140,68400,0,0,376,8516,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,82:2:0	0,15,169:5:0
-X	3131	.	C	<*>	0	.	DP=21;I16=9,10,0,0,792,34778,0,0,1140,68400,0,0,376,8606,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,6,83:2:0	0,15,170:5:0
-X	3132	.	T	<*>	0	.	DP=21;I16=9,11,0,0,819,35197,0,0,1169,69241,0,0,400,9288,0,0;QS=3,0;MQSB=0.943233;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,109:3:0	0,15,174:5:0
-X	3133	.	G	<*>	0	.	DP=21;I16=9,11,0,0,800,34016,0,0,1169,69241,0,0,398,9312,0,0;QS=3,0;MQSB=0.943233;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,97:3:0	0,15,166:5:0
-X	3134	.	G	<*>	0	.	DP=22;I16=10,11,0,0,773,30227,0,0,1229,72841,0,0,396,9352,0,0;QS=3,0;MQSB=0.939898;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,97:3:0	0,15,163:5:0
-X	3135	.	G	<*>	0	.	DP=22;I16=9,12,0,0,812,33714,0,0,1229,72841,0,0,396,9408,0,0;QS=3,0;MQSB=0.950149;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,94:3:0	0,12,151:4:0
-X	3136	.	C	<*>	0	.	DP=22;I16=9,12,0,0,811,33469,0,0,1229,72841,0,0,396,9430,0,0;QS=3,0;MQSB=0.950149;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,102:3:0	0,12,140:4:0
-X	3137	.	A	<*>	0	.	DP=22;I16=10,11,0,0,786,31226,0,0,1229,72841,0,0,396,9416,0,0;QS=3,0;MQSB=0.939898;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,95:3:0	0,12,142:4:0
-X	3138	.	A	<*>	0	.	DP=21;I16=9,11,0,0,720,28200,0,0,1169,69241,0,0,398,9414,0,0;QS=3,0;MQSB=0.943233;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,98:3:0	0,12,147:4:0
-X	3139	.	C	<*>	0	.	DP=21;I16=9,11,0,0,755,31433,0,0,1169,69241,0,0,400,9424,0,0;QS=3,0;MQSB=0.943233;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,91:3:0	0,12,139:4:0
-X	3140	.	C	<*>	0	.	DP=21;I16=9,11,0,0,790,33238,0,0,1169,69241,0,0,402,9446,0,0;QS=3,0;MQSB=0.943233;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,102:3:0	0,12,145:4:0
-X	3141	.	C	<*>	0	.	DP=21;I16=9,11,0,0,819,35401,0,0,1169,69241,0,0,404,9480,0,0;QS=3,0;MQSB=0.943233;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,101:3:0	0,12,150:4:0
-X	3142	.	A	<*>	0	.	DP=21;I16=9,11,0,0,822,35744,0,0,1169,69241,0,0,405,9477,0,0;QS=3,0;MQSB=0.943233;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,107:3:0	0,12,155:4:0
-X	3143	.	G	<*>	0	.	DP=22;I16=10,11,0,0,846,36468,0,0,1198,70082,0,0,406,9488,0,0;QS=3,0;MQSB=0.99938;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,104:3:0	0,12,151:4:0
-X	3144	.	C	<*>	0	.	DP=23;I16=12,10,0,0,855,35905,0,0,1258,73682,0,0,409,9513,0,0;QS=3,0;MQSB=0.997828;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,104:3:0	0,15,165:5:0
-X	3145	.	A	<*>	0	.	DP=23;I16=12,10,0,0,869,35937,0,0,1258,73682,0,0,414,9554,0,0;QS=3,0;MQSB=0.997828;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,106:3:0	0,15,174:5:0
-X	3146	.	G	<*>	0	.	DP=23;I16=12,10,0,0,895,38345,0,0,1258,73682,0,0,419,9613,0,0;QS=3,0;MQSB=0.997828;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,105:3:0	0,15,179:5:0
-X	3147	.	G	<*>	0	.	DP=24;I16=11,11,0,0,851,34815,0,0,1289,76441,0,0,419,9623,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,123:4:0	0,15,172:5:0
-X	3148	.	T	<*>	0	.	DP=24;I16=12,11,0,0,795,30097,0,0,1318,77282,0,0,428,9682,0,0;QS=3,0;MQSB=0.999527;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,107:4:0	0,15,149:5:0
-X	3149	.	G	<*>	0	.	DP=24;I16=12,11,0,0,910,38142,0,0,1318,77282,0,0,433,9743,0,0;QS=3,0;MQSB=0.999527;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,120:4:0	0,15,167:5:0
-X	3150	.	A	<*>	0	.	DP=24;I16=12,11,0,0,854,33784,0,0,1318,77282,0,0,438,9822,0,0;QS=3,0;MQSB=0.999527;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,129:4:0	0,15,167:5:0
-X	3151	.	C	<*>	0	.	DP=24;I16=12,11,0,0,873,35315,0,0,1318,77282,0,0,442,9870,0,0;QS=3,0;MQSB=0.999527;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,125:4:0	0,15,163:5:0
-X	3152	.	C	<*>	0	.	DP=24;I16=12,11,0,0,857,34239,0,0,1318,77282,0,0,445,9889,0,0;QS=3,0;MQSB=0.999527;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,123:4:0	0,15,155:5:0
-X	3153	.	C	<*>	0	.	DP=24;I16=12,11,0,0,891,36711,0,0,1318,77282,0,0,448,9930,0,0;QS=3,0;MQSB=0.999527;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,125:4:0	0,15,166:5:0
-X	3154	.	T	<*>	0	.	DP=25;I16=13,11,0,0,938,38052,0,0,1378,80882,0,0,451,9993,0,0;QS=3,0;MQSB=0.998323;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,133:4:0	0,18,194:6:0
-X	3155	.	G	<*>	0	.	DP=25;I16=13,11,0,0,953,39423,0,0,1378,80882,0,0,454,10030,0,0;QS=3,0;MQSB=0.998323;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,127:4:0	0,18,180:6:0
-X	3156	.	G	<*>	0	.	DP=25;I16=13,11,0,0,946,38818,0,0,1378,80882,0,0,457,10093,0,0;QS=3,0;MQSB=0.998323;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,126:4:0	0,18,189:6:0
-X	3157	.	A	<*>	0	.	DP=24;I16=12,12,0,0,896,33648,0,0,1378,80882,0,0,486,10806,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,130:4:0	0,18,193:6:0
-X	3158	.	A	<*>	0	.	DP=24;I16=12,12,0,0,856,31670,0,0,1378,80882,0,0,490,10918,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,125:4:0	0,18,192:6:0
-X	3159	.	T	<*>	0	.	DP=24;I16=11,12,0,0,864,32952,0,0,1349,80041,0,0,477,10749,0,0;QS=3,0;MQSB=0.944319;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,134:4:0	0,18,194:6:0
-X	3160	.	T	<*>	0	.	DP=24;I16=12,12,0,0,907,34719,0,0,1378,80882,0,0,494,11018,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,134:4:0	0,18,193:6:0
-X	3161	.	C	<*>	0	.	DP=24;I16=12,12,0,0,880,33336,0,0,1378,80882,0,0,494,11006,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,123:4:0	0,18,196:6:0
-X	3162	.	C	<*>	0	.	DP=24;I16=12,12,0,0,916,35764,0,0,1378,80882,0,0,494,11018,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,127:4:0	0,18,188:6:0
-X	3163	.	T	A,<*>	0	.	DP=24;I16=11,12,1,0,895,35099,13,169,1349,80041,29,841,473,10603,20,400;QS=2.97436,0.025641,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=1;BQB=1;MQ0F=0	PL:DP:DV	0,28,255,39,255,255:14:1	0,12,137,12,137,137:4:0	0,18,200,18,200,200:6:0
-X	3164	.	G	<*>	0	.	DP=24;I16=12,11,0,0,887,34437,0,0,1349,80041,0,0,467,10385,0,0;QS=3,0;MQSB=0.944319;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,106:3:0	0,18,188:6:0
-X	3165	.	T	<*>	0	.	DP=24;I16=12,12,0,0,880,32654,0,0,1378,80882,0,0,490,10990,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,133:4:0	0,18,189:6:0
-X	3166	.	C	<*>	0	.	DP=24;I16=12,11,0,0,871,33389,0,0,1349,80041,0,0,463,10369,0,0;QS=3,0;MQSB=0.944319;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,111:3:0	0,18,193:6:0
-X	3167	.	C	<*>	0	.	DP=23;I16=12,11,0,0,879,34199,0,0,1318,77282,0,0,487,11021,0,0;QS=3,0;MQSB=0.999527;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,131:4:0	0,18,189:6:0
-X	3168	.	A	<*>	0	.	DP=23;I16=12,11,0,0,874,33294,0,0,1318,77282,0,0,486,11070,0,0;QS=3,0;MQSB=0.999527;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,125:4:0	0,18,192:6:0
-X	3169	.	T	<*>	0	.	DP=23;I16=11,11,0,0,824,31124,0,0,1289,76441,0,0,458,10416,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,128:4:0	0,18,187:6:0
-X	3170	.	C	<*>	0	.	DP=23;I16=11,11,0,0,877,35167,0,0,1289,76441,0,0,453,10307,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,129:4:0	0,18,201:6:0
-X	3171	.	T	<*>	0	.	DP=23;I16=11,11,0,0,843,32615,0,0,1289,76441,0,0,448,10216,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,127:4:0	0,18,201:6:0
-X	3172	.	G	<*>	0	.	DP=23;I16=12,11,0,0,813,29605,0,0,1318,77282,0,0,468,10768,0,0;QS=3,0;MQSB=0.999527;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,120:4:0	0,18,176:6:0
-X	3173	.	G	<*>	0	.	DP=23;I16=11,11,0,0,801,29659,0,0,1289,76441,0,0,436,9988,0,0;QS=3,0;MQSB=0.936864;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,126:4:0	0,18,174:6:0
-X	3174	.	C	<*>	0	.	DP=24;I16=13,11,0,0,938,36926,0,0,1378,80882,0,0,454,10476,0,0;QS=3,0;MQSB=0.998323;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,127:4:0	0,18,194:6:0
-X	3175	.	A	<*>	0	.	DP=25;I16=13,11,0,0,914,35230,0,0,1409,83641,0,0,422,9684,0,0;QS=3,0;MQSB=0.931547;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,127:4:0	0,21,209:7:0
-X	3176	.	G	<*>	0	.	DP=24;I16=14,10,0,0,909,34913,0,0,1378,80882,0,0,442,10164,0,0;QS=3,0;MQSB=0.993166;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,97:3:0	0,21,205:7:0
-X	3177	.	G	<*>	0	.	DP=23;I16=14,9,0,0,793,28159,0,0,1318,77282,0,0,438,10040,0,0;QS=3,0;MQSB=0.987676;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,9,93:3:0	0,21,195:7:0
-X	3178	.	T	<*>	0	.	DP=23;I16=13,9,0,0,754,26290,0,0,1289,76441,0,0,408,9262,0,0;QS=3,0;MQSB=0.910098;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,96:3:0	0,21,173:7:0
-X	3179	.	G	<*>	0	.	DP=23;I16=13,9,0,0,802,29686,0,0,1289,76441,0,0,403,9131,0,0;QS=3,0;MQSB=0.910098;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,97:3:0	0,21,188:7:0
-X	3180	.	G	<*>	0	.	DP=22;I16=12,9,0,0,701,24107,0,0,1229,72841,0,0,398,8970,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,92:3:0	0,21,175:7:0
-X	3181	.	G	<*>	0	.	DP=22;I16=13,9,0,0,795,29503,0,0,1258,73682,0,0,418,9452,0,0;QS=3,0;MQSB=0.991121;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,99:3:0	0,21,193:7:0
-X	3182	.	C	<*>	0	.	DP=22;I16=12,9,0,0,772,28878,0,0,1198,70082,0,0,396,9038,0,0;QS=3,0;MQSB=0.994334;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,99:3:0	0,21,184:7:0
-X	3183	.	A	<*>	0	.	DP=22;I16=12,9,0,0,766,28304,0,0,1229,72841,0,0,382,8546,0,0;QS=3,0;MQSB=0.913101;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,106:3:0	0,21,193:7:0
-X	3184	.	T	<*>	0	.	DP=21;I16=12,8,0,0,721,26533,0,0,1169,69241,0,0,377,8409,0,0;QS=3,0;MQSB=0.898397;MQ0F=0	PL:DP:DV	0,30,248:10:0	0,9,106:3:0	0,21,196:7:0
-X	3185	.	T	<*>	0	.	DP=20;I16=13,7,0,0,740,27660,0,0,1138,66482,0,0,397,8865,0,0;QS=3,0;MQSB=0.972138;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,103:3:0	0,18,174:6:0
-X	3186	.	G	<*>	0	.	DP=20;I16=13,7,0,0,741,28311,0,0,1138,66482,0,0,391,8665,0,0;QS=3,0;MQSB=0.972138;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,103:3:0	0,18,169:6:0
-X	3187	.	A	<*>	0	.	DP=20;I16=13,7,0,0,693,24927,0,0,1138,66482,0,0,385,8485,0,0;QS=3,0;MQSB=0.972138;MQ0F=0	PL:DP:DV	0,33,247:11:0	0,9,102:3:0	0,18,171:6:0
-X	3188	.	A	<*>	0	.	DP=20;I16=13,7,0,0,704,25746,0,0,1138,66482,0,0,379,8325,0,0;QS=3,0;MQSB=0.972138;MQ0F=0	PL:DP:DV	0,33,249:11:0	0,9,100:3:0	0,18,174:6:0
-X	3189	.	A	<*>	0	.	DP=21;I16=13,8,0,0,763,28171,0,0,1198,70082,0,0,373,8185,0,0;QS=3,0;MQSB=0.983744;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,125:4:0	0,18,174:6:0
-X	3190	.	C	<*>	0	.	DP=20;I16=11,8,0,0,675,24915,0,0,1109,65641,0,0,344,7440,0,0;QS=3,0;MQSB=0.902014;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,123:4:0	0,15,148:5:0
-X	3191	.	T	<*>	0	.	DP=21;I16=11,9,0,0,773,30203,0,0,1169,69241,0,0,340,7340,0,0;QS=3,0;MQSB=0.916401;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,130:4:0	0,15,171:5:0
-X	3192	.	G	<*>	0	.	DP=21;I16=12,9,0,0,751,27785,0,0,1198,70082,0,0,362,7886,0,0;QS=3,0;MQSB=0.994334;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,125:4:0	0,15,152:5:0
-X	3193	.	G	<*>	0	.	DP=21;I16=12,9,0,0,756,27614,0,0,1198,70082,0,0,359,7829,0,0;QS=3,0;MQSB=0.994334;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,121:4:0	0,15,148:5:0
-X	3194	.	T	C,<*>	0	.	DP=21;I16=10,10,1,0,730,26992,18,324,1169,69241,29,841,332,7168,25,625;QS=2.95652,0.0434783,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.99938;BQB=1;MQ0F=0	PL:DP:DV	0,18,255,33,255,255:12:1	0,9,98,9,98,98:3:0	0,18,178,18,178,178:6:0
-X	3195	.	T	<*>	0	.	DP=21;I16=11,10,0,0,776,29184,0,0,1198,70082,0,0,356,7778,0,0;QS=3,0;MQSB=0.99938;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,95:3:0	0,18,189:6:0
-X	3196	.	T	<*>	0	.	DP=21;I16=10,10,0,0,722,26472,0,0,1169,69241,0,0,329,7111,0,0;QS=3,0;MQSB=0.931063;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,91:3:0	0,18,186:6:0
-X	3197	.	A	<*>	0	.	DP=22;I16=12,9,0,0,715,24911,0,0,1229,72841,0,0,352,7718,0,0;QS=3,0;MQSB=0.950149;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,103:3:0	0,18,179:6:0
-X	3198	.	A	<*>	0	.	DP=21;I16=12,8,0,0,745,28155,0,0,1169,69241,0,0,345,7675,0,0;QS=3,0;MQSB=0.953497;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,105:3:0	0,18,198:6:0
-X	3199	.	A	<*>	0	.	DP=21;I16=11,9,0,0,736,27514,0,0,1200,72000,0,0,326,7080,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,105:3:0	0,18,196:6:0
-X	3200	.	A	<*>	0	.	DP=20;I16=11,9,0,0,735,27533,0,0,1169,69241,0,0,350,7660,0,0;QS=3,0;MQSB=0.943233;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,108:3:0	0,18,195:6:0
-X	3201	.	A	<*>	0	.	DP=20;I16=11,8,0,0,706,26814,0,0,1109,65641,0,0,338,7486,0,0;QS=3,0;MQSB=0.946915;MQ0F=0	PL:DP:DV	0,30,248:10:0	0,9,107:3:0	0,18,198:6:0
-X	3202	.	T	<*>	0	.	DP=20;I16=10,9,0,0,692,25620,0,0,1140,68400,0,0,321,6907,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,249:10:0	0,9,109:3:0	0,18,187:6:0
-X	3203	.	G	A,<*>	0	.	DP=19;I16=9,9,1,0,644,23760,19,361,1080,64800,29,841,320,6872,25,625;QS=2.94823,0.0517711,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.934728;BQB=1;MQ0F=0	PL:DP:DV	0,14,239,30,242,248:11:1	0,9,105,9,105,105:3:0	0,15,160,15,160,160:5:0
-X	3204	.	T	<*>	0	.	DP=19;I16=9,8,0,0,619,22955,0,0,1020,61200,0,0,306,6686,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,234:9:0	0,9,101:3:0	0,15,169:5:0
-X	3205	.	C	<*>	0	.	DP=19;I16=9,9,0,0,672,25340,0,0,1080,64800,0,0,318,6856,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,99:3:0	0,15,157:5:0
-X	3206	.	A	<*>	0	.	DP=19;I16=10,9,0,0,661,23623,0,0,1109,65641,0,0,342,7500,0,0;QS=3,0;MQSB=0.934728;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,91:3:0	0,15,165:5:0
-X	3207	.	C	<*>	0	.	DP=19;I16=9,9,0,0,642,23618,0,0,1080,64800,0,0,316,6912,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,90:3:0	0,15,158:5:0
-X	3208	.	A	<*>	0	.	DP=18;I16=10,8,0,0,619,22023,0,0,1049,62041,0,0,341,7591,0,0;QS=3,0;MQSB=0.938795;MQ0F=0	PL:DP:DV	0,33,247:11:0	0,9,95:3:0	0,12,142:4:0
-X	3209	.	C	<*>	0	.	DP=19;I16=11,8,0,0,681,24747,0,0,1109,65641,0,0,340,7612,0,0;QS=3,0;MQSB=0.946915;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,106:3:0	0,12,134:4:0
-X	3210	.	C	<*>	0	.	DP=18;I16=11,7,0,0,664,24900,0,0,1049,62041,0,0,340,7602,0,0;QS=3,0;MQSB=0.951002;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,101:3:0	0,12,141:4:0
-X	3211	.	A	<*>	0	.	DP=17;I16=11,6,0,0,645,24627,0,0,989,58441,0,0,341,7611,0,0;QS=3,0;MQSB=0.955563;MQ0F=0	PL:DP:DV	0,30,243:10:0	0,9,106:3:0	0,12,140:4:0
-X	3212	.	T	<*>	0	.	DP=17;I16=10,6,0,0,575,21295,0,0,960,57600,0,0,316,6964,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,222:9:0	0,9,100:3:0	0,12,144:4:0
-X	3213	.	A	<*>	0	.	DP=17;I16=10,6,0,0,597,22631,0,0,960,57600,0,0,316,6962,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,228:9:0	0,9,117:3:0	0,12,138:4:0
-X	3214	.	G	<*>	0	.	DP=17;I16=11,6,0,0,615,23103,0,0,989,58441,0,0,341,7605,0,0;QS=3,0;MQSB=0.955563;MQ0F=0	PL:DP:DV	0,30,243:10:0	0,9,110:3:0	0,12,134:4:0
-X	3215	.	G	<*>	0	.	DP=17;I16=11,6,0,0,591,21523,0,0,989,58441,0,0,340,7592,0,0;QS=3,0;MQSB=0.955563;MQ0F=0	PL:DP:DV	0,30,241:10:0	0,9,93:3:0	0,12,128:4:0
-X	3216	.	C	<*>	0	.	DP=17;I16=11,6,0,0,623,23303,0,0,989,58441,0,0,339,7597,0,0;QS=3,0;MQSB=0.955563;MQ0F=0	PL:DP:DV	0,30,242:10:0	0,9,94:3:0	0,12,138:4:0
-X	3217	.	C	<*>	0	.	DP=17;I16=11,6,0,0,570,19896,0,0,989,58441,0,0,337,7569,0,0;QS=3,0;MQSB=0.955563;MQ0F=0	PL:DP:DV	0,30,236:10:0	0,9,84:3:0	0,12,123:4:0
-X	3218	.	G	C,<*>	0	.	DP=18;I16=10,7,1,0,547,18185,29,841,1020,61200,29,841,310,6932,24,576;QS=2.91667,0.0833333,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.951002;BQB=1;MQ0F=0	PL:DP:DV	0,4,202,30,205,221:11:1	0,9,96,9,96,96:3:0	0,12,112,12,112,112:4:0
-X	3219	.	G	A,<*>	0	.	DP=18;I16=10,7,1,0,606,22158,19,361,1020,61200,29,841,308,6888,23,529;QS=2.94837,0.0516304,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.951002;BQB=1;MQ0F=0	PL:DP:DV	0,14,234,30,237,243:11:1	0,9,107,9,107,107:3:0	0,12,126,12,126,126:4:0
-X	3220	.	G	<*>	0	.	DP=18;I16=11,7,0,0,631,22827,0,0,1049,62041,0,0,326,7248,0,0;QS=3,0;MQSB=0.951002;MQ0F=0	PL:DP:DV	0,33,252:11:0	0,9,112:3:0	0,12,126:4:0
-X	3221	.	C	<*>	0	.	DP=17;I16=9,7,0,0,598,22586,0,0,960,57600,0,0,301,6659,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,244:9:0	0,9,103:3:0	0,12,139:4:0
-X	3222	.	A	<*>	0	.	DP=17;I16=10,7,0,0,623,23037,0,0,989,58441,0,0,318,6972,0,0;QS=3,0;MQSB=0.943335;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,100:3:0	0,12,133:4:0
-X	3223	.	C	<*>	0	.	DP=17;I16=10,7,0,0,611,22603,0,0,989,58441,0,0,312,6764,0,0;QS=3,0;MQSB=0.943335;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,96:3:0	0,12,132:4:0
-X	3224	.	A	<*>	0	.	DP=16;I16=10,6,0,0,609,23381,0,0,929,54841,0,0,307,6575,0,0;QS=3,0;MQSB=0.948436;MQ0F=0	PL:DP:DV	0,27,238:9:0	0,9,97:3:0	0,12,141:4:0
-X	3225	.	G	<*>	0	.	DP=17;I16=11,6,0,0,604,22692,0,0,989,58441,0,0,302,6404,0,0;QS=3,0;MQSB=0.955563;MQ0F=0	PL:DP:DV	0,27,247:9:0	0,12,108:4:0	0,12,134:4:0
-X	3226	.	T	<*>	0	.	DP=18;I16=11,6,0,0,582,20466,0,0,1020,61200,0,0,282,5996,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,224:9:0	0,12,112:4:0	0,12,131:4:0
-X	3227	.	G	<*>	0	.	DP=18;I16=12,5,0,0,618,23008,0,0,989,58441,0,0,270,5496,0,0;QS=3,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,91:3:0	0,12,125:4:0
-X	3228	.	G	<*>	0	.	DP=18;I16=11,6,0,0,611,22581,0,0,1020,61200,0,0,278,5816,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,248:9:0	0,12,118:4:0	0,12,121:4:0
-X	3229	.	C	<*>	0	.	DP=19;I16=12,7,0,0,686,25394,0,0,1109,65641,0,0,289,5925,0,0;QS=3,0;MQSB=0.957193;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,118:4:0	0,12,126:4:0
-X	3230	.	T	<*>	0	.	DP=19;I16=12,6,0,0,669,25441,0,0,1049,62041,0,0,261,5187,0,0;QS=3,0;MQSB=0.961295;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,107:3:0	0,12,139:4:0
-X	3231	.	C	<*>	0	.	DP=19;I16=12,7,0,0,682,25046,0,0,1109,65641,0,0,283,5725,0,0;QS=3,0;MQSB=0.957193;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,112:4:0	0,12,128:4:0
-X	3232	.	A	<*>	0	.	DP=19;I16=11,7,0,0,597,20779,0,0,1080,64800,0,0,270,5564,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,229:10:0	0,12,117:4:0	0,12,132:4:0
-X	3233	.	C	<*>	0	.	DP=19;I16=12,7,0,0,573,18239,0,0,1109,65641,0,0,277,5629,0,0;QS=3,0;MQSB=0.957193;MQ0F=0	PL:DP:DV	0,33,238:11:0	0,12,91:4:0	0,12,110:4:0
-X	3234	.	G	T,<*>	0	.	DP=19;I16=10,6,1,0,511,17305,22,484,960,57600,29,841,233,4849,8,64;QS=2.93855,0.0614525,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.955563;BQB=1;MQ0F=0	PL:DP:DV	0,11,222,30,225,234:11:1	0,6,63,6,63,63:2:0	0,12,100,12,100,100:4:0
-X	3235	.	C	<*>	0	.	DP=18;I16=12,6,0,0,625,22649,0,0,1049,62041,0,0,274,5582,0,0;QS=3,0;MQSB=0.961295;MQ0F=0	PL:DP:DV	0,30,249:10:0	0,12,119:4:0	0,12,123:4:0
-X	3236	.	C	<*>	0	.	DP=18;I16=12,6,0,0,668,25124,0,0,1049,62041,0,0,273,5567,0,0;QS=3,0;MQSB=0.961295;MQ0F=0	PL:DP:DV	0,30,244:10:0	0,12,137:4:0	0,12,134:4:0
-X	3237	.	T	<*>	0	.	DP=17;I16=11,6,0,0,589,21235,0,0,989,58441,0,0,273,5573,0,0;QS=3,0;MQSB=0.955563;MQ0F=0	PL:DP:DV	0,27,230:9:0	0,12,102:4:0	0,12,136:4:0
-X	3238	.	G	<*>	0	.	DP=17;I16=11,6,0,0,609,22539,0,0,989,58441,0,0,273,5599,0,0;QS=3,0;MQSB=0.955563;MQ0F=0	PL:DP:DV	0,27,243:9:0	0,12,104:4:0	0,12,129:4:0
-X	3239	.	T	<*>	0	.	DP=17;I16=11,6,0,0,574,20204,0,0,989,58441,0,0,273,5645,0,0;QS=3,0;MQSB=0.955563;MQ0F=0	PL:DP:DV	0,27,220:9:0	0,12,107:4:0	0,12,131:4:0
-X	3240	.	A	<*>	0	.	DP=19;I16=12,7,0,0,624,21552,0,0,1109,65641,0,0,273,5711,0,0;QS=3,0;MQSB=0.957193;MQ0F=0	PL:DP:DV	0,33,248:11:0	0,12,101:4:0	0,12,132:4:0
-X	3241	.	A	<*>	0	.	DP=19;I16=11,6,0,0,619,23121,0,0,1020,61200,0,0,249,5173,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,252:10:0	0,9,96:3:0	0,12,143:4:0
-X	3242	.	T	<*>	0	.	DP=19;I16=12,7,0,0,655,23279,0,0,1140,68400,0,0,277,5911,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,252:10:0	0,12,104:4:0	0,15,152:5:0
-X	3243	.	C	<*>	0	.	DP=19;I16=12,7,0,0,682,25216,0,0,1140,68400,0,0,281,6047,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,111:4:0	0,15,148:5:0
-X	3244	.	C	<*>	0	.	DP=18;I16=11,6,0,0,587,21119,0,0,1020,61200,0,0,281,6139,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,221:8:0	0,12,116:4:0	0,15,142:5:0
-X	3245	.	C	<*>	0	.	DP=17;I16=10,7,0,0,631,23851,0,0,1020,61200,0,0,290,6282,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,12,126:4:0	0,12,131:4:0
-X	3246	.	A	<*>	0	.	DP=17;I16=10,7,0,0,646,24716,0,0,1020,61200,0,0,295,6427,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,12,129:4:0	0,12,139:4:0
-X	3247	.	G	<*>	0	.	DP=17;I16=10,7,0,0,606,22554,0,0,1020,61200,0,0,300,6590,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,12,92:4:0	0,12,133:4:0
-X	3248	.	C	<*>	0	.	DP=16;I16=10,6,0,0,603,23115,0,0,960,57600,0,0,306,6770,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,9,99:3:0	0,12,132:4:0
-X	3249	.	C	<*>	0	.	DP=16;I16=10,6,0,0,587,21913,0,0,960,57600,0,0,311,6917,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,246:9:0	0,9,99:3:0	0,12,133:4:0
-X	3250	.	C	<*>	0	.	DP=16;I16=10,6,0,0,616,24080,0,0,960,57600,0,0,316,7082,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,9,95:3:0	0,12,137:4:0
-X	3251	.	T	<*>	0	.	DP=16;I16=10,6,0,0,585,22193,0,0,960,57600,0,0,319,7165,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,241:9:0	0,9,104:3:0	0,12,135:4:0
-X	3252	.	T	<*>	0	.	DP=16;I16=10,6,0,0,553,19781,0,0,960,57600,0,0,321,7215,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,239:9:0	0,9,84:3:0	0,12,126:4:0
-X	3253	.	T	<*>	0	.	DP=16;I16=10,6,0,0,589,21933,0,0,960,57600,0,0,323,7281,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,245:9:0	0,9,102:3:0	0,12,132:4:0
-X	3254	.	G	<*>	0	.	DP=17;I16=10,7,0,0,631,23737,0,0,1020,61200,0,0,325,7363,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,9,100:3:0	0,15,154:5:0
-X	3255	.	G	<*>	0	.	DP=16;I16=9,7,0,0,554,20088,0,0,960,57600,0,0,328,7410,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,243:9:0	0,9,93:3:0	0,12,120:4:0
-X	3256	.	G	<*>	0	.	DP=16;I16=8,7,0,0,571,21985,0,0,900,54000,0,0,306,6846,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,255:9:0	0,6,62:2:0	0,12,142:4:0
-X	3257	.	A	<*>	0	.	DP=16;I16=9,7,0,0,585,21881,0,0,960,57600,0,0,334,7546,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,243:9:0	0,9,94:3:0	0,12,144:4:0
-X	3258	.	G	<*>	0	.	DP=17;I16=9,8,0,0,647,25407,0,0,1020,61200,0,0,337,7635,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,81:3:0	0,12,146:4:0
-X	3259	.	G	<*>	0	.	DP=17;I16=9,8,0,0,605,22237,0,0,1020,61200,0,0,341,7739,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,9,79:3:0	0,12,139:4:0
-X	3260	.	C	<*>	0	.	DP=17;I16=9,7,0,0,616,23908,0,0,960,57600,0,0,319,7183,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,6,64:2:0	0,12,133:4:0
-X	3261	.	C	<*>	0	.	DP=18;I16=9,9,0,0,655,24475,0,0,1080,64800,0,0,347,7891,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,90:3:0	0,12,138:4:0
-X	3262	.	A	<*>	0	.	DP=19;I16=10,9,0,0,712,27036,0,0,1140,68400,0,0,351,7989,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,123:4:0	0,12,148:4:0
-X	3263	.	G	<*>	0	.	DP=19;I16=10,9,0,0,715,27317,0,0,1140,68400,0,0,356,8104,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,116:4:0	0,12,146:4:0
-X	3264	.	G	<*>	0	.	DP=19;I16=10,9,0,0,676,24734,0,0,1140,68400,0,0,361,8237,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,93:4:0	0,12,143:4:0
-X	3265	.	G	<*>	0	.	DP=19;I16=10,9,0,0,701,26199,0,0,1140,68400,0,0,365,8339,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,109:4:0	0,12,137:4:0
-X	3266	.	T	<*>	0	.	DP=19;I16=9,9,0,0,597,20769,0,0,1080,64800,0,0,357,8229,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,82:4:0	0,9,113:3:0
-X	3267	.	G	<*>	0	.	DP=19;I16=10,9,0,0,659,24285,0,0,1140,68400,0,0,367,8299,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,76:4:0	0,12,133:4:0
-X	3268	.	G	<*>	0	.	DP=19;I16=10,9,0,0,668,24306,0,0,1140,68400,0,0,367,8255,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,92:4:0	0,12,142:4:0
-X	3269	.	G	<*>	0	.	DP=19;I16=10,9,0,0,714,27122,0,0,1140,68400,0,0,367,8227,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,115:4:0	0,12,137:4:0
-X	3270	.	T	<*>	0	.	DP=20;I16=10,9,0,0,606,20364,0,0,1140,68400,0,0,361,8141,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,251:11:0	0,12,83:4:0	0,12,136:4:0
-X	3271	.	G	<*>	0	.	DP=19;I16=10,9,0,0,709,26993,0,0,1140,68400,0,0,362,8108,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,100:4:0	0,12,143:4:0
-X	3272	.	G	<*>	0	.	DP=19;I16=10,9,0,0,672,24398,0,0,1140,68400,0,0,363,8093,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,97:4:0	0,12,140:4:0
-X	3273	.	A	<*>	0	.	DP=20;I16=10,10,0,0,735,27355,0,0,1200,72000,0,0,363,8047,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,153:5:0	0,12,147:4:0
-X	3274	.	T	<*>	0	.	DP=19;I16=9,10,0,0,699,26089,0,0,1140,68400,0,0,365,8021,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,142:5:0	0,12,149:4:0
-X	3275	.	C	<*>	0	.	DP=19;I16=9,10,0,0,727,28197,0,0,1140,68400,0,0,367,8015,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,137:5:0	0,12,139:4:0
-X	3276	.	A	<*>	0	.	DP=19;I16=9,10,0,0,681,25123,0,0,1140,68400,0,0,369,8029,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,253:10:0	0,15,150:5:0	0,12,141:4:0
-X	3277	.	C	<*>	0	.	DP=19;I16=9,10,0,0,733,28485,0,0,1140,68400,0,0,371,8063,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,153:5:0	0,12,146:4:0
-X	3278	.	T	<*>	0	.	DP=19;I16=9,10,0,0,737,28901,0,0,1140,68400,0,0,373,8117,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,168:5:0	0,12,153:4:0
-X	3279	.	T	<*>	0	.	DP=19;I16=9,10,0,0,714,27132,0,0,1140,68400,0,0,375,8191,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,148:5:0	0,12,150:4:0
-X	3280	.	G	<*>	0	.	DP=20;I16=9,11,0,0,758,29178,0,0,1200,72000,0,0,376,8234,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,143:5:0	0,12,146:4:0
-X	3281	.	A	<*>	0	.	DP=21;I16=10,11,0,0,822,32654,0,0,1260,75600,0,0,378,8296,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,179:6:0	0,12,157:4:0
-X	3282	.	G	<*>	0	.	DP=21;I16=10,11,0,0,815,32059,0,0,1260,75600,0,0,381,8379,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,173:6:0	0,12,150:4:0
-X	3283	.	G	<*>	0	.	DP=21;I16=10,11,0,0,790,30110,0,0,1260,75600,0,0,384,8484,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,161:6:0	0,12,146:4:0
-X	3284	.	T	<*>	0	.	DP=21;I16=10,11,0,0,748,27628,0,0,1260,75600,0,0,385,8511,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,155:6:0	0,12,146:4:0
-X	3285	.	C	<*>	0	.	DP=21;I16=10,11,0,0,776,29442,0,0,1260,75600,0,0,386,8560,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,169:6:0	0,12,143:4:0
-X	3286	.	A	<*>	0	.	DP=21;I16=10,11,0,0,826,32732,0,0,1260,75600,0,0,387,8631,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,187:6:0	0,12,153:4:0
-X	3287	.	G	<*>	0	.	DP=21;I16=10,11,0,0,804,31448,0,0,1260,75600,0,0,387,8673,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,164:6:0	0,12,150:4:0
-X	3288	.	G	<*>	0	.	DP=22;I16=10,11,0,0,754,27862,0,0,1260,75600,0,0,379,8635,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,141:5:0	0,15,164:5:0
-X	3289	.	A	<*>	0	.	DP=24;I16=13,11,0,0,897,34439,0,0,1440,86400,0,0,386,8714,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,166:6:0	0,15,178:5:0
-X	3290	.	G	<*>	0	.	DP=23;I16=12,10,0,0,832,31964,0,0,1320,79200,0,0,380,8684,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,112:4:0	0,15,168:5:0
-X	3291	.	T	<*>	0	.	DP=22;I16=11,9,0,0,707,25481,0,0,1200,72000,0,0,358,8112,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,9,95:3:0	0,15,168:5:0
-X	3292	.	T	<*>	0	.	DP=22;I16=13,9,0,0,783,28439,0,0,1320,79200,0,0,397,8929,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,127:5:0	0,15,164:5:0
-X	3293	.	C	<*>	0	.	DP=22;I16=13,9,0,0,852,33430,0,0,1320,79200,0,0,400,8992,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,136:5:0	0,15,170:5:0
-X	3294	.	A	<*>	0	.	DP=22;I16=13,9,0,0,818,30684,0,0,1320,79200,0,0,403,9077,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,145:5:0	0,15,162:5:0
-X	3295	.	A	<*>	0	.	DP=22;I16=14,8,0,0,820,31004,0,0,1320,79200,0,0,407,9183,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,140:5:0	0,12,143:4:0
-X	3296	.	G	<*>	0	.	DP=22;I16=14,8,0,0,837,32209,0,0,1320,79200,0,0,411,9259,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,133:5:0	0,12,140:4:0
-X	3297	.	A	<*>	0	.	DP=22;I16=14,8,0,0,787,28771,0,0,1320,79200,0,0,415,9355,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,134:5:0	0,12,140:4:0
-X	3298	.	C	<*>	0	.	DP=22;I16=13,9,0,0,826,31506,0,0,1320,79200,0,0,420,9470,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,113:4:0	0,12,135:4:0
-X	3299	.	C	<*>	0	.	DP=22;I16=13,9,0,0,857,33829,0,0,1320,79200,0,0,425,9553,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,117:4:0	0,12,140:4:0
-X	3300	.	A	<*>	0	.	DP=22;I16=13,9,0,0,861,33855,0,0,1320,79200,0,0,430,9654,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,134:4:0	0,12,144:4:0
-X	3301	.	G	<*>	0	.	DP=22;I16=13,9,0,0,869,34495,0,0,1320,79200,0,0,433,9675,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,131:4:0	0,12,141:4:0
-X	3302	.	C	<*>	0	.	DP=23;I16=14,9,0,0,863,32885,0,0,1380,82800,0,0,436,9718,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,115:4:0	0,15,155:5:0
-X	3303	.	C	<*>	0	.	DP=23;I16=14,9,0,0,887,34451,0,0,1380,82800,0,0,440,9784,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,125:4:0	0,15,153:5:0
-X	3304	.	T	<*>	0	.	DP=23;I16=14,9,0,0,886,34388,0,0,1380,82800,0,0,443,9825,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,134:4:0	0,15,167:5:0
-X	3305	.	G	<*>	0	.	DP=23;I16=14,9,0,0,878,33846,0,0,1380,82800,0,0,446,9892,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,119:4:0	0,15,151:5:0
-X	3306	.	G	<*>	0	.	DP=23;I16=14,9,0,0,886,34386,0,0,1380,82800,0,0,448,9934,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,127:4:0	0,15,150:5:0
-X	3307	.	C	<*>	0	.	DP=23;I16=14,8,0,0,812,30814,0,0,1320,79200,0,0,428,9508,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,116:4:0	0,15,153:5:0
-X	3308	.	C	<*>	0	.	DP=23;I16=14,9,0,0,835,31367,0,0,1380,82800,0,0,450,9986,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,118:4:0	0,15,151:5:0
-X	3309	.	A	<*>	0	.	DP=23;I16=14,9,0,0,875,33541,0,0,1380,82800,0,0,451,9995,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,128:4:0	0,15,162:5:0
-X	3310	.	A	<*>	0	.	DP=24;I16=15,9,0,0,882,32950,0,0,1440,86400,0,0,453,10027,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,152:5:0	0,15,164:5:0
-X	3311	.	C	<*>	0	.	DP=24;I16=15,9,0,0,913,35161,0,0,1440,86400,0,0,456,10084,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,145:5:0	0,15,157:5:0
-X	3312	.	A	<*>	0	.	DP=26;I16=16,9,0,0,950,36336,0,0,1500,90000,0,0,459,10167,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,153:5:0	0,15,160:5:0
-X	3313	.	T	<*>	0	.	DP=26;I16=16,10,0,0,987,37617,0,0,1560,93600,0,0,488,10902,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,180:6:0	0,15,161:5:0
-X	3314	.	G	<*>	0	.	DP=26;I16=16,10,0,0,1007,39401,0,0,1560,93600,0,0,491,10989,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,171:6:0	0,15,161:5:0
-X	3315	.	G	<*>	0	.	DP=26;I16=15,10,0,0,945,36073,0,0,1500,90000,0,0,484,10866,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,172:6:0	0,15,159:5:0
-X	3316	.	T	<*>	0	.	DP=26;I16=15,10,0,0,853,29881,0,0,1500,90000,0,0,464,10216,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,157:6:0	0,12,122:4:0
-X	3317	.	G	<*>	0	.	DP=27;I16=16,11,0,0,997,37431,0,0,1620,97200,0,0,488,10806,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,164:6:0	0,18,167:6:0
-X	3318	.	A	<*>	0	.	DP=26;I16=15,10,0,0,904,33212,0,0,1500,90000,0,0,481,10699,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,155:5:0	0,18,185:6:0
-X	3319	.	A	<*>	0	.	DP=25;I16=15,10,0,0,912,34090,0,0,1500,90000,0,0,482,10682,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,139:5:0	0,18,188:6:0
-X	3320	.	A	<*>	0	.	DP=25;I16=15,10,0,0,888,32722,0,0,1500,90000,0,0,483,10691,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,133:5:0	0,18,178:6:0
-X	3321	.	C	<*>	0	.	DP=25;I16=14,10,0,0,900,34142,0,0,1440,86400,0,0,471,10531,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,157:5:0	0,18,186:6:0
-X	3322	.	C	<*>	0	.	DP=25;I16=15,10,0,0,980,38582,0,0,1500,90000,0,0,483,10683,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,164:5:0	0,18,198:6:0
-X	3323	.	C	<*>	0	.	DP=25;I16=15,10,0,0,922,34948,0,0,1500,90000,0,0,483,10715,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,146:5:0	0,18,201:6:0
-X	3324	.	C	<*>	0	.	DP=25;I16=15,10,0,0,869,31271,0,0,1500,90000,0,0,482,10720,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,142:5:0	0,18,186:6:0
-X	3325	.	G	<*>	0	.	DP=25;I16=15,10,0,0,827,28293,0,0,1500,90000,0,0,481,10747,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,134:5:0	0,18,163:6:0
-X	3326	.	T	<*>	0	.	DP=24;I16=13,10,0,0,842,31362,0,0,1380,82800,0,0,464,10506,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,150:5:0	0,18,186:6:0
-X	3327	.	C	<*>	0	.	DP=24;I16=14,10,0,0,938,37076,0,0,1440,86400,0,0,481,10863,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,154:5:0	0,18,190:6:0
-X	3328	.	T	<*>	0	.	DP=25;I16=15,10,0,0,959,37033,0,0,1500,90000,0,0,480,10900,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,163:5:0	0,21,213:7:0
-X	3329	.	A	<*>	0	.	DP=24;I16=15,9,0,0,888,33082,0,0,1440,86400,0,0,481,10955,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,149:5:0	0,21,207:7:0
-X	3330	.	C	<*>	0	.	DP=25;I16=16,9,0,0,954,37064,0,0,1500,90000,0,0,481,10979,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,168:5:0	0,21,203:7:0
-X	3331	.	T	<*>	0	.	DP=25;I16=16,9,0,0,960,37332,0,0,1500,90000,0,0,482,11024,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,165:5:0	0,21,224:7:0
-X	3332	.	A	<*>	0	.	DP=25;I16=16,9,0,0,933,35065,0,0,1500,90000,0,0,483,11091,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,165:5:0	0,21,211:7:0
-X	3333	.	A	<*>	0	.	DP=26;I16=16,10,0,0,976,37344,0,0,1560,93600,0,0,483,11131,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,166:5:0	0,24,241:8:0
-X	3334	.	A	<*>	0	.	DP=25;I16=15,10,0,0,972,38210,0,0,1500,90000,0,0,485,11195,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,168:5:0	0,24,241:8:0
-X	3335	.	A	<*>	0	.	DP=25;I16=15,10,0,0,970,38200,0,0,1500,90000,0,0,486,11232,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,170:5:0	0,24,239:8:0
-X	3336	.	A	<*>	0	.	DP=25;I16=15,10,0,0,929,35277,0,0,1500,90000,0,0,485,11191,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,166:5:0	0,24,232:8:0
-X	3337	.	T	<*>	0	.	DP=25;I16=15,10,0,0,902,32856,0,0,1500,90000,0,0,484,11172,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,157:5:0	0,24,224:8:0
-X	3338	.	A	<*>	0	.	DP=25;I16=15,10,0,0,892,32056,0,0,1500,90000,0,0,481,11075,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,153:5:0	0,24,214:8:0
-X	3339	.	C	<*>	0	.	DP=25;I16=15,10,0,0,964,37444,0,0,1500,90000,0,0,478,11000,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,167:5:0	0,24,232:8:0
-X	3340	.	A	<*>	0	.	DP=23;I16=14,9,0,0,890,34616,0,0,1380,82800,0,0,477,10945,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,173:5:0	0,24,233:8:0
-X	3341	.	A	<*>	0	.	DP=23;I16=14,9,0,0,885,34459,0,0,1380,82800,0,0,476,10908,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,167:5:0	0,24,238:8:0
-X	3342	.	A	<*>	0	.	DP=23;I16=14,9,0,0,862,33262,0,0,1380,82800,0,0,475,10889,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,170:5:0	0,24,240:8:0
-X	3343	.	A	<*>	0	.	DP=22;I16=13,9,0,0,866,34280,0,0,1320,79200,0,0,474,10836,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,173:5:0	0,21,231:7:0
-X	3344	.	A	<*>	0	.	DP=22;I16=13,9,0,0,859,33731,0,0,1320,79200,0,0,473,10797,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,173:5:0	0,21,226:7:0
-X	3345	.	T	<*>	0	.	DP=22;I16=13,9,0,0,822,31100,0,0,1320,79200,0,0,472,10772,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,254:10:0	0,15,159:5:0	0,21,220:7:0
-X	3346	.	T	<*>	0	.	DP=22;I16=13,9,0,0,847,32679,0,0,1320,79200,0,0,470,10712,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,168:5:0	0,21,221:7:0
-X	3347	.	A	<*>	0	.	DP=23;I16=14,9,0,0,888,34650,0,0,1380,82800,0,0,468,10668,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,185:6:0	0,21,227:7:0
-X	3348	.	G	<*>	0	.	DP=23;I16=14,9,0,0,873,33609,0,0,1380,82800,0,0,467,10641,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,171:6:0	0,21,219:7:0
-X	3349	.	C	<*>	0	.	DP=24;I16=14,9,0,0,815,29785,0,0,1380,82800,0,0,465,10583,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,166:6:0	0,21,205:7:0
-X	3350	.	C	<*>	0	.	DP=24;I16=14,10,0,0,939,37249,0,0,1440,86400,0,0,464,10546,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,209:7:0	0,21,220:7:0
-X	3351	.	T	<*>	0	.	DP=24;I16=14,10,0,0,943,37255,0,0,1440,86400,0,0,463,10531,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,210:7:0	0,21,228:7:0
-X	3352	.	G	<*>	0	.	DP=24;I16=14,10,0,0,887,33267,0,0,1440,86400,0,0,462,10538,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,192:7:0	0,21,214:7:0
-X	3353	.	G	<*>	0	.	DP=24;I16=14,10,0,0,864,32092,0,0,1440,86400,0,0,461,10567,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,190:7:0	0,21,214:7:0
-X	3354	.	C	<*>	0	.	DP=24;I16=14,10,0,0,848,30714,0,0,1440,86400,0,0,459,10567,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,178:7:0	0,21,209:7:0
-X	3355	.	G	<*>	0	.	DP=23;I16=14,9,0,0,738,24386,0,0,1380,82800,0,0,457,10537,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,232:10:0	0,21,170:7:0	0,18,166:6:0
-X	3356	.	T	<*>	0	.	DP=23;I16=14,9,0,0,847,31689,0,0,1380,82800,0,0,454,10476,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,191:7:0	0,18,195:6:0
-X	3357	.	G	<*>	0	.	DP=23;I16=14,9,0,0,863,32919,0,0,1380,82800,0,0,449,10335,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,193:7:0	0,18,192:6:0
-X	3358	.	G	<*>	0	.	DP=22;I16=14,8,0,0,810,30184,0,0,1320,79200,0,0,445,10215,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,239:9:0	0,21,200:7:0	0,18,187:6:0
-X	3359	.	T	<*>	0	.	DP=23;I16=13,8,0,0,743,26737,0,0,1260,75600,0,0,404,9318,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,228:9:0	0,21,194:7:0	0,15,162:5:0
-X	3360	.	G	<*>	0	.	DP=23;I16=15,8,0,0,822,30058,0,0,1380,82800,0,0,436,9932,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,186:7:0	0,18,175:6:0
-X	3361	.	G	<*>	0	.	DP=22;I16=15,7,0,0,751,26793,0,0,1320,79200,0,0,433,9819,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,218:9:0	0,21,187:7:0	0,18,175:6:0
-X	3362	.	C	<*>	0	.	DP=22;I16=15,7,0,0,768,27462,0,0,1320,79200,0,0,430,9724,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,230:9:0	0,21,178:7:0	0,18,173:6:0
-X	3363	.	G	<*>	0	.	DP=21;I16=14,7,0,0,662,21572,0,0,1260,75600,0,0,428,9646,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,194:9:0	0,18,155:6:0	0,18,161:6:0
-X	3364	.	C	<*>	0	.	DP=21;I16=14,7,0,0,818,32184,0,0,1260,75600,0,0,423,9437,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,241:9:0	0,18,191:6:0	0,18,194:6:0
-X	3365	.	A	<*>	0	.	DP=21;I16=14,7,0,0,791,29983,0,0,1260,75600,0,0,418,9250,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,226:9:0	0,18,186:6:0	0,18,190:6:0
-X	3366	.	T	<*>	0	.	DP=21;I16=14,7,0,0,759,28053,0,0,1260,75600,0,0,413,9085,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,221:9:0	0,18,185:6:0	0,18,177:6:0
-X	3367	.	G	<*>	0	.	DP=21;I16=14,7,0,0,767,28539,0,0,1260,75600,0,0,408,8942,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,235:9:0	0,18,185:6:0	0,18,169:6:0
-X	3368	.	C	<*>	0	.	DP=21;I16=14,7,0,0,807,31329,0,0,1260,75600,0,0,403,8821,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,245:9:0	0,18,181:6:0	0,18,189:6:0
-X	3369	.	C	<*>	0	.	DP=21;I16=14,7,0,0,789,30271,0,0,1260,75600,0,0,398,8722,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,228:9:0	0,18,186:6:0	0,18,193:6:0
-X	3370	.	T	<*>	0	.	DP=21;I16=13,7,0,0,798,31960,0,0,1200,72000,0,0,392,8596,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,239:9:0	0,18,201:6:0	0,15,178:5:0
-X	3371	.	G	<*>	0	.	DP=20;I16=13,7,0,0,739,27875,0,0,1200,72000,0,0,387,8493,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,233:9:0	0,18,173:6:0	0,15,169:5:0
-X	3372	.	T	<*>	0	.	DP=20;I16=13,6,0,0,693,25677,0,0,1140,68400,0,0,359,7883,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,220:9:0	0,15,154:5:0	0,15,167:5:0
-X	3373	.	A	<*>	0	.	DP=20;I16=13,7,0,0,729,27019,0,0,1200,72000,0,0,375,8253,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,226:9:0	0,18,162:6:0	0,15,174:5:0
-X	3374	.	A	<*>	0	.	DP=19;I16=13,6,0,0,719,27437,0,0,1140,68400,0,0,369,8115,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,225:9:0	0,15,167:5:0	0,15,164:5:0
-X	3375	.	T	<*>	0	.	DP=20;I16=12,6,0,0,683,26039,0,0,1080,64800,0,0,337,7321,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,221:8:0	0,15,155:5:0	0,15,172:5:0
-X	3376	.	C	<*>	0	.	DP=20;I16=13,7,0,0,739,27867,0,0,1200,72000,0,0,356,7796,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,254:10:0	0,15,146:5:0	0,15,173:5:0
-X	3377	.	C	<*>	0	.	DP=20;I16=13,7,0,0,741,27905,0,0,1200,72000,0,0,350,7666,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,252:10:0	0,15,149:5:0	0,15,173:5:0
-X	3378	.	C	<*>	0	.	DP=20;I16=13,7,0,0,775,30179,0,0,1200,72000,0,0,343,7507,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,15,161:5:0	0,15,172:5:0
-X	3379	.	A	<*>	0	.	DP=20;I16=13,7,0,0,736,27530,0,0,1200,72000,0,0,336,7370,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,245:10:0	0,15,157:5:0	0,15,169:5:0
-X	3380	.	G	<*>	0	.	DP=19;I16=13,6,0,0,729,28249,0,0,1140,68400,0,0,330,7254,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,233:9:0	0,15,157:5:0	0,15,178:5:0
-X	3381	.	C	<*>	0	.	DP=19;I16=13,6,0,0,742,29288,0,0,1140,68400,0,0,324,7158,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,241:9:0	0,15,155:5:0	0,15,178:5:0
-X	3382	.	T	<*>	0	.	DP=17;I16=12,5,0,0,649,25245,0,0,1020,61200,0,0,320,7080,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,222:9:0	0,9,105:3:0	0,15,184:5:0
-X	3383	.	A	<*>	0	.	DP=17;I16=12,4,0,0,556,19808,0,0,960,57600,0,0,291,6393,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,27,196:9:0	0,6,71:2:0	0,15,167:5:0
-X	3384	.	C	<*>	0	.	DP=19;I16=14,5,0,0,701,26181,0,0,1140,68400,0,0,311,6923,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,235:10:0	0,9,98:3:0	0,18,187:6:0
-X	3385	.	T	<*>	0	.	DP=19;I16=14,5,0,0,730,28456,0,0,1140,68400,0,0,307,6797,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,237:10:0	0,9,109:3:0	0,18,195:6:0
-X	3386	.	T	<*>	0	.	DP=19;I16=14,5,0,0,642,22450,0,0,1140,68400,0,0,302,6642,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,197:10:0	0,9,104:3:0	0,18,188:6:0
-X	3387	.	G	<*>	0	.	DP=20;I16=14,6,0,0,723,26761,0,0,1200,72000,0,0,296,6460,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,230:10:0	0,9,105:3:0	0,21,210:7:0
-X	3388	.	G	<*>	0	.	DP=20;I16=14,6,0,0,705,25891,0,0,1200,72000,0,0,291,6303,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,225:10:0	0,9,109:3:0	0,21,202:7:0
-X	3389	.	G	<*>	0	.	DP=18;I16=10,7,0,0,617,22635,0,0,1020,61200,0,0,270,5808,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,190:7:0	0,9,105:3:0	0,21,207:7:0
-X	3390	.	A	<*>	0	.	DP=18;I16=11,7,0,0,631,22681,0,0,1080,64800,0,0,288,6056,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,200:8:0	0,9,105:3:0	0,21,198:7:0
-X	3391	.	A	<*>	0	.	DP=18;I16=11,7,0,0,663,24951,0,0,1080,64800,0,0,287,5965,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,192:8:0	0,9,113:3:0	0,21,224:7:0
-X	3392	.	G	<*>	0	.	DP=18;I16=11,7,0,0,666,25104,0,0,1080,64800,0,0,286,5896,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,211:8:0	0,9,103:3:0	0,21,216:7:0
-X	3393	.	C	<*>	0	.	DP=18;I16=11,7,0,0,686,26472,0,0,1080,64800,0,0,284,5800,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,222:8:0	0,9,106:3:0	0,21,214:7:0
-X	3394	.	T	<*>	0	.	DP=18;I16=11,7,0,0,699,27481,0,0,1080,64800,0,0,282,5728,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,219:8:0	0,9,114:3:0	0,21,222:7:0
-X	3395	.	G	<*>	0	.	DP=17;I16=10,7,0,0,656,25512,0,0,1020,61200,0,0,281,5679,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,205:7:0	0,9,105:3:0	0,21,222:7:0
-X	3396	.	A	<*>	0	.	DP=17;I16=10,7,0,0,644,25446,0,0,1020,61200,0,0,280,5652,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,182:7:0	0,9,119:3:0	0,21,232:7:0
-X	3397	.	G	<*>	0	.	DP=17;I16=10,7,0,0,633,23895,0,0,1020,61200,0,0,279,5647,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,193:7:0	0,9,107:3:0	0,21,218:7:0
-X	3398	.	G	<*>	0	.	DP=16;I16=10,6,0,0,610,23380,0,0,960,57600,0,0,279,5663,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,170:6:0	0,9,110:3:0	0,21,215:7:0
-X	3399	.	G	<*>	0	.	DP=17;I16=10,6,0,0,585,21729,0,0,960,57600,0,0,270,5618,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,15,147:5:0	0,12,122:4:0	0,21,216:7:0
-X	3400	.	A	<*>	0	.	DP=17;I16=10,6,0,0,576,21400,0,0,960,57600,0,0,264,5500,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,15,136:5:0	0,12,131:4:0	0,21,213:7:0
-X	3401	.	T	<*>	0	.	DP=17;I16=11,6,0,0,605,22159,0,0,1020,61200,0,0,280,5784,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,146:6:0	0,12,131:4:0	0,21,216:7:0
-X	3402	.	G	<*>	0	.	DP=17;I16=11,6,0,0,638,24150,0,0,1020,61200,0,0,280,5832,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,172:6:0	0,12,130:4:0	0,21,213:7:0
-X	3403	.	A	<*>	0	.	DP=16;I16=9,6,0,0,579,22815,0,0,900,54000,0,0,276,5874,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,15,139:5:0	0,12,140:4:0	0,18,205:6:0
-X	3404	.	G	<*>	0	.	DP=16;I16=10,6,0,0,564,20652,0,0,960,57600,0,0,281,5935,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,148:6:0	0,12,131:4:0	0,18,186:6:0
-X	3405	.	A	<*>	0	.	DP=16;I16=10,6,0,0,560,20158,0,0,960,57600,0,0,281,5991,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,157:6:0	0,12,124:4:0	0,18,179:6:0
-X	3406	.	A	<*>	0	.	DP=16;I16=10,6,0,0,568,20556,0,0,960,57600,0,0,281,6067,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,150:6:0	0,12,129:4:0	0,18,186:6:0
-X	3407	.	C	<*>	0	.	DP=17;I16=11,6,0,0,591,21225,0,0,1020,61200,0,0,281,6163,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,178:7:0	0,12,106:4:0	0,18,183:6:0
-X	3408	.	T	<*>	0	.	DP=17;I16=11,6,0,0,632,23754,0,0,1020,61200,0,0,282,6280,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,21,177:7:0	0,12,133:4:0	0,18,189:6:0
-X	3409	.	G	<*>	0	.	DP=16;I16=10,6,0,0,599,22667,0,0,960,57600,0,0,283,6369,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,172:6:0	0,12,119:4:0	0,18,192:6:0
-X	3410	.	C	<*>	0	.	DP=16;I16=10,6,0,0,585,21685,0,0,960,57600,0,0,282,6378,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,174:6:0	0,12,126:4:0	0,18,176:6:0
-X	3411	.	T	<*>	0	.	DP=15;I16=9,6,0,0,578,22492,0,0,900,54000,0,0,282,6404,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,165:6:0	0,9,114:3:0	0,18,196:6:0
-X	3412	.	T	<*>	0	.	DP=15;I16=9,6,0,0,546,20202,0,0,900,54000,0,0,283,6445,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,15,148:5:0	0,12,120:4:0	0,18,189:6:0
-X	3413	.	G	<*>	0	.	DP=15;I16=9,6,0,0,559,21023,0,0,900,54000,0,0,283,6401,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,15,158:5:0	0,12,124:4:0	0,18,184:6:0
-X	3414	.	A	<*>	0	.	DP=15;I16=9,6,0,0,512,17878,0,0,900,54000,0,0,283,6373,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,15,148:5:0	0,12,116:4:0	0,18,166:6:0
-X	3415	.	A	<*>	0	.	DP=16;I16=9,7,0,0,544,19656,0,0,960,57600,0,0,282,6310,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,15,142:5:0	0,12,132:4:0	0,21,179:7:0
-X	3416	.	C	<*>	0	.	DP=16;I16=9,7,0,0,562,20168,0,0,960,57600,0,0,282,6262,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,15,143:5:0	0,12,127:4:0	0,21,191:7:0
-X	3417	.	C	<*>	0	.	DP=16;I16=9,7,0,0,566,20666,0,0,960,57600,0,0,282,6230,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,15,147:5:0	0,12,126:4:0	0,21,192:7:0
-X	3418	.	T	<*>	0	.	DP=17;I16=10,5,0,0,557,21637,0,0,900,54000,0,0,268,5988,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,15,150:5:0	0,15,148:5:0	0,15,176:5:0
-X	3419	.	G	<*>	0	.	DP=17;I16=10,7,0,0,594,21642,0,0,1020,61200,0,0,310,6836,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,161:6:0	0,15,140:5:0	0,18,190:6:0
-X	3420	.	G	<*>	0	.	DP=17;I16=10,7,0,0,596,21580,0,0,1020,61200,0,0,312,6850,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,172:6:0	0,15,132:5:0	0,18,188:6:0
-X	3421	.	G	<*>	0	.	DP=18;I16=10,8,0,0,633,22781,0,0,1049,62041,0,0,314,6880,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,21,184:7:0	0,15,138:5:0	0,18,191:6:0
-X	3422	.	A	<*>	0	.	DP=18;I16=9,8,0,0,576,20954,0,0,989,58441,0,0,302,6702,0,0;QS=3,0;MQSB=0.91051;MQ0F=0	PL:DP:DV	0,18,167:6:0	0,15,130:5:0	0,18,188:6:0
-X	3423	.	G	<*>	0	.	DP=18;I16=9,9,0,0,651,24391,0,0,1049,62041,0,0,305,6747,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,21,200:7:0	0,15,149:5:0	0,18,183:6:0
-X	3424	.	G	<*>	0	.	DP=18;I16=8,8,0,0,555,20175,0,0,929,54841,0,0,275,6105,0,0;QS=3,0;MQSB=0.915545;MQ0F=0	PL:DP:DV	0,18,161:6:0	0,15,141:5:0	0,15,169:5:0
-X	3425	.	C	<*>	0	.	DP=18;I16=9,8,0,0,594,21676,0,0,1020,61200,0,0,307,6779,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,168:6:0	0,15,142:5:0	0,18,186:6:0
-X	3426	.	A	<*>	0	.	DP=18;I16=9,8,0,0,633,23967,0,0,1020,61200,0,0,308,6774,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,18,172:6:0	0,15,151:5:0	0,18,202:6:0
-X	3427	.	G	<*>	0	.	DP=18;I16=9,9,0,0,655,24639,0,0,1049,62041,0,0,315,6823,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,21,209:7:0	0,15,144:5:0	0,18,184:6:0
-X	3428	.	A	<*>	0	.	DP=18;I16=9,7,0,0,573,21235,0,0,960,57600,0,0,305,6793,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,15,158:5:0	0,15,147:5:0	0,18,178:6:0
-X	3429	.	C	<*>	0	.	DP=17;I16=8,9,0,0,516,16610,0,0,989,58441,0,0,320,6930,0,0;QS=3,0;MQSB=0.928603;MQ0F=0	PL:DP:DV	0,21,176:7:0	0,15,125:5:0	0,15,124:5:0
-X	3430	.	G	<*>	0	.	DP=18;I16=9,9,0,0,539,17155,0,0,1049,62041,0,0,323,7011,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,24,181:8:0	0,15,113:5:0	0,15,144:5:0
-X	3431	.	T	<*>	0	.	DP=18;I16=9,9,0,0,651,24101,0,0,1049,62041,0,0,327,7111,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,24,210:8:0	0,15,139:5:0	0,15,166:5:0
-X	3432	.	T	<*>	0	.	DP=18;I16=8,9,0,0,577,20601,0,0,989,58441,0,0,306,6606,0,0;QS=3,0;MQSB=0.928603;MQ0F=0	PL:DP:DV	0,21,162:7:0	0,15,144:5:0	0,15,165:5:0
-X	3433	.	G	<*>	0	.	DP=18;I16=9,9,0,0,623,22589,0,0,1049,62041,0,0,334,7320,0,0;QS=3,0;MQSB=0.924089;MQ0F=0	PL:DP:DV	0,24,199:8:0	0,15,138:5:0	0,15,164:5:0
-X	3434	.	C	<*>	0	.	DP=18;I16=10,7,0,0,582,20838,0,0,1020,61200,0,0,324,7208,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,208:8:0	0,15,130:5:0	0,12,137:4:0
-X	3435	.	A	<*>	0	.	DP=18;I16=10,8,0,0,595,21619,0,0,1049,62041,0,0,341,7453,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,27,185:9:0	0,15,150:5:0	0,12,151:4:0
-X	3436	.	G	<*>	0	.	DP=18;I16=10,8,0,0,617,22277,0,0,1049,62041,0,0,345,7549,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,27,218:9:0	0,15,146:5:0	0,12,133:4:0
-X	3437	.	T	G,<*>	0	.	DP=18;I16=10,7,0,1,594,21168,16,256,1020,61200,29,841,333,7409,16,256;QS=2.94286,0.0571429,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.906029;BQB=1;MQ0F=0	PL:DP:DV	0,11,188,24,191,195:9:1	0,15,148,15,148,148:5:0	0,12,132,12,132,132:4:0
-X	3438	.	G	<*>	0	.	DP=18;I16=10,7,0,0,622,23296,0,0,1020,61200,0,0,335,7461,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,215:8:0	0,15,152:5:0	0,12,140:4:0
-X	3439	.	A	<*>	0	.	DP=18;I16=10,8,0,0,619,22965,0,0,1049,62041,0,0,355,7853,0,0;QS=3,0;MQSB=0.906029;MQ0F=0	PL:DP:DV	0,27,215:9:0	0,15,153:5:0	0,12,132:4:0
-X	3440	.	G	<*>	0	.	DP=18;I16=10,7,0,0,610,22660,0,0,1020,61200,0,0,339,7613,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,221:8:0	0,15,143:5:0	0,12,131:4:0
-X	3441	.	C	<*>	0	.	DP=18;I16=10,6,0,0,585,22165,0,0,960,57600,0,0,315,7037,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,226:8:0	0,15,140:5:0	0,9,115:3:0
-X	3442	.	T	<*>	0	.	DP=20;I16=11,9,0,0,670,24716,0,0,1138,66482,0,0,362,8166,0,0;QS=3,0;MQSB=0.997118;MQ0F=0	PL:DP:DV	0,33,248:11:0	0,15,143:5:0	0,12,128:4:0
-X	3443	.	G	<*>	0	.	DP=20;I16=11,9,0,0,708,26092,0,0,1138,66482,0,0,366,8288,0,0;QS=3,0;MQSB=0.997118;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,143:5:0	0,12,137:4:0
-X	3444	.	A	<*>	0	.	DP=20;I16=11,9,0,0,698,25978,0,0,1138,66482,0,0,369,8379,0,0;QS=3,0;MQSB=0.997118;MQ0F=0	PL:DP:DV	0,33,244:11:0	0,15,161:5:0	0,12,131:4:0
-X	3445	.	G	<*>	0	.	DP=20;I16=11,9,0,0,718,26590,0,0,1138,66482,0,0,372,8488,0,0;QS=3,0;MQSB=0.997118;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,153:5:0	0,12,132:4:0
-X	3446	.	A	<*>	0	.	DP=20;I16=10,8,0,0,635,23323,0,0,1049,62041,0,0,325,7365,0,0;QS=3,0;MQSB=0.938795;MQ0F=0	PL:DP:DV	0,27,222:9:0	0,15,154:5:0	0,12,131:4:0
-X	3447	.	T	<*>	0	.	DP=20;I16=11,8,0,0,669,24331,0,0,1109,65641,0,0,352,8084,0,0;QS=3,0;MQSB=0.946915;MQ0F=0	PL:DP:DV	0,30,230:10:0	0,15,150:5:0	0,12,137:4:0
-X	3448	.	C	<*>	0	.	DP=19;I16=10,8,0,0,641,23693,0,0,1049,62041,0,0,355,8193,0,0;QS=3,0;MQSB=0.938795;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,113:4:0	0,12,128:4:0
-X	3449	.	A	<*>	0	.	DP=19;I16=10,8,0,0,565,19185,0,0,1049,62041,0,0,357,8265,0,0;QS=3,0;MQSB=0.938795;MQ0F=0	PL:DP:DV	0,30,217:10:0	0,12,111:4:0	0,12,119:4:0
-X	3450	.	C	<*>	0	.	DP=18;I16=8,8,0,0,520,17846,0,0,898,52082,0,0,334,7674,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,30,229:10:0	0,6,70:2:0	0,12,106:4:0
-X	3451	.	G	<*>	0	.	DP=18;I16=10,7,0,0,528,17178,0,0,989,58441,0,0,361,8345,0,0;QS=3,0;MQSB=0.943335;MQ0F=0	PL:DP:DV	0,30,226:10:0	0,9,56:3:0	0,12,123:4:0
-X	3452	.	C	<*>	0	.	DP=18;I16=10,8,0,0,657,24597,0,0,1018,59282,0,0,388,9028,0,0;QS=3,0;MQSB=0.99606;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,84:3:0	0,12,128:4:0
-X	3453	.	C	<*>	0	.	DP=18;I16=10,8,0,0,663,24951,0,0,1018,59282,0,0,390,9098,0,0;QS=3,0;MQSB=0.99606;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,90:3:0	0,12,125:4:0
-X	3454	.	A	<*>	0	.	DP=18;I16=10,8,0,0,614,21898,0,0,1018,59282,0,0,392,9180,0,0;QS=3,0;MQSB=0.99606;MQ0F=0	PL:DP:DV	0,33,251:11:0	0,9,90:3:0	0,12,128:4:0
-X	3455	.	C	<*>	0	.	DP=18;I16=10,8,0,0,650,23968,0,0,1018,59282,0,0,394,9274,0,0;QS=3,0;MQSB=0.99606;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,90:3:0	0,12,127:4:0
-X	3456	.	T	<*>	0	.	DP=18;I16=10,8,0,0,607,21961,0,0,1018,59282,0,0,395,9329,0,0;QS=3,0;MQSB=0.99606;MQ0F=0	PL:DP:DV	0,33,243:11:0	0,9,88:3:0	0,12,135:4:0
-X	3457	.	G	<*>	0	.	DP=18;I16=9,7,0,0,549,19861,0,0,898,52082,0,0,346,8144,0,0;QS=3,0;MQSB=0.994413;MQ0F=0	PL:DP:DV	0,33,254:11:0	0,6,63:2:0	0,9,107:3:0
-X	3458	.	C	<*>	0	.	DP=18;I16=10,8,0,0,638,23236,0,0,1018,59282,0,0,397,9469,0,0;QS=3,0;MQSB=0.99606;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,81:3:0	0,12,125:4:0
-X	3459	.	A	C,<*>	0	.	DP=17;I16=9,7,0,1,520,18390,22,484,929,54841,29,841,372,8830,25,625;QS=2.92971,0.0702875,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.998843;BQB=1;MQ0F=0	PL:DP:DV	0,8,201,27,204,213:10:1	0,9,84,9,84,84:3:0	0,12,116,12,116,116:4:0
-X	3460	.	C	<*>	0	.	DP=17;I16=8,7,0,0,554,20952,0,0,869,51241,0,0,345,8103,0,0;QS=3,0;MQSB=0.921243;MQ0F=0	PL:DP:DV	0,27,244:9:0	0,6,65:2:0	0,12,131:4:0
-X	3461	.	T	<*>	0	.	DP=17;I16=9,7,0,0,591,22805,0,0,929,54841,0,0,368,8638,0,0;QS=3,0;MQSB=0.933674;MQ0F=0	PL:DP:DV	0,27,231:9:0	0,9,103:3:0	0,12,133:4:0
-X	3462	.	C	<*>	0	.	DP=18;I16=9,9,0,0,672,25486,0,0,1018,59282,0,0,391,9185,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,90:3:0	0,12,130:4:0
-X	3463	.	C	<*>	0	.	DP=18;I16=8,9,0,0,584,21458,0,0,958,55682,0,0,369,8671,0,0;QS=3,0;MQSB=0.998843;MQ0F=0	PL:DP:DV	0,30,244:10:0	0,9,86:3:0	0,12,132:4:0
-X	3464	.	A	<*>	0	.	DP=18;I16=9,9,0,0,628,23490,0,0,1018,59282,0,0,387,8973,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,244:11:0	0,9,96:3:0	0,12,142:4:0
-X	3465	.	G	<*>	0	.	DP=19;I16=9,9,0,0,642,24008,0,0,1018,59282,0,0,384,8842,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,91:3:0	0,12,135:4:0
-X	3466	.	C	<*>	0	.	DP=20;I16=9,10,0,0,682,25218,0,0,1047,60123,0,0,378,8588,0,0;QS=3,0;MQSB=0.904084;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,9,101:3:0	0,15,147:5:0
-X	3467	.	C	<*>	0	.	DP=20;I16=10,9,0,0,685,25919,0,0,1047,60123,0,0,397,9139,0,0;QS=3,0;MQSB=0.948064;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,12,115:4:0	0,15,154:5:0
-X	3468	.	T	<*>	0	.	DP=20;I16=10,9,0,0,672,25426,0,0,1047,60123,0,0,374,8410,0,0;QS=3,0;MQSB=0.948064;MQ0F=0	PL:DP:DV	0,30,246:10:0	0,12,126:4:0	0,15,164:5:0
-X	3469	.	G	<*>	0	.	DP=21;I16=10,11,0,0,788,30064,0,0,1167,67323,0,0,396,8924,0,0;QS=3,0;MQSB=0.914611;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,146:5:0	0,15,163:5:0
-X	3470	.	G	<*>	0	.	DP=22;I16=11,11,0,0,796,29754,0,0,1196,68164,0,0,393,8781,0,0;QS=3,0;MQSB=0.770381;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,131:5:0	0,15,161:5:0
-X	3471	.	G	<*>	0	.	DP=23;I16=12,11,0,0,801,29083,0,0,1256,71764,0,0,391,8657,0,0;QS=3,0;MQSB=0.811552;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,133:5:0	0,15,151:5:0
-X	3472	.	C	<*>	0	.	DP=23;I16=12,11,0,0,757,26535,0,0,1256,71764,0,0,390,8554,0,0;QS=3,0;MQSB=0.811552;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,145:5:0	0,15,136:5:0
-X	3473	.	A	<*>	0	.	DP=23;I16=11,11,0,0,777,28175,0,0,1196,68164,0,0,379,8373,0,0;QS=3,0;MQSB=0.770381;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,148:5:0	0,15,153:5:0
-X	3474	.	A	<*>	0	.	DP=23;I16=12,11,0,0,807,29181,0,0,1256,71764,0,0,388,8414,0,0;QS=3,0;MQSB=0.811552;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,150:5:0	0,15,155:5:0
-X	3475	.	C	<*>	0	.	DP=22;I16=12,10,0,0,737,25849,0,0,1196,68164,0,0,387,8327,0,0;QS=3,0;MQSB=0.838545;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,137:5:0	0,15,143:5:0
-X	3476	.	A	<*>	0	.	DP=22;I16=12,10,0,0,790,29312,0,0,1196,68164,0,0,386,8262,0,0;QS=3,0;MQSB=0.838545;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,149:5:0	0,15,154:5:0
-X	3477	.	G	<*>	0	.	DP=22;I16=11,10,0,0,755,28237,0,0,1136,64564,0,0,363,7735,0,0;QS=3,0;MQSB=0.799507;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,126:4:0	0,15,153:5:0
-X	3478	.	A	<*>	0	.	DP=25;I16=13,11,0,0,857,31637,0,0,1316,75364,0,0,384,8198,0,0;QS=3,0;MQSB=0.845496;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,167:6:0	0,18,190:6:0
-X	3479	.	G	<*>	0	.	DP=25;I16=12,10,0,0,783,28623,0,0,1227,70923,0,0,355,7701,0,0;QS=3,0;MQSB=0.613159;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,152:5:0	0,18,160:6:0
-X	3480	.	T	<*>	0	.	DP=25;I16=13,11,0,0,788,27124,0,0,1316,75364,0,0,393,8531,0,0;QS=3,0;MQSB=0.845496;MQ0F=0	PL:DP:DV	0,33,249:11:0	0,21,182:7:0	0,18,155:6:0
-X	3481	.	A	<*>	0	.	DP=25;I16=12,12,0,0,858,30884,0,0,1347,78123,0,0,397,8685,0,0;QS=3,0;MQSB=0.941765;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,194:7:0	0,15,148:5:0
-X	3482	.	A	<*>	0	.	DP=25;I16=13,12,0,0,927,35013,0,0,1376,78964,0,0,412,8942,0,0;QS=3,0;MQSB=0.822311;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,202:7:0	0,18,182:6:0
-X	3483	.	G	<*>	0	.	DP=25;I16=12,12,0,0,794,27410,0,0,1316,75364,0,0,412,9002,0,0;QS=3,0;MQSB=0.786628;MQ0F=0	PL:DP:DV	0,33,253:11:0	0,21,183:7:0	0,18,158:6:0
-X	3484	.	A	C,<*>	0	.	DP=24;I16=12,9,0,1,710,25220,14,196,1198,70082,60,3600,346,7514,25,625;QS=2.93665,0.0633484,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.804615;BQB=1;MQ0F=0	PL:DP:DV	0,30,227,30,227,227:10:0	0,7,156,18,159,162:7:1	0,15,133,15,133,133:5:0
-X	3485	.	C	<*>	0	.	DP=23;I16=11,11,0,0,766,27656,0,0,1196,68164,0,0,393,8573,0,0;QS=3,0;MQSB=0.770381;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,163:6:0	0,15,120:5:0
-X	3486	.	T	<*>	0	.	DP=24;I16=12,10,0,0,799,30529,0,0,1196,68164,0,0,398,8756,0,0;QS=3,0;MQSB=0.838545;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,21,198:7:0	0,15,128:5:0
-X	3487	.	C	<*>	0	.	DP=24;I16=10,11,0,0,724,27586,0,0,1167,67323,0,0,393,8905,0,0;QS=3,0;MQSB=0.914611;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,162:6:0	0,12,92:4:0
-X	3488	.	T	<*>	0	.	DP=24;I16=12,10,0,0,742,27454,0,0,1196,68164,0,0,429,9571,0,0;QS=3,0;MQSB=0.838545;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,172:7:0	0,12,98:4:0
-X	3489	.	G	<*>	0	.	DP=25;I16=13,11,0,0,778,28994,0,0,1285,72605,0,0,433,9675,0,0;QS=3,0;MQSB=0.97965;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,24,177:8:0	0,12,75:4:0
-X	3490	.	T	C,<*>	0	.	DP=27;I16=14,10,1,0,806,28886,25,625,1254,69846,60,3600,427,9659,12,144;QS=2.90775,0.0922509,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.962269;BQB=1;MQ0F=0	PL:DP:DV	0,39,255,39,255,255:13:0	0,2,168,24,171,183:9:1	0,9,85,9,85,85:3:0
-X	3491	.	C	<*>	0	.	DP=28;I16=15,11,0,0,864,31232,0,0,1405,79805,0,0,445,9903,0,0;QS=3,0;MQSB=0.753395;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,197:9:0	0,9,78:3:0
-X	3492	.	T	<*>	0	.	DP=28;I16=15,11,0,0,852,31516,0,0,1405,79805,0,0,452,9986,0,0;QS=3,0;MQSB=0.753395;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,212:9:0	0,9,96:3:0
-X	3493	.	C	<*>	0	.	DP=28;I16=15,12,0,0,891,32181,0,0,1434,80646,0,0,464,10124,0,0;QS=3,0;MQSB=0.908075;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,27,214:9:0	0,9,80:3:0
-X	3493	.	CAAAAAAAAAAAAA	CAAAAAAAAAAAA,CAAAAAAAAAAAAAA	0	.	INDEL;IDV=2;IMF=0.125;DP=28;I16=9,9,0,2,443,11071,47,1129,1049,62041,89,4441,320,7120,30,650;QS=2.81818,0.0909091,0.0909091;VDB=0.504964;SGB=0.346553;MQSB=0.997118;MQ0F=0	PL:DP:DV	0,19,37,19,40,37:11:2	0,18,39,18,39,39:6:0	0,9,23,9,23,23:3:0
-X	3494	.	A	<*>	0	.	DP=30;I16=15,12,0,0,970,37408,0,0,1465,83405,0,0,440,9568,0,0;QS=3,0;MQSB=0.723173;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,220:9:0	0,12,117:4:0
-X	3495	.	A	<*>	0	.	DP=31;I16=15,13,0,0,966,36178,0,0,1525,87005,0,0,472,10270,0,0;QS=3,0;MQSB=0.695496;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,210:9:0	0,15,129:5:0
-X	3496	.	A	<*>	0	.	DP=31;I16=15,13,0,0,974,36928,0,0,1525,87005,0,0,477,10281,0,0;QS=3,0;MQSB=0.695496;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,207:9:0	0,15,138:5:0
-X	3497	.	A	<*>	0	.	DP=32;I16=14,14,0,0,1015,39525,0,0,1525,87005,0,0,460,9834,0,0;QS=3,0;MQSB=0.62781;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,208:8:0	0,18,148:6:0
-X	3498	.	A	<*>	0	.	DP=32;I16=14,14,0,0,982,37264,0,0,1556,89764,0,0,460,9628,0,0;QS=3,0;MQSB=0.813104;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,27,220:9:0	0,15,115:5:0
-X	3499	.	A	<*>	0	.	DP=32;I16=14,14,0,0,1024,40072,0,0,1525,87005,0,0,489,10267,0,0;QS=3,0;MQSB=0.62781;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,222:8:0	0,18,144:6:0
-X	3500	.	A	<*>	0	.	DP=31;I16=14,14,0,0,995,38097,0,0,1525,87005,0,0,494,10316,0,0;QS=3,0;MQSB=0.62781;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,214:8:0	0,18,150:6:0
-X	3501	.	A	<*>	0	.	DP=31;I16=14,14,0,0,1017,39845,0,0,1525,87005,0,0,499,10399,0,0;QS=3,0;MQSB=0.62781;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,221:8:0	0,18,149:6:0
-X	3502	.	A	<*>	0	.	DP=31;I16=14,14,0,0,1051,41955,0,0,1525,87005,0,0,504,10516,0,0;QS=3,0;MQSB=0.62781;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,223:8:0	0,18,154:6:0
-X	3503	.	A	<*>	0	.	DP=31;I16=14,14,0,0,1038,40832,0,0,1525,87005,0,0,509,10667,0,0;QS=3,0;MQSB=0.62781;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,229:8:0	0,18,155:6:0
-X	3504	.	A	<*>	0	.	DP=31;I16=14,14,0,0,1037,41235,0,0,1525,87005,0,0,512,10750,0,0;QS=3,0;MQSB=0.62781;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,229:8:0	0,18,145:6:0
-X	3505	.	A	<*>	0	.	DP=31;I16=14,14,0,0,1039,40959,0,0,1525,87005,0,0,514,10814,0,0;QS=3,0;MQSB=0.62781;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,24,233:8:0	0,18,156:6:0
-X	3506	.	A	<*>	0	.	DP=32;I16=11,13,0,0,889,34265,0,0,1378,80882,0,0,427,9079,0,0;QS=3,0;MQSB=0.998323;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,201:6:0	0,18,158:6:0
-X	3507	.	T	<*>	0	.	DP=31;I16=10,17,0,0,995,38431,0,0,1527,88923,0,0,493,10499,0,0;QS=3,0;MQSB=0.997168;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,187:6:0	0,18,153:6:0
-X	3508	.	C	<*>	0	.	DP=31;I16=10,17,0,0,997,40091,0,0,1527,88923,0,0,499,10675,0,0;QS=3,0;MQSB=0.997168;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,160:6:0	0,15,119:5:0
-X	3509	.	A	<*>	0	.	DP=30;I16=11,17,0,0,995,37147,0,0,1556,89764,0,0,529,11459,0,0;QS=3,0;MQSB=0.960952;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,175:6:0	0,15,125:5:0
-X	3510	.	C	A,<*>	0	.	DP=29;I16=9,17,1,0,959,37997,40,1600,1498,88082,29,841,483,10351,25,625;QS=2.95246,0.047541,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.997168;BQB=1;MQ0F=0	PL:DP:DV	0,19,255,45,255,255:16:1	0,18,150,18,150,150:6:0	0,15,119,15,119,119:5:0
-X	3511	.	A	<*>	0	.	DP=32;I16=11,17,0,0,923,33125,0,0,1587,92523,0,0,512,11150,0,0;QS=3,0;MQSB=0.993109;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,169:6:0	0,15,115:5:0
-X	3512	.	C	<*>	0	.	DP=32;I16=10,18,0,0,1058,42208,0,0,1618,95282,0,0,493,10733,0,0;QS=3,0;MQSB=0.891417;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,181:6:0	0,15,131:5:0
-X	3513	.	C	A,<*>	0	.	DP=32;I16=10,18,1,0,1074,42406,13,169,1618,95282,29,841,498,10926,25,625;QS=2.98,0.02,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.995968;BQB=1;MQ0F=0	PL:DP:DV	0,39,255,51,255,255:18:1	0,18,190,18,190,190:6:0	0,15,136,15,136,136:5:0
-X	3514	.	A	<*>	0	.	DP=33;I16=11,19,0,0,1101,42213,0,0,1707,99723,0,0,528,11778,0,0;QS=3,0;MQSB=0.997918;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,199:7:0	0,15,132:5:0
-X	3515	.	T	<*>	0	.	DP=33;I16=12,19,0,0,1130,43380,0,0,1736,100564,0,0,557,12563,0,0;QS=3,0;MQSB=0.960505;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,192:7:0	0,15,126:5:0
-X	3516	.	T	<*>	0	.	DP=34;I16=14,17,0,0,1147,44331,0,0,1767,103323,0,0,536,12078,0,0;QS=3,0;MQSB=0.924242;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,203:7:0	0,15,133:5:0
-X	3517	.	T	<*>	0	.	DP=34;I16=14,18,0,0,1183,46549,0,0,1796,104164,0,0,565,12773,0,0;QS=3,0;MQSB=0.988522;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,21,210:7:0	0,15,153:5:0
-X	3518	.	T	<*>	0	.	DP=34;I16=14,18,0,0,1165,44867,0,0,1796,104164,0,0,568,12826,0,0;QS=3,0;MQSB=0.988522;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,21,203:7:0	0,15,141:5:0
-X	3519	.	G	<*>	0	.	DP=33;I16=13,18,0,0,1158,46678,0,0,1736,100564,0,0,572,12912,0,0;QS=3,0;MQSB=0.980167;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,18,189:6:0	0,15,154:5:0
-X	3520	.	G	<*>	0	.	DP=33;I16=12,18,0,0,1111,42471,0,0,1707,99723,0,0,552,12438,0,0;QS=3,0;MQSB=0.991968;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,18,183:6:0	0,15,151:5:0
-X	3521	.	C	<*>	0	.	DP=32;I16=11,17,0,0,1077,43755,0,0,1649,98041,0,0,530,11850,0,0;QS=3,0;MQSB=0.967085;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,185:6:0	0,15,143:5:0
-X	3522	.	T	<*>	0	.	DP=32;I16=12,17,0,0,1125,46329,0,0,1678,98882,0,0,552,12274,0,0;QS=3,0;MQSB=0.993891;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,199:6:0	0,15,158:5:0
-X	3523	.	T	<*>	0	.	DP=31;I16=11,16,0,0,996,38204,0,0,1558,91682,0,0,544,12286,0,0;QS=3,0;MQSB=0.992419;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,193:6:0	0,15,145:5:0
-X	3524	.	C	<*>	0	.	DP=31;I16=11,16,0,0,1067,43883,0,0,1589,94441,0,0,538,11960,0,0;QS=3,0;MQSB=0.96384;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,192:6:0	0,15,152:5:0
-X	3525	.	A	<*>	0	.	DP=31;I16=13,16,0,0,1132,46402,0,0,1678,98882,0,0,556,12250,0,0;QS=3,0;MQSB=0.997839;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,200:6:0	0,15,165:5:0
-X	3526	.	G	<*>	0	.	DP=31;I16=12,16,0,0,1090,43912,0,0,1649,98041,0,0,543,12053,0,0;QS=3,0;MQSB=0.96195;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,181:6:0	0,15,147:5:0
-X	3527	.	A	<*>	0	.	DP=31;I16=13,16,0,0,1068,41740,0,0,1678,98882,0,0,560,12334,0,0;QS=3,0;MQSB=0.997839;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,170:6:0	0,15,157:5:0
-X	3528	.	T	<*>	0	.	DP=31;I16=13,16,0,0,1076,41782,0,0,1678,98882,0,0,561,12369,0,0;QS=3,0;MQSB=0.997839;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,193:6:0	0,15,152:5:0
-X	3529	.	T	<*>	0	.	DP=31;I16=12,16,0,0,1016,38674,0,0,1649,98041,0,0,550,12290,0,0;QS=3,0;MQSB=0.96195;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,184:6:0	0,15,154:5:0
-X	3530	.	G	<*>	0	.	DP=30;I16=12,17,0,0,1070,40570,0,0,1709,101641,0,0,578,13032,0,0;QS=3,0;MQSB=0.965321;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,176:6:0	0,18,175:6:0
-X	3531	.	C	A,<*>	0	.	DP=31;I16=13,17,1,0,1080,40304,38,1444,1738,102482,29,841,607,13801,10,100;QS=2.95773,0.0422741,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.924242;BQB=1;MQ0F=0	PL:DP:DV	0,28,255,54,255,255:19:1	0,18,172,18,172,172:6:0	0,18,175,18,175,175:6:0
-X	3532	.	A	<*>	0	.	DP=31;I16=14,17,0,0,1136,42380,0,0,1767,103323,0,0,619,14003,0,0;QS=3,0;MQSB=0.924242;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,18,180:6:0	0,18,184:6:0
-X	3533	.	T	<*>	0	.	DP=31;I16=13,17,0,0,1074,39206,0,0,1738,102482,0,0,595,13457,0,0;QS=3,0;MQSB=0.996503;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,180:6:0	0,18,176:6:0
-X	3534	.	A	<*>	0	.	DP=30;I16=12,17,0,0,1014,36168,0,0,1678,98882,0,0,597,13561,0,0;QS=3,0;MQSB=0.993891;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,165:6:0	0,18,175:6:0
-X	3535	.	T	<*>	0	.	DP=31;I16=14,17,0,0,1042,36456,0,0,1767,103323,0,0,624,14314,0,0;QS=3,0;MQSB=0.924242;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,18,162:6:0	0,18,164:6:0
-X	3536	.	C	<*>	0	.	DP=31;I16=13,17,0,0,1102,41182,0,0,1738,102482,0,0,602,13842,0,0;QS=3,0;MQSB=0.996503;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,178:6:0	0,18,180:6:0
-X	3537	.	C	<*>	0	.	DP=32;I16=13,17,0,0,1142,43828,0,0,1769,105241,0,0,598,13854,0,0;QS=3,0;MQSB=0.963674;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,194:7:0	0,18,185:6:0
-X	3538	.	T	<*>	0	.	DP=32;I16=14,17,0,0,1151,43471,0,0,1798,106082,0,0,603,13923,0,0;QS=3,0;MQSB=0.998229;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,211:7:0	0,18,185:6:0
-X	3539	.	C	<*>	0	.	DP=32;I16=12,17,0,0,1077,40959,0,0,1709,101641,0,0,600,13994,0,0;QS=3,0;MQSB=0.965321;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,170:6:0	0,18,173:6:0
-X	3540	.	C	<*>	0	.	DP=31;I16=13,17,0,0,1134,43546,0,0,1769,105241,0,0,603,14055,0,0;QS=3,0;MQSB=0.963674;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,209:7:0	0,18,172:6:0
-X	3541	.	T	<*>	0	.	DP=32;I16=13,18,0,0,1143,42901,0,0,1829,108841,0,0,604,14134,0,0;QS=3,0;MQSB=0.966712;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,224:8:0	0,18,187:6:0
-X	3542	.	G	<*>	0	.	DP=32;I16=13,18,0,0,1152,43714,0,0,1829,108841,0,0,604,14134,0,0;QS=3,0;MQSB=0.966712;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,223:8:0	0,18,172:6:0
-X	3543	.	C	<*>	0	.	DP=31;I16=13,17,0,0,1142,43818,0,0,1769,105241,0,0,605,14153,0,0;QS=3,0;MQSB=0.963674;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,221:8:0	0,18,188:6:0
-X	3544	.	A	<*>	0	.	DP=31;I16=13,17,0,0,1089,40065,0,0,1769,105241,0,0,606,14190,0,0;QS=3,0;MQSB=0.963674;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,24,221:8:0	0,18,173:6:0
-X	3545	.	A	<*>	0	.	DP=30;I16=13,16,0,0,1118,43688,0,0,1709,101641,0,0,607,14195,0,0;QS=3,0;MQSB=0.960189;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,21,228:7:0	0,18,196:6:0
-X	3546	.	G	<*>	0	.	DP=30;I16=14,16,0,0,1131,43425,0,0,1738,102482,0,0,630,14698,0,0;QS=3,0;MQSB=0.999136;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,206:7:0	0,18,179:6:0
-X	3547	.	G	<*>	0	.	DP=31;I16=13,17,0,0,1076,39798,0,0,1769,105241,0,0,607,14163,0,0;QS=3,0;MQSB=0.963674;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,189:7:0	0,18,187:6:0
-X	3548	.	A	<*>	0	.	DP=31;I16=13,17,0,0,1071,39059,0,0,1769,105241,0,0,608,14178,0,0;QS=3,0;MQSB=0.963674;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,208:7:0	0,18,179:6:0
-X	3549	.	T	<*>	0	.	DP=30;I16=13,16,0,0,1008,35928,0,0,1678,98882,0,0,605,13989,0,0;QS=3,0;MQSB=0.997839;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,180:6:0	0,15,152:5:0
-X	3550	.	A	<*>	0	.	DP=30;I16=13,16,0,0,1061,39371,0,0,1709,101641,0,0,612,14270,0,0;QS=3,0;MQSB=0.960189;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,194:7:0	0,15,173:5:0
-X	3551	.	T	<*>	0	.	DP=30;I16=13,16,0,0,1026,36844,0,0,1709,101641,0,0,613,14295,0,0;QS=3,0;MQSB=0.960189;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,192:7:0	0,15,162:5:0
-X	3552	.	A	<*>	0	.	DP=30;I16=14,16,0,0,1080,39588,0,0,1738,102482,0,0,631,14627,0,0;QS=3,0;MQSB=0.999136;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,202:7:0	0,15,158:5:0
-X	3553	.	T	A,<*>	0	.	DP=30;I16=13,16,1,0,1047,38333,20,400,1709,101641,29,841,616,14398,16,256;QS=2.96795,0.0320513,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.999136;BQB=1;MQ0F=0	PL:DP:DV	0,34,255,51,255,255:18:1	0,18,178,18,178,178:6:0	0,18,183,18,183,183:6:0
-X	3554	.	A	<*>	0	.	DP=30;I16=14,16,0,0,1063,38413,0,0,1738,102482,0,0,632,14602,0,0;QS=3,0;MQSB=0.999136;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,185:6:0	0,18,179:6:0
-X	3555	.	C	<*>	0	.	DP=30;I16=14,16,0,0,1021,35781,0,0,1738,102482,0,0,632,14574,0,0;QS=3,0;MQSB=0.999136;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,169:6:0	0,18,163:6:0
-X	3556	.	G	<*>	0	.	DP=30;I16=13,16,0,0,1014,36426,0,0,1709,101641,0,0,618,14350,0,0;QS=3,0;MQSB=0.960189;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,168:6:0	0,18,173:6:0
-X	3557	.	C	<*>	0	.	DP=31;I16=14,16,0,0,1001,34919,0,0,1769,105241,0,0,618,14342,0,0;QS=3,0;MQSB=0.958545;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,140:6:0	0,18,165:6:0
-X	3558	.	G	<*>	0	.	DP=31;I16=15,16,0,0,1036,35974,0,0,1798,106082,0,0,630,14476,0,0;QS=3,0;MQSB=0.999805;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,18,159:6:0	0,18,171:6:0
-X	3559	.	T	<*>	0	.	DP=30;I16=14,16,0,0,1086,40202,0,0,1769,105241,0,0,619,14341,0,0;QS=3,0;MQSB=0.958545;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,171:6:0	0,18,192:6:0
-X	3560	.	G	<*>	0	.	DP=31;I16=14,16,0,0,1151,45035,0,0,1738,102482,0,0,611,14127,0,0;QS=3,0;MQSB=0.999136;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,165:5:0	0,18,194:6:0
-X	3561	.	A	<*>	0	.	DP=31;I16=15,16,0,0,1147,43431,0,0,1798,106082,0,0,626,14366,0,0;QS=3,0;MQSB=0.999805;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,18,186:6:0	0,18,196:6:0
-X	3562	.	A	<*>	0	.	DP=31;I16=16,15,0,0,1157,43859,0,0,1798,106082,0,0,623,14257,0,0;QS=3,0;MQSB=0.999805;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,192:6:0	0,21,213:7:0
-X	3563	.	A	<*>	0	.	DP=31;I16=16,15,0,0,1162,44010,0,0,1798,106082,0,0,620,14124,0,0;QS=3,0;MQSB=0.999805;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,192:6:0	0,21,216:7:0
-X	3564	.	T	<*>	0	.	DP=31;I16=15,15,0,0,1132,43298,0,0,1769,105241,0,0,610,13932,0,0;QS=3,0;MQSB=0.952765;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,192:6:0	0,21,214:7:0
-X	3565	.	T	<*>	0	.	DP=32;I16=16,16,0,0,1163,42649,0,0,1858,109682,0,0,611,13791,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,18,189:6:0	0,21,212:7:0
-X	3566	.	C	<*>	0	.	DP=32;I16=16,16,0,0,1162,43586,0,0,1858,109682,0,0,606,13596,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,18,181:6:0	0,21,209:7:0
-X	3567	.	A	<*>	0	.	DP=32;I16=15,16,0,0,1181,45245,0,0,1829,108841,0,0,597,13375,0,0;QS=3,0;MQSB=0.957006;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,192:6:0	0,21,222:7:0
-X	3568	.	A	<*>	0	.	DP=32;I16=15,16,0,0,1194,46670,0,0,1829,108841,0,0,592,13200,0,0;QS=3,0;MQSB=0.957006;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,204:6:0	0,21,228:7:0
-X	3569	.	G	<*>	0	.	DP=31;I16=15,16,0,0,1164,44544,0,0,1829,108841,0,0,586,13006,0,0;QS=3,0;MQSB=0.957006;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,18,180:6:0	0,21,204:7:0
-X	3570	.	T	<*>	0	.	DP=30;I16=14,15,0,0,1029,37527,0,0,1709,101641,0,0,572,12730,0,0;QS=3,0;MQSB=0.954405;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,12,136:4:0	0,21,213:7:0
-X	3571	.	C	<*>	0	.	DP=28;I16=13,15,0,0,1066,41192,0,0,1649,98041,0,0,568,12564,0,0;QS=3,0;MQSB=0.956162;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,138:4:0	0,21,215:7:0
-X	3572	.	A	<*>	0	.	DP=29;I16=13,16,0,0,1108,42566,0,0,1709,101641,0,0,564,12426,0,0;QS=3,0;MQSB=0.960189;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,172:5:0	0,21,218:7:0
-X	3573	.	A	<*>	0	.	DP=29;I16=13,16,0,0,1119,43403,0,0,1709,101641,0,0,558,12168,0,0;QS=3,0;MQSB=0.960189;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,174:5:0	0,21,220:7:0
-X	3574	.	T	<*>	0	.	DP=29;I16=13,16,0,0,1104,42220,0,0,1709,101641,0,0,552,11942,0,0;QS=3,0;MQSB=0.960189;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,175:5:0	0,21,218:7:0
-X	3575	.	G	<*>	0	.	DP=29;I16=13,16,0,0,1122,43748,0,0,1709,101641,0,0,546,11748,0,0;QS=3,0;MQSB=0.960189;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,161:5:0	0,21,212:7:0
-X	3576	.	A	<*>	0	.	DP=29;I16=13,16,0,0,1043,38405,0,0,1709,101641,0,0,540,11586,0,0;QS=3,0;MQSB=0.960189;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,15,170:5:0	0,21,213:7:0
-X	3577	.	C	<*>	0	.	DP=30;I16=13,17,0,0,1123,42529,0,0,1769,105241,0,0,534,11456,0,0;QS=3,0;MQSB=0.963674;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,161:5:0	0,21,211:7:0
-X	3578	.	A	<*>	0	.	DP=30;I16=13,17,0,0,1148,44236,0,0,1769,105241,0,0,529,11359,0,0;QS=3,0;MQSB=0.963674;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,178:5:0	0,21,216:7:0
-X	3579	.	A	<*>	0	.	DP=29;I16=13,16,0,0,1051,38961,0,0,1709,101641,0,0,524,11244,0,0;QS=3,0;MQSB=0.960189;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,172:5:0	0,18,192:6:0
-X	3580	.	A	<*>	0	.	DP=29;I16=13,16,0,0,1104,42344,0,0,1709,101641,0,0,519,11159,0,0;QS=3,0;MQSB=0.960189;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,172:5:0	0,18,201:6:0
-X	3581	.	T	<*>	0	.	DP=29;I16=13,16,0,0,1088,41226,0,0,1709,101641,0,0,513,11055,0,0;QS=3,0;MQSB=0.960189;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,161:5:0	0,18,199:6:0
-X	3582	.	C	<*>	0	.	DP=29;I16=13,16,0,0,1120,43616,0,0,1709,101641,0,0,506,10934,0,0;QS=3,0;MQSB=0.960189;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,172:5:0	0,18,201:6:0
-X	3583	.	A	<*>	0	.	DP=30;I16=14,16,0,0,1130,43606,0,0,1769,105241,0,0,498,10796,0,0;QS=3,0;MQSB=0.958545;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,183:5:0	0,21,213:7:0
-X	3584	.	G	<*>	0	.	DP=29;I16=12,16,0,0,1027,38895,0,0,1649,98041,0,0,487,10665,0,0;QS=3,0;MQSB=0.96195;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,12,137:4:0	0,21,209:7:0
-X	3585	.	A	<*>	0	.	DP=31;I16=14,17,0,0,1057,37719,0,0,1829,108841,0,0,486,10616,0,0;QS=3,0;MQSB=0.962133;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,15,168:5:0	0,24,209:8:0
-X	3586	.	A	<*>	0	.	DP=30;I16=14,15,0,0,1053,40043,0,0,1709,101641,0,0,477,10461,0,0;QS=3,0;MQSB=0.954405;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,174:5:0	0,24,213:8:0
-X	3587	.	G	A,<*>	0	.	DP=29;I16=4,7,10,6,426,16884,555,20381,660,39600,960,57600,192,4420,280,5942;QS=1.32665,1.67335,0;VDB=0.902044;SGB=-3.91326;RPB=0.800999;MQB=1;MQSB=1;BQB=0.156944;MQ0F=0	PL:DP:DV	161,0,184,182,205,255:14:7	22,0,118,34,121,148:5:1	212,24,0,212,24,212:8:8
-X	3588	.	A	<*>	0	.	DP=29;I16=14,14,0,0,999,36973,0,0,1680,100800,0,0,470,10254,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,166:5:0	0,24,215:8:0
-X	3589	.	A	<*>	0	.	DP=28;I16=14,13,0,0,967,35935,0,0,1620,97200,0,0,467,10173,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,166:5:0	0,24,206:8:0
-X	3590	.	A	<*>	0	.	DP=27;I16=13,13,0,0,948,35860,0,0,1560,93600,0,0,464,10072,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,146:4:0	0,24,211:8:0
-X	3591	.	A	<*>	0	.	DP=26;I16=13,13,0,0,913,33539,0,0,1560,93600,0,0,459,9901,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,144:4:0	0,24,212:8:0
-X	3592	.	A	<*>	0	.	DP=26;I16=13,13,0,0,893,32087,0,0,1560,93600,0,0,453,9711,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,143:4:0	0,24,199:8:0
-X	3593	.	A	<*>	0	.	DP=26;I16=13,13,0,0,891,31363,0,0,1560,93600,0,0,447,9553,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,137:4:0	0,24,198:8:0
-X	3594	.	C	<*>	0	.	DP=25;I16=12,12,0,0,910,34868,0,0,1440,86400,0,0,426,9170,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,142:4:0	0,24,216:8:0
-X	3595	.	A	<*>	0	.	DP=24;I16=13,11,0,0,918,35274,0,0,1440,86400,0,0,438,9328,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,143:4:0	0,21,199:7:0
-X	3596	.	T	<*>	0	.	DP=24;I16=13,11,0,0,837,30077,0,0,1440,86400,0,0,434,9258,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,138:4:0	0,21,188:7:0
-X	3597	.	A	<*>	0	.	DP=24;I16=13,11,0,0,893,33549,0,0,1440,86400,0,0,430,9216,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,132:4:0	0,21,204:7:0
-X	3598	.	T	<*>	0	.	DP=23;I16=12,10,0,0,778,28226,0,0,1320,79200,0,0,415,9005,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,140:4:0	0,21,162:7:0
-X	3599	.	A	<*>	0	.	DP=23;I16=13,10,0,0,859,32403,0,0,1380,82800,0,0,425,9105,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,142:4:0	0,21,182:7:0
-X	3600	.	T	<*>	0	.	DP=24;I16=14,10,0,0,872,32086,0,0,1435,85825,0,0,422,9036,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,139:4:0	0,21,183:7:0
-X	3601	.	A	<*>	0	.	DP=24;I16=14,10,0,0,862,31424,0,0,1435,85825,0,0,420,8994,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,132:4:0	0,21,186:7:0
-X	3602	.	T	<*>	0	.	DP=25;I16=15,10,0,0,873,31323,0,0,1495,89425,0,0,418,8980,0,0;QS=3,0;MQSB=0.962269;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,161:5:0	0,21,174:7:0
-X	3603	.	A	<*>	0	.	DP=26;I16=15,11,0,0,907,32447,0,0,1555,93025,0,0,416,8944,0,0;QS=3,0;MQSB=0.960078;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,151:5:0	0,24,216:8:0
-X	3604	.	C	<*>	0	.	DP=27;I16=16,11,0,0,905,31199,0,0,1615,96625,0,0,415,8937,0,0;QS=3,0;MQSB=0.96384;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,147:6:0	0,24,201:8:0
-X	3605	.	G	<*>	0	.	DP=27;I16=15,11,0,0,853,28887,0,0,1555,93025,0,0,393,8477,0,0;QS=3,0;MQSB=0.960078;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,171:6:0	0,21,174:7:0
-X	3606	.	C	<*>	0	.	DP=27;I16=15,12,0,0,982,36756,0,0,1615,96625,0,0,415,8967,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,187:6:0	0,27,231:9:0
-X	3607	.	A	<*>	0	.	DP=26;I16=15,11,0,0,927,33859,0,0,1555,93025,0,0,417,9005,0,0;QS=3,0;MQSB=0.960078;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,183:6:0	0,27,232:9:0
-X	3608	.	A	<*>	0	.	DP=27;I16=14,12,0,0,930,34054,0,0,1555,93025,0,0,394,8450,0,0;QS=3,0;MQSB=0.953497;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,176:6:0	0,24,232:8:0
-X	3609	.	A	<*>	0	.	DP=27;I16=15,12,0,0,955,34701,0,0,1615,96625,0,0,421,9127,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,186:6:0	0,27,238:9:0
-X	3610	.	C	<*>	0	.	DP=27;I16=14,12,0,0,915,33071,0,0,1555,93025,0,0,397,8537,0,0;QS=3,0;MQSB=0.953497;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,172:6:0	0,24,221:8:0
-X	3611	.	C	<*>	0	.	DP=25;I16=13,11,0,0,899,33995,0,0,1435,85825,0,0,398,8502,0,0;QS=3,0;MQSB=0.950498;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,173:6:0	0,24,234:8:0
-X	3612	.	A	<*>	0	.	DP=25;I16=14,11,0,0,957,37723,0,0,1495,89425,0,0,424,9118,0,0;QS=3,0;MQSB=0.955682;MQ0F=0	PL:DP:DV	0,30,255:10:0	0,18,194:6:0	0,27,251:9:0
-X	3613	.	G	<*>	0	.	DP=26;I16=13,12,0,0,902,33110,0,0,1495,89425,0,0,399,8461,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,172:6:0	0,24,223:8:0
-X	3614	.	T	<*>	0	.	DP=26;I16=14,12,0,0,912,33340,0,0,1555,93025,0,0,425,9083,0,0;QS=3,0;MQSB=0.953497;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,156:6:0	0,27,237:9:0
-X	3615	.	A	<*>	0	.	DP=26;I16=15,11,0,0,946,35138,0,0,1555,93025,0,0,427,9109,0,0;QS=3,0;MQSB=0.960078;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,176:6:0	0,27,242:9:0
-X	3616	.	T	<*>	0	.	DP=26;I16=15,11,0,0,965,36541,0,0,1555,93025,0,0,431,9163,0,0;QS=3,0;MQSB=0.960078;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,185:6:0	0,27,238:9:0
-X	3617	.	C	<*>	0	.	DP=25;I16=14,11,0,0,907,33675,0,0,1495,89425,0,0,436,9196,0,0;QS=3,0;MQSB=0.955682;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,176:6:0	0,24,215:8:0
-X	3618	.	C	<*>	0	.	DP=25;I16=14,11,0,0,964,37698,0,0,1495,89425,0,0,441,9259,0,0;QS=3,0;MQSB=0.955682;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,190:6:0	0,24,225:8:0
-X	3619	.	T	<*>	0	.	DP=25;I16=14,11,0,0,961,37553,0,0,1495,89425,0,0,446,9352,0,0;QS=3,0;MQSB=0.955682;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,194:6:0	0,24,238:8:0
-X	3620	.	A	<*>	0	.	DP=25;I16=14,11,0,0,880,31656,0,0,1495,89425,0,0,451,9475,0,0;QS=3,0;MQSB=0.955682;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,178:6:0	0,24,212:8:0
-X	3621	.	C	<*>	0	.	DP=25;I16=14,11,0,0,949,36561,0,0,1495,89425,0,0,456,9628,0,0;QS=3,0;MQSB=0.955682;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,18,182:6:0	0,24,230:8:0
-X	3622	.	T	<*>	0	.	DP=26;I16=15,11,0,0,983,38067,0,0,1555,93025,0,0,460,9762,0,0;QS=3,0;MQSB=0.960078;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,194:7:0	0,24,242:8:0
-X	3623	.	G	<*>	0	.	DP=27;I16=16,11,0,0,969,35645,0,0,1615,96625,0,0,465,9929,0,0;QS=3,0;MQSB=0.96384;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,195:7:0	0,24,209:8:0
-X	3624	.	T	<*>	0	.	DP=27;I16=15,11,0,0,948,35330,0,0,1555,93025,0,0,448,9596,0,0;QS=3,0;MQSB=0.960078;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,188:6:0	0,24,224:8:0
-X	3625	.	G	<*>	0	.	DP=27;I16=14,12,0,0,983,37483,0,0,1555,93025,0,0,453,9735,0,0;QS=3,0;MQSB=0.953497;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,210:7:0	0,24,219:8:0
-X	3626	.	T	<*>	0	.	DP=28;I16=15,12,0,0,998,37364,0,0,1615,96625,0,0,458,9854,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,21,214:7:0	0,27,229:9:0
-X	3627	.	G	<*>	0	.	DP=29;I16=15,13,0,0,999,36375,0,0,1675,100225,0,0,464,10004,0,0;QS=3,0;MQSB=0.956162;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,199:7:0	0,27,224:9:0
-X	3628	.	T	<*>	0	.	DP=29;I16=15,13,0,0,1033,38721,0,0,1675,100225,0,0,471,10187,0,0;QS=3,0;MQSB=0.956162;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,206:7:0	0,27,232:9:0
-X	3629	.	G	<*>	0	.	DP=29;I16=15,13,0,0,1058,40226,0,0,1675,100225,0,0,476,10304,0,0;QS=3,0;MQSB=0.956162;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,207:7:0	0,27,235:9:0
-X	3630	.	T	<*>	0	.	DP=30;I16=15,14,0,0,1052,39072,0,0,1735,103825,0,0,480,10404,0,0;QS=3,0;MQSB=0.954405;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,216:7:0	0,27,223:9:0
-X	3631	.	C	<*>	0	.	DP=29;I16=13,14,0,0,884,29476,0,0,1615,96625,0,0,461,9911,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,186:7:0	0,21,179:7:0
-X	3632	.	G	<*>	0	.	DP=29;I16=14,14,0,0,914,31068,0,0,1675,100225,0,0,491,10649,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,183:7:0	0,24,181:8:0
-X	3633	.	T	<*>	0	.	DP=29;I16=14,14,0,0,1022,38214,0,0,1675,100225,0,0,496,10792,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,216:7:0	0,24,222:8:0
-X	3634	.	T	<*>	0	.	DP=29;I16=14,14,0,0,1043,39891,0,0,1675,100225,0,0,500,10914,0,0;QS=3,0;MQSB=0.949591;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,219:7:0	0,24,227:8:0
-X	3635	.	T	<*>	0	.	DP=28;I16=13,14,0,0,1029,39507,0,0,1615,96625,0,0,505,11063,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,219:7:0	0,24,224:8:0
-X	3636	.	G	<*>	0	.	DP=28;I16=13,14,0,0,1001,37681,0,0,1615,96625,0,0,510,11238,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,201:7:0	0,24,217:8:0
-X	3637	.	T	<*>	0	.	DP=27;I16=13,14,0,0,1019,39331,0,0,1615,96625,0,0,515,11439,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,212:7:0	0,24,240:8:0
-X	3638	.	T	<*>	0	.	DP=26;I16=12,14,0,0,967,36467,0,0,1555,93025,0,0,520,11616,0,0;QS=3,0;MQSB=0.937241;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,185:6:0	0,24,222:8:0
-X	3639	.	G	<*>	0	.	DP=27;I16=13,14,0,0,997,37265,0,0,1615,96625,0,0,524,11768,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,183:6:0	0,27,221:9:0
-X	3640	.	T	<*>	0	.	DP=27;I16=13,14,0,0,1001,37533,0,0,1615,96625,0,0,527,11847,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,191:6:0	0,27,229:9:0
-X	3641	.	G	<*>	0	.	DP=27;I16=13,14,0,0,977,36379,0,0,1615,96625,0,0,529,11905,0,0;QS=3,0;MQSB=0.94394;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,178:6:0	0,27,224:9:0
-X	3642	.	T	<*>	0	.	DP=26;I16=12,13,0,0,931,35169,0,0,1495,89425,0,0,506,11314,0,0;QS=3,0;MQSB=0.939413;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,169:5:0	0,24,225:8:0
-X	3643	.	T	<*>	0	.	DP=26;I16=13,13,0,0,968,36820,0,0,1555,93025,0,0,533,11997,0,0;QS=3,0;MQSB=0.945959;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,176:5:0	0,27,230:9:0
-X	3644	.	T	<*>	0	.	DP=26;I16=12,13,0,0,961,37477,0,0,1495,89425,0,0,517,11755,0,0;QS=3,0;MQSB=0.939413;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,175:5:0	0,24,236:8:0
-X	3645	.	T	<*>	0	.	DP=26;I16=13,13,0,0,980,37508,0,0,1555,93025,0,0,537,12185,0,0;QS=3,0;MQSB=0.945959;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,175:5:0	0,27,239:9:0
-X	3646	.	C	<*>	0	.	DP=26;I16=12,13,0,0,766,25026,0,0,1495,89425,0,0,514,11690,0,0;QS=3,0;MQSB=0.939413;MQ0F=0	PL:DP:DV	0,33,234:11:0	0,15,136:5:0	0,27,188:9:0
-X	3647	.	G	<*>	0	.	DP=26;I16=12,12,0,0,820,29600,0,0,1435,85825,0,0,492,11218,0,0;QS=3,0;MQSB=0.941765;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,151:5:0	0,21,173:7:0
-X	3648	.	A	<*>	0	.	DP=26;I16=13,12,0,0,924,34680,0,0,1495,89425,0,0,519,11919,0,0;QS=3,0;MQSB=0.948139;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,174:5:0	0,24,225:8:0
-X	3649	.	C	<*>	0	.	DP=26;I16=14,12,0,0,955,36105,0,0,1555,93025,0,0,545,12593,0,0;QS=3,0;MQSB=0.953497;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,173:5:0	0,27,226:9:0
-X	3650	.	A	<*>	0	.	DP=27;I16=15,12,0,0,1033,40511,0,0,1615,96625,0,0,546,12664,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,196:6:0	0,27,246:9:0
-X	3651	.	G	<*>	0	.	DP=27;I16=15,12,0,0,1035,40351,0,0,1615,96625,0,0,547,12707,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,194:6:0	0,27,233:9:0
-X	3652	.	C	<*>	0	.	DP=29;I16=15,13,0,0,1010,38264,0,0,1675,100225,0,0,521,12047,0,0;QS=3,0;MQSB=0.956162;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,198:6:0	0,27,225:9:0
-X	3653	.	T	<*>	0	.	DP=29;I16=16,13,0,0,1109,42919,0,0,1735,103825,0,0,546,12610,0,0;QS=3,0;MQSB=0.960189;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,202:6:0	0,27,239:9:0
-X	3654	.	G	<*>	0	.	DP=28;I16=14,12,0,0,981,37447,0,0,1555,93025,0,0,514,11882,0,0;QS=3,0;MQSB=0.953497;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,184:6:0	0,18,180:6:0
-X	3655	.	T	<*>	0	.	DP=28;I16=16,12,0,0,999,37029,0,0,1675,100225,0,0,541,12505,0,0;QS=3,0;MQSB=0.96195;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,190:6:0	0,21,179:7:0
-X	3656	.	C	<*>	0	.	DP=28;I16=15,12,0,0,963,35883,0,0,1615,96625,0,0,518,11848,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,164:5:0	0,21,191:7:0
-X	3657	.	C	<*>	0	.	DP=28;I16=15,12,0,0,923,32223,0,0,1615,96625,0,0,520,11836,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,154:5:0	0,21,192:7:0
-X	3658	.	G	<*>	0	.	DP=28;I16=15,12,0,0,876,29960,0,0,1615,96625,0,0,539,12405,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,142:5:0	0,21,163:7:0
-X	3659	.	T	<*>	0	.	DP=28;I16=16,12,0,0,996,36682,0,0,1675,100225,0,0,548,12448,0,0;QS=3,0;MQSB=0.96195;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,163:6:0	0,21,186:7:0
-X	3660	.	G	<*>	0	.	DP=28;I16=15,12,0,0,997,37571,0,0,1615,96625,0,0,526,11920,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,172:6:0	0,18,171:6:0
-X	3661	.	T	<*>	0	.	DP=28;I16=16,12,0,0,1013,37837,0,0,1675,100225,0,0,549,12423,0,0;QS=3,0;MQSB=0.96195;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,180:6:0	0,21,188:7:0
-X	3662	.	T	<*>	0	.	DP=28;I16=15,12,0,0,987,36627,0,0,1615,96625,0,0,528,11980,0,0;QS=3,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,182:6:0	0,18,184:6:0
-X	3663	.	A	<*>	0	.	DP=29;I16=16,12,0,0,997,36233,0,0,1675,100225,0,0,527,11959,0,0;QS=3,0;MQSB=0.96195;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,170:6:0	0,18,180:6:0
-X	3664	.	T	<*>	0	.	DP=29;I16=17,12,0,0,1044,38402,0,0,1735,103825,0,0,550,12490,0,0;QS=3,0;MQSB=0.965321;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,183:6:0	0,21,196:7:0
-X	3665	.	A	<*>	0	.	DP=27;I16=16,11,0,0,1017,38535,0,0,1615,96625,0,0,552,12510,0,0;QS=3,0;MQSB=0.96384;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,182:6:0	0,21,208:7:0
-X	3666	.	A	<*>	0	.	DP=27;I16=16,11,0,0,1036,40292,0,0,1615,96625,0,0,554,12550,0,0;QS=3,0;MQSB=0.96384;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,193:6:0	0,21,208:7:0
-X	3667	.	T	<*>	0	.	DP=27;I16=15,11,0,0,955,35895,0,0,1555,93025,0,0,540,12354,0,0;QS=3,0;MQSB=0.960078;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,189:6:0	0,18,189:6:0
-X	3668	.	A	<*>	0	.	DP=27;I16=16,11,0,0,981,36297,0,0,1615,96625,0,0,557,12641,0,0;QS=3,0;MQSB=0.96384;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,182:6:0	0,21,209:7:0
-X	3669	.	A	<*>	0	.	DP=27;I16=16,11,0,0,1030,39666,0,0,1615,96625,0,0,558,12694,0,0;QS=3,0;MQSB=0.96384;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,194:6:0	0,21,209:7:0
-X	3670	.	T	<*>	0	.	DP=28;I16=17,11,0,0,1057,40245,0,0,1675,100225,0,0,559,12769,0,0;QS=3,0;MQSB=0.967085;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,181:6:0	0,24,220:8:0
-X	3671	.	T	<*>	0	.	DP=28;I16=17,11,0,0,1059,40427,0,0,1675,100225,0,0,561,12867,0,0;QS=3,0;MQSB=0.967085;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,193:6:0	0,24,223:8:0
-X	3672	.	C	<*>	0	.	DP=28;I16=16,11,0,0,988,37264,0,0,1615,96625,0,0,550,12820,0,0;QS=3,0;MQSB=0.96384;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,169:6:0	0,21,205:7:0
-X	3673	.	C	<*>	0	.	DP=27;I16=16,10,0,0,1016,40148,0,0,1555,93025,0,0,528,12314,0,0;QS=3,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,154:5:0	0,24,219:8:0
-X	3674	.	T	<*>	0	.	DP=27;I16=17,10,0,0,1035,40645,0,0,1615,96625,0,0,556,13028,0,0;QS=3,0;MQSB=0.968979;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,155:5:0	0,24,228:8:0
-X	3675	.	C	<*>	0	.	DP=27;I16=17,10,0,0,1049,41413,0,0,1615,96625,0,0,558,13090,0,0;QS=3,0;MQSB=0.968979;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,149:5:0	0,24,222:8:0
-X	3676	.	T	<*>	0	.	DP=27;I16=17,10,0,0,1040,40640,0,0,1615,96625,0,0,559,13125,0,0;QS=3,0;MQSB=0.968979;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,159:5:0	0,24,231:8:0
-X	3677	.	A	<*>	0	.	DP=27;I16=16,10,0,0,922,34182,0,0,1555,93025,0,0,537,12557,0,0;QS=3,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,136:5:0	0,24,217:8:0
-X	3678	.	G	<*>	0	.	DP=27;I16=17,10,0,0,1009,38307,0,0,1615,96625,0,0,563,13159,0,0;QS=3,0;MQSB=0.968979;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,149:5:0	0,24,216:8:0
-X	3679	.	T	<*>	0	.	DP=27;I16=17,10,0,0,1018,39274,0,0,1615,96625,0,0,563,13105,0,0;QS=3,0;MQSB=0.968979;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,156:5:0	0,24,227:8:0
-X	3680	.	T	<*>	0	.	DP=27;I16=17,10,0,0,988,36872,0,0,1615,96625,0,0,562,13022,0,0;QS=3,0;MQSB=0.968979;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,157:5:0	0,24,202:8:0
-X	3681	.	C	<*>	0	.	DP=27;I16=17,10,0,0,1012,39154,0,0,1615,96625,0,0,560,12910,0,0;QS=3,0;MQSB=0.968979;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,157:5:0	0,24,217:8:0
-X	3682	.	A	<*>	0	.	DP=27;I16=17,10,0,0,1009,38221,0,0,1615,96625,0,0,557,12769,0,0;QS=3,0;MQSB=0.968979;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,156:5:0	0,24,220:8:0
-X	3683	.	A	<*>	0	.	DP=27;I16=17,9,0,0,966,36748,0,0,1555,93025,0,0,546,12552,0,0;QS=3,0;MQSB=0.971017;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,153:5:0	0,24,225:8:0
-X	3684	.	A	<*>	0	.	DP=26;I16=16,10,0,0,974,37440,0,0,1555,93025,0,0,550,12456,0,0;QS=3,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,155:5:0	0,21,215:7:0
-X	3685	.	T	<*>	0	.	DP=26;I16=16,10,0,0,954,36330,0,0,1555,93025,0,0,547,12333,0,0;QS=3,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,148:5:0	0,21,207:7:0
-X	3686	.	T	<*>	0	.	DP=26;I16=16,10,0,0,979,37645,0,0,1555,93025,0,0,544,12232,0,0;QS=3,0;MQSB=0.965874;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,162:5:0	0,21,216:7:0
-X	3687	.	T	<*>	0	.	DP=27;I16=16,11,0,0,1028,39276,0,0,1592,94394,0,0,541,12153,0,0;QS=3,0;MQSB=0.989102;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,159:5:0	0,24,229:8:0
-X	3688	.	A	<*>	0	.	DP=28;I16=17,10,0,0,1007,37883,0,0,1569,92163,0,0,526,11904,0,0;QS=3,0;MQSB=0.99874;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,148:5:0	0,24,232:8:0
-X	3689	.	T	<*>	0	.	DP=28;I16=17,11,0,0,1042,39780,0,0,1629,95763,0,0,535,11919,0,0;QS=3,0;MQSB=0.995584;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,162:5:0	0,24,233:8:0
-X	3690	.	T	<*>	0	.	DP=28;I16=17,11,0,0,1051,39981,0,0,1629,95763,0,0,532,11816,0,0;QS=3,0;MQSB=0.995584;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,160:5:0	0,24,225:8:0
-X	3691	.	C	<*>	0	.	DP=28;I16=16,11,0,0,1037,40549,0,0,1569,92163,0,0,520,11592,0,0;QS=3,0;MQSB=0.992419;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,155:5:0	0,21,214:7:0
-X	3692	.	A	<*>	0	.	DP=29;I16=18,11,0,0,1028,37574,0,0,1689,99363,0,0,522,11496,0,0;QS=3,0;MQSB=0.99773;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,156:5:0	0,24,209:8:0
-X	3693	.	T	<*>	0	.	DP=28;I16=18,10,0,0,1067,40901,0,0,1629,95763,0,0,519,11381,0,0;QS=3,0;MQSB=0.999713;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,160:5:0	0,24,230:8:0
-X	3694	.	T	<*>	0	.	DP=28;I16=18,10,0,0,1043,39659,0,0,1629,95763,0,0,516,11296,0,0;QS=3,0;MQSB=0.999713;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,159:5:0	0,24,234:8:0
-X	3695	.	T	<*>	0	.	DP=28;I16=18,10,0,0,1046,39662,0,0,1629,95763,0,0,513,11241,0,0;QS=3,0;MQSB=0.999713;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,156:5:0	0,24,233:8:0
-X	3696	.	T	<*>	0	.	DP=28;I16=18,10,0,0,1075,41567,0,0,1629,95763,0,0,509,11165,0,0;QS=3,0;MQSB=0.999713;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,162:5:0	0,24,235:8:0
-X	3697	.	T	<*>	0	.	DP=28;I16=18,10,0,0,1031,38399,0,0,1629,95763,0,0,505,11117,0,0;QS=3,0;MQSB=0.999713;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,155:5:0	0,24,229:8:0
-X	3698	.	A	<*>	0	.	DP=28;I16=18,9,0,0,983,36457,0,0,1569,92163,0,0,477,10515,0,0;QS=3,0;MQSB=0.999669;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,144:5:0	0,24,229:8:0
-X	3699	.	A	<*>	0	.	DP=27;I16=17,10,0,0,1011,38455,0,0,1569,92163,0,0,493,10861,0,0;QS=3,0;MQSB=0.99874;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,150:5:0	0,21,226:7:0
-X	3700	.	C	<*>	0	.	DP=28;I16=16,11,0,0,970,35910,0,0,1574,92738,0,0,473,10525,0,0;QS=3,0;MQSB=0.992419;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,168:6:0	0,24,212:8:0
-X	3701	.	T	<*>	0	.	DP=28;I16=17,11,0,0,1071,41669,0,0,1634,96338,0,0,484,10618,0,0;QS=3,0;MQSB=0.990092;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,196:6:0	0,24,233:8:0
-X	3702	.	T	<*>	0	.	DP=28;I16=17,10,0,0,1019,38653,0,0,1597,94969,0,0,462,10144,0,0;QS=3,0;MQSB=0.968979;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,184:6:0	0,21,207:7:0
-X	3703	.	C	<*>	0	.	DP=28;I16=17,11,0,0,1059,40561,0,0,1634,96338,0,0,470,10154,0,0;QS=3,0;MQSB=0.990092;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,183:6:0	0,24,232:8:0
-X	3704	.	A	<*>	0	.	DP=28;I16=17,10,0,0,1015,38483,0,0,1574,92738,0,0,439,9347,0,0;QS=3,0;MQSB=0.984677;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,182:6:0	0,21,211:7:0
-X	3705	.	T	<*>	0	.	DP=27;I16=17,10,0,0,992,37112,0,0,1574,92738,0,0,459,9773,0,0;QS=3,0;MQSB=0.984677;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,180:6:0	0,21,209:7:0
-X	3706	.	A	<*>	0	.	DP=27;I16=17,10,0,0,1040,40262,0,0,1574,92738,0,0,454,9608,0,0;QS=3,0;MQSB=0.984677;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,186:6:0	0,21,204:7:0
-X	3707	.	G	<*>	0	.	DP=26;I16=17,9,0,0,974,37394,0,0,1514,89138,0,0,450,9476,0,0;QS=3,0;MQSB=0.977029;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,173:6:0	0,18,168:6:0
-X	3708	.	T	<*>	0	.	DP=26;I16=18,7,0,0,911,33609,0,0,1454,85538,0,0,426,8934,0,0;QS=3,0;MQSB=0.914166;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,182:6:0	0,15,139:5:0
-X	3709	.	A	<*>	0	.	DP=26;I16=18,8,0,0,905,32473,0,0,1491,86907,0,0,445,9305,0,0;QS=3,0;MQSB=0.998458;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,168:6:0	0,18,162:6:0
-X	3710	.	C	<*>	0	.	DP=26;I16=18,8,0,0,924,33504,0,0,1491,86907,0,0,443,9267,0,0;QS=3,0;MQSB=0.998458;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,165:6:0	0,18,159:6:0
-X	3711	.	C	<*>	0	.	DP=26;I16=18,8,0,0,953,35965,0,0,1491,86907,0,0,441,9261,0,0;QS=3,0;MQSB=0.998458;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,164:6:0	0,18,173:6:0
-X	3712	.	A	<*>	0	.	DP=26;I16=18,8,0,0,893,31917,0,0,1491,86907,0,0,439,9287,0,0;QS=3,0;MQSB=0.998458;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,144:6:0	0,18,165:6:0
-X	3713	.	C	<*>	0	.	DP=26;I16=19,7,0,0,908,32834,0,0,1491,86907,0,0,437,9293,0,0;QS=3,0;MQSB=0.989612;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,163:6:0	0,18,164:6:0
-X	3714	.	A	<*>	0	.	DP=27;I16=19,6,0,0,920,34366,0,0,1408,81076,0,0,409,8651,0,0;QS=3,0;MQSB=0.999494;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,177:6:0	0,18,174:6:0
-X	3715	.	T	<*>	0	.	DP=28;I16=21,6,0,0,982,36286,0,0,1505,86045,0,0,408,8616,0,0;QS=3,0;MQSB=0.996181;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,180:6:0	0,18,164:6:0
-X	3716	.	T	<*>	0	.	DP=26;I16=19,7,0,0,927,33833,0,0,1445,82445,0,0,434,9236,0,0;QS=3,0;MQSB=0.966731;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,165:5:0	0,18,164:6:0
-X	3717	.	C	<*>	0	.	DP=26;I16=19,7,0,0,979,37527,0,0,1445,82445,0,0,435,9261,0,0;QS=3,0;MQSB=0.966731;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,165:5:0	0,18,168:6:0
-X	3718	.	T	<*>	0	.	DP=26;I16=19,7,0,0,994,39040,0,0,1445,82445,0,0,435,9265,0,0;QS=3,0;MQSB=0.966731;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,169:5:0	0,18,165:6:0
-X	3719	.	A	<*>	0	.	DP=26;I16=19,6,0,0,889,32163,0,0,1408,81076,0,0,410,8672,0,0;QS=3,0;MQSB=0.747144;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,148:5:0	0,15,142:5:0
-X	3720	.	C	<*>	0	.	DP=26;I16=19,7,0,0,934,34326,0,0,1445,82445,0,0,435,9357,0,0;QS=3,0;MQSB=0.966731;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,148:5:0	0,18,158:6:0
-X	3721	.	A	<*>	0	.	DP=27;I16=20,5,0,0,910,33944,0,0,1405,80725,0,0,385,8195,0,0;QS=3,0;MQSB=0.697274;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,153:5:0	0,15,145:5:0
-X	3722	.	C	<*>	0	.	DP=27;I16=20,7,0,0,964,35276,0,0,1502,85694,0,0,436,9562,0,0;QS=3,0;MQSB=0.927743;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,151:5:0	0,18,165:6:0
-X	3723	.	A	<*>	0	.	DP=25;I16=18,6,0,0,888,33516,0,0,1345,77125,0,0,414,9082,0,0;QS=3,0;MQSB=0.606531;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,134:4:0	0,15,145:5:0
-X	3724	.	C	<*>	0	.	DP=25;I16=18,7,0,0,944,35956,0,0,1382,78494,0,0,442,9878,0,0;QS=3,0;MQSB=0.889393;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,137:4:0	0,18,169:6:0
-X	3725	.	T	<*>	0	.	DP=25;I16=18,7,0,0,973,38263,0,0,1382,78494,0,0,445,10075,0,0;QS=3,0;MQSB=0.889393;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,138:4:0	0,18,190:6:0
-X	3726	.	G	<*>	0	.	DP=24;I16=18,6,0,0,865,32339,0,0,1322,74894,0,0,446,10146,0,0;QS=3,0;MQSB=0.934987;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,93:3:0	0,18,166:6:0
-X	3727	.	C	<*>	0	.	DP=22;I16=17,5,0,0,762,27812,0,0,1202,67694,0,0,447,10139,0,0;QS=3,0;MQSB=0.963102;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,82:3:0	0,15,143:5:0
-X	3728	.	C	<*>	0	.	DP=22;I16=17,5,0,0,792,29850,0,0,1202,67694,0,0,448,10154,0,0;QS=3,0;MQSB=0.963102;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,89:3:0	0,15,160:5:0
-X	3729	.	C	<*>	0	.	DP=22;I16=17,5,0,0,838,32312,0,0,1202,67694,0,0,449,10191,0,0;QS=3,0;MQSB=0.963102;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,9,93:3:0	0,15,164:5:0
-X	3730	.	A	<*>	0	.	DP=21;I16=17,4,0,0,749,27561,0,0,1142,64094,0,0,448,10100,0,0;QS=3,0;MQSB=0.995997;MQ0F=0	PL:DP:DV	0,39,241:13:0	0,9,98:3:0	0,15,159:5:0
-X	3731	.	T	<*>	0	.	DP=22;I16=18,4,0,0,787,29489,0,0,1152,64194,0,0,447,10031,0,0;QS=3,0;MQSB=0.967917;MQ0F=0	PL:DP:DV	0,42,253:14:0	0,9,101:3:0	0,15,139:5:0
-X	3732	.	G	<*>	0	.	DP=22;I16=18,4,0,0,811,30695,0,0,1152,64194,0,0,447,9985,0,0;QS=3,0;MQSB=0.967917;MQ0F=0	PL:DP:DV	0,42,252:14:0	0,9,101:3:0	0,15,149:5:0
-X	3733	.	T	<*>	0	.	DP=23;I16=19,4,0,0,820,29616,0,0,1212,67794,0,0,447,9963,0,0;QS=3,0;MQSB=0.979651;MQ0F=0	PL:DP:DV	0,45,248:15:0	0,9,101:3:0	0,15,152:5:0
-X	3734	.	C	<*>	0	.	DP=24;I16=20,4,0,0,863,32277,0,0,1272,71394,0,0,447,9915,0,0;QS=3,0;MQSB=0.988072;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,86:3:0	0,15,152:5:0
-X	3735	.	C	<*>	0	.	DP=24;I16=20,4,0,0,826,30112,0,0,1272,71394,0,0,448,9892,0,0;QS=3,0;MQSB=0.988072;MQ0F=0	PL:DP:DV	0,48,254:16:0	0,9,83:3:0	0,15,152:5:0
-X	3736	.	C	<*>	0	.	DP=25;I16=20,3,0,0,839,31471,0,0,1262,71294,0,0,419,9245,0,0;QS=3,0;MQSB=0.963194;MQ0F=0	PL:DP:DV	0,42,235:14:0	0,9,99:3:0	0,18,156:6:0
-X	3737	.	C	<*>	0	.	DP=25;I16=21,4,0,0,894,33402,0,0,1332,74994,0,0,451,9925,0,0;QS=3,0;MQSB=0.993838;MQ0F=0	PL:DP:DV	0,48,251:16:0	0,9,95:3:0	0,18,175:6:0
-X	3738	.	T	<*>	0	.	DP=25;I16=21,4,0,0,926,35484,0,0,1332,74994,0,0,452,9934,0,0;QS=3,0;MQSB=0.993838;MQ0F=0	PL:DP:DV	0,48,253:16:0	0,9,101:3:0	0,18,189:6:0
-X	3739	.	C	<*>	0	.	DP=25;I16=21,4,0,0,958,37390,0,0,1332,74994,0,0,452,9922,0,0;QS=3,0;MQSB=0.993838;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,105:3:0	0,18,181:6:0
-X	3740	.	A	<*>	0	.	DP=24;I16=20,4,0,0,848,31126,0,0,1272,71394,0,0,452,9886,0,0;QS=3,0;MQSB=0.988072;MQ0F=0	PL:DP:DV	0,48,247:16:0	0,9,109:3:0	0,15,163:5:0
-X	3741	.	A	<*>	0	.	DP=24;I16=19,4,0,0,814,30176,0,0,1212,67794,0,0,442,9742,0,0;QS=3,0;MQSB=0.979651;MQ0F=0	PL:DP:DV	0,48,238:16:0	0,6,82:2:0	0,15,172:5:0
-X	3742	.	G	<*>	0	.	DP=24;I16=20,4,0,0,893,34371,0,0,1272,71394,0,0,450,9782,0,0;QS=3,0;MQSB=0.988072;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,101:3:0	0,15,162:5:0
-X	3743	.	C	<*>	0	.	DP=24;I16=19,4,0,0,839,31673,0,0,1262,71294,0,0,437,9619,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,254:15:0	0,9,103:3:0	0,15,158:5:0
-X	3744	.	T	<*>	0	.	DP=24;I16=20,4,0,0,918,36126,0,0,1272,71394,0,0,448,9766,0,0;QS=3,0;MQSB=0.988072;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,118:3:0	0,15,164:5:0
-X	3745	.	T	<*>	0	.	DP=24;I16=19,4,0,0,808,29490,0,0,1212,67794,0,0,422,9166,0,0;QS=3,0;MQSB=0.979651;MQ0F=0	PL:DP:DV	0,45,233:15:0	0,9,108:3:0	0,15,158:5:0
-X	3746	.	C	<*>	0	.	DP=24;I16=20,4,0,0,886,33564,0,0,1272,71394,0,0,445,9789,0,0;QS=3,0;MQSB=0.988072;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,9,101:3:0	0,15,165:5:0
-X	3747	.	C	<*>	0	.	DP=24;I16=19,4,0,0,833,31071,0,0,1262,71294,0,0,426,9504,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,249:15:0	0,9,103:3:0	0,15,162:5:0
-X	3748	.	C	<*>	0	.	DP=24;I16=19,4,0,0,845,31753,0,0,1262,71294,0,0,422,9464,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,9,106:3:0	0,15,161:5:0
-X	3749	.	C	<*>	0	.	DP=24;I16=19,4,0,0,844,31888,0,0,1262,71294,0,0,417,9395,0,0;QS=3,0;MQSB=1;MQ0F=0	PL:DP:DV	0,45,250:15:0	0,9,111:3:0	0,15,154:5:0
-X	3750	.	T	<*>	0	.	DP=25;I16=21,4,0,0,876,32880,0,0,1309,72763,0,0,431,9709,0,0;QS=3,0;MQSB=0.966906;MQ0F=0	PL:DP:DV	0,51,251:17:0	0,9,112:3:0	0,15,146:5:0
-X	3751	.	G	<*>	0	.	DP=24;I16=19,4,0,0,836,31374,0,0,1239,69063,0,0,408,9274,0,0;QS=3,0;MQSB=0.986928;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,82:2:0	0,15,162:5:0
-X	3752	.	G	<*>	0	.	DP=22;I16=19,2,0,0,728,26270,0,0,1069,58363,0,0,404,9134,0,0;QS=3,0;MQSB=0.868421;MQ0F=0	PL:DP:DV	0,42,182:14:0	0,6,74:2:0	0,15,159:5:0
-X	3753	.	C	<*>	0	.	DP=22;I16=19,3,0,0,761,28017,0,0,1129,61963,0,0,426,9674,0,0;QS=3,0;MQSB=0.995434;MQ0F=0	PL:DP:DV	0,45,213:15:0	0,6,61:2:0	0,15,163:5:0
-X	3754	.	T	<*>	0	.	DP=23;I16=19,3,0,0,767,28751,0,0,1129,61963,0,0,425,9707,0,0;QS=3,0;MQSB=0.995434;MQ0F=0	PL:DP:DV	0,45,218:15:0	0,6,69:2:0	0,15,157:5:0
-X	3755	.	C	<*>	0	.	DP=21;I16=16,4,0,0,749,28747,0,0,1028,55504,0,0,404,9188,0,0;QS=3,0;MQSB=0.777932;MQ0F=0	PL:DP:DV	0,36,219:12:0	0,9,93:3:0	0,15,161:5:0
-X	3756	.	C	<*>	0	.	DP=22;I16=17,4,0,0,782,29994,0,0,1038,55604,0,0,430,9840,0,0;QS=3,0;MQSB=0.885747;MQ0F=0	PL:DP:DV	0,39,229:13:0	0,9,93:3:0	0,15,159:5:0
-X	3757	.	T	<*>	0	.	DP=23;I16=17,6,0,0,828,30942,0,0,1158,62804,0,0,456,10510,0,0;QS=3,0;MQSB=0.9945;MQ0F=0	PL:DP:DV	0,39,210:13:0	0,15,143:5:0	0,15,169:5:0
-X	3758	.	G	<*>	0	.	DP=23;I16=17,6,0,0,832,30792,0,0,1158,62804,0,0,458,10574,0,0;QS=3,0;MQSB=0.9945;MQ0F=0	PL:DP:DV	0,39,220:13:0	0,15,135:5:0	0,15,147:5:0
-X	3759	.	C	<*>	0	.	DP=23;I16=17,4,0,0,756,28338,0,0,1061,57835,0,0,409,9357,0,0;QS=3,0;MQSB=0.964547;MQ0F=0	PL:DP:DV	0,39,220:13:0	0,12,112:4:0	0,12,127:4:0
-X	3760	.	A	<*>	0	.	DP=24;I16=17,7,0,0,792,27956,0,0,1218,66404,0,0,459,10607,0,0;QS=3,0;MQSB=0.95083;MQ0F=0	PL:DP:DV	0,39,203:13:0	0,15,127:5:0	0,18,180:6:0
-X	3761	.	A	<*>	0	.	DP=24;I16=17,7,0,0,871,32185,0,0,1218,66404,0,0,460,10624,0,0;QS=3,0;MQSB=0.95083;MQ0F=0	PL:DP:DV	0,39,215:13:0	0,15,136:5:0	0,18,188:6:0
-X	3762	.	C	<*>	0	.	DP=25;I16=17,7,0,0,831,29665,0,0,1241,68635,0,0,435,9983,0,0;QS=3,0;MQSB=0.69242;MQ0F=0	PL:DP:DV	0,39,209:13:0	0,18,149:6:0	0,15,159:5:0
-X	3763	.	C	<*>	0	.	DP=24;I16=16,8,0,0,837,30619,0,0,1218,66404,0,0,460,10510,0,0;QS=3,0;MQSB=0.844324;MQ0F=0	PL:DP:DV	0,36,213:12:0	0,18,149:6:0	0,18,186:6:0
-X	3764	.	A	<*>	0	.	DP=25;I16=17,7,0,0,856,31506,0,0,1241,68635,0,0,437,9903,0,0;QS=3,0;MQSB=0.69242;MQ0F=0	PL:DP:DV	0,39,212:13:0	0,18,139:6:0	0,15,167:5:0
-X	3765	.	C	<*>	0	.	DP=25;I16=17,7,0,0,845,31099,0,0,1218,66404,0,0,436,9750,0,0;QS=3,0;MQSB=0.95083;MQ0F=0	PL:DP:DV	0,39,200:13:0	0,15,129:5:0	0,18,189:6:0
-X	3766	.	A	<*>	0	.	DP=26;I16=17,9,0,0,953,35331,0,0,1338,73604,0,0,462,10340,0,0;QS=3,0;MQSB=0.811273;MQ0F=0	PL:DP:DV	0,42,248:14:0	0,18,158:6:0	0,18,191:6:0
-X	3767	.	A	<*>	0	.	DP=26;I16=17,9,0,0,924,33656,0,0,1338,73604,0,0,464,10328,0,0;QS=3,0;MQSB=0.811273;MQ0F=0	PL:DP:DV	0,42,246:14:0	0,18,148:6:0	0,18,191:6:0
-X	3768	.	A	<*>	0	.	DP=26;I16=17,9,0,0,922,33842,0,0,1338,73604,0,0,466,10340,0,0;QS=3,0;MQSB=0.811273;MQ0F=0	PL:DP:DV	0,42,237:14:0	0,18,146:6:0	0,18,195:6:0
-X	3769	.	T	<*>	0	.	DP=26;I16=17,8,0,0,891,32735,0,0,1278,70004,0,0,461,10327,0,0;QS=3,0;MQSB=0.884621;MQ0F=0	PL:DP:DV	0,42,246:14:0	0,15,144:5:0	0,18,191:6:0
-X	3770	.	C	<*>	0	.	DP=26;I16=17,9,0,0,923,34049,0,0,1338,73604,0,0,470,10436,0,0;QS=3,0;MQSB=0.811273;MQ0F=0	PL:DP:DV	0,42,252:14:0	0,18,142:6:0	0,18,180:6:0
-X	3771	.	T	<*>	0	.	DP=25;I16=16,8,0,0,852,31694,0,0,1218,66404,0,0,464,10438,0,0;QS=3,0;MQSB=0.844324;MQ0F=0	PL:DP:DV	0,42,253:14:0	0,15,140:5:0	0,15,157:5:0
-X	3772	.	A	<*>	0	.	DP=26;I16=16,10,0,0,836,28434,0,0,1338,73604,0,0,476,10624,0,0;QS=3,0;MQSB=0.685145;MQ0F=0	PL:DP:DV	0,42,236:14:0	0,18,122:6:0	0,18,160:6:0
-X	3773	.	C	<*>	0	.	DP=26;I16=16,10,0,0,893,31801,0,0,1338,73604,0,0,480,10752,0,0;QS=3,0;MQSB=0.685145;MQ0F=0	PL:DP:DV	0,42,253:14:0	0,18,140:6:0	0,18,171:6:0
-X	3774	.	T	<*>	0	.	DP=25;I16=15,10,0,0,895,33455,0,0,1278,70004,0,0,485,10903,0,0;QS=3,0;MQSB=0.624282;MQ0F=0	PL:DP:DV	0,42,253:14:0	0,18,129:6:0	0,15,178:5:0
-X	3775	.	C	<*>	0	.	DP=25;I16=15,9,0,0,855,31825,0,0,1241,68635,0,0,477,10883,0,0;QS=3,0;MQSB=0.439649;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,18,147:6:0	0,12,143:4:0
-X	3776	.	T	<*>	0	.	DP=24;I16=15,7,0,0,838,32738,0,0,1152,64194,0,0,457,10375,0,0;QS=3,0;MQSB=0.225079;MQ0F=0	PL:DP:DV	0,39,229:13:0	0,15,149:5:0	0,12,152:4:0
-X	3777	.	C	<*>	0	.	DP=24;I16=15,9,0,0,864,32180,0,0,1218,66404,0,0,492,10998,0,0;QS=3,0;MQSB=0.705785;MQ0F=0	PL:DP:DV	0,39,220:13:0	0,18,160:6:0	0,15,168:5:0
-X	3778	.	T	<*>	0	.	DP=24;I16=14,9,0,0,859,32957,0,0,1208,66304,0,0,468,10372,0,0;QS=3,0;MQSB=0.836049;MQ0F=0	PL:DP:DV	0,36,227:12:0	0,18,157:6:0	0,15,167:5:0
-X	3779	.	G	<*>	0	.	DP=24;I16=15,9,0,0,844,31206,0,0,1218,66404,0,0,493,10971,0,0;QS=3,0;MQSB=0.705785;MQ0F=0	PL:DP:DV	0,39,220:13:0	0,18,152:6:0	0,15,167:5:0
-X	3780	.	C	<*>	0	.	DP=25;I16=14,10,0,0,829,29949,0,0,1268,69904,0,0,467,10295,0,0;QS=3,0;MQSB=0.765017;MQ0F=0	PL:DP:DV	0,39,235:13:0	0,18,144:6:0	0,15,169:5:0
-X	3781	.	C	<*>	0	.	DP=26;I16=16,10,0,0,939,34725,0,0,1315,71373,0,0,492,10896,0,0;QS=3,0;MQSB=0.541994;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,139:6:0	0,15,175:5:0
-X	3782	.	T	<*>	0	.	DP=26;I16=16,10,0,0,989,38031,0,0,1315,71373,0,0,493,10901,0,0;QS=3,0;MQSB=0.541994;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,169:6:0	0,15,176:5:0
-X	3783	.	C	<*>	0	.	DP=26;I16=16,10,0,0,941,34801,0,0,1315,71373,0,0,492,10836,0,0;QS=3,0;MQSB=0.541994;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,155:6:0	0,15,162:5:0
-X	3784	.	T	<*>	0	.	DP=27;I16=16,11,0,0,1001,38035,0,0,1375,74973,0,0,491,10801,0,0;QS=3,0;MQSB=0.467219;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,155:6:0	0,15,178:5:0
-X	3785	.	G	<*>	0	.	DP=28;I16=15,10,0,0,922,36426,0,0,1305,71273,0,0,450,9916,0,0;QS=3,0;MQSB=0.674458;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,125:5:0	0,15,179:5:0
-X	3786	.	T	<*>	0	.	DP=28;I16=16,11,0,0,935,35697,0,0,1375,74973,0,0,490,10774,0,0;QS=3,0;MQSB=0.467219;MQ0F=0	PL:DP:DV	0,48,250:16:0	0,18,145:6:0	0,15,186:5:0
-X	3787	.	G	<*>	0	.	DP=28;I16=16,11,0,0,963,37951,0,0,1375,74973,0,0,489,10781,0,0;QS=3,0;MQSB=0.467219;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,18,143:6:0	0,15,177:5:0
-X	3788	.	G	<*>	0	.	DP=26;I16=14,9,0,0,849,33683,0,0,1184,65386,0,0,459,10075,0,0;QS=3,0;MQSB=0.525788;MQ0F=0	PL:DP:DV	0,39,239:13:0	0,18,144:6:0	0,12,161:4:0
-X	3789	.	G	<*>	0	.	DP=26;I16=13,10,0,0,807,31019,0,0,1231,68535,0,0,438,9474,0,0;QS=3,0;MQSB=0.445672;MQ0F=0	PL:DP:DV	0,39,251:13:0	0,18,133:6:0	0,12,161:4:0
-X	3790	.	T	<*>	0	.	DP=26;I16=13,10,0,0,829,32293,0,0,1231,68535,0,0,435,9359,0,0;QS=3,0;MQSB=0.445672;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,150:6:0	0,12,159:4:0
-X	3791	.	T	<*>	0	.	DP=26;I16=15,10,0,0,887,34725,0,0,1301,72235,0,0,478,10336,0,0;QS=3,0;MQSB=0.382304;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,136:6:0	0,12,159:4:0
-X	3792	.	G	A,<*>	0	.	DP=26;I16=14,8,1,0,809,32805,38,1444,1175,66425,37,1369,417,8991,22,484;QS=2.92629,0.0737052,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.195278;BQB=1;MQ0F=0	PL:DP:DV	0,8,238,42,241,255:15:1	0,12,109,12,109,109:4:0	0,12,157,12,157,157:4:0
-X	3793	.	A	<*>	0	.	DP=26;I16=15,8,0,0,833,33775,0,0,1212,67794,0,0,435,9363,0,0;QS=3,0;MQSB=0.195278;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,12,93:4:0	0,12,159:4:0
-X	3794	.	C	<*>	0	.	DP=26;I16=15,9,0,0,845,33023,0,0,1241,68635,0,0,438,9324,0,0;QS=3,0;MQSB=0.439649;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,15,120:5:0	0,12,157:4:0
-X	3795	.	C	<*>	0	.	DP=26;I16=14,9,0,0,865,35649,0,0,1231,68535,0,0,408,8622,0,0;QS=3,0;MQSB=0.563599;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,132:5:0	0,12,161:4:0
-X	3796	.	T	<*>	0	.	DP=27;I16=15,11,0,0,964,38998,0,0,1361,75835,0,0,453,9821,0,0;QS=3,0;MQSB=0.334895;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,149:7:0	0,12,164:4:0
-X	3797	.	A	<*>	0	.	DP=27;I16=15,10,0,0,848,32392,0,0,1301,72235,0,0,424,9172,0,0;QS=3,0;MQSB=0.382304;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,124:6:0	0,12,159:4:0
-X	3798	.	T	<*>	0	.	DP=27;I16=14,11,0,0,921,37161,0,0,1301,72235,0,0,430,9554,0,0;QS=3,0;MQSB=0.283586;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,21,148:7:0	0,12,165:4:0
-X	3799	.	T	<*>	0	.	DP=27;I16=15,11,0,0,913,35929,0,0,1361,75835,0,0,439,9729,0,0;QS=3,0;MQSB=0.334895;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,21,150:7:0	0,12,161:4:0
-X	3800	.	C	<*>	0	.	DP=26;I16=13,10,0,0,866,36182,0,0,1181,65035,0,0,406,9092,0,0;QS=3,0;MQSB=0.272532;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,104:5:0	0,12,161:4:0
-X	3801	.	T	<*>	0	.	DP=23;I16=12,10,0,0,804,33600,0,0,1121,61435,0,0,430,9750,0,0;QS=3,0;MQSB=0.217267;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,99:5:0	0,9,133:3:0
-X	3802	.	G	<*>	0	.	DP=22;I16=10,9,0,0,730,30516,0,0,994,54486,0,0,380,8550,0,0;QS=3,0;MQSB=0.472367;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,106:4:0	0,9,130:3:0
-X	3803	.	G	<*>	0	.	DP=22;I16=11,9,0,0,703,27393,0,0,1051,57735,0,0,405,9241,0,0;QS=3,0;MQSB=0.372419;MQ0F=0	PL:DP:DV	0,39,249:13:0	0,12,92:4:0	0,9,129:3:0
-X	3804	.	A	<*>	0	.	DP=22;I16=11,9,0,0,740,30360,0,0,1051,57735,0,0,404,9274,0,0;QS=3,0;MQSB=0.372419;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,98:4:0	0,9,132:3:0
-X	3805	.	C	<*>	0	.	DP=22;I16=12,9,0,0,737,29243,0,0,1061,57835,0,0,428,9950,0,0;QS=3,0;MQSB=0.262932;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,81:4:0	0,9,130:3:0
-X	3806	.	A	<*>	0	.	DP=22;I16=12,9,0,0,798,32550,0,0,1061,57835,0,0,426,9968,0,0;QS=3,0;MQSB=0.262932;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,12,105:4:0	0,9,128:3:0
-X	3807	.	C	<*>	0	.	DP=22;I16=10,9,0,0,664,25304,0,0,994,54486,0,0,377,8885,0,0;QS=3,0;MQSB=0.472367;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,83:4:0	0,9,115:3:0
-X	3808	.	G	<*>	0	.	DP=21;I16=9,9,0,0,653,25297,0,0,957,53117,0,0,375,8873,0,0;QS=3,0;MQSB=0.597145;MQ0F=0	PL:DP:DV	0,33,233:11:0	0,12,109:4:0	0,9,132:3:0
-X	3809	.	T	<*>	0	.	DP=22;I16=11,10,0,0,779,32151,0,0,1084,60066,0,0,416,9810,0,0;QS=3,0;MQSB=0.285029;MQ0F=0	PL:DP:DV	0,39,249:13:0	0,12,115:4:0	0,12,161:4:0
-X	3810	.	C	<*>	0	.	DP=23;I16=9,11,0,0,811,34815,0,0,1077,60317,0,0,369,8739,0,0;QS=3,0;MQSB=0.499893;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,112:4:0	0,12,153:4:0
-X	3811	.	A	C,<*>	0	.	DP=23;I16=9,11,2,0,777,32631,39,785,1077,60317,67,3349,367,8669,42,914;QS=2.94104,0.0589569,0;VDB=0.18;SGB=0.346553;RPB=0.425;MQB=0.25;MQSB=0.246128;BQB=0.025;MQ0F=0	PL:DP:DV	0,15,248,36,254,255:14:2	0,12,116,12,116,116:4:0	0,12,158,12,158,158:4:0
-X	3812	.	T	<*>	0	.	DP=23;I16=10,11,0,0,802,32860,0,0,1084,60066,0,0,405,9447,0,0;QS=3,0;MQSB=0.187115;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,114:4:0	0,12,160:4:0
-X	3813	.	A	<*>	0	.	DP=22;I16=10,11,0,0,815,35077,0,0,1084,60066,0,0,402,9330,0,0;QS=3,0;MQSB=0.187115;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,119:4:0	0,12,170:4:0
-X	3814	.	G	<*>	0	.	DP=21;I16=8,11,0,0,775,33731,0,0,1037,58597,0,0,375,8605,0,0;QS=3,0;MQSB=0.41781;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,113:4:0	0,12,163:4:0
-X	3815	.	A	<*>	0	.	DP=20;I16=8,11,0,0,708,29130,0,0,1010,57328,0,0,397,9049,0,0;QS=3,0;MQSB=0.373354;MQ0F=0	PL:DP:DV	0,33,239:11:0	0,12,110:4:0	0,12,162:4:0
-X	3816	.	A	<*>	0	.	DP=20;I16=8,11,0,0,729,31027,0,0,1010,57328,0,0,395,8933,0,0;QS=3,0;MQSB=0.373354;MQ0F=0	PL:DP:DV	0,33,248:11:0	0,12,104:4:0	0,12,160:4:0
-X	3817	.	A	<*>	0	.	DP=20;I16=8,11,0,0,752,31580,0,0,1010,57328,0,0,393,8833,0,0;QS=3,0;MQSB=0.373354;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,12,110:4:0	0,12,161:4:0
-X	3818	.	T	<*>	0	.	DP=20;I16=8,11,0,0,728,30466,0,0,1010,57328,0,0,391,8749,0,0;QS=3,0;MQSB=0.373354;MQ0F=0	PL:DP:DV	0,33,252:11:0	0,12,115:4:0	0,12,160:4:0
-X	3819	.	A	<*>	0	.	DP=21;I16=9,11,0,0,790,34094,0,0,1039,58169,0,0,389,8681,0,0;QS=3,0;MQSB=0.247381;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,121:4:0	0,12,167:4:0
-X	3820	.	G	<*>	0	.	DP=21;I16=9,11,0,0,788,33636,0,0,1039,58169,0,0,388,8630,0,0;QS=3,0;MQSB=0.247381;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,112:4:0	0,12,157:4:0
-X	3821	.	A	<*>	0	.	DP=22;I16=10,11,0,0,832,35864,0,0,1099,61769,0,0,387,8597,0,0;QS=3,0;MQSB=0.317882;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,115:4:0	0,12,168:4:0
-X	3822	.	G	<*>	0	.	DP=22;I16=10,11,0,0,810,33228,0,0,1099,61769,0,0,386,8532,0,0;QS=3,0;MQSB=0.317882;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,103:4:0	0,12,157:4:0
-X	3823	.	T	<*>	0	.	DP=22;I16=9,11,0,0,753,30705,0,0,1042,58520,0,0,380,8460,0,0;QS=3,0;MQSB=0.434285;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,12,102:4:0	0,12,163:4:0
-X	3824	.	C	<*>	0	.	DP=22;I16=10,11,0,0,802,32368,0,0,1099,61769,0,0,384,8456,0,0;QS=3,0;MQSB=0.317882;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,105:4:0	0,12,159:4:0
-X	3825	.	C	<*>	0	.	DP=23;I16=10,11,0,0,813,33955,0,0,1079,59889,0,0,379,8387,0,0;QS=3,0;MQSB=0.317882;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,130:5:0	0,12,157:4:0
-X	3826	.	T	<*>	0	.	DP=23;I16=11,11,0,0,827,34611,0,0,1136,63138,0,0,381,8357,0,0;QS=3,0;MQSB=0.232836;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,133:5:0	0,12,155:4:0
-X	3827	.	G	<*>	0	.	DP=23;I16=11,10,0,0,820,34130,0,0,1076,59538,0,0,355,7715,0,0;QS=3,0;MQSB=0.269397;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,121:4:0	0,12,162:4:0
-X	3828	.	C	<*>	0	.	DP=23;I16=11,10,0,0,805,33147,0,0,1076,59538,0,0,354,7720,0,0;QS=3,0;MQSB=0.269397;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,12,114:4:0	0,12,157:4:0
-X	3829	.	A	<*>	0	.	DP=22;I16=9,11,0,0,763,31295,0,0,1069,59789,0,0,369,8241,0,0;QS=3,0;MQSB=0.477679;MQ0F=0	PL:DP:DV	0,33,255:11:0	0,15,132:5:0	0,12,158:4:0
-X	3830	.	A	<*>	0	.	DP=23;I16=11,11,0,0,825,32693,0,0,1136,63138,0,0,377,8321,0,0;QS=3,0;MQSB=0.232836;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,15,143:5:0	0,12,150:4:0
-X	3831	.	C	A,<*>	0	.	DP=23;I16=10,11,1,0,802,32198,14,196,1126,63038,10,100,370,8294,7,49;QS=2.97758,0.0224215,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.232836;BQB=1;MQ0F=0	PL:DP:DV	0,27,255,36,255,255:13:1	0,15,134,15,134,134:5:0	0,12,149,12,149,149:4:0
-X	3832	.	A	<*>	0	.	DP=24;I16=12,11,0,0,836,32436,0,0,1196,66738,0,0,377,8389,0,0;QS=3,0;MQSB=0.291845;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,15,136:5:0	0,12,139:4:0
-X	3833	.	C	<*>	0	.	DP=23;I16=10,11,0,0,690,24938,0,0,1076,59538,0,0,377,8409,0,0;QS=3,0;MQSB=0.175325;MQ0F=0	PL:DP:DV	0,36,249:12:0	0,15,113:5:0	0,12,131:4:0
-X	3834	.	G	<*>	0	.	DP=22;I16=9,10,0,0,684,26250,0,0,1037,58597,0,0,357,8079,0,0;QS=3,0;MQSB=0.124514;MQ0F=0	PL:DP:DV	0,33,242:11:0	0,12,122:4:0	0,12,156:4:0
-X	3835	.	T	<*>	0	.	DP=22;I16=10,11,0,0,773,30373,0,0,1076,59538,0,0,381,8475,0,0;QS=3,0;MQSB=0.175325;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,15,140:5:0	0,12,153:4:0
-X	3836	.	G	C,<*>	0	.	DP=24;I16=10,12,1,0,833,33183,14,196,1132,61648,10,100,378,8412,2,4;QS=2.97647,0.0235294,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.251407;BQB=1;MQ0F=0	PL:DP:DV	0,27,255,36,255,255:13:1	0,15,149,15,149,149:5:0	0,15,188,15,188,188:5:0
-X	3837	.	G	<*>	0	.	DP=24;I16=8,14,0,0,759,26931,0,0,1135,61999,0,0,399,8955,0,0;QS=3,0;MQSB=0.291667;MQ0F=0	PL:DP:DV	0,33,245:11:0	0,18,149:6:0	0,15,157:5:0
-X	3838	.	C	<*>	0	.	DP=24;I16=10,14,0,0,817,28975,0,0,1202,65348,0,0,409,8945,0,0;QS=3,0;MQSB=0.122456;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,143:6:0	0,15,148:5:0
-X	3839	.	C	<*>	0	.	DP=23;I16=9,13,0,0,688,22248,0,0,1132,61648,0,0,386,8238,0,0;QS=3,0;MQSB=0.248197;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,123:6:0	0,12,112:4:0
-X	3840	.	G	<*>	0	.	DP=23;I16=9,14,0,0,793,27941,0,0,1192,65248,0,0,413,8809,0,0;QS=3,0;MQSB=0.211072;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,160:6:0	0,15,146:5:0
-X	3841	.	T	<*>	0	.	DP=23;I16=9,14,0,0,867,33103,0,0,1192,65248,0,0,414,8734,0,0;QS=3,0;MQSB=0.211072;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,167:6:0	0,15,162:5:0
-X	3842	.	C	<*>	0	.	DP=23;I16=9,14,0,0,890,34728,0,0,1192,65248,0,0,415,8689,0,0;QS=3,0;MQSB=0.211072;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,167:6:0	0,15,159:5:0
-X	3843	.	T	<*>	0	.	DP=24;I16=9,14,0,0,896,35122,0,0,1192,65248,0,0,416,8674,0,0;QS=3,0;MQSB=0.211072;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,164:6:0	0,15,159:5:0
-X	3844	.	G	<*>	0	.	DP=26;I16=10,16,0,0,959,35715,0,0,1372,76048,0,0,442,9314,0,0;QS=3,0;MQSB=0.220358;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,177:7:0	0,18,172:6:0
-X	3845	.	T	<*>	0	.	DP=26;I16=10,16,0,0,970,36442,0,0,1372,76048,0,0,444,9310,0,0;QS=3,0;MQSB=0.220358;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,186:7:0	0,18,166:6:0
-X	3846	.	G	<*>	0	.	DP=27;I16=10,17,0,0,993,37297,0,0,1432,79648,0,0,446,9338,0,0;QS=3,0;MQSB=0.195223;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,175:7:0	0,21,172:7:0
-X	3847	.	T	<*>	0	.	DP=27;I16=10,16,0,0,952,35268,0,0,1372,76048,0,0,423,8723,0,0;QS=3,0;MQSB=0.220358;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,18,170:6:0	0,21,189:7:0
-X	3848	.	C	<*>	0	.	DP=27;I16=10,17,0,0,1025,39533,0,0,1432,79648,0,0,449,9341,0,0;QS=3,0;MQSB=0.195223;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,21,177:7:0	0,21,188:7:0
-X	3849	.	T	<*>	0	.	DP=27;I16=9,17,0,0,987,37685,0,0,1395,78279,0,0,450,9368,0,0;QS=3,0;MQSB=0.282527;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,179:7:0	0,21,190:7:0
-X	3850	.	G	<*>	0	.	DP=26;I16=9,17,0,0,957,35751,0,0,1395,78279,0,0,452,9428,0,0;QS=3,0;MQSB=0.282527;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,179:7:0	0,21,182:7:0
-X	3851	.	G	<*>	0	.	DP=26;I16=9,17,0,0,965,36475,0,0,1395,78279,0,0,453,9469,0,0;QS=3,0;MQSB=0.282527;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,21,177:7:0	0,21,183:7:0
-X	3852	.	C	<*>	0	.	DP=26;I16=9,16,0,0,921,34525,0,0,1335,74679,0,0,444,9440,0,0;QS=3,0;MQSB=0.310905;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,18,163:6:0	0,21,179:7:0
-X	3853	.	T	<*>	0	.	DP=28;I16=10,18,0,0,1050,40222,0,0,1484,82720,0,0,455,9641,0,0;QS=3,0;MQSB=0.515783;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,21,185:7:0	0,21,192:7:0
-X	3854	.	T	<*>	0	.	DP=28;I16=10,17,0,0,955,34605,0,0,1455,81879,0,0,451,9709,0,0;QS=3,0;MQSB=0.359211;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,171:6:0	0,18,178:6:0
-X	3855	.	C	<*>	0	.	DP=29;I16=10,18,0,0,992,36040,0,0,1515,85479,0,0,438,9264,0,0;QS=3,0;MQSB=0.331344;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,139:5:0	0,21,175:7:0
-X	3856	.	T	<*>	0	.	DP=30;I16=10,18,0,0,1033,38725,0,0,1546,88238,0,0,464,9982,0,0;QS=3,0;MQSB=0.190183;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,18,163:6:0	0,21,185:7:0
-X	3857	.	C	<*>	0	.	DP=30;I16=10,19,0,0,1077,40979,0,0,1575,89079,0,0,447,9505,0,0;QS=3,0;MQSB=0.306875;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,15,154:5:0	0,24,194:8:0
-X	3858	.	T	<*>	0	.	DP=31;I16=10,21,0,0,1141,42567,0,0,1695,96279,0,0,477,10255,0,0;QS=3,0;MQSB=0.266219;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,171:6:0	0,24,208:8:0
-X	3859	.	C	<*>	0	.	DP=32;I16=10,21,0,0,950,30078,0,0,1695,96279,0,0,484,10416,0,0;QS=3,0;MQSB=0.266219;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,136:6:0	0,24,156:8:0
-X	3860	.	G	<*>	0	.	DP=32;I16=10,22,0,0,1070,37794,0,0,1755,99879,0,0,516,11240,0,0;QS=3,0;MQSB=0.249261;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,154:6:0	0,27,209:9:0
-X	3861	.	C	<*>	0	.	DP=33;I16=11,20,0,0,1133,42547,0,0,1672,94048,0,0,517,11391,0,0;QS=3,0;MQSB=0.19205;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,162:6:0	0,24,199:8:0
-X	3862	.	T	<*>	0	.	DP=34;I16=11,22,0,0,1241,47443,0,0,1792,101248,0,0,526,11518,0,0;QS=3,0;MQSB=0.161533;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,185:7:0	0,27,221:9:0
-X	3863	.	T	<*>	0	.	DP=34;I16=12,22,0,0,1200,43542,0,0,1852,104848,0,0,541,11685,0,0;QS=3,0;MQSB=0.210327;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,199:7:0	0,27,213:9:0
-X	3864	.	A	<*>	0	.	DP=33;I16=11,22,0,0,1238,47448,0,0,1792,101248,0,0,550,11790,0,0;QS=3,0;MQSB=0.161533;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,210:7:0	0,27,230:9:0
-X	3865	.	G	<*>	0	.	DP=34;I16=11,23,0,0,1251,47113,0,0,1852,104848,0,0,559,11933,0,0;QS=3,0;MQSB=0.149071;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,21,200:7:0	0,27,212:9:0
-X	3866	.	C	<*>	0	.	DP=33;I16=11,21,0,0,1165,43545,0,0,1732,97648,0,0,545,11489,0,0;QS=3,0;MQSB=0.175751;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,189:7:0	0,24,197:8:0
-X	3867	.	A	<*>	0	.	DP=33;I16=11,22,0,0,1152,41510,0,0,1792,101248,0,0,580,12284,0,0;QS=3,0;MQSB=0.161533;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,188:7:0	0,27,195:9:0
-X	3868	.	T	<*>	0	.	DP=33;I16=11,22,0,0,1255,48141,0,0,1792,101248,0,0,590,12494,0,0;QS=3,0;MQSB=0.161533;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,21,202:7:0	0,27,221:9:0
-X	3869	.	C	<*>	0	.	DP=33;I16=11,21,0,0,1169,43987,0,0,1732,97648,0,0,589,12623,0,0;QS=3,0;MQSB=0.175751;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,18,164:6:0	0,27,211:9:0
-X	3870	.	T	<*>	0	.	DP=34;I16=11,23,0,0,1262,47808,0,0,1852,104848,0,0,608,12932,0,0;QS=3,0;MQSB=0.149071;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,24,215:8:0	0,27,211:9:0
-X	3871	.	T	<*>	0	.	DP=36;I16=11,25,0,0,1341,50655,0,0,1972,112048,0,0,617,13157,0,0;QS=3,0;MQSB=0.128391;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,24,221:8:0	0,27,223:9:0
-X	3872	.	G	<*>	0	.	DP=36;I16=11,25,0,0,1287,47095,0,0,1972,112048,0,0,626,13322,0,0;QS=3,0;MQSB=0.128391;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,24,211:8:0	0,27,200:9:0
-X	3873	.	T	<*>	0	.	DP=35;I16=10,24,0,0,1242,46680,0,0,1852,104848,0,0,626,13428,0,0;QS=3,0;MQSB=0.0982034;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,21,194:7:0	0,24,212:8:0
-X	3874	.	T	<*>	0	.	DP=36;I16=12,24,0,0,1290,47660,0,0,1972,112048,0,0,646,13774,0,0;QS=3,0;MQSB=0.182088;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,24,228:8:0	0,24,204:8:0
-X	3875	.	T	<*>	0	.	DP=37;I16=13,24,0,0,1324,48418,0,0,2029,115297,0,0,657,14061,0,0;QS=3,0;MQSB=0.117872;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,24,231:8:0	0,24,197:8:0
-X	3876	.	C	<*>	0	.	DP=37;I16=13,22,0,0,1248,45354,0,0,1909,108097,0,0,623,13325,0,0;QS=3,0;MQSB=0.140806;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,21,196:7:0	0,24,180:8:0
-X	3877	.	C	<*>	0	.	DP=37;I16=13,24,0,0,1363,51201,0,0,2029,115297,0,0,681,14765,0,0;QS=3,0;MQSB=0.117872;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,24,217:8:0	0,24,196:8:0
-X	3878	.	A	<*>	0	.	DP=37;I16=13,23,0,0,1309,48045,0,0,1969,111697,0,0,670,14654,0,0;QS=3,0;MQSB=0.128568;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,24,218:8:0	0,24,188:8:0
-X	3879	.	A	<*>	0	.	DP=38;I16=14,24,0,0,1453,56567,0,0,2066,116666,0,0,703,15543,0,0;QS=3,0;MQSB=0.076112;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,24,226:8:0	0,24,206:8:0
-X	3880	.	G	<*>	0	.	DP=37;I16=14,22,0,0,1311,48735,0,0,1946,109466,0,0,689,15267,0,0;QS=3,0;MQSB=0.094094;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,24,209:8:0	0,24,183:8:0
-X	3881	.	G	<*>	0	.	DP=37;I16=14,21,0,0,1200,42778,0,0,1886,105866,0,0,690,15578,0,0;QS=3,0;MQSB=0.105399;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,18,178:6:0	0,24,174:8:0
-X	3882	.	T	<*>	0	.	DP=37;I16=14,21,0,0,1192,42352,0,0,1886,105866,0,0,684,15348,0,0;QS=3,0;MQSB=0.105399;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,21,189:7:0	0,21,178:7:0
-X	3883	.	C	<*>	0	.	DP=38;I16=15,22,0,0,1295,46659,0,0,2006,113066,0,0,717,16279,0,0;QS=3,0;MQSB=0.124405;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,24,205:8:0	0,24,171:8:0
-X	3884	.	C	<*>	0	.	DP=39;I16=16,23,0,0,1363,49387,0,0,2103,118035,0,0,749,17141,0,0;QS=3,0;MQSB=0.0760633;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,24,202:8:0	0,27,212:9:0
-X	3885	.	T	<*>	0	.	DP=40;I16=16,24,0,0,1445,53663,0,0,2163,121635,0,0,754,17262,0,0;QS=3,0;MQSB=0.0679472;MQ0F=0	PL:DP:DV	0,69,255:23:0	0,24,219:8:0	0,27,214:9:0
-X	3886	.	C	<*>	0	.	DP=39;I16=16,23,0,0,1370,49762,0,0,2103,118035,0,0,761,17421,0,0;QS=3,0;MQSB=0.0760633;MQ0F=0	PL:DP:DV	0,69,255:23:0	0,24,199:8:0	0,24,191:8:0
-X	3887	.	C	<*>	0	.	DP=39;I16=16,23,0,0,1364,49222,0,0,2103,118035,0,0,767,17567,0,0;QS=3,0;MQSB=0.0760633;MQ0F=0	PL:DP:DV	0,69,255:23:0	0,24,194:8:0	0,24,201:8:0
-X	3888	.	C	<*>	0	.	DP=39;I16=15,23,0,0,1387,51885,0,0,2043,114435,0,0,747,17073,0,0;QS=3,0;MQSB=0.0555905;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,24,195:8:0	0,24,208:8:0
-X	3889	.	A	<*>	0	.	DP=38;I16=15,23,0,0,1364,49918,0,0,2066,116666,0,0,777,17811,0,0;QS=3,0;MQSB=0.112471;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,24,202:8:0	0,24,218:8:0
-X	3890	.	C	<*>	0	.	DP=38;I16=14,23,0,0,1362,51064,0,0,2006,113066,0,0,757,17329,0,0;QS=3,0;MQSB=0.0844255;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,24,203:8:0	0,24,216:8:0
-X	3891	.	A	<*>	0	.	DP=39;I16=15,24,0,0,1466,56312,0,0,2126,120266,0,0,786,18076,0,0;QS=3,0;MQSB=0.102114;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,24,203:8:0	0,27,239:9:0
-X	3892	.	G	<*>	0	.	DP=38;I16=15,23,0,0,1340,48838,0,0,2066,116666,0,0,792,18226,0,0;QS=3,0;MQSB=0.112471;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,24,186:8:0	0,27,208:9:0
-X	3893	.	T	<*>	0	.	DP=39;I16=15,24,0,0,1348,48170,0,0,2126,120266,0,0,798,18404,0,0;QS=3,0;MQSB=0.102114;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,24,196:8:0	0,27,212:9:0
-X	3894	.	G	<*>	0	.	DP=39;I16=15,23,0,0,1364,49900,0,0,2066,116666,0,0,779,17937,0,0;QS=3,0;MQSB=0.112471;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,24,202:8:0	0,27,208:9:0
-X	3895	.	T	<*>	0	.	DP=39;I16=15,24,0,0,1375,49773,0,0,2126,120266,0,0,810,18752,0,0;QS=3,0;MQSB=0.102114;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,24,202:8:0	0,27,225:9:0
-X	3896	.	A	<*>	0	.	DP=40;I16=15,24,0,0,1468,57326,0,0,2126,120266,0,0,815,18923,0,0;QS=3,0;MQSB=0.102114;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,24,224:8:0	0,27,233:9:0
-X	3897	.	G	<*>	0	.	DP=40;I16=15,24,0,0,1468,56812,0,0,2126,120266,0,0,819,19021,0,0;QS=3,0;MQSB=0.102114;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,21,199:7:0	0,30,234:10:0
-X	3898	.	C	<*>	0	.	DP=40;I16=15,23,0,0,1487,59351,0,0,2066,116666,0,0,813,19023,0,0;QS=3,0;MQSB=0.112471;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,18,186:6:0	0,30,238:10:0
-X	3899	.	A	<*>	0	.	DP=40;I16=15,24,0,0,1449,55055,0,0,2126,120266,0,0,829,19293,0,0;QS=3,0;MQSB=0.102114;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,21,191:7:0	0,30,231:10:0
-X	3900	.	T	<*>	0	.	DP=40;I16=15,24,0,0,1458,55516,0,0,2126,120266,0,0,833,19417,0,0;QS=3,0;MQSB=0.102114;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,21,197:7:0	0,30,240:10:0
-X	3901	.	G	<*>	0	.	DP=40;I16=14,22,0,0,1303,48245,0,0,1969,111697,0,0,761,17639,0,0;QS=3,0;MQSB=0.180757;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,18,154:6:0	0,27,218:9:0
-X	3902	.	C	<*>	0	.	DP=40;I16=15,24,0,0,1436,55412,0,0,2126,120266,0,0,837,19537,0,0;QS=3,0;MQSB=0.102114;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,21,166:7:0	0,30,217:10:0
-X	3903	.	A	<*>	0	.	DP=42;I16=15,24,0,0,1299,45567,0,0,2089,117417,0,0,814,19008,0,0;QS=3,0;MQSB=0.0901152;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,24,175:8:0	0,30,204:10:0
-X	3904	.	C	<*>	0	.	DP=42;I16=15,24,0,0,1439,54545,0,0,2086,117066,0,0,815,19113,0,0;QS=3,0;MQSB=0.0426917;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,24,191:8:0	0,30,244:10:0
-X	3905	.	C	<*>	0	.	DP=42;I16=15,25,0,0,1572,63314,0,0,2146,120666,0,0,822,19192,0,0;QS=3,0;MQSB=0.0381122;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,24,212:8:0	0,33,255:11:0
-X	3906	.	T	<*>	0	.	DP=42;I16=16,25,0,0,1593,63039,0,0,2206,124266,0,0,846,19758,0,0;QS=3,0;MQSB=0.0536599;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,24,210:8:0	0,33,253:11:0
-X	3907	.	G	<*>	0	.	DP=42;I16=16,25,0,0,1558,60192,0,0,2206,124266,0,0,846,19776,0,0;QS=3,0;MQSB=0.0536599;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,24,203:8:0	0,33,249:11:0
-X	3908	.	C	<*>	0	.	DP=42;I16=16,25,0,0,1514,58968,0,0,2206,124266,0,0,845,19777,0,0;QS=3,0;MQSB=0.0536599;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,24,193:8:0	0,33,244:11:0
-X	3909	.	T	<*>	0	.	DP=43;I16=16,25,0,0,1491,55895,0,0,2201,123691,0,0,835,19697,0,0;QS=3,0;MQSB=0.0757469;MQ0F=0	PL:DP:DV	0,69,255:23:0	0,24,202:8:0	0,30,237:10:0
-X	3910	.	A	<*>	0	.	DP=40;I16=16,23,0,0,1432,53926,0,0,2081,116491,0,0,844,19724,0,0;QS=3,0;MQSB=0.0949554;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,21,193:7:0	0,30,224:10:0
-X	3911	.	C	<*>	0	.	DP=40;I16=16,23,0,0,1440,55290,0,0,2081,116491,0,0,843,19613,0,0;QS=3,0;MQSB=0.0949554;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,21,184:7:0	0,30,214:10:0
-X	3912	.	A	C,<*>	0	.	DP=41;I16=17,22,0,1,1358,49508,16,256,2081,116491,60,3600,830,19358,11,121;QS=2.95181,0.0481928,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.125266;BQB=1;MQ0F=0	PL:DP:DV	0,69,255,69,255,255:23:0	0,21,166,21,166,166:7:0	0,14,202,27,205,208:10:1
-X	3913	.	C	<*>	0	.	DP=40;I16=16,23,0,0,1494,59096,0,0,2081,116491,0,0,824,19100,0,0;QS=3,0;MQSB=0.0949554;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,21,183:7:0	0,30,234:10:0
-X	3914	.	T	<*>	0	.	DP=42;I16=16,24,0,0,1512,59342,0,0,2141,120091,0,0,823,19007,0,0;QS=3,0;MQSB=0.0846181;MQ0F=0	PL:DP:DV	0,69,255:23:0	0,21,192:7:0	0,30,228:10:0
-X	3915	.	C	<*>	0	.	DP=42;I16=16,24,0,0,1537,60953,0,0,2141,120091,0,0,799,18321,0,0;QS=3,0;MQSB=0.0846181;MQ0F=0	PL:DP:DV	0,72,255:24:0	0,18,176:6:0	0,30,229:10:0
-X	3916	.	C	<*>	0	.	DP=42;I16=16,25,0,0,1618,66342,0,0,2201,123691,0,0,825,18919,0,0;QS=3,0;MQSB=0.0757469;MQ0F=0	PL:DP:DV	0,72,255:24:0	0,21,190:7:0	0,30,251:10:0
-X	3917	.	T	<*>	0	.	DP=43;I16=16,25,0,0,1601,65219,0,0,2201,123691,0,0,825,18875,0,0;QS=3,0;MQSB=0.0757469;MQ0F=0	PL:DP:DV	0,72,255:24:0	0,21,191:7:0	0,30,254:10:0
-X	3918	.	T	<*>	0	.	DP=43;I16=16,25,0,0,1541,60711,0,0,2201,123691,0,0,801,18239,0,0;QS=3,0;MQSB=0.0757469;MQ0F=0	PL:DP:DV	0,75,255:25:0	0,18,179:6:0	0,30,254:10:0
-X	3919	.	C	<*>	0	.	DP=42;I16=15,26,0,0,1621,66337,0,0,2232,126450,0,0,826,18786,0,0;QS=3,0;MQSB=0.110793;MQ0F=0	PL:DP:DV	0,72,255:24:0	0,21,200:7:0	0,30,242:10:0
-X	3920	.	T	<*>	0	.	DP=42;I16=15,26,0,0,1605,64327,0,0,2232,126450,0,0,825,18691,0,0;QS=3,0;MQSB=0.110793;MQ0F=0	PL:DP:DV	0,72,255:24:0	0,21,207:7:0	0,30,251:10:0
-X	3921	.	T	<*>	0	.	DP=42;I16=15,26,0,0,1519,58507,0,0,2232,126450,0,0,824,18630,0,0;QS=3,0;MQSB=0.110793;MQ0F=0	PL:DP:DV	0,72,255:24:0	0,21,201:7:0	0,30,242:10:0
-X	3922	.	A	<*>	0	.	DP=42;I16=14,26,0,0,1539,61289,0,0,2195,125081,0,0,819,18545,0,0;QS=3,0;MQSB=0.168991;MQ0F=0	PL:DP:DV	0,72,255:24:0	0,18,179:6:0	0,30,244:10:0
-X	3923	.	G	<*>	0	.	DP=41;I16=14,25,0,0,1515,60945,0,0,2135,121481,0,0,792,17834,0,0;QS=3,0;MQSB=0.182501;MQ0F=0	PL:DP:DV	0,69,255:23:0	0,18,172:6:0	0,30,240:10:0
-X	3924	.	G	<*>	0	.	DP=41;I16=13,26,0,0,1524,61106,0,0,2135,121481,0,0,808,18356,0,0;QS=3,0;MQSB=0.128469;MQ0F=0	PL:DP:DV	0,69,255:23:0	0,18,158:6:0	0,30,247:10:0
-X	3925	.	G	<*>	0	.	DP=41;I16=14,25,0,0,1425,55687,0,0,2135,121481,0,0,788,17758,0,0;QS=3,0;MQSB=0.182501;MQ0F=0	PL:DP:DV	0,72,255:24:0	0,15,134:5:0	0,30,245:10:0
-X	3926	.	C	<*>	0	.	DP=41;I16=14,26,0,0,1512,59674,0,0,2195,125081,0,0,811,18393,0,0;QS=3,0;MQSB=0.168991;MQ0F=0	PL:DP:DV	0,72,255:24:0	0,18,152:6:0	0,30,237:10:0
-X	3927	.	T	<*>	0	.	DP=41;I16=14,26,0,0,1512,59566,0,0,2195,125081,0,0,808,18384,0,0;QS=3,0;MQSB=0.168991;MQ0F=0	PL:DP:DV	0,72,255:24:0	0,18,160:6:0	0,30,237:10:0
-X	3928	.	G	<*>	0	.	DP=41;I16=14,25,0,0,1479,58495,0,0,2135,121481,0,0,779,17731,0,0;QS=3,0;MQSB=0.182501;MQ0F=0	PL:DP:DV	0,72,255:24:0	0,18,149:6:0	0,27,233:9:0
-X	3929	.	A	<*>	0	.	DP=41;I16=13,26,0,0,1452,56436,0,0,2135,121481,0,0,796,18256,0,0;QS=3,0;MQSB=0.128469;MQ0F=0	PL:DP:DV	0,69,255:23:0	0,18,161:6:0	0,30,220:10:0
-X	3930	.	T	<*>	0	.	DP=40;I16=13,25,0,0,1387,52929,0,0,2078,118232,0,0,767,17521,0,0;QS=3,0;MQSB=0.25797;MQ0F=0	PL:DP:DV	0,69,255:23:0	0,15,149:5:0	0,30,224:10:0
-X	3931	.	A	<*>	0	.	DP=40;I16=13,25,0,0,1387,52877,0,0,2078,118232,0,0,761,17439,0,0;QS=3,0;MQSB=0.25797;MQ0F=0	PL:DP:DV	0,69,255:23:0	0,18,166:6:0	0,27,222:9:0
-X	3932	.	T	<*>	0	.	DP=39;I16=12,26,0,0,1394,53644,0,0,2078,118232,0,0,780,17964,0,0;QS=3,0;MQSB=0.190372;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,18,161:6:0	0,30,231:10:0
-X	3933	.	T	<*>	0	.	DP=38;I16=12,24,0,0,1389,54743,0,0,1958,111032,0,0,752,17366,0,0;QS=3,0;MQSB=0.218161;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,18,166:6:0	0,24,220:8:0
-X	3934	.	C	<*>	0	.	DP=38;I16=12,25,0,0,1395,54915,0,0,2018,114632,0,0,768,17758,0,0;QS=3,0;MQSB=0.203497;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,18,152:6:0	0,27,209:9:0
-X	3935	.	C	<*>	0	.	DP=38;I16=12,24,0,0,1239,44621,0,0,1958,111032,0,0,737,17075,0,0;QS=3,0;MQSB=0.218161;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,15,134:5:0	0,27,170:9:0
-X	3936	.	A	G,<*>	0	.	DP=37;I16=5,6,6,17,424,16384,801,30271,609,34563,1314,77018,225,5325,511,11851;QS=0.87994,2.12006,0;VDB=0.0574114;SGB=-4.60123;RPB=0.741697;MQB=0.812605;MQSB=0.143788;BQB=0.883831;MQ0F=0	PL:DP:DV	233,0,206,255,239,255:20:11	77,0,58,83,70,141:6:4	196,24,0,196,24,196:8:8
-X	3937	.	C	<*>	0	.	DP=36;I16=11,24,0,0,1155,39875,0,0,1952,112422,0,0,745,17291,0,0;QS=3,0;MQSB=0.219636;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,18,143:6:0	0,24,156:8:0
-X	3938	.	G	<*>	0	.	DP=35;I16=11,23,0,0,1155,41761,0,0,1892,108822,0,0,737,17079,0,0;QS=3,0;MQSB=0.231054;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,15,119:5:0	0,24,176:8:0
-X	3939	.	C	<*>	0	.	DP=35;I16=11,22,0,0,1273,50651,0,0,1832,105222,0,0,703,16221,0,0;QS=3,0;MQSB=0.243713;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,15,135:5:0	0,21,174:7:0
-X	3940	.	A	<*>	0	.	DP=35;I16=11,22,0,0,1148,42754,0,0,1832,105222,0,0,691,15867,0,0;QS=3,0;MQSB=0.243713;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,15,117:5:0	0,21,163:7:0
-X	3941	.	C	<*>	0	.	DP=35;I16=11,22,0,0,1216,47488,0,0,1832,105222,0,0,688,15892,0,0;QS=3,0;MQSB=0.243713;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,15,133:5:0	0,21,181:7:0
-X	3942	.	C	<*>	0	.	DP=35;I16=11,23,0,0,1336,54166,0,0,1892,108822,0,0,690,15772,0,0;QS=3,0;MQSB=0.231054;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,15,140:5:0	0,24,195:8:0
-X	3943	.	T	<*>	0	.	DP=35;I16=11,23,0,0,1296,51618,0,0,1892,108822,0,0,676,15406,0,0;QS=3,0;MQSB=0.231054;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,15,142:5:0	0,24,195:8:0
-X	3944	.	G	<*>	0	.	DP=34;I16=10,22,0,0,1199,46445,0,0,1803,104381,0,0,654,14954,0,0;QS=3,0;MQSB=0.1117;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,149:5:0	0,24,195:8:0
-X	3945	.	C	<*>	0	.	DP=33;I16=10,22,0,0,1256,51226,0,0,1772,101622,0,0,649,14657,0,0;QS=3,0;MQSB=0.187579;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,15,142:5:0	0,21,177:7:0
-X	3946	.	T	<*>	0	.	DP=33;I16=10,21,0,0,1170,45884,0,0,1712,98022,0,0,609,13599,0,0;QS=3,0;MQSB=0.199344;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,15,144:5:0	0,18,158:6:0
-X	3947	.	A	<*>	0	.	DP=32;I16=10,21,0,0,1094,41048,0,0,1712,98022,0,0,620,13820,0,0;QS=3,0;MQSB=0.199344;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,15,128:5:0	0,18,149:6:0
-X	3948	.	C	<*>	0	.	DP=32;I16=10,20,0,0,1134,45104,0,0,1652,94422,0,0,596,13344,0,0;QS=3,0;MQSB=0.212591;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,12,105:4:0	0,18,155:6:0
-X	3949	.	A	C,<*>	0	.	DP=32;I16=10,17,0,1,1027,39909,24,576,1472,83622,60,3600,541,12211,25,625;QS=2.85093,0.149068,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.244621;BQB=1;MQ0F=0	PL:DP:DV	0,60,255,60,255,255:20:0	0,9,89,9,89,89:3:0	9,0,107,21,110,124:5:1
-X	3950	.	C	<*>	0	.	DP=33;I16=11,21,0,0,1191,46247,0,0,1772,101622,0,0,576,12680,0,0;QS=3,0;MQSB=0.257801;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,15,118:5:0	0,18,168:6:0
-X	3951	.	T	<*>	0	.	DP=34;I16=12,19,0,0,1148,44272,0,0,1712,98022,0,0,530,11670,0,0;QS=3,0;MQSB=0.354733;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,15,146:5:0	0,15,152:5:0
-X	3952	.	C	<*>	0	.	DP=35;I16=13,20,0,0,1176,43762,0,0,1832,105222,0,0,545,12025,0,0;QS=3,0;MQSB=0.394875;MQ0F=0	PL:DP:DV	0,66,255:22:0	0,18,158:6:0	0,15,143:5:0
-X	3953	.	C	<*>	0	.	DP=34;I16=13,20,0,0,1246,48436,0,0,1863,107981,0,0,538,11772,0,0;QS=3,0;MQSB=0.252983;MQ0F=0	PL:DP:DV	0,63,255:21:0	0,18,163:6:0	0,18,168:6:0
-X	3954	.	T	<*>	0	.	DP=33;I16=13,19,0,0,1195,45815,0,0,1803,104381,0,0,526,11438,0,0;QS=3,0;MQSB=0.264585;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,18,171:6:0	0,18,167:6:0
-X	3955	.	T	<*>	0	.	DP=32;I16=13,18,0,0,1180,46092,0,0,1743,100781,0,0,515,11139,0,0;QS=3,0;MQSB=0.277468;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,18,173:6:0	0,18,174:6:0
-X	3956	.	C	<*>	0	.	DP=32;I16=13,18,0,0,1181,47021,0,0,1743,100781,0,0,504,10874,0,0;QS=3,0;MQSB=0.277468;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,18,167:6:0	0,18,167:6:0
-X	3957	.	T	<*>	0	.	DP=31;I16=13,17,0,0,1153,46051,0,0,1683,97181,0,0,494,10642,0,0;QS=3,0;MQSB=0.291833;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,18,161:6:0	0,15,162:5:0
-X	3958	.	T	<*>	0	.	DP=31;I16=13,16,0,0,1070,40600,0,0,1623,93581,0,0,483,10393,0,0;QS=3,0;MQSB=0.307929;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,15,139:5:0	0,15,157:5:0
-X	3959	.	A	<*>	0	.	DP=30;I16=14,15,0,0,1062,39758,0,0,1623,93581,0,0,474,10176,0,0;QS=3,0;MQSB=0.377103;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,12,118:4:0	0,15,154:5:0
-X	3960	.	T	<*>	0	.	DP=30;I16=14,15,0,0,995,36027,0,0,1623,93581,0,0,464,9892,0,0;QS=3,0;MQSB=0.377103;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,12,105:4:0	0,15,142:5:0
-X	3961	.	G	<*>	0	.	DP=29;I16=12,16,0,0,1067,40899,0,0,1586,92212,0,0,457,9739,0,0;QS=3,0;MQSB=0.455864;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,12,114:4:0	0,12,122:4:0
-X	3962	.	G	<*>	0	.	DP=29;I16=13,16,0,0,1025,37125,0,0,1623,93581,0,0,471,10053,0,0;QS=3,0;MQSB=0.307929;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,12,108:4:0	0,15,144:5:0
-X	3963	.	C	<*>	0	.	DP=28;I16=13,15,0,0,1040,39100,0,0,1563,89981,0,0,463,9871,0,0;QS=3,0;MQSB=0.326055;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,12,111:4:0	0,12,126:4:0
-X	3964	.	T	<*>	0	.	DP=27;I16=12,15,0,0,1036,39928,0,0,1503,86381,0,0,456,9720,0,0;QS=3,0;MQSB=0.273507;MQ0F=0	PL:DP:DV	0,60,255:20:0	0,9,94:3:0	0,12,133:4:0
-X	3965	.	G	<*>	0	.	DP=26;I16=12,14,0,0,993,38165,0,0,1443,82781,0,0,450,9598,0,0;QS=3,0;MQSB=0.29215;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,9,92:3:0	0,12,134:4:0
-X	3966	.	A	<*>	0	.	DP=26;I16=12,13,0,0,930,34834,0,0,1406,81412,0,0,432,9310,0,0;QS=3,0;MQSB=0.520812;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,9,90:3:0	0,12,140:4:0
-X	3967	.	T	<*>	0	.	DP=26;I16=12,13,0,0,900,32830,0,0,1406,81412,0,0,421,9001,0,0;QS=3,0;MQSB=0.520812;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,9,90:3:0	0,9,100:3:0
-X	3968	.	A	<*>	0	.	DP=25;I16=12,13,0,0,885,31773,0,0,1406,81412,0,0,415,8853,0,0;QS=3,0;MQSB=0.520812;MQ0F=0	PL:DP:DV	0,57,255:19:0	0,9,90:3:0	0,9,99:3:0
-X	3969	.	T	<*>	0	.	DP=24;I16=11,13,0,0,886,32972,0,0,1369,80043,0,0,410,8736,0,0;QS=3,0;MQSB=0.702671;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,9,85:3:0	0,9,108:3:0
-X	3970	.	T	<*>	0	.	DP=24;I16=11,13,0,0,861,31313,0,0,1369,80043,0,0,405,8649,0,0;QS=3,0;MQSB=0.702671;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,9,83:3:0	0,9,104:3:0
-X	3971	.	C	<*>	0	.	DP=22;I16=11,11,0,0,815,30625,0,0,1249,72843,0,0,402,8590,0,0;QS=3,0;MQSB=0.751921;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,57:2:0	0,9,103:3:0
-X	3972	.	C	<*>	0	.	DP=22;I16=11,11,0,0,812,30486,0,0,1249,72843,0,0,399,8557,0,0;QS=3,0;MQSB=0.751921;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,55:2:0	0,9,96:3:0
-X	3973	.	A	<*>	0	.	DP=22;I16=11,11,0,0,795,28873,0,0,1249,72843,0,0,395,8501,0,0;QS=3,0;MQSB=0.751921;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,52:2:0	0,9,97:3:0
-X	3974	.	C	<*>	0	.	DP=22;I16=11,11,0,0,729,24447,0,0,1249,72843,0,0,392,8472,0,0;QS=3,0;MQSB=0.751921;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,55:2:0	0,9,78:3:0
-X	3975	.	G	<*>	0	.	DP=22;I16=11,11,0,0,717,24525,0,0,1249,72843,0,0,390,8470,0,0;QS=3,0;MQSB=0.751921;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,46:2:0	0,9,96:3:0
-X	3976	.	C	<*>	0	.	DP=22;I16=11,11,0,0,816,30652,0,0,1249,72843,0,0,387,8445,0,0;QS=3,0;MQSB=0.751921;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,55:2:0	0,9,97:3:0
-X	3977	.	A	<*>	0	.	DP=23;I16=11,11,0,0,740,25384,0,0,1249,72843,0,0,382,8346,0,0;QS=3,0;MQSB=0.751921;MQ0F=0	PL:DP:DV	0,51,255:17:0	0,6,48:2:0	0,9,90:3:0
-X	3978	.	C	<*>	0	.	DP=23;I16=11,12,0,0,769,26631,0,0,1309,76443,0,0,377,8223,0,0;QS=3,0;MQSB=0.726094;MQ0F=0	PL:DP:DV	0,54,255:18:0	0,6,47:2:0	0,9,103:3:0
-X	3979	.	C	<*>	0	.	DP=21;I16=9,11,0,0,744,28160,0,0,1152,67874,0,0,361,7905,0,0;QS=3,0;MQSB=0.885207;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,51:2:0	0,9,104:3:0
-X	3980	.	T	<*>	0	.	DP=21;I16=10,11,0,0,756,27872,0,0,1212,71474,0,0,367,7855,0,0;QS=3,0;MQSB=0.914611;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,51:2:0	0,9,98:3:0
-X	3981	.	G	<*>	0	.	DP=21;I16=10,11,0,0,785,29641,0,0,1212,71474,0,0,362,7710,0,0;QS=3,0;MQSB=0.914611;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,50:2:0	0,9,93:3:0
-X	3982	.	C	<*>	0	.	DP=21;I16=10,11,0,0,779,29495,0,0,1212,71474,0,0,357,7591,0,0;QS=3,0;MQSB=0.914611;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,55:2:0	0,9,97:3:0
-X	3983	.	T	<*>	0	.	DP=20;I16=9,11,0,0,720,26274,0,0,1155,68225,0,0,353,7497,0,0;QS=3,0;MQSB=0.993528;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,57:2:0	0,9,93:3:0
-X	3984	.	A	<*>	0	.	DP=21;I16=10,11,0,0,739,26279,0,0,1192,69594,0,0,348,7378,0,0;QS=3,0;MQSB=0.885602;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,53:2:0	0,9,80:3:0
-X	3985	.	C	<*>	0	.	DP=20;I16=10,10,0,0,728,26998,0,0,1132,65994,0,0,344,7234,0,0;QS=3,0;MQSB=0.902256;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,55:2:0	0,9,91:3:0
-X	3986	.	A	<*>	0	.	DP=20;I16=10,10,0,0,685,23815,0,0,1132,65994,0,0,340,7114,0,0;QS=3,0;MQSB=0.902256;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,56:2:0	0,9,84:3:0
-X	3987	.	C	<*>	0	.	DP=20;I16=10,10,0,0,736,28118,0,0,1132,65994,0,0,336,7018,0,0;QS=3,0;MQSB=0.902256;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,55:2:0	0,9,94:3:0
-X	3988	.	T	<*>	0	.	DP=21;I16=10,10,0,0,741,27797,0,0,1132,65994,0,0,332,6946,0,0;QS=3,0;MQSB=0.902256;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,58:2:0	0,9,91:3:0
-X	3989	.	C	<*>	0	.	DP=21;I16=10,11,0,0,729,26185,0,0,1192,69594,0,0,327,6801,0,0;QS=3,0;MQSB=0.885602;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,55:2:0	0,9,88:3:0
-X	3990	.	C	<*>	0	.	DP=21;I16=10,11,0,0,766,28674,0,0,1192,69594,0,0,322,6686,0,0;QS=3,0;MQSB=0.885602;MQ0F=0	PL:DP:DV	0,48,255:16:0	0,6,55:2:0	0,9,95:3:0
-X	3991	.	T	<*>	0	.	DP=20;I16=9,11,0,0,729,27311,0,0,1132,65994,0,0,318,6600,0,0;QS=3,0;MQSB=0.850154;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,55:2:0	0,9,89:3:0
-X	3992	.	T	<*>	0	.	DP=19;I16=9,10,0,0,667,24173,0,0,1072,62394,0,0,313,6441,0,0;QS=3,0;MQSB=0.868634;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,56:2:0	0,6,72:2:0
-X	3993	.	C	<*>	0	.	DP=18;I16=9,9,0,0,701,27529,0,0,1012,58794,0,0,309,6307,0,0;QS=3,0;MQSB=0.888755;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,59:2:0	0,6,70:2:0
-X	3994	.	T	<*>	0	.	DP=19;I16=10,9,0,0,718,27520,0,0,1049,60163,0,0,305,6197,0,0;QS=3,0;MQSB=0.716531;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,58:2:0	0,6,72:2:0
-X	3995	.	T	<*>	0	.	DP=19;I16=9,9,0,0,641,23025,0,0,989,56563,0,0,277,5487,0,0;QS=3,0;MQSB=0.650623;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,53:2:0	0,6,69:2:0
-X	3996	.	A	<*>	0	.	DP=19;I16=9,9,0,0,665,24815,0,0,989,56563,0,0,274,5428,0,0;QS=3,0;MQSB=0.650623;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,54:2:0	0,6,73:2:0
-X	3997	.	G	C,<*>	0	.	DP=19;I16=10,8,0,1,645,23703,21,441,989,56563,60,3600,287,5843,6,36;QS=2.96023,0.0397727,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.716531;BQB=1;MQ0F=0	PL:DP:DV	0,24,255,42,255,255:15:1	0,6,57,6,57,57:2:0	0,6,60,6,60,60:2:0
-X	3998	.	G	<*>	0	.	DP=18;I16=9,8,0,0,626,23710,0,0,929,52963,0,0,265,5203,0,0;QS=3,0;MQSB=0.687289;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,6,58:2:0	0,3,36:1:0
-X	3999	.	G	A,<*>	0	.	DP=18;I16=9,7,0,1,596,22974,37,1369,869,49363,60,3600,263,5387,4,16;QS=2.92871,0.0712909,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.687289;BQB=1;MQ0F=0	PL:DP:DV	0,5,255,39,255,255:14:1	0,6,56,6,56,56:2:0	0,3,38,3,38,38:1:0
-X	4000	.	C	<*>	0	.	DP=18;I16=10,8,0,0,669,25389,0,0,989,56563,0,0,283,5753,0,0;QS=3,0;MQSB=0.751866;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,55:2:0	0,3,36:1:0
-X	4001	.	T	<*>	0	.	DP=18;I16=10,8,0,0,680,26006,0,0,989,56563,0,0,279,5727,0,0;QS=3,0;MQSB=0.751866;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,56:2:0	0,3,33:1:0
-X	4002	.	G	<*>	0	.	DP=17;I16=10,7,0,0,621,23281,0,0,929,52963,0,0,276,5724,0,0;QS=2,0;MQSB=0.79189;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,44:2:0	0,0,0:0:0
-X	4003	.	A	<*>	0	.	DP=17;I16=10,7,0,0,597,21507,0,0,929,52963,0,0,272,5692,0,0;QS=2,0;MQSB=0.79189;MQ0F=0	PL:DP:DV	0,45,255:15:0	0,6,55:2:0	0,0,0:0:0
-X	4004	.	T	<*>	0	.	DP=15;I16=9,6,0,0,527,19031,0,0,849,48963,0,0,270,5678,0,0;QS=2,0;MQSB=0.957526;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,3,40:1:0	0,0,0:0:0
-X	4005	.	A	<*>	0	.	DP=15;I16=8,5,0,0,479,17731,0,0,729,41763,0,0,237,5195,0,0;QS=2,0;MQSB=0.958048;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,35:1:0	0,0,0:0:0
-X	4006	.	T	<*>	0	.	DP=15;I16=9,6,0,0,554,20776,0,0,849,48963,0,0,266,5698,0,0;QS=2,0;MQSB=0.957526;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,3,40:1:0	0,0,0:0:0
-X	4007	.	T	G,<*>	0	.	DP=15;I16=9,5,0,1,490,17810,15,225,789,45363,60,3600,245,5371,19,361;QS=1.96746,0.032538,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.957526;BQB=1;MQ0F=0	PL:DP:DV	0,26,255,39,255,255:14:1	0,3,41,3,41,41:1:0	0,0,0,0,0,0:0:0
-X	4008	.	C	<*>	0	.	DP=15;I16=9,6,0,0,488,16890,0,0,849,48963,0,0,262,5782,0,0;QS=2,0;MQSB=0.957526;MQ0F=0	PL:DP:DV	0,42,255:14:0	0,3,30:1:0	0,0,0:0:0
-X	4009	.	C	<*>	0	.	DP=14;I16=9,5,0,0,524,20150,0,0,794,45938,0,0,261,5847,0,0;QS=2,0;MQSB=0.800737;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,3,40:1:0	0,0,0:0:0
-X	4010	.	A	<*>	0	.	DP=14;I16=9,5,0,0,523,19731,0,0,794,45938,0,0,259,5875,0,0;QS=2,0;MQSB=0.800737;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,3,41:1:0	0,0,0:0:0
-X	4011	.	C	<*>	0	.	DP=14;I16=9,5,0,0,489,17613,0,0,794,45938,0,0,257,5915,0,0;QS=2,0;MQSB=0.800737;MQ0F=0	PL:DP:DV	0,39,255:13:0	0,3,41:1:0	0,0,0:0:0
-X	4012	.	A	<*>	0	.	DP=14;I16=7,5,0,0,365,11867,0,0,674,38738,0,0,223,5293,0,0;QS=2,0;MQSB=0.6821;MQ0F=0	PL:DP:DV	0,33,231:11:0	0,3,30:1:0	0,0,0:0:0
-X	4013	.	C	<*>	0	.	DP=14;I16=8,5,0,0,451,15885,0,0,734,42338,0,0,247,5995,0,0;QS=2,0;MQSB=0.765017;MQ0F=0	PL:DP:DV	0,36,255:12:0	0,3,37:1:0	0,0,0:0:0
-X	4014	.	A	<*>	0	.	DP=12;I16=8,2,0,0,358,13372,0,0,554,31538,0,0,222,5404,0,0;QS=2,0;MQSB=0.75;MQ0F=0	PL:DP:DV	0,27,213:9:0	0,3,34:1:0	0,0,0:0:0
-X	4015	.	C	<*>	0	.	DP=12;I16=8,2,0,0,350,12812,0,0,554,31538,0,0,222,5442,0,0;QS=2,0;MQSB=0.75;MQ0F=0	PL:DP:DV	0,27,222:9:0	0,3,21:1:0	0,0,0:0:0
-X	4016	.	C	<*>	0	.	DP=12;I16=8,3,0,0,350,11956,0,0,614,35138,0,0,247,6109,0,0;QS=2,0;MQSB=0.829029;MQ0F=0	PL:DP:DV	0,30,215:10:0	0,3,32:1:0	0,0,0:0:0
-X	4017	.	C	<*>	0	.	DP=11;I16=5,2,0,0,227,7765,0,0,374,20738,0,0,173,4279,0,0;QS=2,0;MQSB=0.6;MQ0F=0	PL:DP:DV	0,18,161:6:0	0,3,20:1:0	0,0,0:0:0
-X	4018	.	G	<*>	0	.	DP=11;I16=8,2,0,0,284,8442,0,0,554,31538,0,0,249,6201,0,0;QS=2,0;MQSB=0.75;MQ0F=0	PL:DP:DV	0,27,183:9:0	0,3,17:1:0	0,0,0:0:0
-X	4019	.	C	<*>	0	.	DP=11;I16=9,2,0,0,383,14427,0,0,614,35138,0,0,250,6250,0,0;QS=2,0;MQSB=0.777778;MQ0F=0	PL:DP:DV	0,30,228:10:0	0,3,33:1:0	0,0,0:0:0
-X	4020	.	T	<*>	0	.	DP=10;I16=8,2,0,0,362,13668,0,0,554,31538,0,0,250,6250,0,0;QS=2,0;MQSB=0.75;MQ0F=0	PL:DP:DV	0,27,213:9:0	0,3,38:1:0	0,0,0:0:0
-X	4021	.	A	<*>	0	.	DP=10;I16=8,1,0,0,304,10512,0,0,494,27938,0,0,225,5625,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,177:8:0	0,3,33:1:0	0,0,0:0:0
-X	4022	.	C	<*>	0	.	DP=10;I16=7,2,0,0,310,11582,0,0,494,27938,0,0,225,5625,0,0;QS=2,0;MQSB=0.714286;MQ0F=0	PL:DP:DV	0,24,202:8:0	0,3,36:1:0	0,0,0:0:0
-X	4023	.	A	<*>	0	.	DP=10;I16=8,2,0,0,354,13116,0,0,554,31538,0,0,250,6250,0,0;QS=2,0;MQSB=0.75;MQ0F=0	PL:DP:DV	0,27,209:9:0	0,3,40:1:0	0,0,0:0:0
-X	4024	.	C	<*>	0	.	DP=10;I16=8,2,0,0,361,13669,0,0,554,31538,0,0,250,6250,0,0;QS=2,0;MQSB=0.75;MQ0F=0	PL:DP:DV	0,27,214:9:0	0,3,39:1:0	0,0,0:0:0
-X	4025	.	T	<*>	0	.	DP=10;I16=8,1,0,0,360,14488,0,0,494,27938,0,0,224,5576,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,199:8:0	0,3,42:1:0	0,0,0:0:0
-X	4026	.	C	<*>	0	.	DP=10;I16=8,2,0,0,329,11655,0,0,554,31538,0,0,248,6154,0,0;QS=2,0;MQSB=0.75;MQ0F=0	PL:DP:DV	0,27,192:9:0	0,3,39:1:0	0,0,0:0:0
-X	4027	.	C	<*>	0	.	DP=10;I16=8,2,0,0,380,14888,0,0,554,31538,0,0,246,6060,0,0;QS=2,0;MQSB=0.75;MQ0F=0	PL:DP:DV	0,27,231:9:0	0,3,38:1:0	0,0,0:0:0
-X	4028	.	T	<*>	0	.	DP=10;I16=8,2,0,0,333,12157,0,0,554,31538,0,0,244,5970,0,0;QS=2,0;MQSB=0.75;MQ0F=0	PL:DP:DV	0,27,202:9:0	0,3,41:1:0	0,0,0:0:0
-X	4029	.	T	<*>	0	.	DP=10;I16=8,2,0,0,377,14333,0,0,554,31538,0,0,242,5884,0,0;QS=2,0;MQSB=0.75;MQ0F=0	PL:DP:DV	0,27,225:9:0	0,3,38:1:0	0,0,0:0:0
-X	4030	.	C	<*>	0	.	DP=10;I16=8,2,0,0,348,12558,0,0,554,31538,0,0,240,5802,0,0;QS=2,0;MQSB=0.75;MQ0F=0	PL:DP:DV	0,27,211:9:0	0,3,30:1:0	0,0,0:0:0
-X	4031	.	T	<*>	0	.	DP=10;I16=8,2,0,0,388,15302,0,0,554,31538,0,0,238,5724,0,0;QS=2,0;MQSB=0.75;MQ0F=0	PL:DP:DV	0,27,229:9:0	0,3,39:1:0	0,0,0:0:0
-X	4032	.	T	<*>	0	.	DP=10;I16=8,2,0,0,341,11901,0,0,554,31538,0,0,236,5650,0,0;QS=2,0;MQSB=0.75;MQ0F=0	PL:DP:DV	0,27,204:9:0	0,3,39:1:0	0,0,0:0:0
-X	4033	.	A	<*>	0	.	DP=10;I16=7,2,0,0,299,10717,0,0,494,27938,0,0,218,5324,0,0;QS=2,0;MQSB=0.714286;MQ0F=0	PL:DP:DV	0,24,193:8:0	0,3,38:1:0	0,0,0:0:0
-X	4034	.	G	<*>	0	.	DP=10;I16=8,2,0,0,347,12527,0,0,554,31538,0,0,231,5465,0,0;QS=2,0;MQSB=0.75;MQ0F=0	PL:DP:DV	0,27,211:9:0	0,3,39:1:0	0,0,0:0:0
-X	4035	.	G	T,<*>	0	.	DP=10;I16=7,2,1,0,316,11900,13,169,494,27938,60,3600,202,4682,25,625;QS=1.9547,0.0452962,0;SGB=-0.556633;RPB=1;MQB=1;MQSB=0.75;BQB=1;MQ0F=0	PL:DP:DV	0,13,195,24,198,200:9:1	0,3,31,3,31,31:1:0	0,0,0,0,0,0:0:0
-X	4036	.	G	<*>	0	.	DP=10;I16=8,1,0,0,269,8839,0,0,494,27938,0,0,198,4532,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,156:8:0	0,3,34:1:0	0,0,0:0:0
-X	4037	.	C	<*>	0	.	DP=10;I16=8,2,0,0,342,12466,0,0,554,31538,0,0,219,5015,0,0;QS=2,0;MQSB=0.75;MQ0F=0	PL:DP:DV	0,27,210:9:0	0,3,30:1:0	0,0,0:0:0
-X	4038	.	T	<*>	0	.	DP=10;I16=8,2,0,0,335,12149,0,0,554,31538,0,0,215,4881,0,0;QS=2,0;MQSB=0.75;MQ0F=0	PL:DP:DV	0,27,203:9:0	0,3,29:1:0	0,0,0:0:0
-X	4039	.	G	<*>	0	.	DP=10;I16=8,1,0,0,302,10798,0,0,494,27938,0,0,186,4130,0,0;QS=2,0;MQSB=1;MQ0F=0	PL:DP:DV	0,24,180:8:0	0,3,31:1:0	0,0,0:0:0
-X	4040	.	A	<*>	0	.	DP=10;I16=8,2,0,0,380,14602,0,0,554,31538,0,0,207,4637,0,0;QS=2,0;MQSB=0.75;MQ0F=0	PL:DP:DV	0,27,223:9:0	0,3,41:1:0	0,0,0:0:0
-X	4041	.	T	<*>	0	.	DP=10;I16=8,2,0,0,367,13633,0,0,554,31538,0,0,202,4478,0,0;QS=2,0;MQSB=0.75;MQ0F=0	PL:DP:DV	0,27,216:9:0	0,3,40:1:0	0,0,0:0:0
-X	4042	.	A	<*>	0	.	DP=10;I16=8,2,0,0,337,11657,0,0,554,31538,0,0,197,4329,0,0;QS=2,0;MQSB=0.75;MQ0F=0	PL:DP:DV	0,27,205:9:0	0,3,34:1:0	0,0,0:0:0
-X	4043	.	T	<*>	0	.	DP=10;I16=8,2,0,0,314,10428,0,0,554,31538,0,0,192,4190,0,0;QS=2,0;MQSB=0.75;MQ0F=0	PL:DP:DV	0,27,190:9:0	0,3,35:1:0	0,0,0:0:0
-X	4044	.	T	<*>	0	.	DP=10;I16=8,2,0,0,333,11579,0,0,554,31538,0,0,187,4061,0,0;QS=2,0;MQSB=0.75;MQ0F=0	PL:DP:DV	0,27,199:9:0	0,3,37:1:0	0,0,0:0:0
-X	4045	.	C	<*>	0	.	DP=10;I16=7,2,0,0,291,10099,0,0,494,27938,0,0,176,3906,0,0;QS=1,0;MQSB=0.714286;MQ0F=0	PL:DP:DV	0,27,204:9:0	0,0,0:0:0	0,0,0:0:0
-X	4046	.	C	<*>	0	.	DP=10;I16=8,2,0,0,356,13032,0,0,554,31538,0,0,177,3833,0,0;QS=2,0;MQSB=0.75;MQ0F=0	PL:DP:DV	0,27,212:9:0	0,3,35:1:0	0,0,0:0:0
-X	4047	.	A	<*>	0	.	DP=10;I16=8,2,0,0,347,12557,0,0,554,31538,0,0,172,3734,0,0;QS=2,0;MQSB=0.75;MQ0F=0	PL:DP:DV	0,27,204:9:0	0,3,40:1:0	0,0,0:0:0
-X	4048	.	C	<*>	0	.	DP=10;I16=8,2,0,0,342,12124,0,0,554,31538,0,0,167,3645,0,0;QS=2,0;MQSB=0.75;MQ0F=0	PL:DP:DV	0,27,202:9:0	0,3,37:1:0	0,0,0:0:0
-X	4049	.	G	<*>	0	.	DP=10;I16=7,2,0,0,260,7786,0,0,494,27938,0,0,146,3310,0,0;QS=2,0;MQSB=0.714286;MQ0F=0	PL:DP:DV	0,24,173:8:0	0,3,24:1:0	0,0,0:0:0
-X	4050	.	C	<*>	0	.	DP=9;I16=6,2,0,0,291,10813,0,0,434,24338,0,0,157,3495,0,0;QS=1,0;MQSB=0.666667;MQ0F=0	PL:DP:DV	0,24,204:8:0	0,0,0:0:0	0,0,0:0:0
-X	4051	.	A	<*>	0	.	DP=8;I16=5,2,0,0,259,9679,0,0,374,20738,0,0,146,3370,0,0;QS=1,0;MQSB=0.6;MQ0F=0	PL:DP:DV	0,21,192:7:0	0,0,0:0:0	0,0,0:0:0
-X	4052	.	C	<*>	0	.	DP=8;I16=5,2,0,0,247,9025,0,0,374,20738,0,0,143,3281,0,0;QS=1,0;MQSB=0.6;MQ0F=0	PL:DP:DV	0,21,190:7:0	0,0,0:0:0	0,0,0:0:0
-X	4053	.	C	<*>	0	.	DP=8;I16=6,2,0,0,254,9000,0,0,434,24338,0,0,146,3234,0,0;QS=1,0;MQSB=0.666667;MQ0F=0	PL:DP:DV	0,24,184:8:0	0,0,0:0:0	0,0,0:0:0
-X	4054	.	C	<*>	0	.	DP=8;I16=3,2,0,0,160,5344,0,0,254,13538,0,0,122,2984,0,0;QS=1,0;MQSB=0.333333;MQ0F=0	PL:DP:DV	0,15,134:5:0	0,0,0:0:0	0,0,0:0:0
-X	4055	.	G	<*>	0	.	DP=8;I16=6,2,0,0,230,6982,0,0,434,24338,0,0,138,3066,0,0;QS=1,0;MQSB=0.666667;MQ0F=0	PL:DP:DV	0,24,169:8:0	0,0,0:0:0	0,0,0:0:0
-X	4056	.	C	<*>	0	.	DP=8;I16=6,2,0,0,275,10153,0,0,434,24338,0,0,134,2994,0,0;QS=1,0;MQSB=0.666667;MQ0F=0	PL:DP:DV	0,24,197:8:0	0,0,0:0:0	0,0,0:0:0
-X	4057	.	T	<*>	0	.	DP=8;I16=5,2,0,0,243,8603,0,0,374,20738,0,0,127,2877,0,0;QS=1,0;MQSB=0.6;MQ0F=0	PL:DP:DV	0,21,182:7:0	0,0,0:0:0	0,0,0:0:0
-X	4058	.	A	<*>	0	.	DP=7;I16=4,2,0,0,214,7742,0,0,314,17138,0,0,116,2728,0,0;QS=1,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,18,171:6:0	0,0,0:0:0	0,0,0:0:0
-X	4059	.	C	<*>	0	.	DP=6;I16=4,2,0,0,204,7164,0,0,314,17138,0,0,119,2635,0,0;QS=1,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,18,168:6:0	0,0,0:0:0	0,0,0:0:0
-X	4060	.	A	<*>	0	.	DP=6;I16=4,2,0,0,227,8683,0,0,314,17138,0,0,115,2501,0,0;QS=1,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,18,177:6:0	0,0,0:0:0	0,0,0:0:0
-X	4061	.	C	<*>	0	.	DP=6;I16=4,2,0,0,193,6681,0,0,314,17138,0,0,111,2375,0,0;QS=1,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,18,157:6:0	0,0,0:0:0	0,0,0:0:0
-X	4062	.	T	<*>	0	.	DP=6;I16=4,1,0,0,195,7621,0,0,254,13538,0,0,82,1632,0,0;QS=1,0;MQSB=1;MQ0F=0	PL:DP:DV	0,15,151:5:0	0,0,0:0:0	0,0,0:0:0
-X	4063	.	C	<*>	0	.	DP=6;I16=4,2,0,0,216,7984,0,0,314,17138,0,0,102,2098,0,0;QS=1,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,18,170:6:0	0,0,0:0:0	0,0,0:0:0
-X	4064	.	C	<*>	0	.	DP=6;I16=4,2,0,0,227,8747,0,0,314,17138,0,0,97,1949,0,0;QS=1,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,18,177:6:0	0,0,0:0:0	0,0,0:0:0
-X	4065	.	T	<*>	0	.	DP=6;I16=4,2,0,0,202,6880,0,0,314,17138,0,0,92,1810,0,0;QS=1,0;MQSB=0.5;MQ0F=0	PL:DP:DV	0,18,161:6:0	0,0,0:0:0	0,0,0:0:0
-X	4066	.	T	<*>	0	.	DP=5;I16=3,2,0,0,180,6554,0,0,254,13538,0,0,88,1680,0,0;QS=1,0;MQSB=0.333333;MQ0F=0	PL:DP:DV	0,15,153:5:0	0,0,0:0:0	0,0,0:0:0
-X	4067	.	C	<*>	0	.	DP=5;I16=3,2,0,0,181,6637,0,0,254,13538,0,0,84,1558,0,0;QS=1,0;MQSB=0.333333;MQ0F=0	PL:DP:DV	0,15,153:5:0	0,0,0:0:0	0,0,0:0:0
-X	4068	.	T	<*>	0	.	DP=5;I16=3,2,0,0,198,7868,0,0,254,13538,0,0,80,1444,0,0;QS=1,0;MQSB=0.333333;MQ0F=0	PL:DP:DV	0,15,164:5:0	0,0,0:0:0	0,0,0:0:0
-X	4069	.	T	<*>	0	.	DP=5;I16=3,2,0,0,177,6325,0,0,254,13538,0,0,76,1338,0,0;QS=1,0;MQSB=0.333333;MQ0F=0	PL:DP:DV	0,15,154:5:0	0,0,0:0:0	0,0,0:0:0
-X	4070	.	A	<*>	0	.	DP=5;I16=3,2,0,0,161,5263,0,0,254,13538,0,0,72,1240,0,0;QS=1,0;MQSB=0.333333;MQ0F=0	PL:DP:DV	0,15,140:5:0	0,0,0:0:0	0,0,0:0:0
-X	4071	.	G	<*>	0	.	DP=5;I16=3,2,0,0,166,5658,0,0,254,13538,0,0,68,1150,0,0;QS=1,0;MQSB=0.333333;MQ0F=0	PL:DP:DV	0,15,142:5:0	0,0,0:0:0	0,0,0:0:0
-X	4072	.	G	<*>	0	.	DP=5;I16=2,2,0,0,138,4974,0,0,194,9938,0,0,55,987,0,0;QS=1,0;MQSB=0;MQ0F=0	PL:DP:DV	0,12,122:4:0	0,0,0:0:0	0,0,0:0:0
-X	4073	.	G	<*>	0	.	DP=5;I16=3,2,0,0,156,5082,0,0,254,13538,0,0,60,994,0,0;QS=1,0;MQSB=0.333333;MQ0F=0	PL:DP:DV	0,15,136:5:0	0,0,0:0:0	0,0,0:0:0
-X	4074	.	C	<*>	0	.	DP=5;I16=3,2,0,0,160,5602,0,0,254,13538,0,0,56,928,0,0;QS=1,0;MQSB=0.333333;MQ0F=0	PL:DP:DV	0,15,142:5:0	0,0,0:0:0	0,0,0:0:0
-X	4075	.	T	<*>	0	.	DP=5;I16=3,2,0,0,187,7069,0,0,254,13538,0,0,52,870,0,0;QS=1,0;MQSB=0.333333;MQ0F=0	PL:DP:DV	0,15,155:5:0	0,0,0:0:0	0,0,0:0:0
-X	4076	.	G	<*>	0	.	DP=5;I16=3,2,0,0,174,6298,0,0,254,13538,0,0,48,820,0,0;QS=1,0;MQSB=0.333333;MQ0F=0	PL:DP:DV	0,15,149:5:0	0,0,0:0:0	0,0,0:0:0
-X	4077	.	A	<*>	0	.	DP=4;I16=3,1,0,0,138,4810,0,0,194,9938,0,0,44,728,0,0;QS=1,0;MQSB=1;MQ0F=0	PL:DP:DV	0,12,121:4:0	0,0,0:0:0	0,0,0:0:0
-X	4078	.	T	<*>	0	.	DP=4;I16=3,1,0,0,143,5173,0,0,194,9938,0,0,40,644,0,0;QS=1,0;MQSB=1;MQ0F=0	PL:DP:DV	0,12,124:4:0	0,0,0:0:0	0,0,0:0:0
-X	4079	.	A	<*>	0	.	DP=4;I16=3,1,0,0,121,3847,0,0,194,9938,0,0,36,568,0,0;QS=1,0;MQSB=1;MQ0F=0	PL:DP:DV	0,12,107:4:0	0,0,0:0:0	0,0,0:0:0
-X	4080	.	T	<*>	0	.	DP=4;I16=3,0,0,0,106,3778,0,0,134,6338,0,0,25,451,0,0;QS=1,0;MQ0F=0	PL:DP:DV	0,9,87:3:0	0,0,0:0:0	0,0,0:0:0
-X	4081	.	T	<*>	0	.	DP=4;I16=3,1,0,0,106,2934,0,0,194,9938,0,0,28,440,0,0;QS=1,0;MQSB=1;MQ0F=0	PL:DP:DV	0,12,94:4:0	0,0,0:0:0	0,0,0:0:0
-X	4082	.	C	<*>	0	.	DP=3;I16=2,1,0,0,110,4042,0,0,134,6338,0,0,25,387,0,0;QS=1,0;MQSB=1;MQ0F=0	PL:DP:DV	0,9,103:3:0	0,0,0:0:0	0,0,0:0:0
-X	4083	.	C	<*>	0	.	DP=3;I16=2,1,0,0,104,3648,0,0,134,6338,0,0,22,340,0,0;QS=1,0;MQSB=1;MQ0F=0	PL:DP:DV	0,9,98:3:0	0,0,0:0:0	0,0,0:0:0
-X	4084	.	A	<*>	0	.	DP=2;I16=1,1,0,0,78,3050,0,0,97,4969,0,0,20,298,0,0;QS=1,0;MQSB=1;MQ0F=0	PL:DP:DV	0,6,74:2:0	0,0,0:0:0	0,0,0:0:0
-X	4085	.	C	<*>	0	.	DP=2;I16=1,1,0,0,62,1940,0,0,97,4969,0,0,18,260,0,0;QS=1,0;MQSB=1;MQ0F=0	PL:DP:DV	0,6,62:2:0	0,0,0:0:0	0,0,0:0:0
-X	4086	.	G	<*>	0	.	DP=2;I16=1,1,0,0,56,1640,0,0,97,4969,0,0,16,226,0,0;QS=1,0;MQSB=1;MQ0F=0	PL:DP:DV	0,6,56:2:0	0,0,0:0:0	0,0,0:0:0
-X	4087	.	C	<*>	0	.	DP=2;I16=1,1,0,0,69,2405,0,0,97,4969,0,0,14,196,0,0;QS=1,0;MQSB=1;MQ0F=0	PL:DP:DV	0,6,68:2:0	0,0,0:0:0	0,0,0:0:0
-X	4088	.	A	<*>	0	.	DP=1;I16=1,0,0,0,39,1521,0,0,37,1369,0,0,13,169,0,0;QS=1,0;MQ0F=0	PL:DP:DV	0,3,37:1:0	0,0,0:0:0	0,0,0:0:0
-X	4089	.	C	<*>	0	.	DP=1;I16=1,0,0,0,36,1296,0,0,37,1369,0,0,12,144,0,0;QS=1,0;MQ0F=0	PL:DP:DV	0,3,36:1:0	0,0,0:0:0	0,0,0:0:0
-X	4090	.	C	<*>	0	.	DP=1;I16=1,0,0,0,33,1089,0,0,37,1369,0,0,11,121,0,0;QS=1,0;MQ0F=0	PL:DP:DV	0,3,33:1:0	0,0,0:0:0	0,0,0:0:0
-X	4091	.	T	<*>	0	.	DP=1;I16=1,0,0,0,36,1296,0,0,37,1369,0,0,10,100,0,0;QS=1,0;MQ0F=0	PL:DP:DV	0,3,36:1:0	0,0,0:0:0	0,0,0:0:0
-X	4092	.	G	<*>	0	.	DP=1;I16=1,0,0,0,37,1369,0,0,37,1369,0,0,9,81,0,0;QS=1,0;MQ0F=0	PL:DP:DV	0,3,37:1:0	0,0,0:0:0	0,0,0:0:0
-X	4093	.	C	<*>	0	.	DP=1;I16=1,0,0,0,35,1225,0,0,37,1369,0,0,8,64,0,0;QS=1,0;MQ0F=0	PL:DP:DV	0,3,35:1:0	0,0,0:0:0	0,0,0:0:0
-X	4094	.	T	<*>	0	.	DP=1;I16=1,0,0,0,40,1600,0,0,37,1369,0,0,7,49,0,0;QS=1,0;MQ0F=0	PL:DP:DV	0,3,37:1:0	0,0,0:0:0	0,0,0:0:0
-X	4095	.	A	<*>	0	.	DP=1;I16=1,0,0,0,35,1225,0,0,37,1369,0,0,6,36,0,0;QS=1,0;MQ0F=0	PL:DP:DV	0,3,35:1:0	0,0,0:0:0	0,0,0:0:0
-X	4096	.	C	<*>	0	.	DP=1;I16=1,0,0,0,32,1024,0,0,37,1369,0,0,5,25,0,0;QS=1,0;MQ0F=0	PL:DP:DV	0,3,32:1:0	0,0,0:0:0	0,0,0:0:0
-X	4097	.	A	<*>	0	.	DP=1;I16=1,0,0,0,35,1225,0,0,37,1369,0,0,4,16,0,0;QS=1,0;MQ0F=0	PL:DP:DV	0,3,35:1:0	0,0,0:0:0	0,0,0:0:0
-X	4098	.	C	<*>	0	.	DP=1;I16=1,0,0,0,31,961,0,0,37,1369,0,0,3,9,0,0;QS=1,0;MQ0F=0	PL:DP:DV	0,3,31:1:0	0,0,0:0:0	0,0,0:0:0
-X	4099	.	T	<*>	0	.	DP=1;I16=1,0,0,0,32,1024,0,0,37,1369,0,0,2,4,0,0;QS=1,0;MQ0F=0	PL:DP:DV	0,3,32:1:0	0,0,0:0:0	0,0,0:0:0
-X	4100	.	C	<*>	0	.	DP=1;I16=1,0,0,0,27,729,0,0,37,1369,0,0,1,1,0,0;QS=1,0;MQ0F=0	PL:DP:DV	0,3,27:1:0	0,0,0:0:0	0,0,0:0:0
-X	4101	.	C	<*>	0	.	DP=1;I16=1,0,0,0,26,676,0,0,37,1369,0,0,0,0,0,0;QS=1,0;MQ0F=0	PL:DP:DV	0,3,26:1:0	0,0,0:0:0	0,0,0:0:0
--- a/test-data/mpileup.c.vcf	Fri Feb 05 19:23:10 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,4127 +0,0 @@
-##fileformat=VCFv4.2
-##FILTER=<ID=PASS,Description="All filters passed">
-##samtoolsVersion=1.1-19-g6b249e2+htslib-1.1-74-g845c515
-##samtoolsCommand=samtools mpileup -uvDV -b xxx//mpileup.bam.list -f xxx//mpileup.ref.fa.gz
-##reference=file://xxx//mpileup.ref.fa.gz
-##contig=<ID=17,length=81195210>
-##ALT=<ID=X,Description="Represents allele(s) other than observed.">
-##INFO=<ID=INDEL,Number=0,Type=Flag,Description="Indicates that the variant is an INDEL.">
-##INFO=<ID=IDV,Number=1,Type=Integer,Description="Maximum number of reads supporting an indel">
-##INFO=<ID=IMF,Number=1,Type=Float,Description="Maximum fraction of reads supporting an indel">
-##INFO=<ID=DP,Number=1,Type=Integer,Description="Raw read depth">
-##INFO=<ID=VDB,Number=1,Type=Float,Description="Variant Distance Bias for filtering splice-site artefacts in RNA-seq data (bigger is better)",Version="3">
-##INFO=<ID=RPB,Number=1,Type=Float,Description="Mann-Whitney U test of Read Position Bias (bigger is better)">
-##INFO=<ID=MQB,Number=1,Type=Float,Description="Mann-Whitney U test of Mapping Quality Bias (bigger is better)">
-##INFO=<ID=BQB,Number=1,Type=Float,Description="Mann-Whitney U test of Base Quality Bias (bigger is better)">
-##INFO=<ID=MQSB,Number=1,Type=Float,Description="Mann-Whitney U test of Mapping Quality vs Strand Bias (bigger is better)">
-##INFO=<ID=SGB,Number=1,Type=Float,Description="Segregation based metric.">
-##INFO=<ID=MQ0F,Number=1,Type=Float,Description="Fraction of MQ0 reads (smaller is better)">
-##INFO=<ID=I16,Number=16,Type=Float,Description="Auxiliary tag used for calling, see description of bcf_callret1_t in bam2bcf.h">
-##INFO=<ID=QS,Number=R,Type=Float,Description="Auxiliary tag used for calling">
-##FORMAT=<ID=PL,Number=G,Type=Integer,Description="List of Phred-scaled genotype likelihoods">
-##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Number of high-quality bases">
-##FORMAT=<ID=DV,Number=1,Type=Integer,Description="Number of high-quality non-reference bases">
-#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	HG00100	HG00101	HG00102
-17	1	.	A	<X>	0	.	DP=11;I16=11,0,0,0,452,18594,0,0,319,9251,0,0,223,4959,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-17	2	.	A	<X>	0	.	DP=11;I16=11,0,0,0,439,17587,0,0,319,9251,0,0,226,5030,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-17	3	.	G	<X>	0	.	DP=11;I16=11,0,0,0,431,16971,0,0,319,9251,0,0,229,5111,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-17	4	.	C	<X>	0	.	DP=11;I16=11,0,0,0,423,16417,0,0,319,9251,0,0,232,5202,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,71:3:0
-17	5	.	T	<X>	0	.	DP=11;I16=11,0,0,0,450,18520,0,0,319,9251,0,0,234,5252,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-17	6	.	T	<X>	0	.	DP=11;I16=11,0,0,0,403,14847,0,0,319,9251,0,0,236,5310,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-17	7	.	C	<X>	0	.	DP=11;I16=11,0,0,0,446,18114,0,0,319,9251,0,0,237,5327,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-17	8	.	T	<X>	0	.	DP=11;I16=11,0,0,0,465,19677,0,0,319,9251,0,0,238,5354,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-17	9	.	C	<X>	0	.	DP=11;I16=11,0,0,0,447,18205,0,0,319,9251,0,0,239,5391,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-17	10	.	A	<X>	0	.	DP=11;I16=11,0,0,0,426,16756,0,0,319,9251,0,0,240,5438,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,69:3:0
-17	11	.	C	<X>	0	.	DP=11;I16=11,0,0,0,413,15603,0,0,319,9251,0,0,241,5495,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-17	12	.	C	<X>	0	.	DP=11;I16=11,0,0,0,438,17506,0,0,319,9251,0,0,242,5562,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-17	13	.	C	<X>	0	.	DP=11;I16=11,0,0,0,437,17463,0,0,319,9251,0,0,243,5639,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-17	14	.	T	<X>	0	.	DP=11;I16=11,0,0,0,453,18715,0,0,319,9251,0,0,242,5628,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-17	15	.	G	<X>	0	.	DP=11;I16=11,0,0,0,439,17599,0,0,319,9251,0,0,240,5580,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-17	16	.	T	<X>	0	.	DP=11;I16=11,0,0,0,426,16546,0,0,319,9251,0,0,238,5544,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-17	17	.	T	<X>	0	.	DP=11;I16=11,0,0,0,407,15195,0,0,319,9251,0,0,235,5469,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,15,100:5:0	0,9,72:3:0	0,9,72:3:0
-17	18	.	C	<X>	0	.	DP=12;I16=12,0,0,0,450,17136,0,0,379,12851,0,0,231,5353,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,18,113:6:0	0,9,72:3:0	0,9,72:3:0
-17	19	.	C	<X>	0	.	DP=13;I16=13,0,0,0,502,19652,0,0,439,16451,0,0,228,5246,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,18,112:6:0	0,12,89:4:0	0,9,72:3:0
-17	20	.	T	<X>	0	.	DP=13;I16=13,0,0,0,532,21878,0,0,439,16451,0,0,226,5150,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,18,116:6:0	0,12,98:4:0	0,9,72:3:0
-17	21	.	G	<X>	0	.	DP=13;I16=13,0,0,0,498,19254,0,0,439,16451,0,0,224,5066,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,18,117:6:0	0,12,94:4:0	0,9,72:3:0
-17	22	.	C	<X>	0	.	DP=13;I16=13,0,0,0,511,20289,0,0,470,19210,0,0,223,4993,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,18,115:6:0	0,12,91:4:0	0,9,76:3:0
-17	23	.	A	<X>	0	.	DP=14;I16=14,0,0,0,513,19399,0,0,530,22810,0,0,223,4931,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,133:7:0	0,12,82:4:0	0,9,82:3:0
-17	24	.	T	<X>	0	.	DP=14;I16=14,0,0,0,534,20540,0,0,530,22810,0,0,224,4882,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,131:7:0	0,12,96:4:0	0,9,80:3:0
-17	25	.	A	<X>	0	.	DP=15;I16=15,0,0,0,561,21133,0,0,590,26410,0,0,225,4847,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,140:8:0	0,12,96:4:0	0,9,81:3:0
-17	26	.	G	<X>	0	.	DP=15;I16=15,0,0,0,591,23429,0,0,590,26410,0,0,227,4827,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,151:8:0	0,12,96:4:0	0,9,81:3:0
-17	27	.	A	<X>	0	.	DP=15;I16=15,0,0,0,588,23120,0,0,590,26410,0,0,229,4823,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,146:8:0	0,12,98:4:0	0,9,83:3:0
-17	28	.	T	<X>	0	.	DP=16;I16=16,0,0,0,605,23001,0,0,650,30010,0,0,231,4835,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,147:8:0	0,12,97:4:0	0,12,101:4:0
-17	29	.	A	<X>	0	.	DP=17;I16=17,0,0,0,615,22533,0,0,710,33610,0,0,234,4864,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,146:8:0	0,15,102:5:0	0,12,104:4:0
-17	30	.	A	<X>	0	.	DP=17;I16=17,0,0,0,660,25914,0,0,710,33610,0,0,238,4912,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,149:8:0	0,15,115:5:0	0,12,108:4:0
-17	31	.	T	<X>	0	.	DP=17;I16=17,0,0,0,656,25392,0,0,710,33610,0,0,242,4980,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,150:8:0	0,15,113:5:0	0,12,105:4:0
-17	32	.	T	<X>	0	.	DP=17;I16=17,0,0,0,605,21789,0,0,741,36369,0,0,247,5067,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,143:8:0	0,15,104:5:0	0,12,104:4:0
-17	33	.	G	<X>	0	.	DP=17;I16=17,0,0,0,659,25757,0,0,741,36369,0,0,252,5124,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,158:8:0	0,15,118:5:0	0,12,105:4:0
-17	34	.	C	<X>	0	.	DP=17;I16=17,0,0,0,658,25704,0,0,741,36369,0,0,257,5203,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,151:8:0	0,15,121:5:0	0,12,106:4:0
-17	35	.	A	<X>	0	.	DP=18;I16=18,0,0,0,677,25881,0,0,801,39969,0,0,262,5304,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,152:8:0	0,15,109:5:0	0,15,121:5:0
-17	36	.	T	<X>	0	.	DP=18;I16=18,0,0,0,678,25796,0,0,801,39969,0,0,268,5428,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,151:8:0	0,15,114:5:0	0,15,125:5:0
-17	37	.	G	<X>	0	.	DP=18;I16=18,0,0,0,685,26291,0,0,801,39969,0,0,274,5576,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,157:8:0	0,15,116:5:0	0,15,126:5:0
-17	38	.	A	<X>	0	.	DP=18;I16=18,0,0,0,697,27245,0,0,801,39969,0,0,280,5748,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,152:8:0	0,15,116:5:0	0,15,129:5:0
-17	39	.	C	<X>	0	.	DP=16;I16=16,0,0,0,591,22311,0,0,743,38287,0,0,288,5942,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,148:7:0	0,12,94:4:0	0,15,123:5:0
-17	40	.	A	<X>	0	.	DP=16;I16=16,0,0,0,630,24896,0,0,743,38287,0,0,295,6107,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,21,146:7:0	0,12,104:4:0	0,15,127:5:0
-17	41	.	A	<X>	0	.	DP=17;I16=17,0,0,0,645,24685,0,0,803,41887,0,0,302,6294,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,151:8:0	0,12,104:4:0	0,15,131:5:0
-17	42	.	T	<X>	0	.	DP=17;I16=17,0,0,0,618,23118,0,0,803,41887,0,0,310,6504,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,155:8:0	0,12,82:4:0	0,15,127:5:0
-17	43	.	T	<X>	0	.	DP=17;I16=17,0,0,0,631,23689,0,0,803,41887,0,0,318,6738,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,151:8:0	0,12,101:4:0	0,15,129:5:0
-17	44	.	G	<X>	0	.	DP=17;I16=17,0,0,0,664,26162,0,0,803,41887,0,0,324,6896,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,164:8:0	0,12,100:4:0	0,15,129:5:0
-17	45	.	C	<X>	0	.	DP=17;I16=17,0,0,0,657,25525,0,0,803,41887,0,0,329,7027,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,163:8:0	0,12,108:4:0	0,15,125:5:0
-17	46	.	C	<X>	0	.	DP=17;I16=17,0,0,0,646,25244,0,0,803,41887,0,0,334,7180,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,161:8:0	0,12,98:4:0	0,15,131:5:0
-17	47	.	T	<X>	0	.	DP=17;I16=17,0,0,0,700,28998,0,0,803,41887,0,0,339,7355,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,165:8:0	0,12,110:4:0	0,15,136:5:0
-17	48	.	T	<X>	0	.	DP=17;I16=17,0,0,0,648,25020,0,0,803,41887,0,0,343,7501,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,155:8:0	0,12,105:4:0	0,15,131:5:0
-17	49	.	G	<X>	0	.	DP=18;I16=18,0,0,0,686,26674,0,0,832,42728,0,0,346,7616,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,158:8:0	0,15,119:5:0	0,15,128:5:0
-17	50	.	T	<X>	0	.	DP=18;I16=17,0,0,0,650,24972,0,0,772,39128,0,0,332,7426,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,155:8:0	0,12,101:4:0	0,15,128:5:0
-17	51	.	C	<X>	0	.	DP=18;I16=18,0,0,0,681,26529,0,0,832,42728,0,0,353,7853,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,167:8:0	0,15,99:5:0	0,15,127:5:0
-17	52	.	C	<X>	0	.	DP=18;I16=17,0,0,0,645,24983,0,0,803,41887,0,0,353,7965,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,164:8:0	0,12,99:4:0	0,15,128:5:0
-17	53	.	C	<X>	0	.	DP=18;I16=18,0,0,0,687,26735,0,0,832,42728,0,0,359,8113,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,164:8:0	0,15,113:5:0	0,15,132:5:0
-17	54	.	T	<X>	0	.	DP=18;I16=18,0,0,0,736,30194,0,0,832,42728,0,0,361,8219,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,163:8:0	0,15,128:5:0	0,15,136:5:0
-17	55	.	G	<X>	0	.	DP=18;I16=18,0,0,0,674,26082,0,0,832,42728,0,0,362,8290,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,168:8:0	0,15,112:5:0	0,15,122:5:0
-17	56	.	C	<X>	0	.	DP=18;I16=18,0,0,0,701,27645,0,0,832,42728,0,0,363,8375,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,162:8:0	0,15,121:5:0	0,15,131:5:0
-17	57	.	T	<X>	0	.	DP=18;I16=17,0,0,0,694,29118,0,0,803,41887,0,0,356,8410,0,0;QS=3,0;MQ0F=0	PL:DP:DV	0,24,163:8:0	0,12,117:4:0	0,15,138:5:0