Mercurial > repos > iuc > clair3
changeset 0:44f6ec903688 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/clair3 commit 9968295e33bad5323ac9cbff8f64c2db35189a5f
| author | iuc |
|---|---|
| date | Wed, 15 Jun 2022 09:45:05 +0000 |
| parents | |
| children | 63e02ef6e153 |
| files | clair3.xml test-data/all_fasta.loc test-data/clair3_models.loc test-data/full_alignment_1.vcf test-data/merge_output_1.vcf test-data/phased_bam_1.bam test-data/pileup_1.vcf test-data/test1.bam test-data/test1.bed test-data/test1.fasta test-data/test1.vcf.gz tool-data/all_fasta.loc.sample tool-data/model.loc.sample tool_data_table_conf.xml.sample tool_data_table_conf.xml.test |
| diffstat | 14 files changed, 464 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/clair3.xml Wed Jun 15 09:45:05 2022 +0000 @@ -0,0 +1,311 @@ +<tool id="clair3" name="Clair3" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="21.09"> + <macros> + <token name="@TOOL_VERSION@">0.1.11</token> + <token name="@VERSION_SUFFIX@">0</token> + </macros> + <requirements> + <requirement type="package" version="@TOOL_VERSION@">clair3</requirement> + </requirements> + <version_command><![CDATA[run_clair3.sh --version | cut -f2 -d ' ']]></version_command> + <command detect_errors="exit_code"><![CDATA[ + #if $ref_source.source == "history" + ln -s '${ref_source.ref_fasta}' reference.fasta && + #elif $ref_source.source == "builtin" + ln -s '${ref_source.ref_fasta_builtin.fields.path}' reference.fasta && + #end if + samtools faidx reference.fasta && + + #if $model_source.source == "datatable" + #set model_path = $model_source.model.fields.path + #end if + + ln -s '${$bam_input}' input_reads.bam && + ln -s '${$bam_input.metadata.bam_index}' input_reads.bai && + + #if $bed_or_vcf.bed_or_vcf_selector == 'bed' + ln -s '$bed_or_vcf.bed_fn' input.bed && + #elif $bed_or_vcf.bed_or_vcf_selector == 'vcf' + ln -s '$bed_or_vcf.vcf_fn' input.vcf && + #end if + + run_clair3.sh + --bam_fn=input_reads.bam + --ref_fn=reference.fasta + #if $model_source.source == "datatable" + --platform='${model_source.model.fields.platform}' + --model_path=${model_source.model.fields.path} + #else + #if $model_source.select_built_in == "hifi" or $model_source.select_built_in == "ilmn": + --platform='${$model_source.select_built_in}' + #else + --platform='ont' + #end if + --model_path=\$(dirname \$(which run_clair3.sh))/models/$model_source.select_built_in + #end if + --output='.' + --threads=\${GALAXY_SLOTS:-1} + #if $bed_or_vcf.bed_or_vcf_selector == 'bed' + --bed_fn=input.bed + #elif $bed_or_vcf.bed_or_vcf_selector == 'vcf' + --vcf_fn=input.vcf + #else + $bed_or_vcf.include_all_ctgs + #end if + #if $output_options.selection_mode == 'advanced' + $output_options.gvcf + #end if + #if $adv.qual + --qual=$adv.qual + #end if + #if $adv.snp_min_af + --snp_min_af=$adv.snp_min_af + #end if + #if $adv.indel_min_af + --indel_min_af=$adv.indel_min_af + #end if + $adv.enable_phasing + $adv.no_phasing_for_fa + $adv.print_ref_calls + $adv.ploidity_model + #if $adv.chunk_size + --chunk_size=$adv.chunk_size + #end if + + ]]></command> + <inputs> + <conditional name="ref_source"> + <param type="select" label="Reference genome source" name="source"> + <option value="history" selected="true">History</option> + <option value="builtin">Built-in</option> + </param> + <when value="history"> + <param type="data" format="fasta" name="ref_fasta" label="Reference genome" /> + </when> + <when value="builtin"> + <param type="select" name="ref_fasta_builtin" label="Reference genome"> + <options from_data_table="all_fasta" /> + </param> + </when> + </conditional> + <conditional name="model_source"> + <param type="select" label="Select if you want to use built-in models or your own via datatable." name="source"> + <option value="built-in">Built-in</option> + <option value="datatable">Datatable</option> + </param> + <when value="built-in"> + <param type="select" name="select_built_in" label="Select built-in model."> + <option value="r941_prom_sup_g5014">r941_prom_sup_g5014</option> + <option value="r941_prom_hac_g360+g422">r941_prom_hac_g360+g422</option> + <option value="hifi">hifi</option> + <option value="ilmn">ilmn</option> + </param> + </when> + <when value="datatable"> + <param argument="--model_path" type="select" name="model" label="Select model" > + <options from_data_table="clair3_models"> + <validator type="no_options" message="no modles available" /> + </options> + </param> + </when> + </conditional> + <param type="data" name="bam_input" format="bam" label="BAM file input." /> + <conditional name="bed_or_vcf"> + <param type="select" name="bed_or_vcf_selector" label="Restict variant calling to:"> + <option value="unrestricted" selected="true">Whole reference (unrestricted)</option> + <option value="bed" selected="true">Regions defined in BED dataset</option> + <option value="vcf">Sites defined in VCF dataset</option> + </param> + <when value="bed"> + <param type="data" name="bed_fn" format="bed" label="Call variants only in the provided bed regions."/> + </when> + <when value="vcf"> + <param type="data" name="vcf_fn" format="vcf" label="Candidate sites VCF file input, variants will only be called at the sites in the VCF file if provided."/> + </when> + <when value="unrestricted"> + <param type="boolean" name="include_all_ctgs" truevalue="--include_all_ctgs" falsevalue="" checked="true" label="Call variants on all contigs, otherwise call in chr{1..22,X,Y} and {1..22,X,Y}, default: disable." /> + </when> + </conditional> + <conditional name="output_options"> + <param label="Use advanced output options" name="selection_mode" type="select"> + <option selected="true" value="defaults">Show merged output file only</option> + <option value="advanced">Show intermediate output files</option> + </param> + <when value="defaults"/> + <when value="advanced"> + <param name="full_alignment_check" type="boolean" label="Show full alignment file"/> + <param name="pileup_check" type="boolean" label="Show pileup file"/> + <param name="phased_bam_check" type="boolean" label="Show itermediate phased BAM file"/> + <param type="boolean" name="gvcf" truevalue="--gvcf" falsevalue="" label="Enable GVCF output, default: disable" /> + </when> + </conditional> + <section name="adv" title="Advanced Parameters" expanded="false"> + <param type="integer" name="qual" value="0" min="0" label="If set, variants with >qual will be marked PASS, or LowQual otherwise." /> + <param type="float" name="snp_min_af" value="0.08" min="0" max="1" label="Minimum SNP AF required for a candidate variant. Lowering the value might increase a bit of sensitivity in trade of speed and accuracy, default: ont:0.08,hifi:0.08,ilmn:0.08." /> + <param type="float" name="indel_min_af" value="0.15" min="0" max="1" label="Minimum INDEL AF required for a candidate variant. Lowering the value might increase a bit of sensitivity in trade of speed and accuracy, default: ont:0.15,hifi:0.08,ilmn:0.08." /> + <param type="boolean" name="enable_phasing" truevalue="--enable_phasing" falsevalue="" label="Output phased variants using whatshap, default: disable" /> + <param type="boolean" name="no_phasing_for_fa" truevalue="--no_phasing_for_fa" falsevalue="" label="EXPERIMENTAL: Call variants without whatshap phasing in full alignment calling, default: disable." /> + <param type="boolean" name="print_ref_calls" truevalue="--print_ref_calls" falsevalue="" label="Show reference calls (0/0) in vcf file, default: disable." /> + <param type="select" name="ploidity_model" label="Call with the following ploidy model" help="EXPERIMENTAL: Enable haploid calling mode. Only 1/1 is considered as a variant, default: disable. EXPERIMENTAL: Enable haploid calling mode. 0/1 and 1/1 are considered as a variant, default: disable."> + <option value="" selected="true">diploid</option> + <option value="--haploid_sensitive">haploid (sensitive)</option> + <option value="--haploid_precise">haploid (precise)</option> + </param> + <param type="integer" name="chunk_size" value="5000000" min="1" label="The size of each chuck for parallel processing, default: 5Mbp." optional="true" /> + </section> + </inputs> + <outputs> + <data name="merge_output" format="vcf_bgzip" from_work_dir="./merge_output.vcf.gz" /> + <data name="pileup" format="vcf_bgzip" from_work_dir="./pileup.vcf.gz"> + <filter>output_options['selection_mode'] == 'advanced' and output_options['pileup_check']</filter> + </data> + <data name="full_alignment" format="vcf_bgzip" from_work_dir="./full_alignment.vcf.gz"> + <filter>output_options['selection_mode'] == 'advanced' and output_options['full_alignment_check']</filter> + </data> + <data name="phased_bam" format="bam" from_work_dir="./phased_bam.bam"> + <filter>output_options['selection_mode'] == 'advanced' and output_options['phased_bam_check']</filter> + </data> + </outputs> + <tests> + <test expect_num_outputs="1"> + <conditional name="model_source"> + <param name="source" value="built-in"/> + <param name="select_built_in" value="r941_prom_hac_g360+g422"/> + </conditional> + <param name="bam_input" value="test1.bam" /> + <conditional name="ref_source"> + <param name="source" value="history" /> + <param name="ref_fasta" value="test1.fasta" /> + </conditional> + <conditional name="bed_or_vcf"> + <param name="bed_or_vcf_selector" value="vcf"/> + <param name="vcf_fn" value="test1.vcf.gz" /> + </conditional> + <conditional name="output_options"> + <param name="selection_mode" value="advanced"/> + <param name="gvcf" value="true" /> + </conditional> + <section name="adv"> + <param name="no_phasing_for_fa" value="true"/> + <param name="print_ref_calls" value="true"/> + <param name="ploidity_model" value=""/> + </section> + <assert_stdout> + <has_text text="[WARNING] No contig intersection found, output header only in" /> + </assert_stdout> + </test> + <test expect_num_outputs="4"> + <conditional name="model_source"> + <param name="source" value="builtin" /> + <param name="select_built_in" value="r941_prom_hac_g360+g422" /> + </conditional> + <param name="bam_input" value="test1.bam" /> + <conditional name="bed_or_vcf"> + <param name="bed_or_vcf_selector" value="unrestricted"/> + <param name="include_all_ctgs" value="true" /> + </conditional> + <conditional name="ref_source"> + <param name="source" value="builtin" /> + <param name="ref_fasta_builtin" value="test1" /> + </conditional> + <conditional name="output_options"> + <param name="selection_mode" value="advanced"/> + <param name="pileup_check" value="true"/> + <param name="full_alignment_check" value="true"/> + <param name="phased_bam_check" value="true"/> + </conditional> + <section name="adv"> + <param name="print_ref_calls" value="true"/> + </section> + <output name="merge_output" decompress="true" file="merge_output_1.vcf" ftype="vcf_bgzip"/> + <output name="pileup" decompress="true" file="pileup_1.vcf" ftype="vcf_bgzip"/> + <output name="full_alignment" decompress="true" file="full_alignment_1.vcf" ftype="vcf_bgzip"/> + <output name="phased_bam" file="phased_bam_1.bam" ftype="bam"/> + </test> + <test expect_num_outputs="4"> + <conditional name="model_source"> + <param name="source" value="datatable" /> + <param name="model" value="test_model" /> + </conditional> + <param name="bam_input" value="test1.bam" /> + <conditional name="bed_or_vcf"> + <param name="bed_or_vcf_selector" value="bed"/> + <param name="bed_fn" value="test1.bed" /> + </conditional> + <conditional name="ref_source"> + <param name="source" value="builtin" /> + <param name="ref_fasta_builtin" value="test1" /> + </conditional> + <conditional name="output_options"> + <param name="selection_mode" value="advanced"/> + <param name="pileup_check" value="true"/> + <param name="full_alignment_check" value="true"/> + <param name="phased_bam_check" value="true"/> + </conditional> + <section name="adv"> + <param name="snp_min_af" value="0.5"/> + <param name="indel_min_af" value="0.12"/> + <param name="no_phasing_for_fa" value="true" /> + <param name="print_ref_calls" value="true"/> + </section> + <output name="merge_output" ftype="vcf_bgzip"> + <assert_contents> + <has_size value="450" delta="50" /> + </assert_contents> + </output> + <output name="pileup" ftype="vcf_bgzip"> + <assert_contents> + <has_size value="0" /> + </assert_contents> + </output> + <output name="full_alignment" ftype="vcf_bgzip"> + <assert_contents> + <has_size value="0" /> + </assert_contents> + </output> + <output name="phased_bam" ftype="bam"> + <assert_contents> + <has_size value="0" /> + </assert_contents> + </output> + </test> + </tests> + <help><![CDATA[ + Clair3 is a germline small variant caller for long-reads. Clair3 makes the best of two major method categories: + pileup calling handles most variant candidates with speed, and full-alignment tackles complicated candidates to maximize precision and recall. + Clair3 runs fast and has superior performance, especially at lower coverage. Clair3 is simple and modular for easy deployment and integration. + + https://github.com/HKU-BAL/Clair3 + + LICENSE: + + Copyright 2021 The University of Hong Kong, Department of Computer Science + + Redistribution and use in source and binary forms, with or without modification, + are permitted provided that the following conditions are met: + + 1. Redistributions of source code must retain the above copyright notice, this + list of conditions and the following disclaimer. + + 2. Redistributions in binary form must reproduce the above copyright notice, + this list of conditions and the following disclaimer in the documentation + and/or other materials provided with the distribution. + + 3. Neither the name of the copyright holder nor the names of its contributors + may be used to endorse or promote products derived from this software without + specific prior written permission. + + THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND + ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED + WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE + DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE LIABLE FOR + ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES + (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; + LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON + ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT + (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS + SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. + ]]></help> + <citations> + <citation type="doi">10.1101/2021.12.29.474431</citation> + </citations> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/all_fasta.loc Wed Jun 15 09:45:05 2022 +0000 @@ -0,0 +1,10 @@ +#This file lists the locations and dbkeys of all the fasta files +#under the "genome" directory (a directory that contains a directory +#for each build). The script extract_fasta.py will generate the file +#all_fasta.loc. This file has the format (white space characters are +#TAB characters): +# +#<unique_build_id> <display_name> <file_path> +# +#So, all_fasta.loc could look something like this: +test1 "Test Genome" ${__HERE__}/test1.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/clair3_models.loc Wed Jun 15 09:45:05 2022 +0000 @@ -0,0 +1,10 @@ +#Enter the model names in the second column, the platform name in the second and the path in the third. +#This file lists the locations and dbkeys of all the model files +#under the "models" directory (a directory that contains a directory +#for each build). This file has the format (white space characters are +#TAB characters): +# +#<unique_build_id> <display_name> <platform> <file_path> +# +#So, all_model.loc could look something like this: +test_model "the_model_name" ont $(dirname $(which run_clair3.sh))/models/r941_prom_hac_g360+g422
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test1.bed Wed Jun 15 09:45:05 2022 +0000 @@ -0,0 +1,3 @@ +chr1 14756 15038 JUNC00000001 294 - 14756 15038 255,0,0 2 73,69 0,213 +chr1 14969 15836 JUNC00000002 144 - 14969 15836 255,0,0 2 69,41 0,826 +chr1 15905 16677 JUNC00000003 12 - 15905 16677 255,0,0 2 42,71 0,701
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test1.fasta Wed Jun 15 09:45:05 2022 +0000 @@ -0,0 +1,85 @@ +>demo20 +TGCCTGCTTTGTGCCAGGTTCTGGGTTGGGAGGTGCTGGGGACAGGGAGATGAGTCAGAC +CTgggaagatttcgtagaggaggtgacagtaagctggaacctgtgtaatgagcaggagtt +gcccagtggagaaggggaaggtgttccaggcggaagaaacagcatatgcaaaggccccaa +ggtaggaagggccctagtgtgtgcagaggacagggcatggggaggggaactaaggctgag +gccaaggagaggaaatgactcacaccgtgagagaggagttgagaccagggaggCTGCTTG +CTGTATGATGCAACTGAGAGGGTAGAACAAGGCTGGCACAGAGAAGGTGGGGAAGGAAAA +GGAGAGACGAAGCTGAGATTTCAGCAGGGCCAAGTCAGCCGTGAGTGCCAGGCTGCGGAG +CCCAGATTCTCTGGGCTGagaaagagcactctgtccagagtgtggaggggggcctggagg +ggatgagactcaaagctgggaggccagagaggaggctgctagagttttctgggagagagt +tactggggcctgaacTCCAGTGAGGCActtcccatttcacagaccaggaaactgaggccc +aagagtgaggcaactggcccaagggcacacagccaggtaaggcagaacCTTCCTTCTTTG +GAGCTCCCTTGGGTGGGAAGCTGTGGGCTCCCCTTCATAGCCCACCCTTTTGGCTGTATC +TCCCTGCTGCCCTGGGCATATGCTCCCTTATTCTGTCCTCCCTTGAAGCTGACTGCTGGC +CTTAAAGGGCCCCTGTTTCTTCCCTCTGGACTACATGAGATCGGGATAGTATTAATGACT +AAAACCTACCAGGGGTTTCTAGGCCTGGCCTGGAAAAAGTGACTGTTGACAAACAAAGTG +CAGAGATTTAAAATCTCCTCTGTCTCAATTAGTGGAATCCAGTTAGAGGTTTGAACTATG +ATTCTACCAGAATCCAATCTCTCTGGGTAGCCAGGTACCCAGGATGGGGCTAAAATTCCA +GATGGATAGGTTGTCAACACCAGTGAGGAACCAGGAGGCTACCACAGGGTGGGACTTCCT +GGTTTGGCTTTACATCTGAACTTCAGGGATCCCAGATCCTGGATCTGGGGCACTTGTCCA +GAGAAGGCTATTGCTCTCATGTCACAAATGAGATGACTAAGACCCCCAAATCAATTCCAG +TTCACTCACAAGCATTTCCTGGGCAGTGGAGACCCCTGCCCCACCTGTTGGCACCCCCTC +AGCTCCCCACAGGGAATTGGAGTCCAGCCAAGCATGAGGAGGCTGTTGGCCTCAAGGTGA +GCAGGGATGGGCTGAACCTCACCCAGTAAGGCAAGGACAGAGCCAGGGTTGGCCTGAGAT +TTCCAGCCACCCTTTCCAAGGCTCTGCTCACTGTTATTTTCCTTAGTCTacaacaatatc +aataacaataacaacaataatatcaacaCAAAAAGTGAAATACTCACCATGTATTGTAGT +GTTTCCAAGGTGTCATGTAATGCCAGGGGTAGTTTGGGGCCAGGAAAAATATTTTTGGGA +GGCATAAGAATAGGATGGACTGATATTGATATGCAACAGTTTGATCTGGTCCTCCTCTGA +ATATCTGGGCTGGTAATTTGTACCAGTTTCCCTCGCTTTtgtgcataggcactgtgctga +acccttttgtatgcatgaactcatccgattctctgtgcaagaactctatgagattattat +tcccgttttacaagtaagaaaaattgaggctctgagaagttaaataaatgacttgtatga +agttccagtgctaattaataagtgaaggagccagggcttgaactccggcccatctgactg +caaagccagtgcccttcctcctacacATCTTCCTTTGGATTTCCACCACTGAGCATATGT +AAGGTTGGGCAAACAGCCTGCATGAACAATCGCTGCTTTTATATCATGCACAAGTTTGGT +CTTTTCTGCCTGTGCCCATGTCCTTGTAACCTTCTGAACCAAACTCCCCAGTGCCTGGGA +ACATCAGAAGACTTGACTCTCTTCTCCTTTCACTAGCCTCCACCTGACTGGGACAAAGCC +ATGCAGAGAGCTAGTGCTCCCTTCCTGCTAGACTTCAAGGATGCCTGGTTCCTGTGCCCC +ATCTCCATCCAGCCCTCTCTTCTACACCTGGTGACTGAGCCTCTCCTTCAGTTTCTCCAT +CCAGAAGGGGGTGAAAGCAACTGCCTAGTGTCCTTCCCTGGTGATAGTGGAGCACGGGGG +ACAGGGTGTTTGGGCAAAAGGTGCCCAAGGTGAGGTGCCCAACACAACCTCCTACTCAGA +CGATTGAGCAGACATTCAGCCTCATCTGGGGACTGGGTTACCAGTGGGTTAGTGGGAGGC +ATTGGGCCCAGGCCCTGTGCCTTGGGCTGAGCTACAAGAAACCCACACATGGGATGAATT +CAGGCAGCTCAAGGCCAGGTCTGTGCATACGCCAGTAATAGGTTCAGGTTAATCCACATG +TCGCGATTTGGAAGGTGTCTACTTTTCCTACCTGTAGCTTCCTTAGGCCTCAAACCCCTA +CTCAGCTGGGTCTGCCAGACTGAGATGGAGCCAGGGTGGAATCTTCTGCCCTCAAATCCC +TGTCAGCCCTGGTGGTGCCGGGAGCGCCATCACTATTGGGTCTTAAAGGCTTTCCAGCCT +TCCACTATGGATCCAGGAGCAGCAGTAGCCCCTTTGGTCTTTCTCTCTCATCAGGACATC +TCCACTCATGGTTCCAGTCAGAGCTTCTTGAAAGTAGTCCCACTCTGTTCAAAAGCCTCC +CATGCCCCCTGCTAGCCTCAGGCTAAGAGCCCTTCTCCTTCGCACAGCCTTTGGACCTGT +CTATTTTTATGGTCTGGAAACTTCAGGAACACTGATAGCTGAGCATCTGGCACATATTAT +GCACTCAAAAACCATGTATTTCTTTCTCCTTCCCTTTGGGACCCGTAAACCAGGGactgg +acatttttgcaagagacaggagctgtgactgtgcattcactgctgtatccccagcaccca +gcactgggcctgccacacagtaagtgcttagtaaatgtttgttgactgagtgaTTGCAGC +TGGGGCCAAGAATGCCTTGGACACCCCAAGTAGGCCGTGTTAGAAGGAGTCAGTGAGAGC +CTGGGAGCCCAGCCCAGAATTGTTTTCTTGACCCAGAAGCCAGGGCCAGGGATGCCTCTT +CACTTCTGTTTGGCCCTCTTGGGCTTAGGGGCAGGGGCATTAAGATGAgagaggtccttg +gggtgcattgagtctaacctcccagttcctcccattctacagccaggaaaactgaggccc +agggaggggtaggacaagcccaagAAAGTGGGGCTGGAGAATGAATCCTGGAGACCAAAC +TTGTCAGTCTGGATTGCTGTTGCCCTCATCCTCGCCTCCAAAACCCatgggtaaactgag +gccaagagaggggcaggggcatgcccaaggtcacccatggaatcaggggacagggcctgg +attgggattgttgttgacgccattattactgtttattgttgtttctatttcacAGATGGT +CGGGGAGGGTGGGGCCCGCAATGGCTCCCAGGCGCCCAGAGACCCTGGAGGGTGAGCAGG +GTCTCCCCTCCCCTCTCCTGCCCGTCTTTAGCCACACTGGGGCGCACACCGCTCACTCAC +CCGGGGCCGAGGCGTTAGCCCTTTCTTGCACCAGGTGCCGCAACAACACCAGCAGCTGGC +GCAGGCTGTGCTGCTGGTCCTGCAGGAGGCTGGAGTTGTGCCTGACACCGCGCAGGCCGC +GCTCGATGTTGGTGAGGGCGGCGCTCTGGCGGCTCAGCGTGTTCAGCAGCTTCGCCTTCT +TGCTGAGGATGCTGGCCAGCTCCTCCTGCTGCTTGGTCTCCAGGGCCTGCAACCGCTTCT +CGAGCGCGCTGCGGGGTAGGGGGCGCACAGAGGTGAGCCTGGCATCCTCGCGAAGCACGC +ACCCCCGCGCGCCTCCCCGGCCCTGGAGTCCCTGCAGCCCGACGATGAGACTCAAGTGTG +GTGGAACGTCCTGTGCCCACTGTAGGCACAGATTGAGGAGGGGAGAAAAGAGATACCCGG +CCCTGGAGTAATATAGATTGAGGTTTAGTGGAAGAAAGAGGTGGTGTGGGAGGGACACCA +GCAACTGGGTAGCTATTATCAAATCCCAACTGTGCTTGCTTTTTGACCCAGCAGTCTACT +CTCAGGAGTTATCCTCTAGGGAGCATGGTCAAGAATGGCCCTGGGGACTTGCTTGTAATA +GAAAAACAAACTAACCAACCAACCAAAAAAGATATAGCCTAGATGCCCAAAAGCCAGGAC +TGGCTGAATCCGTTGCGTTTTGGCGTCCCTGGAAATGTTCCGCAGTCATGAAGGAGGAGG +CATTTGCACAGAATTGGAAAGATGCCCAGGACTTGGGGCACATCAAGCCTAACCCCATGT +GTGGCAAGAGAAGAAAGAAAGTATTAATGTAAATAAAGAGAAATGGGGTGAACATATAGG +AGAAGGCTGGAAAGACCGCAGTGGTGCCTGTGTTTGGGAAGAATATGAAAGAAATTCCCT +CAAGTGCTGTGACTTCTGCAGAGCAGGTTTGAGTGGATGAAGATGGAGAGGAGGAAGATG +GGGGCAGGATGGAGGGCCCAACTTTCACTTTTATTTTGTACAGGTTCCTGTTGTCCGATG +ATATTATAATAATCAAGAGACATTTTTTGTAATGGATTTAGAAGCAAAGAGGAGTTTTTC +AAAAGAAAGCCTTAGACTCAGCTCTTTCTTTTTGGACATTTTATCCTCCAGATTTACTca +catgtgtgtgaaatgagatatggaaatgttactcatcgtatcactggttggattagtaaa +aggctggaagcaacctcaatatccattaactggggactggaggaataaaagcagggacca +catatggtggagcattataa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/all_fasta.loc.sample Wed Jun 15 09:45:05 2022 +0000 @@ -0,0 +1,10 @@ +#This file lists the locations and dbkeys of all the fasta files +#under the "genome" directory (a directory that contains a directory +#for each build). The script extract_fasta.py will generate the file +#all_fasta.loc. This file has the format (white space characters are +#TAB characters): +# +#<unique_build_id> <display_name> <file_path> +# +#So, all_fasta.loc could look something like this: +#test1 Test-Genome ./test-data/test1.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/model.loc.sample Wed Jun 15 09:45:05 2022 +0000 @@ -0,0 +1,10 @@ +#Enter the model names in the second column, the platform name in the second and the path in the third. +#This file lists the locations and dbkeys of all the model files +#under the "models" directory (a directory that contains a directory +#for each build). This file has the format (white space characters are +#TAB characters): +# +#<unique_build_id> <display_name> <platform> <file_path> +# +#So, all_model.loc could look something like this: +#test_model "the_model_name" r941_prom_hac_g360+g422 $(dirname $(which run_clair3.sh))/models/r941_prom_hac_g360+g422
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.sample Wed Jun 15 09:45:05 2022 +0000 @@ -0,0 +1,12 @@ +<?xml version="1.0"?> +<tables> + <!-- Locations of indexes in the Bowtie mapper format --> + <table name="model" comment_char="#"> + <columns>value, name, platform, path</columns> + <file path="tool-data/model.loc" /> + </table> + <table name="all_fasta" comment_char="#"> + <columns>value, name, path</columns> + <file path="tool-data/all_fasta.loc" /> + </table> +</tables>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.test Wed Jun 15 09:45:05 2022 +0000 @@ -0,0 +1,13 @@ +<?xml version="1.0"?> +<tables> + <!-- Locations of model folders --> + <table name="clair3_models" comment_char="#"> + <columns>value, name, platform, path</columns> + <file path="${__HERE__}/test-data/clair3_models.loc" /> + </table> + <!-- Locations of reference genome files in fasta format --> + <table name="all_fasta" comment_char="#"> + <columns>value, name, path</columns> + <file path="${__HERE__}/test-data/all_fasta.loc" /> + </table> +</tables>