changeset 3:2bb86e2c417f draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/gffcompare commit c8a752199588db982182cbe7fffbcb8512313526
author iuc
date Mon, 27 May 2019 13:54:15 -0400 (2019-05-27)
parents f99d7825a501
children 0f710191a66d
files gffcompare.xml test-data/fasta_indexes.loc test-data/gene_sets.loc test-data/gffcompare_in1.gtf test-data/gffcompare_in2.gtf test-data/gffcompare_in3.gtf test-data/gffcompare_out1-1.refmap test-data/gffcompare_out1-1.tmap test-data/gffcompare_out1-2.refmap test-data/gffcompare_out1-2.tmap test-data/gffcompare_out1.gtf test-data/gffcompare_out1.loci test-data/gffcompare_out1.stats test-data/gffcompare_out1.tracking test-data/gffcompare_out2-1.refmap test-data/gffcompare_out2-1.tmap test-data/gffcompare_out2-2.refmap test-data/gffcompare_out2-2.tmap test-data/gffcompare_out2.gtf test-data/gffcompare_out2.loci test-data/gffcompare_out2.stats test-data/gffcompare_out2.tracking test-data/gffcompare_out3.gtf test-data/gffcompare_out3.loci test-data/gffcompare_out3.stats test-data/gffcompare_out3.tracking test-data/sequence.fa tool-data/gene_sets.loc.sample tool_data_table_conf.xml.sample tool_data_table_conf.xml.test
diffstat 30 files changed, 859 insertions(+), 1144 deletions(-) [+]
line wrap: on
line diff
--- a/gffcompare.xml	Tue Feb 05 15:51:44 2019 -0500
+++ b/gffcompare.xml	Mon May 27 13:54:15 2019 -0400
@@ -1,11 +1,15 @@
-<tool id="gffcompare" name="GffCompare" version="0.10.6">
+<tool id="gffcompare" name="GffCompare" version="@GFFCOMPARE_VERSION@">
     <description>compare assembled transcripts to a reference annotation</description>
-    <requirements>
-        <requirement type="package" version="0.10.6">gffcompare</requirement>
+    <macros>
+        <token name="@GFFCOMPARE_VERSION@">0.11.2</token>
+    </macros>
+	<requirements>
+        <requirement type="package" version="@GFFCOMPARE_VERSION@">gffcompare</requirement>
     </requirements>
     <version_command>gffcompare -v | awk '{print $2}'</version_command>
     <command detect_errors="aggressive"><![CDATA[
 #import re
+
 #set escaped_element_identifiers = [re.sub('[^\w\-]', '_', str(_.element_identifier)) for _ in $gffinputs]
 #for $input, $escaped_element_identifier in zip($gffinputs, $escaped_element_identifiers):
     ln -s '$input' '$escaped_element_identifier' &&
@@ -18,15 +22,24 @@
     #end if
 #end if
 
+#if $annotation.use_ref_annotation == "Yes":
+    #if $annotation.ref_source.ref_source_sel == "history":
+        ln -s '$annotation.ref_source.reference_annotation' ref_annotation &&
+    #else
+        ln -s '$annotation.ref_source.index.fields.path' ref_annotation &&
+    #end if
+#end if
+
 gffcompare
 ## Use annotation reference?
 #if $annotation.use_ref_annotation == "Yes":
-    -r '$annotation.reference_annotation'
+    -r ref_annotation
     $annotation.ignore_nonoverlapping_reference
     $annotation.ignore_nonoverlapping_transfrags
-    #if not $annotation.refmap_tmap:
-        -T
-    #end if
+    $annotation.strict_match
+#end if
+#if $annotation.refmap_tmap == "":
+    -T
 #end if
 
 ## Use sequence data?
@@ -35,8 +48,10 @@
 #end if
 
 $discard_single_exon
+$discard_duplicates
 -e $max_dist_exon
 -d $max_dist_group
+$chr_stats
 -p '$adv_output.p'
 $adv_output.A
 $adv_output.C
@@ -56,26 +71,46 @@
                 <option value="Yes">Yes</option>
             </param>
             <when value="Yes">
-                <param argument="-r" format="gff3,gtf" help="Requires an annotation file in GFF3 or GTF format." label="Reference Annotation" name="reference_annotation" type="data" />
+                <conditional name="ref_source">
+                    <param label="Choose the source for the reference annotation" name="ref_source_sel" type="select">
+                        <option value="cached">Locally cached</option>
+                        <option value="history">History</option>
+                    </param>
+                    <when value="cached">
+                        <param argument="-r" label="Using reference annotation" name="index" type="select">
+                            <options from_data_table="gene_sets">
+                                <filter column="1" key="dbkey" ref="gffinputs" type="data_meta" />
+                            </options>
+                            <validator message="No reference annotation is available for the build associated with the selected input dataset" type="no_options" />
+                        </param>
+                    </when>
+                    <when value="history">
+                        <param argument="-r" format="gff3,gtf" help="Requires an annotation file in GFF3 or GTF format." label="Reference Annotation" name="reference_annotation" type="data" />
+                    </when>
+                </conditional>
                 <param argument="-R" falsevalue="" help="consider only the reference transcripts that overlap any of the input transfrags (Sn correction)" label="Ignore reference transcripts that are not overlapped by any input transfrags" name="ignore_nonoverlapping_reference" truevalue="-R" type="boolean" />
                 <param argument="-Q" falsevalue="" help="consider only the input transcripts that overlap any of the reference transcripts (Sp correction). Warning: this will discard all 'novel' loci!" label="Ignore input transcripts that are not overlapped by any reference transcripts" name="ignore_nonoverlapping_transfrags" truevalue="-Q" type="boolean" />
-                <param argument="-T" name="refmap_tmap" label="Generate tmap and refmap files for each input file" type="select" multiple="True">
+                <param argument="--strict-match" name="strict_match" type="boolean" checked="false" truevalue="--strict-match" falsevalue=""  label="the match code '=' is only assigned when all exon boundaries match" help="code '~' is assigned for intron chain match or single-exon" />
+                <param argument="-T" name="refmap_tmap" label="Generate tmap or refmap file for each input file" type="select" multiple="True">
                     <option value="refmap" selected="True">refmap</option>
                     <option value="tmap" selected="True">tmap</option>
                 </param>
             </when>
             <when value="No">
+                <param argument="-T" name="refmap_tmap" label="Generate tmap file for each input file" type="select" multiple="True">
+                    <option value="tmap" selected="True">tmap</option>
+                </param>
             </when>
         </conditional>
         <conditional name="seq_data">
             <param help="Use sequence data for some optional classification functions, including the addition of the p_id attribute required by Cuffdiff." label="Use Sequence Data" name="use_seq_data" type="select">
+                <option value="No">No</option>
                 <option value="Yes">Yes</option>
-                <option value="No">No</option>
             </param>
             <when value="No"/>
             <when value="Yes">
                 <conditional name="seq_source">
-                    <param label="Choose the source for the reference list" name="index_source" type="select">
+                    <param label="Choose the source for the reference sequence" name="index_source" type="select">
                         <option value="cached">Locally cached</option>
                         <option value="history">History</option>
                     </param>
@@ -83,8 +118,8 @@
                         <param argument="-s" label="Using reference genome" name="index" type="select">
                             <options from_data_table="fasta_indexes">
                                 <filter column="1" key="dbkey" ref="gffinputs" type="data_meta" />
-                                <validator message="No reference genome is available for the build associated with the selected input dataset" type="no_options" />
                             </options>
+                            <validator message="No reference genome is available for the build associated with the selected input dataset" type="no_options" />
                         </param>
                     </when>
                     <when value="history">
@@ -93,19 +128,26 @@
                 </conditional>
             </when>
         </conditional>
-        <param argument="-M/-N" label="discard (ignore) single-exon transcripts" name="discard_single_exon" type="select">
+        <param name="discard_single_exon" argument="-M/-N" type="select" label="Discard single-exon transcripts" help="If -S and also --strict-match is given, exact matching of all exon boundaries is required">
             <option selected="True" value="">No</option>
             <option value="-M">Discard single-exon transfrags and reference transcripts</option>
             <option value="-N">Discard single-exon reference transcripts</option>
         </param>
+        <param label="Discard duplicates" name="discard_duplicates" type="select">
+            <option value="">None</option>
+            <option value="-D">discard 'duplicate' query transfrags within a single sample (-D)</option>
+            <option value="-S">Only discard 'duplicate' query or reference transcripts if their boundaries are fully contained within other, larger or identical transfrags (-S)</option>
+        </param>
+        <param name="no_merge" argument="--no-merge" type="boolean" checked="false" truevalue="--no-merge" falsevalue=""  label="Disable close-exon merging" help="Default: merge exons separated by 'introns' shorter than 5 bases" />
         <param argument="-e" help="max. distance (range) allowed from free ends of terminal exons of reference transcripts when assessing exon accuracy. Default: 100" label="Max. Distance for assessing exon accuracy" name="max_dist_exon" type="integer" value="100" />
         <param argument="-d" help="max. distance (range) for grouping transcript start sites. Default: 100" label="Max distance for transcript grouping" name="max_dist_group" type="integer" value="100" />
-        <section name="adv_output" title="Options for the annotated/combined GTF output file">
+        <param name="chr_stats" argument="--chr-stats" type="boolean" checked="false" truevalue="--chr-stats" falsevalue="" label="Show summary and accuracy data separately for each reference sequence in the transcript accuracy data set" />
+        <section name="adv_output" title="Options for the combined GTF output file">
             <param argument="-p"  type="text" value="TCONS" label="name prefix for consensus transcripts" help="for combined.gtf (default: 'TCONS')" />
-            <param argument="-C"  type="boolean" checked="false" truevalue="-C" falsevalue=""  label="discard the 'contained' transfrags" help="i.e. collapse intron-redundant transfrags across all query files" />
+            <param argument="-C"  type="boolean" checked="false" truevalue="-C" falsevalue=""  label="discard matching and 'contained' transfrags" help="i.e. collapse intron-redundant transfrags across all query files" />
             <param argument="-A"  type="boolean" checked="false" truevalue="-A" falsevalue=""  label="discard the 'contained' transfrags except intron-redundant transfrags starting with a different 5' exon" help="like -C but does not discard intron-redundant transfrags if they start with a different 5' exon" />
             <param argument="-X"  type="boolean" checked="false" truevalue="-X" falsevalue=""  label="discard the 'contained' transfrags also if ends stick out within the container's introns" help="like -C but also discard contained transfrags if transfrag ends stick out within the container's introns" />
-            <param argument="-K"  type="boolean" checked="false" truevalue="-A" falsevalue=""  label="do NOT discard any redundant transfrag matching a reference" help="for -C/-A/-X" />
+            <param argument="-K"  type="boolean" checked="false" truevalue="-K" falsevalue=""  label="do NOT discard any redundant transfrag matching a reference" help="for -C/-A/-X" />
         </section>
     </inputs>
     <outputs>
@@ -113,51 +155,292 @@
         <data format="tabular" from_work_dir="gffcmp.loci" label="${tool.name} on ${on_string}: loci" name="transcripts_loci" />
         <data format="tabular" from_work_dir="gffcmp.tracking" label="${tool.name} on ${on_string}: data ${gffinputs[0].hid} tracking file" name="transcripts_tracking" />
         <data format="gtf" from_work_dir="gffcmp.combined.gtf" label="${tool.name} on ${on_string}: combined transcripts" name="transcripts_combined">
-            <filter>isinstance(gffinputs, list)</filter>
+            <filter>(isinstance(gffinputs, list) and len(gffinputs) > 1) or annotation['use_ref_annotation'] == "No"</filter>
         </data>
         <data format="gtf" from_work_dir="gffcmp.annotated.gtf" label="${tool.name} on ${on_string}: annotated transcripts" name="transcripts_annotated">
-            <filter>not isinstance(gffinputs, list)</filter>
+            <filter>not (isinstance(gffinputs, list) and len(gffinputs) > 1) and annotation['use_ref_annotation'] == "Yes"</filter>
         </data>
         <collection name="refmap_output" type="list" label="${tool.name} on ${on_string}: refmap">
             <discover_datasets pattern="gffcmp\.(?P&lt;designation&gt;.+)\.refmap" ext="tabular" />
-            <filter>annotation['use_ref_annotation'] == 'Yes' and annotation['refmap_tmap'] != None and 'refmap' in annotation['refmap_tmap']</filter>
+            <filter>annotation['refmap_tmap'] != None and 'refmap' in annotation['refmap_tmap']</filter>
         </collection>
         <collection name="tmap_output" type="list" label="${tool.name} on ${on_string}: tmap">
             <discover_datasets pattern="gffcmp\.(?P&lt;designation&gt;.+)\.tmap" ext="tabular" />
-            <filter>annotation['use_ref_annotation'] == 'Yes' and annotation['refmap_tmap'] != None and 'tmap' in annotation['refmap_tmap']</filter>
+            <filter>annotation['refmap_tmap'] != None and 'tmap' in annotation['refmap_tmap']</filter>
         </collection>
     </outputs>
     <tests>
+        <!-- 2 inputs, no reference, default options -->
+        <test expect_num_outputs="5">
+            <param ftype="gtf" name="gffinputs" value="gffcompare_in1.gtf,gffcompare_in2.gtf" />
+            <conditional name="annotation">
+                <param name="use_ref_annotation" value="No" />
+            </conditional>
+            <conditional name="seq_data">
+                <param name="use_seq_data" value="No" />
+            </conditional>
+            <assert_command>
+                <not_has_text text="-R " />
+                <not_has_text text="-Q " />
+                <not_has_text text="--strict-match " />
+                <not_has_text text="-T " />
+                <not_has_text text="-s " />
+                <not_has_text text="-M " />
+                <not_has_text text="-N " />
+                <has_text text="-e 100 " />
+                <has_text text="-d 100 " />
+                <not_has_text text="-D " />
+                <not_has_text text="--no-merge " />
+                <has_text text="-p TCONS " />
+                <not_has_text text="-C " />
+                <not_has_text text="-A " />
+                <not_has_text text="-X " />
+                <not_has_text text="-K " />
+            </assert_command>
+            <output file="gffcompare_out1.stats" name="transcripts_stats" />
+            <output file="gffcompare_out1.loci" name="transcripts_loci" />
+            <output file="gffcompare_out1.tracking" name="transcripts_tracking" />
+            <output file="gffcompare_out1.gtf" name="transcripts_combined" />
+            <output_collection name="tmap_output" type="list" count="2"/>
+        </test>
+        <!-- 2 inputs, no reference, with refsequence, default options (but disable tmap output) -->
+        <test expect_num_outputs="4">
+            <param ftype="gtf" name="gffinputs" value="gffcompare_in1.gtf,gffcompare_in2.gtf" />
+            <conditional name="annotation">
+                <param name="use_ref_annotation" value="No" />
+                <param name="refmap_tmap" value=""/>
+            </conditional>
+            <conditional name="seq_data">
+                <param name="use_seq_data" value="Yes" />
+                <conditional name="seq_source">
+                    <param name="index_source" value="history"/>
+                    <param name="ref_file" ftype="fasta" value="sequence.fa"/>
+                </conditional>
+            </conditional>
+            <assert_command>
+                <not_has_text text="-R " />
+                <not_has_text text="-Q " />
+                <has_text text="-T " />
+                <has_text text="-s " />
+                <not_has_text text="-M " />
+                <not_has_text text="-N " />
+                <has_text text="-e 100 " />
+                <has_text text="-d 100 " />
+                <has_text text="-p TCONS " />
+                <not_has_text text="-C " />
+                <not_has_text text="-A " />
+                <not_has_text text="-X " />
+                <not_has_text text="-K " />
+            </assert_command>
+            <output file="gffcompare_out1.stats" name="transcripts_stats" compare="sim_size" />
+            <output file="gffcompare_out1.loci" name="transcripts_loci" compare="sim_size" />
+            <output file="gffcompare_out1.tracking" name="transcripts_tracking" compare="sim_size" />
+            <output file="gffcompare_out1.gtf" name="transcripts_combined" compare="sim_size" />
+        </test>
+        <!-- 2 inputs, no reference, with cached refsequence, default options (but disable tmap output) -->
+        <test expect_num_outputs="4">
+            <param ftype="gtf" name="gffinputs" value="gffcompare_in1.gtf,gffcompare_in2.gtf" dbkey="hg17" />
+            <conditional name="annotation">
+                <param name="use_ref_annotation" value="No" />
+                <param name="refmap_tmap" value=""/>
+            </conditional>
+            <conditional name="seq_data">
+                <param name="use_seq_data" value="Yes" />
+                <conditional name="seq_source">
+                    <param name="index_source" value="cached"/>
+                    <param name="index" value="test_buildid"/>
+                </conditional>
+            </conditional>
+            <assert_command>
+                <not_has_text text="-R " />
+                <not_has_text text="-Q " />
+                <has_text text="-T " />
+                <has_text text="-s " />
+                <not_has_text text="-M " />
+                <not_has_text text="-N " />
+                <has_text text="-e 100 " />
+                <has_text text="-d 100 " />
+                <has_text text="-p TCONS " />
+                <not_has_text text="-C " />
+                <not_has_text text="-A " />
+                <not_has_text text="-X " />
+                <not_has_text text="-K " />
+            </assert_command>
+            <output file="gffcompare_out1.stats" name="transcripts_stats" compare="sim_size" />
+            <output file="gffcompare_out1.loci" name="transcripts_loci" compare="sim_size" />
+            <output file="gffcompare_out1.tracking" name="transcripts_tracking" compare="sim_size" />
+            <output file="gffcompare_out1.gtf" name="transcripts_combined" compare="sim_size" />
+        </test>
+        <!-- 2 inputs and reference, default options -->
         <test expect_num_outputs="6">
             <param ftype="gtf" name="gffinputs" value="gffcompare_in1.gtf,gffcompare_in2.gtf" />
-            <param name="use_ref_annotation" value="Yes" />
             <conditional name="annotation">
-                <param ftype="gtf" name="reference_annotation" value="gffcompare_in3.gtf" />
-                <param name="ignore_nonoverlapping_reference" value="Yes" />
-                <param name="ignore_nonoverlapping_transfrags" value="No" />
+                <param name="use_ref_annotation" value="Yes" />
+                <conditional name="ref_source">
+                    <param name="ref_source_sel" value="history"/>
+                    <param ftype="gtf" name="reference_annotation" value="gffcompare_in3.gtf" />
+                </conditional>
+            </conditional>
+            <conditional name="seq_data">
+                <param name="use_seq_data" value="No" />
             </conditional>
-            <param name="use_seq_data" value="No" />
-            <param name="discard_single_exon" value="" />
-            <param name="max_dist_exon" value="100" />
-            <param name="max_dist_group" value="100" />
-            <output file="gffcompare_out1.stats" name="transcripts_stats" lines_diff="6" />
-            <output file="gffcompare_out1.loci" name="transcripts_loci" lines_diff="2" />
-            <output file="gffcompare_out1.tracking" name="transcripts_tracking" />
-            <output file="gffcompare_out1.gtf" name="transcripts_combined" />
+            <assert_command>
+                <not_has_text text="-R " />
+                <not_has_text text="-Q " />
+                <not_has_text text="-T " />
+                <not_has_text text="-M " />
+                <not_has_text text="-N " />
+                <has_text text="-e 100 " />
+                <has_text text="-d 100 " />
+                <has_text text="-p TCONS " />
+                <not_has_text text="-C " />
+                <not_has_text text="-A " />
+                <not_has_text text="-X " />
+                <not_has_text text="-K " />
+            </assert_command>
+            <output file="gffcompare_out2.stats" name="transcripts_stats" lines_diff="6" />
+            <output file="gffcompare_out2.loci" name="transcripts_loci" lines_diff="2" />
+            <output file="gffcompare_out2.tracking" name="transcripts_tracking" />
+            <output file="gffcompare_out2.gtf" name="transcripts_combined" />
             <output_collection name="refmap_output" type="list" count="2">
-                <element name="gffcompare_in1_gtf" file="gffcompare_out1-1.refmap" ftype="tabular" />
-                <element name="gffcompare_in2_gtf" file="gffcompare_out1-2.refmap" ftype="tabular" />
+                <element name="gffcompare_in1_gtf" file="gffcompare_out2-1.refmap" ftype="tabular" />
+                <element name="gffcompare_in2_gtf" file="gffcompare_out2-2.refmap" ftype="tabular" />
             </output_collection>
             <output_collection name="tmap_output" type="list" count="2">
-                <element name="gffcompare_in1_gtf" file="gffcompare_out1-1.tmap" ftype="tabular" />
-                <element name="gffcompare_in2_gtf" file="gffcompare_out1-2.tmap" ftype="tabular" />
+                <element name="gffcompare_in1_gtf" file="gffcompare_out2-1.tmap" ftype="tabular" />
+                <element name="gffcompare_in2_gtf" file="gffcompare_out2-2.tmap" ftype="tabular" />
             </output_collection>
         </test>
+        <!-- 2 inputs and reference (cached), non default options, only refmap output -->
+        <test expect_num_outputs="5">
+            <param ftype="gtf" name="gffinputs" value="gffcompare_in1.gtf,gffcompare_in2.gtf" dbkey="hg17" />
+            <conditional name="annotation">
+                <param name="use_ref_annotation" value="Yes" />
+                <conditional name="ref_source">
+                    <param name="ref_source_sel" value="cached"/>
+                    <param name="index" value="test_buildid"/>
+                </conditional>
+                <param name="ignore_nonoverlapping_reference" value="Yes" />
+                <param name="ignore_nonoverlapping_transfrags" value="Yes" />
+                <param name="strict_match" value="--strict-match" />
+                <param name="refmap_tmap" value="refmap" />
+            </conditional>
+            <conditional name="seq_data">
+                <param name="use_seq_data" value="No" />
+            </conditional>
+            <param name="discard_single_exon" value="-M"/>
+            <param name="discard_duplicates" value="-D"/>
+            <param name="no_merge" value="--no-merge" />
+            <param name="max_dist_exon" value="101" />
+            <param name="max_dist_group" value="99" />
+            <param name="chr_stats" value="--chr-stats" />
+            <assert_command>
+                <has_text text="-R " />
+                <has_text text="-Q " />
+                <has_text text="--strict-match " />
+                <not_has_text text="-T " />
+                <has_text text="-M " />
+                <not_has_text text="-N " />
+                <has_text text="-e 101 " />
+                <has_text text="-d 99 " />
+                <has_text text="-D " />
+                <has_text text="--no-merge " />
+                <has_text text="--chr-stats" />
+                <not_has_text text="-p TCONS " />
+                <not_has_text text="-C " />
+                <not_has_text text="-A " />
+                <not_has_text text="-X " />
+                <not_has_text text="-K " />
+            </assert_command>
+            <output file="gffcompare_out2.stats" name="transcripts_stats" compare="sim_size" />
+            <output file="gffcompare_out2.loci" name="transcripts_loci" compare="sim_size" />
+            <output file="gffcompare_out2.tracking" name="transcripts_tracking" compare="sim_size" />
+            <output file="gffcompare_out2.gtf" name="transcripts_combined" compare="sim_size" delta="50000"/>
+            <output_collection name="refmap_output" type="list" count="0"/> <!-- because of -M no refmaps are created -->
+        </test>
+        <!-- 2 inputs and reference, non default advanced options, only tmap output -->
+        <test expect_num_outputs="5">
+            <param ftype="gtf" name="gffinputs" value="gffcompare_in1.gtf,gffcompare_in2.gtf" />
+            <conditional name="annotation">
+                <param name="use_ref_annotation" value="Yes" />
+                <conditional name="ref_source">
+                    <param name="ref_source_sel" value="history"/>
+                    <param ftype="gtf" name="reference_annotation" value="gffcompare_in3.gtf" />
+                </conditional>
+                <param name="refmap_tmap" value="tmap" />
+            </conditional>
+            <conditional name="seq_data">
+                <param name="use_seq_data" value="No" />
+            </conditional>
+            <section name="adv_output">
+                <param name="p" value="OTHER" />
+                <param name="C" value="-C" />
+                <param name="A" value="-A" />
+                <param name="X" value="-X" />
+                <param name="K" value="-K" />
+            </section>
+            <assert_command>
+                <not_has_text text="-R " />
+                <not_has_text text="-Q " />
+                <not_has_text text="-T " />
+                <not_has_text text="-M " />
+                <not_has_text text="-N " />
+                <has_text text="-e 100 " />
+                <has_text text="-d 100 " />
+                <has_text text="-p OTHER " />
+                <has_text text="-C " />
+                <has_text text="-A " />
+                <has_text text="-X " />
+                <has_text text="-K " />
+            </assert_command>
+            <output file="gffcompare_out2.stats" name="transcripts_stats" compare="sim_size" />
+            <output file="gffcompare_out2.loci" name="transcripts_loci" compare="sim_size" />
+            <output file="gffcompare_out2.tracking" name="transcripts_tracking" compare="sim_size" />
+            <output file="gffcompare_out2.gtf" name="transcripts_combined" compare="sim_size" delta="50000"/>
+            <output_collection name="tmap_output" type="list" count="2"/>
+        </test>
+        <!-- 2 inputs and reference, default options, no tmap or refmap output -->
+        <test expect_num_outputs="4">
+            <param ftype="gtf" name="gffinputs" value="gffcompare_in1.gtf,gffcompare_in2.gtf" />
+            <conditional name="annotation">
+                <param name="use_ref_annotation" value="Yes" />
+                <conditional name="ref_source">
+                    <param name="ref_source_sel" value="history"/>
+                    <param ftype="gtf" name="reference_annotation" value="gffcompare_in3.gtf" />
+                </conditional>
+                <param name="refmap_tmap" value="" />
+            </conditional>
+            <conditional name="seq_data">
+                <param name="use_seq_data" value="No" />
+            </conditional>
+            <assert_command>
+                <not_has_text text="-R " />
+                <not_has_text text="-Q " />
+                <has_text text="-T " />
+                <not_has_text text="-M " />
+                <not_has_text text="-N " />
+                <has_text text="-e 100 " />
+                <has_text text="-d 100 " />
+                <has_text text="-p TCONS " />
+                <not_has_text text="-C " />
+                <not_has_text text="-A " />
+                <not_has_text text="-X " />
+                <not_has_text text="-K " />
+            </assert_command>
+            <output file="gffcompare_out2.stats" name="transcripts_stats" lines_diff="6" />
+            <output file="gffcompare_out2.loci" name="transcripts_loci" lines_diff="2" />
+            <output file="gffcompare_out2.tracking" name="transcripts_tracking" />
+            <output file="gffcompare_out2.gtf" name="transcripts_combined" />
+        </test>
+
         <test expect_num_outputs="4">
             <param ftype="gtf" name="gffinputs" value="gffcompare_in4.gtf" />
-            <param name="use_ref_annotation" value="Yes" />
             <conditional name="annotation">
-                <param ftype="gtf" name="reference_annotation" value="gffcompare_in5.gtf" />
+                <param name="use_ref_annotation" value="Yes" />
+                <conditional name="ref_source">
+                    <param name="ref_source_sel" value="history"/>
+                    <param ftype="gtf" name="reference_annotation" value="gffcompare_in5.gtf" />
+                </conditional>
                 <param name="ignore_nonoverlapping_reference" value="Yes" />
                 <param name="ignore_nonoverlapping_transfrags" value="No" />
                 <param name="refmap_tmap" value="" />
@@ -166,10 +449,10 @@
             <param name="discard_single_exon" value="" />
             <param name="max_dist_exon" value="100" />
             <param name="max_dist_group" value="100" />
-            <output file="gffcompare_out2.stats" name="transcripts_stats" lines_diff="6" />
-            <output file="gffcompare_out2.loci" name="transcripts_loci" />
-            <output file="gffcompare_out2.tracking" name="transcripts_tracking" />
-            <output file="gffcompare_out2.gtf" name="transcripts_annotated" />
+            <output file="gffcompare_out3.stats" name="transcripts_stats" lines_diff="6" />
+            <output file="gffcompare_out3.loci" name="transcripts_loci" />
+            <output file="gffcompare_out3.tracking" name="transcripts_tracking" />
+            <output file="gffcompare_out3.gtf" name="transcripts_annotated" />
         </test>
     </tests>
     <help>
@@ -182,6 +465,8 @@
 * classify transcripts from one or multiple GTF/GFF3 files as they relate to reference transcripts provided in a
 annotation file (also in GTF/GFF3 format)
 
+More information can be found here: https://ccb.jhu.edu/software/stringtie/gffcompare.shtml.
+
 The original form of this program is also distributed as part of the Cufflinks suite, under the name "CuffCompare"
 (see manual: http://cole-trapnell-lab.github.io/cufflinks/cuffcompare/). Most of the options and parameters of CuffCompare
 are supported by GffCompare, while new features will likely be added to GffCompare in the future.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fasta_indexes.loc	Mon May 27 13:54:15 2019 -0400
@@ -0,0 +1,30 @@
+#This is a sample file distributed with Galaxy that enables tools
+#to use a directory of Samtools indexed sequences data files.  You will need
+#to create these data files and then create a fasta_indexes.loc file
+#similar to this one (store it in this directory) that points to
+#the directories in which those files are stored. The fasta_indexes.loc
+#file has this format (white space characters are TAB characters):
+#
+# <unique_build_id>	<dbkey>	<display_name>	<file_base_path>
+#
+#So, for example, if you had hg19 Canonical indexed stored in
+#
+# /depot/data2/galaxy/hg19/sam/,
+#
+#then the fasta_indexes.loc entry would look like this:
+#
+#hg19canon	hg19	Human (Homo sapiens): hg19 Canonical	/depot/data2/galaxy/hg19/sam/hg19canon.fa
+#
+#and your /depot/data2/galaxy/hg19/sam/ directory
+#would contain hg19canon.fa and hg19canon.fa.fai files.
+#
+#Your fasta_indexes.loc file should include an entry per line for
+#each index set you have stored.  The file in the path does actually
+#exist, but it should never be directly used. Instead, the name serves
+#as a prefix for the index file.  For example:
+#
+test_buildid	hg17	test_displayname	${__HERE__}/sequence.fa
+#hg18canon	hg18	Human (Homo sapiens): hg18 Canonical	/depot/data2/galaxy/hg18/sam/hg18canon.fa
+#hg18full	hg18	Human (Homo sapiens): hg18 Full	/depot/data2/galaxy/hg18/sam/hg18full.fa
+#hg19canon	hg19	Human (Homo sapiens): hg19 Canonical	/depot/data2/galaxy/hg19/sam/hg19canon.fa
+#hg19full	hg19	Human (Homo sapiens): hg19 Full	/depot/data2/galaxy/hg19/sam/hg19full.fa
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gene_sets.loc	Mon May 27 13:54:15 2019 -0400
@@ -0,0 +1,14 @@
+# This is a sample file distributed with featureCounts that enables it and other# tools to use gene/exon annotations in the GFF/GTF format.
+# 
+# The gene_sets.loc file syntax is:
+#<unique_build_id>	<dbkey>	<display_name>	<path>
+# 
+# Please ensure that the above fields are tab separated.
+# 
+# In case you have TWO or MORE providers PER dbkey, the one mentioned
+# first in the file, should have the "default" priority.
+#
+#Example:
+#
+test_buildid	hg17	test_displayname	${__HERE__}/gffcompare_in3.gtf
+
--- a/test-data/gffcompare_in1.gtf	Tue Feb 05 15:51:44 2019 -0500
+++ b/test-data/gffcompare_in1.gtf	Mon May 27 13:54:15 2019 -0400
@@ -1,100 +1,11 @@
-chr1	Cufflinks	transcript	3111450	3111490	1000	.	.	gene_id "CUFF.1"; transcript_id "CUFF.1.1"; FPKM "20.6079364877"; frac "1.000000"; conf_lo "0.000000"; conf_hi "49.751960"; cov "1.317073";
-chr1	Cufflinks	exon	3111450	3111490	1000	.	.	gene_id "CUFF.1"; transcript_id "CUFF.1.1"; exon_number "1"; FPKM "20.6079364877"; frac "1.000000"; conf_lo "0.000000"; conf_hi "49.751960"; cov "1.317073";
-chr1	Cufflinks	transcript	3111546	3111576	1000	.	.	gene_id "CUFF.3"; transcript_id "CUFF.3.1"; FPKM "27.2556579354"; frac "1.000000"; conf_lo "0.000000"; conf_hi "65.800979"; cov "1.741935";
-chr1	Cufflinks	exon	3111546	3111576	1000	.	.	gene_id "CUFF.3"; transcript_id "CUFF.3.1"; exon_number "1"; FPKM "27.2556579354"; frac "1.000000"; conf_lo "0.000000"; conf_hi "65.800979"; cov "1.741935";
-chr1	Cufflinks	transcript	3200326	3200352	1000	.	.	gene_id "CUFF.5"; transcript_id "CUFF.5.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
-chr1	Cufflinks	exon	3200326	3200352	1000	.	.	gene_id "CUFF.5"; transcript_id "CUFF.5.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
-chr1	Cufflinks	transcript	3200023	3200191	1000	.	.	gene_id "CUFF.7"; transcript_id "CUFF.7.1"; FPKM "9.9991171124"; frac "1.000000"; conf_lo "0.000000"; conf_hi "19.998234"; cov "0.639053";
-chr1	Cufflinks	exon	3200023	3200191	1000	.	.	gene_id "CUFF.7"; transcript_id "CUFF.7.1"; exon_number "1"; FPKM "9.9991171124"; frac "1.000000"; conf_lo "0.000000"; conf_hi "19.998234"; cov "0.639053";
-chr1	Cufflinks	transcript	3201078	3201481	1000	.	.	gene_id "CUFF.9"; transcript_id "CUFF.9.1"; FPKM "17.7768957078"; frac "1.000000"; conf_lo "9.153835"; conf_hi "26.399957"; cov "1.136139";
-chr1	Cufflinks	exon	3201078	3201481	1000	.	.	gene_id "CUFF.9"; transcript_id "CUFF.9.1"; exon_number "1"; FPKM "17.7768957078"; frac "1.000000"; conf_lo "9.153835"; conf_hi "26.399957"; cov "1.136139";
-chr1	Cufflinks	transcript	3201673	3201699	1000	.	.	gene_id "CUFF.11"; transcript_id "CUFF.11.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
-chr1	Cufflinks	exon	3201673	3201699	1000	.	.	gene_id "CUFF.11"; transcript_id "CUFF.11.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
-chr1	Cufflinks	transcript	3204755	3204833	1000	.	.	gene_id "CUFF.13"; transcript_id "CUFF.13.1"; FPKM "10.6952581772"; frac "1.000000"; conf_lo "0.000000"; conf_hi "25.820637"; cov "0.683544";
-chr1	Cufflinks	exon	3204755	3204833	1000	.	.	gene_id "CUFF.13"; transcript_id "CUFF.13.1"; exon_number "1"; FPKM "10.6952581772"; frac "1.000000"; conf_lo "0.000000"; conf_hi "25.820637"; cov "0.683544";
-chr1	Cufflinks	transcript	3212214	3212292	1000	.	.	gene_id "CUFF.15"; transcript_id "CUFF.15.1"; FPKM "10.6952581772"; frac "1.000000"; conf_lo "0.000000"; conf_hi "25.820637"; cov "0.683544";
-chr1	Cufflinks	exon	3212214	3212292	1000	.	.	gene_id "CUFF.15"; transcript_id "CUFF.15.1"; exon_number "1"; FPKM "10.6952581772"; frac "1.000000"; conf_lo "0.000000"; conf_hi "25.820637"; cov "0.683544";
-chr1	Cufflinks	transcript	3213096	3213192	1000	.	.	gene_id "CUFF.17"; transcript_id "CUFF.17.1"; FPKM "8.7105710927"; frac "1.000000"; conf_lo "0.000000"; conf_hi "21.029179"; cov "0.556701";
-chr1	Cufflinks	exon	3213096	3213192	1000	.	.	gene_id "CUFF.17"; transcript_id "CUFF.17.1"; exon_number "1"; FPKM "8.7105710927"; frac "1.000000"; conf_lo "0.000000"; conf_hi "21.029179"; cov "0.556701";
-chr1	Cufflinks	transcript	3212368	3212439	1000	.	.	gene_id "CUFF.19"; transcript_id "CUFF.19.1"; FPKM "29.3376873610"; frac "1.000000"; conf_lo "3.097262"; conf_hi "55.578113"; cov "1.875000";
-chr1	Cufflinks	exon	3212368	3212439	1000	.	.	gene_id "CUFF.19"; transcript_id "CUFF.19.1"; exon_number "1"; FPKM "29.3376873610"; frac "1.000000"; conf_lo "3.097262"; conf_hi "55.578113"; cov "1.875000";
-chr1	Cufflinks	transcript	3243019	3243079	1000	.	.	gene_id "CUFF.21"; transcript_id "CUFF.21.1"; FPKM "13.8512359999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "33.439842"; cov "0.885246";
-chr1	Cufflinks	exon	3243019	3243079	1000	.	.	gene_id "CUFF.21"; transcript_id "CUFF.21.1"; exon_number "1"; FPKM "13.8512359999"; frac "1.000000"; conf_lo "0.000000"; conf_hi "33.439842"; cov "0.885246";
-chr1	Cufflinks	transcript	3243348	3243401	1000	.	.	gene_id "CUFF.23"; transcript_id "CUFF.23.1"; FPKM "23.4701498888"; frac "1.000000"; conf_lo "0.000000"; conf_hi "50.571145"; cov "1.500000";
-chr1	Cufflinks	exon	3243348	3243401	1000	.	.	gene_id "CUFF.23"; transcript_id "CUFF.23.1"; exon_number "1"; FPKM "23.4701498888"; frac "1.000000"; conf_lo "0.000000"; conf_hi "50.571145"; cov "1.500000";
-chr1	Cufflinks	transcript	3242634	3242923	1000	.	.	gene_id "CUFF.25"; transcript_id "CUFF.25.1"; FPKM "14.5676792413"; frac "1.000000"; conf_lo "5.354270"; conf_hi "23.781089"; cov "0.931034";
-chr1	Cufflinks	exon	3242634	3242923	1000	.	.	gene_id "CUFF.25"; transcript_id "CUFF.25.1"; exon_number "1"; FPKM "14.5676792413"; frac "1.000000"; conf_lo "5.354270"; conf_hi "23.781089"; cov "0.931034";
-chr1	Cufflinks	transcript	3256975	3257011	1000	.	.	gene_id "CUFF.27"; transcript_id "CUFF.27.1"; FPKM "34.2537322701"; frac "1.000000"; conf_lo "0.000000"; conf_hi "73.806535"; cov "2.189189";
-chr1	Cufflinks	exon	3256975	3257011	1000	.	.	gene_id "CUFF.27"; transcript_id "CUFF.27.1"; exon_number "1"; FPKM "34.2537322701"; frac "1.000000"; conf_lo "0.000000"; conf_hi "73.806535"; cov "2.189189";
-chr1	Cufflinks	transcript	3189900	3190041	1000	.	.	gene_id "CUFF.29"; transcript_id "CUFF.29.1"; FPKM "107.1032192108"; frac "1.000000"; conf_lo "71.402146"; conf_hi "142.804292"; cov "6.845070";
-chr1	Cufflinks	exon	3189900	3190041	1000	.	.	gene_id "CUFF.29"; transcript_id "CUFF.29.1"; exon_number "1"; FPKM "107.1032192108"; frac "1.000000"; conf_lo "71.402146"; conf_hi "142.804292"; cov "6.845070";
-chr1	Cufflinks	transcript	3190273	3190303	1000	.	.	gene_id "CUFF.31"; transcript_id "CUFF.31.1"; FPKM "122.6504607091"; frac "1.000000"; conf_lo "40.883487"; conf_hi "204.417435"; cov "7.838710";
-chr1	Cufflinks	exon	3190273	3190303	1000	.	.	gene_id "CUFF.31"; transcript_id "CUFF.31.1"; exon_number "1"; FPKM "122.6504607091"; frac "1.000000"; conf_lo "40.883487"; conf_hi "204.417435"; cov "7.838710";
-chr1	Cufflinks	transcript	3190455	3190481	1000	.	.	gene_id "CUFF.33"; transcript_id "CUFF.33.1"; FPKM "109.5273661476"; frac "1.000000"; conf_lo "26.732460"; conf_hi "192.322273"; cov "7.000000";
-chr1	Cufflinks	exon	3190455	3190481	1000	.	.	gene_id "CUFF.33"; transcript_id "CUFF.33.1"; exon_number "1"; FPKM "109.5273661476"; frac "1.000000"; conf_lo "26.732460"; conf_hi "192.322273"; cov "7.000000";
-chr1	Cufflinks	transcript	3191539	3191669	1000	.	.	gene_id "CUFF.35"; transcript_id "CUFF.35.1"; FPKM "96.7471827476"; frac "1.000000"; conf_lo "61.420107"; conf_hi "132.074259"; cov "6.183206";
-chr1	Cufflinks	exon	3191539	3191669	1000	.	.	gene_id "CUFF.35"; transcript_id "CUFF.35.1"; exon_number "1"; FPKM "96.7471827476"; frac "1.000000"; conf_lo "61.420107"; conf_hi "132.074259"; cov "6.183206";
-chr1	Cufflinks	transcript	3191877	3191945	1000	.	.	gene_id "CUFF.37"; transcript_id "CUFF.37.1"; FPKM "104.0850125502"; frac "1.000000"; conf_lo "53.596365"; conf_hi "154.573660"; cov "6.652174";
-chr1	Cufflinks	exon	3191877	3191945	1000	.	.	gene_id "CUFF.37"; transcript_id "CUFF.37.1"; exon_number "1"; FPKM "104.0850125502"; frac "1.000000"; conf_lo "53.596365"; conf_hi "154.573660"; cov "6.652174";
-chr1	Cufflinks	transcript	3192442	3192494	1000	.	.	gene_id "CUFF.39"; transcript_id "CUFF.39.1"; FPKM "23.9129829055"; frac "1.000000"; conf_lo "0.000000"; conf_hi "51.525317"; cov "1.528302";
-chr1	Cufflinks	exon	3192442	3192494	1000	.	.	gene_id "CUFF.39"; transcript_id "CUFF.39.1"; exon_number "1"; FPKM "23.9129829055"; frac "1.000000"; conf_lo "0.000000"; conf_hi "51.525317"; cov "1.528302";
-chr1	Cufflinks	transcript	3192551	3192629	1000	.	.	gene_id "CUFF.41"; transcript_id "CUFF.41.1"; FPKM "10.6952581772"; frac "1.000000"; conf_lo "0.000000"; conf_hi "25.820637"; cov "0.683544";
-chr1	Cufflinks	exon	3192551	3192629	1000	.	.	gene_id "CUFF.41"; transcript_id "CUFF.41.1"; exon_number "1"; FPKM "10.6952581772"; frac "1.000000"; conf_lo "0.000000"; conf_hi "25.820637"; cov "0.683544";
-chr1	Cufflinks	transcript	3192732	3192811	1000	.	.	gene_id "CUFF.43"; transcript_id "CUFF.43.1"; FPKM "10.5615674500"; frac "1.000000"; conf_lo "0.000000"; conf_hi "25.497879"; cov "0.675000";
-chr1	Cufflinks	exon	3192732	3192811	1000	.	.	gene_id "CUFF.43"; transcript_id "CUFF.43.1"; exon_number "1"; FPKM "10.5615674500"; frac "1.000000"; conf_lo "0.000000"; conf_hi "25.497879"; cov "0.675000";
-chr1	Cufflinks	transcript	3192941	3193042	1000	.	.	gene_id "CUFF.45"; transcript_id "CUFF.45.1"; FPKM "20.7089557842"; frac "1.000000"; conf_lo "2.186303"; conf_hi "39.231609"; cov "1.323529";
-chr1	Cufflinks	exon	3192941	3193042	1000	.	.	gene_id "CUFF.45"; transcript_id "CUFF.45.1"; exon_number "1"; FPKM "20.7089557842"; frac "1.000000"; conf_lo "2.186303"; conf_hi "39.231609"; cov "1.323529";
-chr1	Cufflinks	transcript	3194186	3194226	1000	.	.	gene_id "CUFF.47"; transcript_id "CUFF.47.1"; FPKM "20.6079364877"; frac "1.000000"; conf_lo "0.000000"; conf_hi "49.751960"; cov "1.317073";
-chr1	Cufflinks	exon	3194186	3194226	1000	.	.	gene_id "CUFF.47"; transcript_id "CUFF.47.1"; exon_number "1"; FPKM "20.6079364877"; frac "1.000000"; conf_lo "0.000000"; conf_hi "49.751960"; cov "1.317073";
-chr1	Cufflinks	transcript	3194303	3194329	1000	.	.	gene_id "CUFF.49"; transcript_id "CUFF.49.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
-chr1	Cufflinks	exon	3194303	3194329	1000	.	.	gene_id "CUFF.49"; transcript_id "CUFF.49.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
-chr1	Cufflinks	transcript	3195084	3195110	1000	.	.	gene_id "CUFF.51"; transcript_id "CUFF.51.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
-chr1	Cufflinks	exon	3195084	3195110	1000	.	.	gene_id "CUFF.51"; transcript_id "CUFF.51.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
-chr1	Cufflinks	transcript	3195451	3195477	1000	.	.	gene_id "CUFF.53"; transcript_id "CUFF.53.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
-chr1	Cufflinks	exon	3195451	3195477	1000	.	.	gene_id "CUFF.53"; transcript_id "CUFF.53.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
-chr1	Cufflinks	transcript	3197090	3197116	1000	.	.	gene_id "CUFF.55"; transcript_id "CUFF.55.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
-chr1	Cufflinks	exon	3197090	3197116	1000	.	.	gene_id "CUFF.55"; transcript_id "CUFF.55.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
-chr1	Cufflinks	transcript	3197247	3197273	1000	.	.	gene_id "CUFF.57"; transcript_id "CUFF.57.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
-chr1	Cufflinks	exon	3197247	3197273	1000	.	.	gene_id "CUFF.57"; transcript_id "CUFF.57.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
-chr1	Cufflinks	transcript	3197347	3197373	1000	.	.	gene_id "CUFF.59"; transcript_id "CUFF.59.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
-chr1	Cufflinks	exon	3197347	3197373	1000	.	.	gene_id "CUFF.59"; transcript_id "CUFF.59.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
-chr1	Cufflinks	transcript	3277191	3277218	1000	.	.	gene_id "CUFF.61"; transcript_id "CUFF.61.1"; FPKM "45.2638604998"; frac "1.000000"; conf_lo "0.000000"; conf_hi "97.530065"; cov "2.892857";
-chr1	Cufflinks	exon	3277191	3277218	1000	.	.	gene_id "CUFF.61"; transcript_id "CUFF.61.1"; exon_number "1"; FPKM "45.2638604998"; frac "1.000000"; conf_lo "0.000000"; conf_hi "97.530065"; cov "2.892857";
-chr1	Cufflinks	transcript	3278237	3278263	1000	.	.	gene_id "CUFF.63"; transcript_id "CUFF.63.1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
-chr1	Cufflinks	exon	3278237	3278263	1000	.	.	gene_id "CUFF.63"; transcript_id "CUFF.63.1"; exon_number "1"; FPKM "15.6467665925"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.940300"; cov "1.000000";
-chr1	Cufflinks	transcript	3280687	3280741	1000	.	.	gene_id "CUFF.65"; transcript_id "CUFF.65.1"; FPKM "15.3622799272"; frac "1.000000"; conf_lo "0.000000"; conf_hi "37.087825"; cov "0.981818";
-chr1	Cufflinks	exon	3280687	3280741	1000	.	.	gene_id "CUFF.65"; transcript_id "CUFF.65.1"; exon_number "1"; FPKM "15.3622799272"; frac "1.000000"; conf_lo "0.000000"; conf_hi "37.087825"; cov "0.981818";
-chr1	Cufflinks	transcript	3290489	3290553	1000	.	.	gene_id "CUFF.67"; transcript_id "CUFF.67.1"; FPKM "12.9988522461"; frac "1.000000"; conf_lo "0.000000"; conf_hi "31.382005"; cov "0.830769";
-chr1	Cufflinks	exon	3290489	3290553	1000	.	.	gene_id "CUFF.67"; transcript_id "CUFF.67.1"; exon_number "1"; FPKM "12.9988522461"; frac "1.000000"; conf_lo "0.000000"; conf_hi "31.382005"; cov "0.830769";
-chr1	Cufflinks	transcript	3290940	3291023	1000	.	.	gene_id "CUFF.69"; transcript_id "CUFF.69.1"; FPKM "10.0586356666"; frac "1.000000"; conf_lo "0.000000"; conf_hi "24.283695"; cov "0.642857";
-chr1	Cufflinks	exon	3290940	3291023	1000	.	.	gene_id "CUFF.69"; transcript_id "CUFF.69.1"; exon_number "1"; FPKM "10.0586356666"; frac "1.000000"; conf_lo "0.000000"; conf_hi "24.283695"; cov "0.642857";
-chr1	Cufflinks	transcript	3291089	3291186	1000	.	.	gene_id "CUFF.71"; transcript_id "CUFF.71.1"; FPKM "8.6216877142"; frac "1.000000"; conf_lo "0.000000"; conf_hi "20.814595"; cov "0.551020";
-chr1	Cufflinks	exon	3291089	3291186	1000	.	.	gene_id "CUFF.71"; transcript_id "CUFF.71.1"; exon_number "1"; FPKM "8.6216877142"; frac "1.000000"; conf_lo "0.000000"; conf_hi "20.814595"; cov "0.551020";
-chr1	Cufflinks	transcript	3299610	3299664	1000	.	.	gene_id "CUFF.73"; transcript_id "CUFF.73.1"; FPKM "15.3622799272"; frac "1.000000"; conf_lo "0.000000"; conf_hi "37.087825"; cov "0.981818";
-chr1	Cufflinks	exon	3299610	3299664	1000	.	.	gene_id "CUFF.73"; transcript_id "CUFF.73.1"; exon_number "1"; FPKM "15.3622799272"; frac "1.000000"; conf_lo "0.000000"; conf_hi "37.087825"; cov "0.981818";
-chr1	Cufflinks	transcript	3300052	3300078	1000	.	.	gene_id "CUFF.75"; transcript_id "CUFF.75.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
-chr1	Cufflinks	exon	3300052	3300078	1000	.	.	gene_id "CUFF.75"; transcript_id "CUFF.75.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
-chr1	Cufflinks	transcript	3319000	3319051	1000	.	.	gene_id "CUFF.77"; transcript_id "CUFF.77.1"; FPKM "16.2485653076"; frac "1.000000"; conf_lo "0.000000"; conf_hi "39.227507"; cov "1.038462";
-chr1	Cufflinks	exon	3319000	3319051	1000	.	.	gene_id "CUFF.77"; transcript_id "CUFF.77.1"; exon_number "1"; FPKM "16.2485653076"; frac "1.000000"; conf_lo "0.000000"; conf_hi "39.227507"; cov "1.038462";
-chr1	Cufflinks	transcript	3355888	3355914	1000	.	.	gene_id "CUFF.79"; transcript_id "CUFF.79.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
-chr1	Cufflinks	exon	3355888	3355914	1000	.	.	gene_id "CUFF.79"; transcript_id "CUFF.79.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
-chr1	Cufflinks	transcript	3363215	3363278	1000	.	.	gene_id "CUFF.81"; transcript_id "CUFF.81.1"; FPKM "13.2019593124"; frac "1.000000"; conf_lo "0.000000"; conf_hi "31.872349"; cov "0.843750";
-chr1	Cufflinks	exon	3363215	3363278	1000	.	.	gene_id "CUFF.81"; transcript_id "CUFF.81.1"; exon_number "1"; FPKM "13.2019593124"; frac "1.000000"; conf_lo "0.000000"; conf_hi "31.872349"; cov "0.843750";
-chr1	Cufflinks	transcript	3363754	3363849	1000	.	.	gene_id "CUFF.83"; transcript_id "CUFF.83.1"; FPKM "13.2019593124"; frac "1.000000"; conf_lo "0.000000"; conf_hi "28.446269"; cov "0.843750";
-chr1	Cufflinks	exon	3363754	3363849	1000	.	.	gene_id "CUFF.83"; transcript_id "CUFF.83.1"; exon_number "1"; FPKM "13.2019593124"; frac "1.000000"; conf_lo "0.000000"; conf_hi "28.446269"; cov "0.843750";
-chr1	Cufflinks	transcript	3367136	3367162	1000	.	.	gene_id "CUFF.85"; transcript_id "CUFF.85.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
-chr1	Cufflinks	exon	3367136	3367162	1000	.	.	gene_id "CUFF.85"; transcript_id "CUFF.85.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
-chr1	Cufflinks	transcript	3367334	3367382	1000	.	.	gene_id "CUFF.87"; transcript_id "CUFF.87.1"; FPKM "17.2433754285"; frac "1.000000"; conf_lo "0.000000"; conf_hi "41.629191"; cov "1.102041";
-chr1	Cufflinks	exon	3367334	3367382	1000	.	.	gene_id "CUFF.87"; transcript_id "CUFF.87.1"; exon_number "1"; FPKM "17.2433754285"; frac "1.000000"; conf_lo "0.000000"; conf_hi "41.629191"; cov "1.102041";
-chr1	Cufflinks	transcript	3377212	3377262	1000	.	.	gene_id "CUFF.89"; transcript_id "CUFF.89.1"; FPKM "16.5671646274"; frac "1.000000"; conf_lo "0.000000"; conf_hi "39.996674"; cov "1.058824";
-chr1	Cufflinks	exon	3377212	3377262	1000	.	.	gene_id "CUFF.89"; transcript_id "CUFF.89.1"; exon_number "1"; FPKM "16.5671646274"; frac "1.000000"; conf_lo "0.000000"; conf_hi "39.996674"; cov "1.058824";
-chr1	Cufflinks	transcript	3391326	3391352	1000	.	.	gene_id "CUFF.91"; transcript_id "CUFF.91.1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
-chr1	Cufflinks	exon	3391326	3391352	1000	.	.	gene_id "CUFF.91"; transcript_id "CUFF.91.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
-chr1	Cufflinks	transcript	3435842	3435880	1000	.	.	gene_id "CUFF.93"; transcript_id "CUFF.93.1"; FPKM "21.6647537435"; frac "1.000000"; conf_lo "0.000000"; conf_hi "52.303342"; cov "1.384615";
-chr1	Cufflinks	exon	3435842	3435880	1000	.	.	gene_id "CUFF.93"; transcript_id "CUFF.93.1"; exon_number "1"; FPKM "21.6647537435"; frac "1.000000"; conf_lo "0.000000"; conf_hi "52.303342"; cov "1.384615";
-chr1	Cufflinks	transcript	3447762	3447788	1000	.	.	gene_id "CUFF.95"; transcript_id "CUFF.95.1"; FPKM "46.9402997776"; frac "1.000000"; conf_lo "0.000000"; conf_hi "101.142289"; cov "3.000000";
-chr1	Cufflinks	exon	3447762	3447788	1000	.	.	gene_id "CUFF.95"; transcript_id "CUFF.95.1"; exon_number "1"; FPKM "46.9402997776"; frac "1.000000"; conf_lo "0.000000"; conf_hi "101.142289"; cov "3.000000";
-chr1	Cufflinks	transcript	3450907	3450965	1000	.	.	gene_id "CUFF.97"; transcript_id "CUFF.97.1"; FPKM "21.4811541355"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.285454"; cov "1.372881";
-chr1	Cufflinks	exon	3450907	3450965	1000	.	.	gene_id "CUFF.97"; transcript_id "CUFF.97.1"; exon_number "1"; FPKM "21.4811541355"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.285454"; cov "1.372881";
-chr1	Cufflinks	transcript	3451052	3451109	1000	.	.	gene_id "CUFF.99"; transcript_id "CUFF.99.1"; FPKM "14.5676792413"; frac "1.000000"; conf_lo "0.000000"; conf_hi "35.169489"; cov "0.931034";
-chr1	Cufflinks	exon	3451052	3451109	1000	.	.	gene_id "CUFF.99"; transcript_id "CUFF.99.1"; exon_number "1"; FPKM "14.5676792413"; frac "1.000000"; conf_lo "0.000000"; conf_hi "35.169489"; cov "0.931034";
+chr1	Cufflinks	transcript	5	10	0.000000	-	.	gene_id "CUFF.1"; transcript_id "CUFF.1.1"; FPKM "20.6079364877"; frac "1.000000"; conf_lo "0.000000"; conf_hi "49.751960"; cov "1.317073";
+chr1	Cufflinks	exon	2	10	0.000000	-	.	gene_id "CUFF.1"; transcript_id "CUFF.1.1"; exon_number "1"; FPKM "20.6079364877"; frac "1.000000"; conf_lo "0.000000"; conf_hi "49.751960"; cov "1.317073";
+chr1	Cufflinks	transcript	15	20	0.000000	-	.	gene_id "CUFF.3"; transcript_id "CUFF.3.1"; FPKM "27.2556579354"; frac "1.000000"; conf_lo "0.000000"; conf_hi "65.800979"; cov "1.741935";
+chr1	Cufflinks	exon	22	30	0.000000	-	.	gene_id "CUFF.5"; transcript_id "CUFF.5.1"; exon_number "1"; FPKM "31.2935331850"; frac "1.000000"; conf_lo "0.000000"; conf_hi "75.549272"; cov "2.000000";
+chr1	Cufflinks	transcript	32	37	0.000000	+	.	gene_id "CUFF.7"; transcript_id "CUFF.7.1"; FPKM "9.9991171124"; frac "1.000000"; conf_lo "0.000000"; conf_hi "19.998234"; cov "0.639053";
+chr1	Cufflinks	exon	32	40	0.000000	+	.	gene_id "CUFF.7"; transcript_id "CUFF.7.1"; exon_number "1"; FPKM "9.9991171124"; frac "1.000000"; conf_lo "0.000000"; conf_hi "19.998234"; cov "0.639053";
+chr1	Cufflinks	transcript	42	50	0.000000	+	.	gene_id "CUFF.9"; transcript_id "CUFF.9.1"; FPKM "17.7768957078"; frac "1.000000"; conf_lo "9.153835"; conf_hi "26.399957"; cov "1.136139";
+chr1	Cufflinks	exon	42	50	0.000000	+	.	gene_id "CUFF.9"; transcript_id "CUFF.9.1"; exon_number "1"; FPKM "17.7768957078"; frac "1.000000"; conf_lo "9.153835"; conf_hi "26.399957"; cov "1.136139";
+chr1	Cufflinks	transcript	52	60	0.000000	+	.	gene_id "CUFF.10"; transcript_id "CUFF.10.1"; FPKM "17.7768957078"; frac "1.000000"; conf_lo "9.153835"; conf_hi "26.399957"; cov "1.136139";
+chr1	Cufflinks	exon	52	60	0.000000	+	.	gene_id "CUFF.10"; transcript_id "CUFF.10.1"; exon_number "1"; FPKM "17.7768957078"; frac "1.000000"; conf_lo "9.153835"; conf_hi "26.399957"; cov "1.136139";
+
--- a/test-data/gffcompare_in2.gtf	Tue Feb 05 15:51:44 2019 -0500
+++ b/test-data/gffcompare_in2.gtf	Mon May 27 13:54:15 2019 -0400
@@ -1,100 +1,9 @@
-chr1	Cufflinks	transcript	3174766	3174792	1000	.	.	gene_id "CUFF.1"; transcript_id "CUFF.1.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	exon	3174766	3174792	1000	.	.	gene_id "CUFF.1"; transcript_id "CUFF.1.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	transcript	3187402	3187428	1000	.	.	gene_id "CUFF.3"; transcript_id "CUFF.3.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	exon	3187402	3187428	1000	.	.	gene_id "CUFF.3"; transcript_id "CUFF.3.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	transcript	3188522	3188548	1000	.	.	gene_id "CUFF.5"; transcript_id "CUFF.5.1"; FPKM "21.2266273824"; frac "1.000000"; conf_lo "0.000000"; conf_hi "59.889707"; cov "1.205672";
-chr1	Cufflinks	exon	3188522	3188548	1000	.	.	gene_id "CUFF.5"; transcript_id "CUFF.5.1"; exon_number "1"; FPKM "21.2266273824"; frac "1.000000"; conf_lo "0.000000"; conf_hi "59.889707"; cov "1.205672";
-chr1	Cufflinks	transcript	3190859	3191434	1000	.	.	gene_id "CUFF.7"; transcript_id "CUFF.7.1"; FPKM "29.7095235531"; frac "1.000000"; conf_lo "19.806349"; conf_hi "39.612698"; cov "1.687500";
-chr1	Cufflinks	exon	3190859	3191434	1000	.	.	gene_id "CUFF.7"; transcript_id "CUFF.7.1"; exon_number "1"; FPKM "29.7095235531"; frac "1.000000"; conf_lo "19.806349"; conf_hi "39.612698"; cov "1.687500";
-chr1	Cufflinks	transcript	3191513	3192077	1000	.	.	gene_id "CUFF.9"; transcript_id "CUFF.9.1"; FPKM "34.0729325807"; frac "1.000000"; conf_lo "23.364686"; conf_hi "44.781179"; cov "1.935341";
-chr1	Cufflinks	exon	3191513	3192077	1000	.	.	gene_id "CUFF.9"; transcript_id "CUFF.9.1"; exon_number "1"; FPKM "34.0729325807"; frac "1.000000"; conf_lo "23.364686"; conf_hi "44.781179"; cov "1.935341";
-chr1	Cufflinks	transcript	3189811	3190789	1000	.	.	gene_id "CUFF.11"; transcript_id "CUFF.11.1"; FPKM "32.5317765567"; frac "1.000000"; conf_lo "24.582998"; conf_hi "40.480555"; cov "1.847804";
-chr1	Cufflinks	exon	3189811	3190789	1000	.	.	gene_id "CUFF.11"; transcript_id "CUFF.11.1"; exon_number "1"; FPKM "32.5317765567"; frac "1.000000"; conf_lo "24.582998"; conf_hi "40.480555"; cov "1.847804";
-chr1	Cufflinks	transcript	3192251	3192336	1000	.	.	gene_id "CUFF.13"; transcript_id "CUFF.13.1"; FPKM "16.5820596576"; frac "1.000000"; conf_lo "0.000000"; conf_hi "35.729373"; cov "0.941860";
-chr1	Cufflinks	exon	3192251	3192336	1000	.	.	gene_id "CUFF.13"; transcript_id "CUFF.13.1"; exon_number "1"; FPKM "16.5820596576"; frac "1.000000"; conf_lo "0.000000"; conf_hi "35.729373"; cov "0.941860";
-chr1	Cufflinks	transcript	3192650	3192676	1000	.	.	gene_id "CUFF.15"; transcript_id "CUFF.15.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	exon	3192650	3192676	1000	.	.	gene_id "CUFF.15"; transcript_id "CUFF.15.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	transcript	3194707	3194733	1000	.	.	gene_id "CUFF.17"; transcript_id "CUFF.17.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	exon	3194707	3194733	1000	.	.	gene_id "CUFF.17"; transcript_id "CUFF.17.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	transcript	3197426	3197452	1000	.	.	gene_id "CUFF.19"; transcript_id "CUFF.19.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	exon	3197426	3197452	1000	.	.	gene_id "CUFF.19"; transcript_id "CUFF.19.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	transcript	3200431	3200457	1000	.	.	gene_id "CUFF.21"; transcript_id "CUFF.21.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	exon	3200431	3200457	1000	.	.	gene_id "CUFF.21"; transcript_id "CUFF.21.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	transcript	3200057	3200144	1000	.	.	gene_id "CUFF.23"; transcript_id "CUFF.23.1"; FPKM "16.2051946653"; frac "1.000000"; conf_lo "0.000000"; conf_hi "34.917342"; cov "0.920455";
-chr1	Cufflinks	exon	3200057	3200144	1000	.	.	gene_id "CUFF.23"; transcript_id "CUFF.23.1"; exon_number "1"; FPKM "16.2051946653"; frac "1.000000"; conf_lo "0.000000"; conf_hi "34.917342"; cov "0.920455";
-chr1	Cufflinks	transcript	3201161	3201187	1000	.	.	gene_id "CUFF.25"; transcript_id "CUFF.25.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	exon	3201161	3201187	1000	.	.	gene_id "CUFF.25"; transcript_id "CUFF.25.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	transcript	3201008	3201039	1000	.	.	gene_id "CUFF.26"; transcript_id "CUFF.26.1"; FPKM "29.7095235531"; frac "1.000000"; conf_lo "0.000000"; conf_hi "71.725135"; cov "1.687500";
-chr1	Cufflinks	exon	3201008	3201039	1000	.	.	gene_id "CUFF.26"; transcript_id "CUFF.26.1"; exon_number "1"; FPKM "29.7095235531"; frac "1.000000"; conf_lo "0.000000"; conf_hi "71.725135"; cov "1.687500";
-chr1	Cufflinks	transcript	3201597	3201666	1000	.	.	gene_id "CUFF.29"; transcript_id "CUFF.29.1"; FPKM "13.5814964814"; frac "1.000000"; conf_lo "0.000000"; conf_hi "32.788633"; cov "0.771429";
-chr1	Cufflinks	exon	3201597	3201666	1000	.	.	gene_id "CUFF.29"; transcript_id "CUFF.29.1"; exon_number "1"; FPKM "13.5814964814"; frac "1.000000"; conf_lo "0.000000"; conf_hi "32.788633"; cov "0.771429";
-chr1	Cufflinks	transcript	3201726	3201809	1000	.	.	gene_id "CUFF.31"; transcript_id "CUFF.31.1"; FPKM "22.6358274691"; frac "1.000000"; conf_lo "0.000000"; conf_hi "45.271655"; cov "1.285714";
-chr1	Cufflinks	exon	3201726	3201809	1000	.	.	gene_id "CUFF.31"; transcript_id "CUFF.31.1"; exon_number "1"; FPKM "22.6358274691"; frac "1.000000"; conf_lo "0.000000"; conf_hi "45.271655"; cov "1.285714";
-chr1	Cufflinks	transcript	3211522	3211561	1000	.	.	gene_id "CUFF.33"; transcript_id "CUFF.33.1"; FPKM "23.7676188425"; frac "1.000000"; conf_lo "0.000000"; conf_hi "57.380108"; cov "1.350000";
-chr1	Cufflinks	exon	3211522	3211561	1000	.	.	gene_id "CUFF.33"; transcript_id "CUFF.33.1"; exon_number "1"; FPKM "23.7676188425"; frac "1.000000"; conf_lo "0.000000"; conf_hi "57.380108"; cov "1.350000";
-chr1	Cufflinks	transcript	3212718	3212801	1000	.	.	gene_id "CUFF.35"; transcript_id "CUFF.35.1"; FPKM "11.3179137345"; frac "1.000000"; conf_lo "0.000000"; conf_hi "27.323861"; cov "0.642857";
-chr1	Cufflinks	exon	3212718	3212801	1000	.	.	gene_id "CUFF.35"; transcript_id "CUFF.35.1"; exon_number "1"; FPKM "11.3179137345"; frac "1.000000"; conf_lo "0.000000"; conf_hi "27.323861"; cov "0.642857";
-chr1	Cufflinks	transcript	3213119	3213242	1000	.	.	gene_id "CUFF.37"; transcript_id "CUFF.37.1"; FPKM "11.5004607302"; frac "1.000000"; conf_lo "0.000000"; conf_hi "24.780049"; cov "0.653226";
-chr1	Cufflinks	exon	3213119	3213242	1000	.	.	gene_id "CUFF.37"; transcript_id "CUFF.37.1"; exon_number "1"; FPKM "11.5004607302"; frac "1.000000"; conf_lo "0.000000"; conf_hi "24.780049"; cov "0.653226";
-chr1	Cufflinks	transcript	3240607	3240633	1000	.	.	gene_id "CUFF.39"; transcript_id "CUFF.39.1"; FPKM "52.8169307611"; frac "1.000000"; conf_lo "0.000000"; conf_hi "113.804669"; cov "3.000000";
-chr1	Cufflinks	exon	3240607	3240633	1000	.	.	gene_id "CUFF.39"; transcript_id "CUFF.39.1"; exon_number "1"; FPKM "52.8169307611"; frac "1.000000"; conf_lo "0.000000"; conf_hi "113.804669"; cov "3.000000";
-chr1	Cufflinks	transcript	3242480	3242512	1000	.	.	gene_id "CUFF.41"; transcript_id "CUFF.41.1"; FPKM "43.2138524409"; frac "1.000000"; conf_lo "0.000000"; conf_hi "93.112911"; cov "2.454545";
-chr1	Cufflinks	exon	3242480	3242512	1000	.	.	gene_id "CUFF.41"; transcript_id "CUFF.41.1"; exon_number "1"; FPKM "43.2138524409"; frac "1.000000"; conf_lo "0.000000"; conf_hi "93.112911"; cov "2.454545";
-chr1	Cufflinks	transcript	3242925	3243005	1000	.	.	gene_id "CUFF.43"; transcript_id "CUFF.43.1"; FPKM "23.4741914494"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.948383"; cov "1.333333";
-chr1	Cufflinks	exon	3242925	3243005	1000	.	.	gene_id "CUFF.43"; transcript_id "CUFF.43.1"; exon_number "1"; FPKM "23.4741914494"; frac "1.000000"; conf_lo "0.000000"; conf_hi "46.948383"; cov "1.333333";
-chr1	Cufflinks	transcript	3243109	3243154	1000	.	.	gene_id "CUFF.45"; transcript_id "CUFF.45.1"; FPKM "20.6674946457"; frac "1.000000"; conf_lo "0.000000"; conf_hi "49.895746"; cov "1.173913";
-chr1	Cufflinks	exon	3243109	3243154	1000	.	.	gene_id "CUFF.45"; transcript_id "CUFF.45.1"; exon_number "1"; FPKM "20.6674946457"; frac "1.000000"; conf_lo "0.000000"; conf_hi "49.895746"; cov "1.173913";
-chr1	Cufflinks	transcript	3254080	3254106	1000	.	.	gene_id "CUFF.47"; transcript_id "CUFF.47.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	exon	3254080	3254106	1000	.	.	gene_id "CUFF.47"; transcript_id "CUFF.47.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	transcript	3277156	3277182	1000	.	.	gene_id "CUFF.49"; transcript_id "CUFF.49.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	exon	3277156	3277182	1000	.	.	gene_id "CUFF.49"; transcript_id "CUFF.49.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	transcript	3277914	3278390	1000	.	.	gene_id "CUFF.51"; transcript_id "CUFF.51.1"; FPKM "14.9481879513"; frac "1.000000"; conf_lo "7.228977"; conf_hi "22.667399"; cov "0.849057";
-chr1	Cufflinks	exon	3277914	3278390	1000	.	.	gene_id "CUFF.51"; transcript_id "CUFF.51.1"; exon_number "1"; FPKM "14.9481879513"; frac "1.000000"; conf_lo "7.228977"; conf_hi "22.667399"; cov "0.849057";
-chr1	Cufflinks	transcript	3280118	3280144	1000	.	.	gene_id "CUFF.53"; transcript_id "CUFF.53.1"; FPKM "52.8169307611"; frac "1.000000"; conf_lo "0.000000"; conf_hi "113.804669"; cov "3.000000";
-chr1	Cufflinks	exon	3280118	3280144	1000	.	.	gene_id "CUFF.53"; transcript_id "CUFF.53.1"; exon_number "1"; FPKM "52.8169307611"; frac "1.000000"; conf_lo "0.000000"; conf_hi "113.804669"; cov "3.000000";
-chr1	Cufflinks	transcript	3280499	3280525	1000	.	.	gene_id "CUFF.55"; transcript_id "CUFF.55.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	exon	3280499	3280525	1000	.	.	gene_id "CUFF.55"; transcript_id "CUFF.55.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	transcript	3282505	3282531	1000	.	.	gene_id "CUFF.57"; transcript_id "CUFF.57.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	exon	3282505	3282531	1000	.	.	gene_id "CUFF.57"; transcript_id "CUFF.57.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	transcript	3282651	3282677	1000	.	.	gene_id "CUFF.59"; transcript_id "CUFF.59.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	exon	3282651	3282677	1000	.	.	gene_id "CUFF.59"; transcript_id "CUFF.59.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	transcript	3282761	3282832	1000	.	.	gene_id "CUFF.61"; transcript_id "CUFF.61.1"; FPKM "13.2042326903"; frac "1.000000"; conf_lo "0.000000"; conf_hi "31.877838"; cov "0.750000";
-chr1	Cufflinks	exon	3282761	3282832	1000	.	.	gene_id "CUFF.61"; transcript_id "CUFF.61.1"; exon_number "1"; FPKM "13.2042326903"; frac "1.000000"; conf_lo "0.000000"; conf_hi "31.877838"; cov "0.750000";
-chr1	Cufflinks	transcript	3284967	3284993	1000	.	.	gene_id "CUFF.63"; transcript_id "CUFF.63.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	exon	3284967	3284993	1000	.	.	gene_id "CUFF.63"; transcript_id "CUFF.63.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	transcript	3290799	3290859	1000	.	.	gene_id "CUFF.65"; transcript_id "CUFF.65.1"; FPKM "31.1706476623"; frac "1.000000"; conf_lo "0.000000"; conf_hi "62.341295"; cov "1.770492";
-chr1	Cufflinks	exon	3290799	3290859	1000	.	.	gene_id "CUFF.65"; transcript_id "CUFF.65.1"; exon_number "1"; FPKM "31.1706476623"; frac "1.000000"; conf_lo "0.000000"; conf_hi "62.341295"; cov "1.770492";
-chr1	Cufflinks	transcript	3299444	3299640	1000	.	.	gene_id "CUFF.67"; transcript_id "CUFF.67.1"; FPKM "15.6813507371"; frac "1.000000"; conf_lo "3.378764"; conf_hi "27.983938"; cov "0.890700";
-chr1	Cufflinks	exon	3299444	3299640	1000	.	.	gene_id "CUFF.67"; transcript_id "CUFF.67.1"; exon_number "1"; FPKM "15.6813507371"; frac "1.000000"; conf_lo "3.378764"; conf_hi "27.983938"; cov "0.890700";
-chr1	Cufflinks	transcript	3290920	3291273	1000	.	.	gene_id "CUFF.69"; transcript_id "CUFF.69.1"; FPKM "18.7992465421"; frac "1.000000"; conf_lo "8.750627"; conf_hi "28.847866"; cov "1.067797";
-chr1	Cufflinks	exon	3290920	3291273	1000	.	.	gene_id "CUFF.69"; transcript_id "CUFF.69.1"; exon_number "1"; FPKM "18.7992465421"; frac "1.000000"; conf_lo "8.750627"; conf_hi "28.847866"; cov "1.067797";
-chr1	Cufflinks	transcript	3299692	3299733	1000	.	.	gene_id "CUFF.71"; transcript_id "CUFF.71.1"; FPKM "22.6358274691"; frac "1.000000"; conf_lo "0.000000"; conf_hi "54.647722"; cov "1.285714";
-chr1	Cufflinks	exon	3299692	3299733	1000	.	.	gene_id "CUFF.71"; transcript_id "CUFF.71.1"; exon_number "1"; FPKM "22.6358274691"; frac "1.000000"; conf_lo "0.000000"; conf_hi "54.647722"; cov "1.285714";
-chr1	Cufflinks	transcript	3307749	3307775	1000	.	.	gene_id "CUFF.73"; transcript_id "CUFF.73.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	exon	3307749	3307775	1000	.	.	gene_id "CUFF.73"; transcript_id "CUFF.73.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	transcript	3318621	3318647	1000	.	.	gene_id "CUFF.75"; transcript_id "CUFF.75.1"; FPKM "52.8169307611"; frac "1.000000"; conf_lo "0.000000"; conf_hi "113.804669"; cov "3.000000";
-chr1	Cufflinks	exon	3318621	3318647	1000	.	.	gene_id "CUFF.75"; transcript_id "CUFF.75.1"; exon_number "1"; FPKM "52.8169307611"; frac "1.000000"; conf_lo "0.000000"; conf_hi "113.804669"; cov "3.000000";
-chr1	Cufflinks	transcript	3330528	3330554	1000	.	.	gene_id "CUFF.77"; transcript_id "CUFF.77.1"; FPKM "17.6056435870"; frac "1.000000"; conf_lo "0.000000"; conf_hi "52.816931"; cov "1.000000";
-chr1	Cufflinks	exon	3330528	3330554	1000	.	.	gene_id "CUFF.77"; transcript_id "CUFF.77.1"; exon_number "1"; FPKM "17.6056435870"; frac "1.000000"; conf_lo "0.000000"; conf_hi "52.816931"; cov "1.000000";
-chr1	Cufflinks	transcript	3351241	3351311	1000	.	.	gene_id "CUFF.79"; transcript_id "CUFF.79.1"; FPKM "13.3902077986"; frac "1.000000"; conf_lo "0.000000"; conf_hi "32.326821"; cov "0.760563";
-chr1	Cufflinks	exon	3351241	3351311	1000	.	.	gene_id "CUFF.79"; transcript_id "CUFF.79.1"; exon_number "1"; FPKM "13.3902077986"; frac "1.000000"; conf_lo "0.000000"; conf_hi "32.326821"; cov "0.760563";
-chr1	Cufflinks	transcript	3355908	3356119	1000	.	.	gene_id "CUFF.81"; transcript_id "CUFF.81.1"; FPKM "11.2111409634"; frac "1.000000"; conf_lo "1.183592"; conf_hi "21.238690"; cov "0.636792";
-chr1	Cufflinks	exon	3355908	3356119	1000	.	.	gene_id "CUFF.81"; transcript_id "CUFF.81.1"; exon_number "1"; FPKM "11.2111409634"; frac "1.000000"; conf_lo "1.183592"; conf_hi "21.238690"; cov "0.636792";
-chr1	Cufflinks	transcript	3356181	3356225	1000	.	.	gene_id "CUFF.83"; transcript_id "CUFF.83.1"; FPKM "21.1267723045"; frac "1.000000"; conf_lo "0.000000"; conf_hi "51.004540"; cov "1.200000";
-chr1	Cufflinks	exon	3356181	3356225	1000	.	.	gene_id "CUFF.83"; transcript_id "CUFF.83.1"; exon_number "1"; FPKM "21.1267723045"; frac "1.000000"; conf_lo "0.000000"; conf_hi "51.004540"; cov "1.200000";
-chr1	Cufflinks	transcript	3363077	3363176	1000	.	.	gene_id "CUFF.85"; transcript_id "CUFF.85.1"; FPKM "19.0140950740"; frac "1.000000"; conf_lo "0.000000"; conf_hi "38.028190"; cov "1.080000";
-chr1	Cufflinks	exon	3363077	3363176	1000	.	.	gene_id "CUFF.85"; transcript_id "CUFF.85.1"; exon_number "1"; FPKM "19.0140950740"; frac "1.000000"; conf_lo "0.000000"; conf_hi "38.028190"; cov "1.080000";
-chr1	Cufflinks	transcript	3363388	3363446	1000	.	.	gene_id "CUFF.87"; transcript_id "CUFF.87.1"; FPKM "24.1704598398"; frac "1.000000"; conf_lo "0.000000"; conf_hi "52.080103"; cov "1.372881";
-chr1	Cufflinks	exon	3363388	3363446	1000	.	.	gene_id "CUFF.87"; transcript_id "CUFF.87.1"; exon_number "1"; FPKM "24.1704598398"; frac "1.000000"; conf_lo "0.000000"; conf_hi "52.080103"; cov "1.372881";
-chr1	Cufflinks	transcript	3364872	3364919	1000	.	.	gene_id "CUFF.89"; transcript_id "CUFF.89.1"; FPKM "29.7095235531"; frac "1.000000"; conf_lo "0.000000"; conf_hi "64.015126"; cov "1.687500";
-chr1	Cufflinks	exon	3364872	3364919	1000	.	.	gene_id "CUFF.89"; transcript_id "CUFF.89.1"; exon_number "1"; FPKM "29.7095235531"; frac "1.000000"; conf_lo "0.000000"; conf_hi "64.015126"; cov "1.687500";
-chr1	Cufflinks	transcript	3367211	3367237	1000	.	.	gene_id "CUFF.91"; transcript_id "CUFF.91.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	exon	3367211	3367237	1000	.	.	gene_id "CUFF.91"; transcript_id "CUFF.91.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	transcript	3369581	3369607	1000	.	.	gene_id "CUFF.93"; transcript_id "CUFF.93.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	exon	3369581	3369607	1000	.	.	gene_id "CUFF.93"; transcript_id "CUFF.93.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	transcript	3375002	3375028	1000	.	.	gene_id "CUFF.95"; transcript_id "CUFF.95.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	exon	3375002	3375028	1000	.	.	gene_id "CUFF.95"; transcript_id "CUFF.95.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	transcript	3379889	3379915	1000	.	.	gene_id "CUFF.97"; transcript_id "CUFF.97.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	exon	3379889	3379915	1000	.	.	gene_id "CUFF.97"; transcript_id "CUFF.97.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
-chr1	Cufflinks	transcript	3386740	3386836	1000	.	.	gene_id "CUFF.99"; transcript_id "CUFF.99.1"; FPKM "19.6021598701"; frac "1.000000"; conf_lo "0.000000"; conf_hi "39.204320"; cov "1.113402";
-chr1	Cufflinks	exon	3386740	3386836	1000	.	.	gene_id "CUFF.99"; transcript_id "CUFF.99.1"; exon_number "1"; FPKM "19.6021598701"; frac "1.000000"; conf_lo "0.000000"; conf_hi "39.204320"; cov "1.113402";
+chr1	Cufflinks	transcript	5	10	1000	-	.	gene_id "CUFF.1"; transcript_id "CUFF.1.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
+chr1	Cufflinks	exon	2	10	1000	-	.	gene_id "CUFF.1"; transcript_id "CUFF.1.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
+chr1	Cufflinks	transcript	15	20	1000	+	.	gene_id "CUFF.3"; transcript_id "CUFF.3.1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
+chr1	Cufflinks	exon	12	20	0.000000	+	.	gene_id "CUFF.3"; transcript_id "CUFF.3.1"; exon_number "1"; FPKM "35.2112871741"; frac "1.000000"; conf_lo "0.000000"; conf_hi "85.007567"; cov "2.000000";
+chr1	Cufflinks	transcript	25	30	1000	-	.	gene_id "CUFF.5"; transcript_id "CUFF.5.1"; FPKM "21.2266273824"; frac "1.000000"; conf_lo "0.000000"; conf_hi "59.889707"; cov "1.205672";
+chr1	Cufflinks	exon	22	30	0.000000	-	.	 gene_id "CUFF.5"; transcript_id "CUFF.5.1"; exon_number "1"; FPKM "21.2266273824"; frac "1.000000"; conf_lo "0.000000"; conf_hi "59.889707"; cov "1.205672";
+chr1	Cufflinks	transcript	42	47	1000	+	.	 gene_id "CUFF.7"; transcript_id "CUFF.7.1"; FPKM "29.7095235531"; frac "1.000000"; conf_lo "19.806349"; conf_hi "39.612698"; cov "1.687500";
+chr1	Cufflinks	exon	42	47	0.000000	+	.	gene_id "CUFF.7"; transcript_id "CUFF.7.1"; exon_number "1"; FPKM "29.7095235531"; frac "1.000000"; conf_lo "19.806349"; conf_hi "39.612698"; cov "1.687500";
+
--- a/test-data/gffcompare_in3.gtf	Tue Feb 05 15:51:44 2019 -0500
+++ b/test-data/gffcompare_in3.gtf	Mon May 27 13:54:15 2019 -0400
@@ -1,100 +1,10 @@
-chr1	mm9_refFlat	stop_codon	3206103	3206105	0.000000	-	.	gene_id "Xkr4"; transcript_id "Xkr4"; 
-chr1	mm9_refFlat	CDS	3206106	3207049	0.000000	-	2	gene_id "Xkr4"; transcript_id "Xkr4"; 
-chr1	mm9_refFlat	exon	3204563	3207049	0.000000	-	.	gene_id "Xkr4"; transcript_id "Xkr4"; 
-chr1	mm9_refFlat	CDS	3411783	3411982	0.000000	-	1	gene_id "Xkr4"; transcript_id "Xkr4"; 
-chr1	mm9_refFlat	exon	3411783	3411982	0.000000	-	.	gene_id "Xkr4"; transcript_id "Xkr4"; 
-chr1	mm9_refFlat	CDS	3660633	3661429	0.000000	-	0	gene_id "Xkr4"; transcript_id "Xkr4"; 
-chr1	mm9_refFlat	start_codon	3661427	3661429	0.000000	-	.	gene_id "Xkr4"; transcript_id "Xkr4"; 
-chr1	mm9_refFlat	exon	3660633	3661579	0.000000	-	.	gene_id "Xkr4"; transcript_id "Xkr4"; 
-chr1	mm9_refFlat	stop_codon	4334681	4334683	0.000000	-	.	gene_id "Rp1"; transcript_id "Rp1"; 
-chr1	mm9_refFlat	CDS	4334684	4340172	0.000000	-	2	gene_id "Rp1"; transcript_id "Rp1"; 
-chr1	mm9_refFlat	exon	4334224	4340172	0.000000	-	.	gene_id "Rp1"; transcript_id "Rp1"; 
-chr1	mm9_refFlat	CDS	4341991	4342162	0.000000	-	0	gene_id "Rp1"; transcript_id "Rp1"; 
-chr1	mm9_refFlat	exon	4341991	4342162	0.000000	-	.	gene_id "Rp1"; transcript_id "Rp1"; 
-chr1	mm9_refFlat	CDS	4342283	4342906	0.000000	-	0	gene_id "Rp1"; transcript_id "Rp1"; 
-chr1	mm9_refFlat	start_codon	4342904	4342906	0.000000	-	.	gene_id "Rp1"; transcript_id "Rp1"; 
-chr1	mm9_refFlat	exon	4342283	4342918	0.000000	-	.	gene_id "Rp1"; transcript_id "Rp1"; 
-chr1	mm9_refFlat	exon	4350281	4350473	0.000000	-	.	gene_id "Rp1"; transcript_id "Rp1"; 
-chr1	mm9_refFlat	stop_codon	4481797	4481799	0.000000	-	.	gene_id "Sox17"; transcript_id "Sox17"; 
-chr1	mm9_refFlat	CDS	4481800	4482749	0.000000	-	2	gene_id "Sox17"; transcript_id "Sox17"; 
-chr1	mm9_refFlat	exon	4481009	4482749	0.000000	-	.	gene_id "Sox17"; transcript_id "Sox17"; 
-chr1	mm9_refFlat	CDS	4483181	4483487	0.000000	-	0	gene_id "Sox17"; transcript_id "Sox17"; 
-chr1	mm9_refFlat	start_codon	4483485	4483487	0.000000	-	.	gene_id "Sox17"; transcript_id "Sox17"; 
-chr1	mm9_refFlat	exon	4483181	4483547	0.000000	-	.	gene_id "Sox17"; transcript_id "Sox17"; 
-chr1	mm9_refFlat	exon	4483853	4483944	0.000000	-	.	gene_id "Sox17"; transcript_id "Sox17"; 
-chr1	mm9_refFlat	exon	4485217	4486023	0.000000	-	.	gene_id "Sox17"; transcript_id "Sox17"; 
-chr1	mm9_refFlat	exon	4486372	4486494	0.000000	-	.	gene_id "Sox17"; transcript_id "Sox17"; 
-chr1	mm9_refFlat	stop_codon	4766545	4766547	0.000000	-	.	gene_id "Mrpl15"; transcript_id "Mrpl15"; 
-chr1	mm9_refFlat	CDS	4766548	4766882	0.000000	-	2	gene_id "Mrpl15"; transcript_id "Mrpl15"; 
-chr1	mm9_refFlat	exon	4763279	4766882	0.000000	-	.	gene_id "Mrpl15"; transcript_id "Mrpl15"; 
-chr1	mm9_refFlat	CDS	4767606	4767729	0.000000	-	0	gene_id "Mrpl15"; transcript_id "Mrpl15"; 
-chr1	mm9_refFlat	exon	4767606	4767729	0.000000	-	.	gene_id "Mrpl15"; transcript_id "Mrpl15"; 
-chr1	mm9_refFlat	CDS	4772649	4772814	0.000000	-	1	gene_id "Mrpl15"; transcript_id "Mrpl15"; 
-chr1	mm9_refFlat	exon	4772649	4772814	0.000000	-	.	gene_id "Mrpl15"; transcript_id "Mrpl15"; 
-chr1	mm9_refFlat	CDS	4774032	4774186	0.000000	-	0	gene_id "Mrpl15"; transcript_id "Mrpl15"; 
-chr1	mm9_refFlat	exon	4774032	4774186	0.000000	-	.	gene_id "Mrpl15"; transcript_id "Mrpl15"; 
-chr1	mm9_refFlat	CDS	4775654	4775758	0.000000	-	0	gene_id "Mrpl15"; transcript_id "Mrpl15"; 
-chr1	mm9_refFlat	start_codon	4775756	4775758	0.000000	-	.	gene_id "Mrpl15"; transcript_id "Mrpl15"; 
-chr1	mm9_refFlat	exon	4775654	4775807	0.000000	-	.	gene_id "Mrpl15"; transcript_id "Mrpl15"; 
-chr1	mm9_refFlat	stop_codon	4764533	4764535	0.000000	-	.	gene_id "Mrpl15"; transcript_id "Mrpl15_dup1"; 
-chr1	mm9_refFlat	CDS	4764536	4764597	0.000000	-	2	gene_id "Mrpl15"; transcript_id "Mrpl15_dup1"; 
-chr1	mm9_refFlat	exon	4763279	4764597	0.000000	-	.	gene_id "Mrpl15"; transcript_id "Mrpl15_dup1"; 
-chr1	mm9_refFlat	CDS	4767606	4767729	0.000000	-	0	gene_id "Mrpl15"; transcript_id "Mrpl15_dup1"; 
-chr1	mm9_refFlat	exon	4767606	4767729	0.000000	-	.	gene_id "Mrpl15"; transcript_id "Mrpl15_dup1"; 
-chr1	mm9_refFlat	CDS	4772649	4772814	0.000000	-	1	gene_id "Mrpl15"; transcript_id "Mrpl15_dup1"; 
-chr1	mm9_refFlat	exon	4772649	4772814	0.000000	-	.	gene_id "Mrpl15"; transcript_id "Mrpl15_dup1"; 
-chr1	mm9_refFlat	CDS	4774032	4774186	0.000000	-	0	gene_id "Mrpl15"; transcript_id "Mrpl15_dup1"; 
-chr1	mm9_refFlat	exon	4774032	4774186	0.000000	-	.	gene_id "Mrpl15"; transcript_id "Mrpl15_dup1"; 
-chr1	mm9_refFlat	CDS	4775654	4775758	0.000000	-	0	gene_id "Mrpl15"; transcript_id "Mrpl15_dup1"; 
-chr1	mm9_refFlat	start_codon	4775756	4775758	0.000000	-	.	gene_id "Mrpl15"; transcript_id "Mrpl15_dup1"; 
-chr1	mm9_refFlat	exon	4775654	4775807	0.000000	-	.	gene_id "Mrpl15"; transcript_id "Mrpl15_dup1"; 
-chr1	mm9_refFlat	exon	4763279	4764597	0.000000	-	.	gene_id "Mrpl15"; transcript_id "Mrpl15_dup2"; 
-chr1	mm9_refFlat	exon	4767606	4767729	0.000000	-	.	gene_id "Mrpl15"; transcript_id "Mrpl15_dup2"; 
-chr1	mm9_refFlat	exon	4772649	4772814	0.000000	-	.	gene_id "Mrpl15"; transcript_id "Mrpl15_dup2"; 
-chr1	mm9_refFlat	exon	4775654	4775807	0.000000	-	.	gene_id "Mrpl15"; transcript_id "Mrpl15_dup2"; 
-chr1	mm9_refFlat	start_codon	4797995	4797997	0.000000	+	.	gene_id "Lypla1"; transcript_id "Lypla1"; 
-chr1	mm9_refFlat	CDS	4797995	4798063	0.000000	+	0	gene_id "Lypla1"; transcript_id "Lypla1"; 
-chr1	mm9_refFlat	exon	4797974	4798063	0.000000	+	.	gene_id "Lypla1"; transcript_id "Lypla1"; 
-chr1	mm9_refFlat	CDS	4798536	4798567	0.000000	+	0	gene_id "Lypla1"; transcript_id "Lypla1"; 
-chr1	mm9_refFlat	exon	4798536	4798567	0.000000	+	.	gene_id "Lypla1"; transcript_id "Lypla1"; 
-chr1	mm9_refFlat	CDS	4818665	4818730	0.000000	+	1	gene_id "Lypla1"; transcript_id "Lypla1"; 
-chr1	mm9_refFlat	exon	4818665	4818730	0.000000	+	.	gene_id "Lypla1"; transcript_id "Lypla1"; 
-chr1	mm9_refFlat	CDS	4820349	4820396	0.000000	+	1	gene_id "Lypla1"; transcript_id "Lypla1"; 
-chr1	mm9_refFlat	exon	4820349	4820396	0.000000	+	.	gene_id "Lypla1"; transcript_id "Lypla1"; 
-chr1	mm9_refFlat	CDS	4822392	4822462	0.000000	+	1	gene_id "Lypla1"; transcript_id "Lypla1"; 
-chr1	mm9_refFlat	exon	4822392	4822462	0.000000	+	.	gene_id "Lypla1"; transcript_id "Lypla1"; 
-chr1	mm9_refFlat	CDS	4827082	4827155	0.000000	+	2	gene_id "Lypla1"; transcript_id "Lypla1"; 
-chr1	mm9_refFlat	exon	4827082	4827155	0.000000	+	.	gene_id "Lypla1"; transcript_id "Lypla1"; 
-chr1	mm9_refFlat	CDS	4829468	4829569	0.000000	+	0	gene_id "Lypla1"; transcript_id "Lypla1"; 
-chr1	mm9_refFlat	exon	4829468	4829569	0.000000	+	.	gene_id "Lypla1"; transcript_id "Lypla1"; 
-chr1	mm9_refFlat	CDS	4831037	4831213	0.000000	+	0	gene_id "Lypla1"; transcript_id "Lypla1"; 
-chr1	mm9_refFlat	exon	4831037	4831213	0.000000	+	.	gene_id "Lypla1"; transcript_id "Lypla1"; 
-chr1	mm9_refFlat	CDS	4835044	4835094	0.000000	+	0	gene_id "Lypla1"; transcript_id "Lypla1"; 
-chr1	mm9_refFlat	stop_codon	4835095	4835097	0.000000	+	.	gene_id "Lypla1"; transcript_id "Lypla1"; 
-chr1	mm9_refFlat	exon	4835044	4836816	0.000000	+	.	gene_id "Lypla1"; transcript_id "Lypla1"; 
-chr1	mm9_refFlat	start_codon	4847995	4847997	0.000000	+	.	gene_id "Tcea1"; transcript_id "Tcea1"; 
-chr1	mm9_refFlat	CDS	4847995	4848057	0.000000	+	0	gene_id "Tcea1"; transcript_id "Tcea1"; 
-chr1	mm9_refFlat	exon	4847775	4848057	0.000000	+	.	gene_id "Tcea1"; transcript_id "Tcea1"; 
-chr1	mm9_refFlat	CDS	4857551	4857613	0.000000	+	0	gene_id "Tcea1"; transcript_id "Tcea1"; 
-chr1	mm9_refFlat	exon	4857551	4857613	0.000000	+	.	gene_id "Tcea1"; transcript_id "Tcea1"; 
-chr1	mm9_refFlat	CDS	4868108	4868213	0.000000	+	0	gene_id "Tcea1"; transcript_id "Tcea1"; 
-chr1	mm9_refFlat	exon	4868108	4868213	0.000000	+	.	gene_id "Tcea1"; transcript_id "Tcea1"; 
-chr1	mm9_refFlat	CDS	4876825	4876912	0.000000	+	2	gene_id "Tcea1"; transcript_id "Tcea1"; 
-chr1	mm9_refFlat	exon	4876825	4876912	0.000000	+	.	gene_id "Tcea1"; transcript_id "Tcea1"; 
-chr1	mm9_refFlat	CDS	4879538	4879683	0.000000	+	1	gene_id "Tcea1"; transcript_id "Tcea1"; 
-chr1	mm9_refFlat	exon	4879538	4879683	0.000000	+	.	gene_id "Tcea1"; transcript_id "Tcea1"; 
-chr1	mm9_refFlat	CDS	4880821	4880877	0.000000	+	2	gene_id "Tcea1"; transcript_id "Tcea1"; 
-chr1	mm9_refFlat	exon	4880821	4880877	0.000000	+	.	gene_id "Tcea1"; transcript_id "Tcea1"; 
-chr1	mm9_refFlat	CDS	4881996	4882150	0.000000	+	2	gene_id "Tcea1"; transcript_id "Tcea1"; 
-chr1	mm9_refFlat	exon	4881996	4882150	0.000000	+	.	gene_id "Tcea1"; transcript_id "Tcea1"; 
-chr1	mm9_refFlat	CDS	4883498	4883644	0.000000	+	0	gene_id "Tcea1"; transcript_id "Tcea1"; 
-chr1	mm9_refFlat	exon	4883498	4883644	0.000000	+	.	gene_id "Tcea1"; transcript_id "Tcea1"; 
-chr1	mm9_refFlat	CDS	4885015	4885086	0.000000	+	0	gene_id "Tcea1"; transcript_id "Tcea1"; 
-chr1	mm9_refFlat	exon	4885015	4885086	0.000000	+	.	gene_id "Tcea1"; transcript_id "Tcea1"; 
-chr1	mm9_refFlat	CDS	4886437	4886442	0.000000	+	0	gene_id "Tcea1"; transcript_id "Tcea1"; 
-chr1	mm9_refFlat	stop_codon	4886443	4886445	0.000000	+	.	gene_id "Tcea1"; transcript_id "Tcea1"; 
-chr1	mm9_refFlat	exon	4886437	4887987	0.000000	+	.	gene_id "Tcea1"; transcript_id "Tcea1"; 
-chr1	mm9_refFlat	start_codon	4847995	4847997	0.000000	+	.	gene_id "Tcea1"; transcript_id "Tcea1_dup1"; 
-chr1	mm9_refFlat	CDS	4847995	4848057	0.000000	+	0	gene_id "Tcea1"; transcript_id "Tcea1_dup1"; 
-chr1	mm9_refFlat	exon	4847775	4848057	0.000000	+	.	gene_id "Tcea1"; transcript_id "Tcea1_dup1"; 
-chr1	mm9_refFlat	CDS	4857551	4857613	0.000000	+	0	gene_id "Tcea1"; transcript_id "Tcea1_dup1"; 
+chr1	mm9_refFlat	CDS	5	10	0.000000	-	0	gene_id "Xkr4"; transcript_id "Xkr4"; 
+chr1	mm9_refFlat	exon	2	10	0.000000	-	.	gene_id "Xkr4"; transcript_id "Xkr4"; 
+chr1	mm9_refFlat	CDS	15	20	0.000000	-	0	gene_id "Rp1"; transcript_id "Rp1"; 
+chr1	mm9_refFlat	exon	12	20	0.000000	-	.	gene_id "Rp1"; transcript_id "Rp1"; 
+chr1	mm9_refFlat	CDS	25	30	0.000000	-	0	gene_id "Sox17"; transcript_id "Sox17"; 
+chr1	mm9_refFlat	exon	22	30	0.000000	-	.	gene_id "Sox17"; transcript_id "Sox17"; 
+chr1	mm9_refFlat	CDS	32	37	0.000000	+	0	gene_id "Lypla1"; transcript_id "Lypla1"; 
+chr1	mm9_refFlat	exon	32	40	0.000000	+	.	gene_id "Lypla1"; transcript_id "Lypla1"; 
+chr1	mm9_refFlat	CDS	42	50	0.000000	+	0	gene_id "Lypla1"; transcript_id "Lypla1"; 
+chr1	mm9_refFlat	exon	42	50	0.000000	+	.	gene_id "Lypla1"; transcript_id "Lypla1"; 
--- a/test-data/gffcompare_out1-1.refmap	Tue Feb 05 15:51:44 2019 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,2 +0,0 @@
-ref_gene_id	ref_id	class_code	qry_id_list
-Xkr4	Xkr4	c	CUFF.13|CUFF.13.1
--- a/test-data/gffcompare_out1-1.tmap	Tue Feb 05 15:51:44 2019 -0500
+++ b/test-data/gffcompare_out1-1.tmap	Mon May 27 13:54:15 2019 -0400
@@ -1,51 +1,7 @@
 ref_gene_id	ref_id	class_code	qry_gene_id	qry_id	num_exons	FPKM	TPM		cov	len	major_iso_id	ref_match_len
--	-	u	CUFF.1	CUFF.1.1	1	20.607936	0.000000	1.317073	41	CUFF.1.1	-
--	-	u	CUFF.3	CUFF.3.1	1	27.255658	0.000000	1.741935	31	CUFF.3.1	-
--	-	u	CUFF.5	CUFF.5.1	1	31.293533	0.000000	2.000000	27	CUFF.5.1	-
--	-	u	CUFF.7	CUFF.7.1	1	9.999117	0.000000	0.639053	169	CUFF.7.1	-
--	-	u	CUFF.9	CUFF.9.1	1	17.776896	0.000000	1.136139	404	CUFF.9.1	-
--	-	u	CUFF.11	CUFF.11.1	1	31.293533	0.000000	2.000000	27	CUFF.11.1	-
-Xkr4	Xkr4	c	CUFF.13	CUFF.13.1	1	10.695258	0.000000	0.683544	79	CUFF.13.1	3634
-Xkr4	Xkr4	i	CUFF.15	CUFF.15.1	1	10.695258	0.000000	0.683544	79	CUFF.15.1	3634
-Xkr4	Xkr4	i	CUFF.17	CUFF.17.1	1	8.710571	0.000000	0.556701	97	CUFF.17.1	3634
-Xkr4	Xkr4	i	CUFF.19	CUFF.19.1	1	29.337687	0.000000	1.875000	72	CUFF.19.1	3634
-Xkr4	Xkr4	i	CUFF.21	CUFF.21.1	1	13.851236	0.000000	0.885246	61	CUFF.21.1	3634
-Xkr4	Xkr4	i	CUFF.23	CUFF.23.1	1	23.470150	0.000000	1.500000	54	CUFF.23.1	3634
-Xkr4	Xkr4	i	CUFF.25	CUFF.25.1	1	14.567679	0.000000	0.931034	290	CUFF.25.1	3634
-Xkr4	Xkr4	i	CUFF.27	CUFF.27.1	1	34.253732	0.000000	2.189189	37	CUFF.27.1	3634
--	-	u	CUFF.29	CUFF.29.1	1	107.103219	0.000000	6.845070	142	CUFF.29.1	-
--	-	u	CUFF.31	CUFF.31.1	1	122.650461	0.000000	7.838710	31	CUFF.31.1	-
--	-	u	CUFF.33	CUFF.33.1	1	109.527366	0.000000	7.000000	27	CUFF.33.1	-
--	-	u	CUFF.35	CUFF.35.1	1	96.747183	0.000000	6.183206	131	CUFF.35.1	-
--	-	u	CUFF.37	CUFF.37.1	1	104.085013	0.000000	6.652174	69	CUFF.37.1	-
--	-	u	CUFF.39	CUFF.39.1	1	23.912983	0.000000	1.528302	53	CUFF.39.1	-
--	-	u	CUFF.41	CUFF.41.1	1	10.695258	0.000000	0.683544	79	CUFF.41.1	-
--	-	u	CUFF.43	CUFF.43.1	1	10.561567	0.000000	0.675000	80	CUFF.43.1	-
--	-	u	CUFF.45	CUFF.45.1	1	20.708956	0.000000	1.323529	102	CUFF.45.1	-
--	-	u	CUFF.47	CUFF.47.1	1	20.607936	0.000000	1.317073	41	CUFF.47.1	-
--	-	u	CUFF.49	CUFF.49.1	1	15.646767	0.000000	1.000000	27	CUFF.49.1	-
--	-	u	CUFF.51	CUFF.51.1	1	31.293533	0.000000	2.000000	27	CUFF.51.1	-
--	-	u	CUFF.53	CUFF.53.1	1	31.293533	0.000000	2.000000	27	CUFF.53.1	-
--	-	u	CUFF.55	CUFF.55.1	1	31.293533	0.000000	2.000000	27	CUFF.55.1	-
--	-	u	CUFF.57	CUFF.57.1	1	15.646767	0.000000	1.000000	27	CUFF.57.1	-
--	-	u	CUFF.59	CUFF.59.1	1	15.646767	0.000000	1.000000	27	CUFF.59.1	-
-Xkr4	Xkr4	i	CUFF.61	CUFF.61.1	1	45.263860	0.000000	2.892857	28	CUFF.61.1	3634
-Xkr4	Xkr4	i	CUFF.63	CUFF.63.1	1	15.646767	0.000000	1.000000	27	CUFF.63.1	3634
-Xkr4	Xkr4	i	CUFF.65	CUFF.65.1	1	15.362280	0.000000	0.981818	55	CUFF.65.1	3634
-Xkr4	Xkr4	i	CUFF.67	CUFF.67.1	1	12.998852	0.000000	0.830769	65	CUFF.67.1	3634
-Xkr4	Xkr4	i	CUFF.69	CUFF.69.1	1	10.058636	0.000000	0.642857	84	CUFF.69.1	3634
-Xkr4	Xkr4	i	CUFF.71	CUFF.71.1	1	8.621688	0.000000	0.551020	98	CUFF.71.1	3634
-Xkr4	Xkr4	i	CUFF.73	CUFF.73.1	1	15.362280	0.000000	0.981818	55	CUFF.73.1	3634
-Xkr4	Xkr4	i	CUFF.75	CUFF.75.1	1	31.293533	0.000000	2.000000	27	CUFF.75.1	3634
-Xkr4	Xkr4	i	CUFF.77	CUFF.77.1	1	16.248565	0.000000	1.038462	52	CUFF.77.1	3634
-Xkr4	Xkr4	i	CUFF.79	CUFF.79.1	1	31.293533	0.000000	2.000000	27	CUFF.79.1	3634
-Xkr4	Xkr4	i	CUFF.81	CUFF.81.1	1	13.201959	0.000000	0.843750	64	CUFF.81.1	3634
-Xkr4	Xkr4	i	CUFF.83	CUFF.83.1	1	13.201959	0.000000	0.843750	96	CUFF.83.1	3634
-Xkr4	Xkr4	i	CUFF.85	CUFF.85.1	1	31.293533	0.000000	2.000000	27	CUFF.85.1	3634
-Xkr4	Xkr4	i	CUFF.87	CUFF.87.1	1	17.243375	0.000000	1.102041	49	CUFF.87.1	3634
-Xkr4	Xkr4	i	CUFF.89	CUFF.89.1	1	16.567165	0.000000	1.058824	51	CUFF.89.1	3634
-Xkr4	Xkr4	i	CUFF.91	CUFF.91.1	1	31.293533	0.000000	2.000000	27	CUFF.91.1	3634
-Xkr4	Xkr4	i	CUFF.93	CUFF.93.1	1	21.664754	0.000000	1.384615	39	CUFF.93.1	3634
-Xkr4	Xkr4	i	CUFF.95	CUFF.95.1	1	46.940300	0.000000	3.000000	27	CUFF.95.1	3634
-Xkr4	Xkr4	i	CUFF.97	CUFF.97.1	1	21.481154	0.000000	1.372881	59	CUFF.97.1	3634
-Xkr4	Xkr4	i	CUFF.99	CUFF.99.1	1	14.567679	0.000000	0.931034	58	CUFF.99.1	3634
+-	-	u	CUFF.1	CUFF.1.1	1	20.607936	0.000000	1.317073	9	CUFF.1.1	-
+-	-	u	CUFF.3	CUFF.3.1	1	27.255658	0.000000	1.741935	6	CUFF.3.1	-
+-	-	u	CUFF.5	CUFF.5.1	1	31.293533	0.000000	2.000000	9	CUFF.5.1	-
+-	-	u	CUFF.7	CUFF.7.1	1	9.999117	0.000000	0.639053	9	CUFF.7.1	-
+-	-	u	CUFF.9	CUFF.9.1	1	17.776896	0.000000	1.136139	9	CUFF.9.1	-
+-	-	u	CUFF.10	CUFF.10.1	1	17.776896	0.000000	1.136139	9	CUFF.10.1	-
--- a/test-data/gffcompare_out1-2.refmap	Tue Feb 05 15:51:44 2019 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,1 +0,0 @@
-ref_gene_id	ref_id	class_code	qry_id_list
--- a/test-data/gffcompare_out1-2.tmap	Tue Feb 05 15:51:44 2019 -0500
+++ b/test-data/gffcompare_out1-2.tmap	Mon May 27 13:54:15 2019 -0400
@@ -1,51 +1,5 @@
 ref_gene_id	ref_id	class_code	qry_gene_id	qry_id	num_exons	FPKM	TPM		cov	len	major_iso_id	ref_match_len
--	-	u	CUFF.1	CUFF.1.1	1	35.211287	0.000000	2.000000	27	CUFF.1.1	-
--	-	u	CUFF.3	CUFF.3.1	1	35.211287	0.000000	2.000000	27	CUFF.3.1	-
--	-	u	CUFF.5	CUFF.5.1	1	21.226627	0.000000	1.205672	27	CUFF.5.1	-
--	-	u	CUFF.7	CUFF.7.1	1	29.709524	0.000000	1.687500	576	CUFF.7.1	-
--	-	u	CUFF.9	CUFF.9.1	1	34.072933	0.000000	1.935341	565	CUFF.9.1	-
--	-	u	CUFF.11	CUFF.11.1	1	32.531777	0.000000	1.847804	979	CUFF.11.1	-
--	-	u	CUFF.13	CUFF.13.1	1	16.582060	0.000000	0.941860	86	CUFF.13.1	-
--	-	u	CUFF.15	CUFF.15.1	1	35.211287	0.000000	2.000000	27	CUFF.15.1	-
--	-	u	CUFF.17	CUFF.17.1	1	35.211287	0.000000	2.000000	27	CUFF.17.1	-
--	-	u	CUFF.19	CUFF.19.1	1	35.211287	0.000000	2.000000	27	CUFF.19.1	-
--	-	u	CUFF.21	CUFF.21.1	1	35.211287	0.000000	2.000000	27	CUFF.21.1	-
--	-	u	CUFF.23	CUFF.23.1	1	16.205195	0.000000	0.920455	88	CUFF.23.1	-
--	-	u	CUFF.25	CUFF.25.1	1	35.211287	0.000000	2.000000	27	CUFF.25.1	-
--	-	u	CUFF.26	CUFF.26.1	1	29.709524	0.000000	1.687500	32	CUFF.26.1	-
--	-	u	CUFF.29	CUFF.29.1	1	13.581496	0.000000	0.771429	70	CUFF.29.1	-
--	-	u	CUFF.31	CUFF.31.1	1	22.635827	0.000000	1.285714	84	CUFF.31.1	-
-Xkr4	Xkr4	i	CUFF.33	CUFF.33.1	1	23.767619	0.000000	1.350000	40	CUFF.33.1	3634
-Xkr4	Xkr4	i	CUFF.35	CUFF.35.1	1	11.317914	0.000000	0.642857	84	CUFF.35.1	3634
-Xkr4	Xkr4	i	CUFF.37	CUFF.37.1	1	11.500461	0.000000	0.653226	124	CUFF.37.1	3634
-Xkr4	Xkr4	i	CUFF.39	CUFF.39.1	1	52.816931	0.000000	3.000000	27	CUFF.39.1	3634
-Xkr4	Xkr4	i	CUFF.41	CUFF.41.1	1	43.213852	0.000000	2.454545	33	CUFF.41.1	3634
-Xkr4	Xkr4	i	CUFF.43	CUFF.43.1	1	23.474191	0.000000	1.333333	81	CUFF.43.1	3634
-Xkr4	Xkr4	i	CUFF.45	CUFF.45.1	1	20.667495	0.000000	1.173913	46	CUFF.45.1	3634
-Xkr4	Xkr4	i	CUFF.47	CUFF.47.1	1	35.211287	0.000000	2.000000	27	CUFF.47.1	3634
-Xkr4	Xkr4	i	CUFF.49	CUFF.49.1	1	35.211287	0.000000	2.000000	27	CUFF.49.1	3634
-Xkr4	Xkr4	i	CUFF.51	CUFF.51.1	1	14.948188	0.000000	0.849057	477	CUFF.51.1	3634
-Xkr4	Xkr4	i	CUFF.53	CUFF.53.1	1	52.816931	0.000000	3.000000	27	CUFF.53.1	3634
-Xkr4	Xkr4	i	CUFF.55	CUFF.55.1	1	35.211287	0.000000	2.000000	27	CUFF.55.1	3634
-Xkr4	Xkr4	i	CUFF.57	CUFF.57.1	1	35.211287	0.000000	2.000000	27	CUFF.57.1	3634
-Xkr4	Xkr4	i	CUFF.59	CUFF.59.1	1	35.211287	0.000000	2.000000	27	CUFF.59.1	3634
-Xkr4	Xkr4	i	CUFF.61	CUFF.61.1	1	13.204233	0.000000	0.750000	72	CUFF.61.1	3634
-Xkr4	Xkr4	i	CUFF.63	CUFF.63.1	1	35.211287	0.000000	2.000000	27	CUFF.63.1	3634
-Xkr4	Xkr4	i	CUFF.65	CUFF.65.1	1	31.170648	0.000000	1.770492	61	CUFF.65.1	3634
-Xkr4	Xkr4	i	CUFF.67	CUFF.67.1	1	15.681351	0.000000	0.890700	197	CUFF.67.1	3634
-Xkr4	Xkr4	i	CUFF.69	CUFF.69.1	1	18.799247	0.000000	1.067797	354	CUFF.69.1	3634
-Xkr4	Xkr4	i	CUFF.71	CUFF.71.1	1	22.635827	0.000000	1.285714	42	CUFF.71.1	3634
-Xkr4	Xkr4	i	CUFF.73	CUFF.73.1	1	35.211287	0.000000	2.000000	27	CUFF.73.1	3634
-Xkr4	Xkr4	i	CUFF.75	CUFF.75.1	1	52.816931	0.000000	3.000000	27	CUFF.75.1	3634
-Xkr4	Xkr4	i	CUFF.77	CUFF.77.1	1	17.605644	0.000000	1.000000	27	CUFF.77.1	3634
-Xkr4	Xkr4	i	CUFF.79	CUFF.79.1	1	13.390208	0.000000	0.760563	71	CUFF.79.1	3634
-Xkr4	Xkr4	i	CUFF.81	CUFF.81.1	1	11.211141	0.000000	0.636792	212	CUFF.81.1	3634
-Xkr4	Xkr4	i	CUFF.83	CUFF.83.1	1	21.126772	0.000000	1.200000	45	CUFF.83.1	3634
-Xkr4	Xkr4	i	CUFF.85	CUFF.85.1	1	19.014095	0.000000	1.080000	100	CUFF.85.1	3634
-Xkr4	Xkr4	i	CUFF.87	CUFF.87.1	1	24.170460	0.000000	1.372881	59	CUFF.87.1	3634
-Xkr4	Xkr4	i	CUFF.89	CUFF.89.1	1	29.709524	0.000000	1.687500	48	CUFF.89.1	3634
-Xkr4	Xkr4	i	CUFF.91	CUFF.91.1	1	35.211287	0.000000	2.000000	27	CUFF.91.1	3634
-Xkr4	Xkr4	i	CUFF.93	CUFF.93.1	1	35.211287	0.000000	2.000000	27	CUFF.93.1	3634
-Xkr4	Xkr4	i	CUFF.95	CUFF.95.1	1	35.211287	0.000000	2.000000	27	CUFF.95.1	3634
-Xkr4	Xkr4	i	CUFF.97	CUFF.97.1	1	35.211287	0.000000	2.000000	27	CUFF.97.1	3634
-Xkr4	Xkr4	i	CUFF.99	CUFF.99.1	1	19.602160	0.000000	1.113402	97	CUFF.99.1	3634
+-	-	u	CUFF.1	CUFF.1.1	1	35.211287	0.000000	2.000000	9	CUFF.1.1	-
+-	-	u	CUFF.3	CUFF.3.1	1	35.211287	0.000000	2.000000	9	CUFF.3.1	-
+-	-	u	CUFF.5	CUFF.5.1	1	21.226627	0.000000	1.205672	9	CUFF.5.1	-
+-	-	u	CUFF.7	CUFF.7.1	1	29.709524	0.000000	1.687500	6	CUFF.7.1	-
--- a/test-data/gffcompare_out1.gtf	Tue Feb 05 15:51:44 2019 -0500
+++ b/test-data/gffcompare_out1.gtf	Mon May 27 13:54:15 2019 -0400
@@ -1,200 +1,16 @@
-chr1	Cufflinks	transcript	3204755	3204833	.	-	.	transcript_id "TCONS_00000001"; gene_id "XLOC_000001"; gene_name "Xkr4"; oId "CUFF.13.1"; cmp_ref "Xkr4"; class_code "c"; tss_id "TSS1";
-chr1	Cufflinks	exon	3204755	3204833	.	-	.	transcript_id "TCONS_00000001"; gene_id "XLOC_000001"; exon_number "1";
-chr1	Cufflinks	transcript	3111450	3111490	.	.	.	transcript_id "TCONS_00000002"; gene_id "XLOC_000002"; oId "CUFF.1.1"; class_code "u"; tss_id "TSS2";
-chr1	Cufflinks	exon	3111450	3111490	.	.	.	transcript_id "TCONS_00000002"; gene_id "XLOC_000002"; exon_number "1";
-chr1	Cufflinks	transcript	3111546	3111576	.	.	.	transcript_id "TCONS_00000003"; gene_id "XLOC_000003"; oId "CUFF.3.1"; class_code "u"; tss_id "TSS3";
-chr1	Cufflinks	exon	3111546	3111576	.	.	.	transcript_id "TCONS_00000003"; gene_id "XLOC_000003"; exon_number "1";
-chr1	Cufflinks	transcript	3174766	3174792	.	.	.	transcript_id "TCONS_00000051"; gene_id "XLOC_000004"; oId "CUFF.1.1"; class_code "u"; tss_id "TSS4";
-chr1	Cufflinks	exon	3174766	3174792	.	.	.	transcript_id "TCONS_00000051"; gene_id "XLOC_000004"; exon_number "1";
-chr1	Cufflinks	transcript	3187402	3187428	.	.	.	transcript_id "TCONS_00000052"; gene_id "XLOC_000005"; oId "CUFF.3.1"; class_code "u"; tss_id "TSS5";
-chr1	Cufflinks	exon	3187402	3187428	.	.	.	transcript_id "TCONS_00000052"; gene_id "XLOC_000005"; exon_number "1";
-chr1	Cufflinks	transcript	3188522	3188548	.	.	.	transcript_id "TCONS_00000053"; gene_id "XLOC_000006"; oId "CUFF.5.1"; class_code "u"; tss_id "TSS6";
-chr1	Cufflinks	exon	3188522	3188548	.	.	.	transcript_id "TCONS_00000053"; gene_id "XLOC_000006"; exon_number "1";
-chr1	Cufflinks	transcript	3189811	3190789	.	.	.	transcript_id "TCONS_00000054"; gene_id "XLOC_000007"; oId "CUFF.11.1"; class_code "u"; tss_id "TSS7";
-chr1	Cufflinks	exon	3189811	3190789	.	.	.	transcript_id "TCONS_00000054"; gene_id "XLOC_000007"; exon_number "1";
-chr1	Cufflinks	transcript	3189900	3190041	.	.	.	transcript_id "TCONS_00000004"; gene_id "XLOC_000007"; oId "CUFF.29.1"; contained_in "TCONS_00000054"; class_code "u"; tss_id "TSS7";
-chr1	Cufflinks	exon	3189900	3190041	.	.	.	transcript_id "TCONS_00000004"; gene_id "XLOC_000007"; exon_number "1";
-chr1	Cufflinks	transcript	3190273	3190303	.	.	.	transcript_id "TCONS_00000005"; gene_id "XLOC_000007"; oId "CUFF.31.1"; contained_in "TCONS_00000054"; class_code "u"; tss_id "TSS8";
-chr1	Cufflinks	exon	3190273	3190303	.	.	.	transcript_id "TCONS_00000005"; gene_id "XLOC_000007"; exon_number "1";
-chr1	Cufflinks	transcript	3190455	3190481	.	.	.	transcript_id "TCONS_00000006"; gene_id "XLOC_000007"; oId "CUFF.33.1"; contained_in "TCONS_00000054"; class_code "u"; tss_id "TSS9";
-chr1	Cufflinks	exon	3190455	3190481	.	.	.	transcript_id "TCONS_00000006"; gene_id "XLOC_000007"; exon_number "1";
-chr1	Cufflinks	transcript	3190859	3191434	.	.	.	transcript_id "TCONS_00000055"; gene_id "XLOC_000008"; oId "CUFF.7.1"; class_code "u"; tss_id "TSS10";
-chr1	Cufflinks	exon	3190859	3191434	.	.	.	transcript_id "TCONS_00000055"; gene_id "XLOC_000008"; exon_number "1";
-chr1	Cufflinks	transcript	3191513	3192077	.	.	.	transcript_id "TCONS_00000056"; gene_id "XLOC_000009"; oId "CUFF.9.1"; class_code "u"; tss_id "TSS11";
-chr1	Cufflinks	exon	3191513	3192077	.	.	.	transcript_id "TCONS_00000056"; gene_id "XLOC_000009"; exon_number "1";
-chr1	Cufflinks	transcript	3191539	3191669	.	.	.	transcript_id "TCONS_00000007"; gene_id "XLOC_000009"; oId "CUFF.35.1"; contained_in "TCONS_00000056"; class_code "u"; tss_id "TSS11";
-chr1	Cufflinks	exon	3191539	3191669	.	.	.	transcript_id "TCONS_00000007"; gene_id "XLOC_000009"; exon_number "1";
-chr1	Cufflinks	transcript	3191877	3191945	.	.	.	transcript_id "TCONS_00000008"; gene_id "XLOC_000009"; oId "CUFF.37.1"; contained_in "TCONS_00000056"; class_code "u"; tss_id "TSS12";
-chr1	Cufflinks	exon	3191877	3191945	.	.	.	transcript_id "TCONS_00000008"; gene_id "XLOC_000009"; exon_number "1";
-chr1	Cufflinks	transcript	3192251	3192336	.	.	.	transcript_id "TCONS_00000057"; gene_id "XLOC_000010"; oId "CUFF.13.1"; class_code "u"; tss_id "TSS13";
-chr1	Cufflinks	exon	3192251	3192336	.	.	.	transcript_id "TCONS_00000057"; gene_id "XLOC_000010"; exon_number "1";
-chr1	Cufflinks	transcript	3192442	3192494	.	.	.	transcript_id "TCONS_00000009"; gene_id "XLOC_000011"; oId "CUFF.39.1"; class_code "u"; tss_id "TSS14";
-chr1	Cufflinks	exon	3192442	3192494	.	.	.	transcript_id "TCONS_00000009"; gene_id "XLOC_000011"; exon_number "1";
-chr1	Cufflinks	transcript	3192551	3192629	.	.	.	transcript_id "TCONS_00000010"; gene_id "XLOC_000012"; oId "CUFF.41.1"; class_code "u"; tss_id "TSS15";
-chr1	Cufflinks	exon	3192551	3192629	.	.	.	transcript_id "TCONS_00000010"; gene_id "XLOC_000012"; exon_number "1";
-chr1	Cufflinks	transcript	3192650	3192676	.	.	.	transcript_id "TCONS_00000058"; gene_id "XLOC_000013"; oId "CUFF.15.1"; class_code "u"; tss_id "TSS16";
-chr1	Cufflinks	exon	3192650	3192676	.	.	.	transcript_id "TCONS_00000058"; gene_id "XLOC_000013"; exon_number "1";
-chr1	Cufflinks	transcript	3192732	3192811	.	.	.	transcript_id "TCONS_00000011"; gene_id "XLOC_000014"; oId "CUFF.43.1"; class_code "u"; tss_id "TSS17";
-chr1	Cufflinks	exon	3192732	3192811	.	.	.	transcript_id "TCONS_00000011"; gene_id "XLOC_000014"; exon_number "1";
-chr1	Cufflinks	transcript	3192941	3193042	.	.	.	transcript_id "TCONS_00000012"; gene_id "XLOC_000015"; oId "CUFF.45.1"; class_code "u"; tss_id "TSS18";
-chr1	Cufflinks	exon	3192941	3193042	.	.	.	transcript_id "TCONS_00000012"; gene_id "XLOC_000015"; exon_number "1";
-chr1	Cufflinks	transcript	3194186	3194226	.	.	.	transcript_id "TCONS_00000013"; gene_id "XLOC_000016"; oId "CUFF.47.1"; class_code "u"; tss_id "TSS19";
-chr1	Cufflinks	exon	3194186	3194226	.	.	.	transcript_id "TCONS_00000013"; gene_id "XLOC_000016"; exon_number "1";
-chr1	Cufflinks	transcript	3194303	3194329	.	.	.	transcript_id "TCONS_00000014"; gene_id "XLOC_000017"; oId "CUFF.49.1"; class_code "u"; tss_id "TSS20";
-chr1	Cufflinks	exon	3194303	3194329	.	.	.	transcript_id "TCONS_00000014"; gene_id "XLOC_000017"; exon_number "1";
-chr1	Cufflinks	transcript	3194707	3194733	.	.	.	transcript_id "TCONS_00000059"; gene_id "XLOC_000018"; oId "CUFF.17.1"; class_code "u"; tss_id "TSS21";
-chr1	Cufflinks	exon	3194707	3194733	.	.	.	transcript_id "TCONS_00000059"; gene_id "XLOC_000018"; exon_number "1";
-chr1	Cufflinks	transcript	3195084	3195110	.	.	.	transcript_id "TCONS_00000015"; gene_id "XLOC_000019"; oId "CUFF.51.1"; class_code "u"; tss_id "TSS22";
-chr1	Cufflinks	exon	3195084	3195110	.	.	.	transcript_id "TCONS_00000015"; gene_id "XLOC_000019"; exon_number "1";
-chr1	Cufflinks	transcript	3195451	3195477	.	.	.	transcript_id "TCONS_00000016"; gene_id "XLOC_000020"; oId "CUFF.53.1"; class_code "u"; tss_id "TSS23";
-chr1	Cufflinks	exon	3195451	3195477	.	.	.	transcript_id "TCONS_00000016"; gene_id "XLOC_000020"; exon_number "1";
-chr1	Cufflinks	transcript	3197090	3197116	.	.	.	transcript_id "TCONS_00000017"; gene_id "XLOC_000021"; oId "CUFF.55.1"; class_code "u"; tss_id "TSS24";
-chr1	Cufflinks	exon	3197090	3197116	.	.	.	transcript_id "TCONS_00000017"; gene_id "XLOC_000021"; exon_number "1";
-chr1	Cufflinks	transcript	3197247	3197273	.	.	.	transcript_id "TCONS_00000018"; gene_id "XLOC_000022"; oId "CUFF.57.1"; class_code "u"; tss_id "TSS25";
-chr1	Cufflinks	exon	3197247	3197273	.	.	.	transcript_id "TCONS_00000018"; gene_id "XLOC_000022"; exon_number "1";
-chr1	Cufflinks	transcript	3197347	3197373	.	.	.	transcript_id "TCONS_00000019"; gene_id "XLOC_000023"; oId "CUFF.59.1"; class_code "u"; tss_id "TSS26";
-chr1	Cufflinks	exon	3197347	3197373	.	.	.	transcript_id "TCONS_00000019"; gene_id "XLOC_000023"; exon_number "1";
-chr1	Cufflinks	transcript	3197426	3197452	.	.	.	transcript_id "TCONS_00000060"; gene_id "XLOC_000024"; oId "CUFF.19.1"; class_code "u"; tss_id "TSS27";
-chr1	Cufflinks	exon	3197426	3197452	.	.	.	transcript_id "TCONS_00000060"; gene_id "XLOC_000024"; exon_number "1";
-chr1	Cufflinks	transcript	3200023	3200191	.	.	.	transcript_id "TCONS_00000020"; gene_id "XLOC_000025"; oId "CUFF.7.1"; class_code "u"; tss_id "TSS28";
-chr1	Cufflinks	exon	3200023	3200191	.	.	.	transcript_id "TCONS_00000020"; gene_id "XLOC_000025"; exon_number "1";
-chr1	Cufflinks	transcript	3200057	3200144	.	.	.	transcript_id "TCONS_00000061"; gene_id "XLOC_000025"; oId "CUFF.23.1"; contained_in "TCONS_00000020"; class_code "u"; tss_id "TSS28";
-chr1	Cufflinks	exon	3200057	3200144	.	.	.	transcript_id "TCONS_00000061"; gene_id "XLOC_000025"; exon_number "1";
-chr1	Cufflinks	transcript	3200326	3200352	.	.	.	transcript_id "TCONS_00000021"; gene_id "XLOC_000026"; oId "CUFF.5.1"; class_code "u"; tss_id "TSS29";
-chr1	Cufflinks	exon	3200326	3200352	.	.	.	transcript_id "TCONS_00000021"; gene_id "XLOC_000026"; exon_number "1";
-chr1	Cufflinks	transcript	3200431	3200457	.	.	.	transcript_id "TCONS_00000062"; gene_id "XLOC_000027"; oId "CUFF.21.1"; class_code "u"; tss_id "TSS30";
-chr1	Cufflinks	exon	3200431	3200457	.	.	.	transcript_id "TCONS_00000062"; gene_id "XLOC_000027"; exon_number "1";
-chr1	Cufflinks	transcript	3201008	3201039	.	.	.	transcript_id "TCONS_00000063"; gene_id "XLOC_000028"; oId "CUFF.26.1"; class_code "u"; tss_id "TSS31";
-chr1	Cufflinks	exon	3201008	3201039	.	.	.	transcript_id "TCONS_00000063"; gene_id "XLOC_000028"; exon_number "1";
-chr1	Cufflinks	transcript	3201078	3201481	.	.	.	transcript_id "TCONS_00000022"; gene_id "XLOC_000029"; oId "CUFF.9.1"; class_code "u"; tss_id "TSS32";
-chr1	Cufflinks	exon	3201078	3201481	.	.	.	transcript_id "TCONS_00000022"; gene_id "XLOC_000029"; exon_number "1";
-chr1	Cufflinks	transcript	3201161	3201187	.	.	.	transcript_id "TCONS_00000064"; gene_id "XLOC_000029"; oId "CUFF.25.1"; contained_in "TCONS_00000022"; class_code "u"; tss_id "TSS32";
-chr1	Cufflinks	exon	3201161	3201187	.	.	.	transcript_id "TCONS_00000064"; gene_id "XLOC_000029"; exon_number "1";
-chr1	Cufflinks	transcript	3201597	3201666	.	.	.	transcript_id "TCONS_00000065"; gene_id "XLOC_000030"; oId "CUFF.29.1"; class_code "u"; tss_id "TSS33";
-chr1	Cufflinks	exon	3201597	3201666	.	.	.	transcript_id "TCONS_00000065"; gene_id "XLOC_000030"; exon_number "1";
-chr1	Cufflinks	transcript	3201673	3201699	.	.	.	transcript_id "TCONS_00000023"; gene_id "XLOC_000031"; oId "CUFF.11.1"; class_code "u"; tss_id "TSS34";
-chr1	Cufflinks	exon	3201673	3201699	.	.	.	transcript_id "TCONS_00000023"; gene_id "XLOC_000031"; exon_number "1";
-chr1	Cufflinks	transcript	3201726	3201809	.	.	.	transcript_id "TCONS_00000066"; gene_id "XLOC_000032"; oId "CUFF.31.1"; class_code "u"; tss_id "TSS35";
-chr1	Cufflinks	exon	3201726	3201809	.	.	.	transcript_id "TCONS_00000066"; gene_id "XLOC_000032"; exon_number "1";
-chr1	Cufflinks	transcript	3211522	3211561	.	.	.	transcript_id "TCONS_00000067"; gene_id "XLOC_000033"; gene_name "Xkr4"; oId "CUFF.33.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS36";
-chr1	Cufflinks	exon	3211522	3211561	.	.	.	transcript_id "TCONS_00000067"; gene_id "XLOC_000033"; exon_number "1";
-chr1	Cufflinks	transcript	3212214	3212292	.	.	.	transcript_id "TCONS_00000024"; gene_id "XLOC_000034"; gene_name "Xkr4"; oId "CUFF.15.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS37";
-chr1	Cufflinks	exon	3212214	3212292	.	.	.	transcript_id "TCONS_00000024"; gene_id "XLOC_000034"; exon_number "1";
-chr1	Cufflinks	transcript	3212368	3212439	.	.	.	transcript_id "TCONS_00000025"; gene_id "XLOC_000035"; gene_name "Xkr4"; oId "CUFF.19.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS38";
-chr1	Cufflinks	exon	3212368	3212439	.	.	.	transcript_id "TCONS_00000025"; gene_id "XLOC_000035"; exon_number "1";
-chr1	Cufflinks	transcript	3212718	3212801	.	.	.	transcript_id "TCONS_00000068"; gene_id "XLOC_000036"; gene_name "Xkr4"; oId "CUFF.35.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS39";
-chr1	Cufflinks	exon	3212718	3212801	.	.	.	transcript_id "TCONS_00000068"; gene_id "XLOC_000036"; exon_number "1";
-chr1	Cufflinks	transcript	3213096	3213192	.	.	.	transcript_id "TCONS_00000026"; gene_id "XLOC_000037"; gene_name "Xkr4"; oId "CUFF.17.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS40";
-chr1	Cufflinks	exon	3213096	3213192	.	.	.	transcript_id "TCONS_00000026"; gene_id "XLOC_000037"; exon_number "1";
-chr1	Cufflinks	transcript	3213119	3213242	.	.	.	transcript_id "TCONS_00000069"; gene_id "XLOC_000037"; gene_name "Xkr4"; oId "CUFF.37.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS40";
-chr1	Cufflinks	exon	3213119	3213242	.	.	.	transcript_id "TCONS_00000069"; gene_id "XLOC_000037"; exon_number "1";
-chr1	Cufflinks	transcript	3240607	3240633	.	.	.	transcript_id "TCONS_00000070"; gene_id "XLOC_000038"; gene_name "Xkr4"; oId "CUFF.39.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS41";
-chr1	Cufflinks	exon	3240607	3240633	.	.	.	transcript_id "TCONS_00000070"; gene_id "XLOC_000038"; exon_number "1";
-chr1	Cufflinks	transcript	3242480	3242512	.	.	.	transcript_id "TCONS_00000071"; gene_id "XLOC_000039"; gene_name "Xkr4"; oId "CUFF.41.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS42";
-chr1	Cufflinks	exon	3242480	3242512	.	.	.	transcript_id "TCONS_00000071"; gene_id "XLOC_000039"; exon_number "1";
-chr1	Cufflinks	transcript	3242634	3242923	.	.	.	transcript_id "TCONS_00000027"; gene_id "XLOC_000040"; gene_name "Xkr4"; oId "CUFF.25.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS43";
-chr1	Cufflinks	exon	3242634	3242923	.	.	.	transcript_id "TCONS_00000027"; gene_id "XLOC_000040"; exon_number "1";
-chr1	Cufflinks	transcript	3242925	3243005	.	.	.	transcript_id "TCONS_00000072"; gene_id "XLOC_000041"; gene_name "Xkr4"; oId "CUFF.43.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS44";
-chr1	Cufflinks	exon	3242925	3243005	.	.	.	transcript_id "TCONS_00000072"; gene_id "XLOC_000041"; exon_number "1";
-chr1	Cufflinks	transcript	3243019	3243079	.	.	.	transcript_id "TCONS_00000028"; gene_id "XLOC_000042"; gene_name "Xkr4"; oId "CUFF.21.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS45";
-chr1	Cufflinks	exon	3243019	3243079	.	.	.	transcript_id "TCONS_00000028"; gene_id "XLOC_000042"; exon_number "1";
-chr1	Cufflinks	transcript	3243109	3243154	.	.	.	transcript_id "TCONS_00000073"; gene_id "XLOC_000043"; gene_name "Xkr4"; oId "CUFF.45.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS46";
-chr1	Cufflinks	exon	3243109	3243154	.	.	.	transcript_id "TCONS_00000073"; gene_id "XLOC_000043"; exon_number "1";
-chr1	Cufflinks	transcript	3243348	3243401	.	.	.	transcript_id "TCONS_00000029"; gene_id "XLOC_000044"; gene_name "Xkr4"; oId "CUFF.23.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS47";
-chr1	Cufflinks	exon	3243348	3243401	.	.	.	transcript_id "TCONS_00000029"; gene_id "XLOC_000044"; exon_number "1";
-chr1	Cufflinks	transcript	3254080	3254106	.	.	.	transcript_id "TCONS_00000074"; gene_id "XLOC_000045"; gene_name "Xkr4"; oId "CUFF.47.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS48";
-chr1	Cufflinks	exon	3254080	3254106	.	.	.	transcript_id "TCONS_00000074"; gene_id "XLOC_000045"; exon_number "1";
-chr1	Cufflinks	transcript	3256975	3257011	.	.	.	transcript_id "TCONS_00000030"; gene_id "XLOC_000046"; gene_name "Xkr4"; oId "CUFF.27.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS49";
-chr1	Cufflinks	exon	3256975	3257011	.	.	.	transcript_id "TCONS_00000030"; gene_id "XLOC_000046"; exon_number "1";
-chr1	Cufflinks	transcript	3277156	3277182	.	.	.	transcript_id "TCONS_00000075"; gene_id "XLOC_000047"; gene_name "Xkr4"; oId "CUFF.49.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS50";
-chr1	Cufflinks	exon	3277156	3277182	.	.	.	transcript_id "TCONS_00000075"; gene_id "XLOC_000047"; exon_number "1";
-chr1	Cufflinks	transcript	3277191	3277218	.	.	.	transcript_id "TCONS_00000031"; gene_id "XLOC_000048"; gene_name "Xkr4"; oId "CUFF.61.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS51";
-chr1	Cufflinks	exon	3277191	3277218	.	.	.	transcript_id "TCONS_00000031"; gene_id "XLOC_000048"; exon_number "1";
-chr1	Cufflinks	transcript	3277914	3278390	.	.	.	transcript_id "TCONS_00000076"; gene_id "XLOC_000049"; gene_name "Xkr4"; oId "CUFF.51.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS52";
-chr1	Cufflinks	exon	3277914	3278390	.	.	.	transcript_id "TCONS_00000076"; gene_id "XLOC_000049"; exon_number "1";
-chr1	Cufflinks	transcript	3278237	3278263	.	.	.	transcript_id "TCONS_00000032"; gene_id "XLOC_000049"; gene_name "Xkr4"; oId "CUFF.63.1"; contained_in "TCONS_00000076"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS53";
-chr1	Cufflinks	exon	3278237	3278263	.	.	.	transcript_id "TCONS_00000032"; gene_id "XLOC_000049"; exon_number "1";
-chr1	Cufflinks	transcript	3280118	3280144	.	.	.	transcript_id "TCONS_00000077"; gene_id "XLOC_000050"; gene_name "Xkr4"; oId "CUFF.53.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS54";
-chr1	Cufflinks	exon	3280118	3280144	.	.	.	transcript_id "TCONS_00000077"; gene_id "XLOC_000050"; exon_number "1";
-chr1	Cufflinks	transcript	3280499	3280525	.	.	.	transcript_id "TCONS_00000078"; gene_id "XLOC_000051"; gene_name "Xkr4"; oId "CUFF.55.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS55";
-chr1	Cufflinks	exon	3280499	3280525	.	.	.	transcript_id "TCONS_00000078"; gene_id "XLOC_000051"; exon_number "1";
-chr1	Cufflinks	transcript	3280687	3280741	.	.	.	transcript_id "TCONS_00000033"; gene_id "XLOC_000052"; gene_name "Xkr4"; oId "CUFF.65.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS56";
-chr1	Cufflinks	exon	3280687	3280741	.	.	.	transcript_id "TCONS_00000033"; gene_id "XLOC_000052"; exon_number "1";
-chr1	Cufflinks	transcript	3282505	3282531	.	.	.	transcript_id "TCONS_00000079"; gene_id "XLOC_000053"; gene_name "Xkr4"; oId "CUFF.57.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS57";
-chr1	Cufflinks	exon	3282505	3282531	.	.	.	transcript_id "TCONS_00000079"; gene_id "XLOC_000053"; exon_number "1";
-chr1	Cufflinks	transcript	3282651	3282677	.	.	.	transcript_id "TCONS_00000080"; gene_id "XLOC_000054"; gene_name "Xkr4"; oId "CUFF.59.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS58";
-chr1	Cufflinks	exon	3282651	3282677	.	.	.	transcript_id "TCONS_00000080"; gene_id "XLOC_000054"; exon_number "1";
-chr1	Cufflinks	transcript	3282761	3282832	.	.	.	transcript_id "TCONS_00000081"; gene_id "XLOC_000055"; gene_name "Xkr4"; oId "CUFF.61.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS59";
-chr1	Cufflinks	exon	3282761	3282832	.	.	.	transcript_id "TCONS_00000081"; gene_id "XLOC_000055"; exon_number "1";
-chr1	Cufflinks	transcript	3284967	3284993	.	.	.	transcript_id "TCONS_00000082"; gene_id "XLOC_000056"; gene_name "Xkr4"; oId "CUFF.63.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS60";
-chr1	Cufflinks	exon	3284967	3284993	.	.	.	transcript_id "TCONS_00000082"; gene_id "XLOC_000056"; exon_number "1";
-chr1	Cufflinks	transcript	3290489	3290553	.	.	.	transcript_id "TCONS_00000034"; gene_id "XLOC_000057"; gene_name "Xkr4"; oId "CUFF.67.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS61";
-chr1	Cufflinks	exon	3290489	3290553	.	.	.	transcript_id "TCONS_00000034"; gene_id "XLOC_000057"; exon_number "1";
-chr1	Cufflinks	transcript	3290799	3290859	.	.	.	transcript_id "TCONS_00000083"; gene_id "XLOC_000058"; gene_name "Xkr4"; oId "CUFF.65.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS62";
-chr1	Cufflinks	exon	3290799	3290859	.	.	.	transcript_id "TCONS_00000083"; gene_id "XLOC_000058"; exon_number "1";
-chr1	Cufflinks	transcript	3290920	3291273	.	.	.	transcript_id "TCONS_00000084"; gene_id "XLOC_000059"; gene_name "Xkr4"; oId "CUFF.69.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS63";
-chr1	Cufflinks	exon	3290920	3291273	.	.	.	transcript_id "TCONS_00000084"; gene_id "XLOC_000059"; exon_number "1";
-chr1	Cufflinks	transcript	3290940	3291023	.	.	.	transcript_id "TCONS_00000035"; gene_id "XLOC_000059"; gene_name "Xkr4"; oId "CUFF.69.1"; contained_in "TCONS_00000084"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS63";
-chr1	Cufflinks	exon	3290940	3291023	.	.	.	transcript_id "TCONS_00000035"; gene_id "XLOC_000059"; exon_number "1";
-chr1	Cufflinks	transcript	3291089	3291186	.	.	.	transcript_id "TCONS_00000036"; gene_id "XLOC_000059"; gene_name "Xkr4"; oId "CUFF.71.1"; contained_in "TCONS_00000084"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS64";
-chr1	Cufflinks	exon	3291089	3291186	.	.	.	transcript_id "TCONS_00000036"; gene_id "XLOC_000059"; exon_number "1";
-chr1	Cufflinks	transcript	3299444	3299640	.	.	.	transcript_id "TCONS_00000085"; gene_id "XLOC_000060"; gene_name "Xkr4"; oId "CUFF.67.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS65";
-chr1	Cufflinks	exon	3299444	3299640	.	.	.	transcript_id "TCONS_00000085"; gene_id "XLOC_000060"; exon_number "1";
-chr1	Cufflinks	transcript	3299610	3299664	.	.	.	transcript_id "TCONS_00000037"; gene_id "XLOC_000060"; gene_name "Xkr4"; oId "CUFF.73.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS66";
-chr1	Cufflinks	exon	3299610	3299664	.	.	.	transcript_id "TCONS_00000037"; gene_id "XLOC_000060"; exon_number "1";
-chr1	Cufflinks	transcript	3299692	3299733	.	.	.	transcript_id "TCONS_00000086"; gene_id "XLOC_000061"; gene_name "Xkr4"; oId "CUFF.71.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS67";
-chr1	Cufflinks	exon	3299692	3299733	.	.	.	transcript_id "TCONS_00000086"; gene_id "XLOC_000061"; exon_number "1";
-chr1	Cufflinks	transcript	3300052	3300078	.	.	.	transcript_id "TCONS_00000038"; gene_id "XLOC_000062"; gene_name "Xkr4"; oId "CUFF.75.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS68";
-chr1	Cufflinks	exon	3300052	3300078	.	.	.	transcript_id "TCONS_00000038"; gene_id "XLOC_000062"; exon_number "1";
-chr1	Cufflinks	transcript	3307749	3307775	.	.	.	transcript_id "TCONS_00000087"; gene_id "XLOC_000063"; gene_name "Xkr4"; oId "CUFF.73.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS69";
-chr1	Cufflinks	exon	3307749	3307775	.	.	.	transcript_id "TCONS_00000087"; gene_id "XLOC_000063"; exon_number "1";
-chr1	Cufflinks	transcript	3318621	3318647	.	.	.	transcript_id "TCONS_00000088"; gene_id "XLOC_000064"; gene_name "Xkr4"; oId "CUFF.75.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS70";
-chr1	Cufflinks	exon	3318621	3318647	.	.	.	transcript_id "TCONS_00000088"; gene_id "XLOC_000064"; exon_number "1";
-chr1	Cufflinks	transcript	3319000	3319051	.	.	.	transcript_id "TCONS_00000039"; gene_id "XLOC_000065"; gene_name "Xkr4"; oId "CUFF.77.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS71";
-chr1	Cufflinks	exon	3319000	3319051	.	.	.	transcript_id "TCONS_00000039"; gene_id "XLOC_000065"; exon_number "1";
-chr1	Cufflinks	transcript	3330528	3330554	.	.	.	transcript_id "TCONS_00000089"; gene_id "XLOC_000066"; gene_name "Xkr4"; oId "CUFF.77.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS72";
-chr1	Cufflinks	exon	3330528	3330554	.	.	.	transcript_id "TCONS_00000089"; gene_id "XLOC_000066"; exon_number "1";
-chr1	Cufflinks	transcript	3351241	3351311	.	.	.	transcript_id "TCONS_00000090"; gene_id "XLOC_000067"; gene_name "Xkr4"; oId "CUFF.79.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS73";
-chr1	Cufflinks	exon	3351241	3351311	.	.	.	transcript_id "TCONS_00000090"; gene_id "XLOC_000067"; exon_number "1";
-chr1	Cufflinks	transcript	3355888	3355914	.	.	.	transcript_id "TCONS_00000040"; gene_id "XLOC_000068"; gene_name "Xkr4"; oId "CUFF.79.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS74";
-chr1	Cufflinks	exon	3355888	3355914	.	.	.	transcript_id "TCONS_00000040"; gene_id "XLOC_000068"; exon_number "1";
-chr1	Cufflinks	transcript	3355908	3356119	.	.	.	transcript_id "TCONS_00000091"; gene_id "XLOC_000068"; gene_name "Xkr4"; oId "CUFF.81.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS74";
-chr1	Cufflinks	exon	3355908	3356119	.	.	.	transcript_id "TCONS_00000091"; gene_id "XLOC_000068"; exon_number "1";
-chr1	Cufflinks	transcript	3356181	3356225	.	.	.	transcript_id "TCONS_00000092"; gene_id "XLOC_000069"; gene_name "Xkr4"; oId "CUFF.83.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS75";
-chr1	Cufflinks	exon	3356181	3356225	.	.	.	transcript_id "TCONS_00000092"; gene_id "XLOC_000069"; exon_number "1";
-chr1	Cufflinks	transcript	3363077	3363176	.	.	.	transcript_id "TCONS_00000093"; gene_id "XLOC_000070"; gene_name "Xkr4"; oId "CUFF.85.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS76";
-chr1	Cufflinks	exon	3363077	3363176	.	.	.	transcript_id "TCONS_00000093"; gene_id "XLOC_000070"; exon_number "1";
-chr1	Cufflinks	transcript	3363215	3363278	.	.	.	transcript_id "TCONS_00000041"; gene_id "XLOC_000071"; gene_name "Xkr4"; oId "CUFF.81.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS77";
-chr1	Cufflinks	exon	3363215	3363278	.	.	.	transcript_id "TCONS_00000041"; gene_id "XLOC_000071"; exon_number "1";
-chr1	Cufflinks	transcript	3363388	3363446	.	.	.	transcript_id "TCONS_00000094"; gene_id "XLOC_000072"; gene_name "Xkr4"; oId "CUFF.87.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS78";
-chr1	Cufflinks	exon	3363388	3363446	.	.	.	transcript_id "TCONS_00000094"; gene_id "XLOC_000072"; exon_number "1";
-chr1	Cufflinks	transcript	3363754	3363849	.	.	.	transcript_id "TCONS_00000042"; gene_id "XLOC_000073"; gene_name "Xkr4"; oId "CUFF.83.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS79";
-chr1	Cufflinks	exon	3363754	3363849	.	.	.	transcript_id "TCONS_00000042"; gene_id "XLOC_000073"; exon_number "1";
-chr1	Cufflinks	transcript	3364872	3364919	.	.	.	transcript_id "TCONS_00000095"; gene_id "XLOC_000074"; gene_name "Xkr4"; oId "CUFF.89.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS80";
-chr1	Cufflinks	exon	3364872	3364919	.	.	.	transcript_id "TCONS_00000095"; gene_id "XLOC_000074"; exon_number "1";
-chr1	Cufflinks	transcript	3367136	3367162	.	.	.	transcript_id "TCONS_00000043"; gene_id "XLOC_000075"; gene_name "Xkr4"; oId "CUFF.85.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS81";
-chr1	Cufflinks	exon	3367136	3367162	.	.	.	transcript_id "TCONS_00000043"; gene_id "XLOC_000075"; exon_number "1";
-chr1	Cufflinks	transcript	3367211	3367237	.	.	.	transcript_id "TCONS_00000096"; gene_id "XLOC_000076"; gene_name "Xkr4"; oId "CUFF.91.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS82";
-chr1	Cufflinks	exon	3367211	3367237	.	.	.	transcript_id "TCONS_00000096"; gene_id "XLOC_000076"; exon_number "1";
-chr1	Cufflinks	transcript	3367334	3367382	.	.	.	transcript_id "TCONS_00000044"; gene_id "XLOC_000077"; gene_name "Xkr4"; oId "CUFF.87.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS83";
-chr1	Cufflinks	exon	3367334	3367382	.	.	.	transcript_id "TCONS_00000044"; gene_id "XLOC_000077"; exon_number "1";
-chr1	Cufflinks	transcript	3369581	3369607	.	.	.	transcript_id "TCONS_00000097"; gene_id "XLOC_000078"; gene_name "Xkr4"; oId "CUFF.93.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS84";
-chr1	Cufflinks	exon	3369581	3369607	.	.	.	transcript_id "TCONS_00000097"; gene_id "XLOC_000078"; exon_number "1";
-chr1	Cufflinks	transcript	3375002	3375028	.	.	.	transcript_id "TCONS_00000098"; gene_id "XLOC_000079"; gene_name "Xkr4"; oId "CUFF.95.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS85";
-chr1	Cufflinks	exon	3375002	3375028	.	.	.	transcript_id "TCONS_00000098"; gene_id "XLOC_000079"; exon_number "1";
-chr1	Cufflinks	transcript	3377212	3377262	.	.	.	transcript_id "TCONS_00000045"; gene_id "XLOC_000080"; gene_name "Xkr4"; oId "CUFF.89.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS86";
-chr1	Cufflinks	exon	3377212	3377262	.	.	.	transcript_id "TCONS_00000045"; gene_id "XLOC_000080"; exon_number "1";
-chr1	Cufflinks	transcript	3379889	3379915	.	.	.	transcript_id "TCONS_00000099"; gene_id "XLOC_000081"; gene_name "Xkr4"; oId "CUFF.97.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS87";
-chr1	Cufflinks	exon	3379889	3379915	.	.	.	transcript_id "TCONS_00000099"; gene_id "XLOC_000081"; exon_number "1";
-chr1	Cufflinks	transcript	3386740	3386836	.	.	.	transcript_id "TCONS_00000100"; gene_id "XLOC_000082"; gene_name "Xkr4"; oId "CUFF.99.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS88";
-chr1	Cufflinks	exon	3386740	3386836	.	.	.	transcript_id "TCONS_00000100"; gene_id "XLOC_000082"; exon_number "1";
-chr1	Cufflinks	transcript	3391326	3391352	.	.	.	transcript_id "TCONS_00000046"; gene_id "XLOC_000083"; gene_name "Xkr4"; oId "CUFF.91.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS89";
-chr1	Cufflinks	exon	3391326	3391352	.	.	.	transcript_id "TCONS_00000046"; gene_id "XLOC_000083"; exon_number "1";
-chr1	Cufflinks	transcript	3435842	3435880	.	.	.	transcript_id "TCONS_00000047"; gene_id "XLOC_000084"; gene_name "Xkr4"; oId "CUFF.93.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS90";
-chr1	Cufflinks	exon	3435842	3435880	.	.	.	transcript_id "TCONS_00000047"; gene_id "XLOC_000084"; exon_number "1";
-chr1	Cufflinks	transcript	3447762	3447788	.	.	.	transcript_id "TCONS_00000048"; gene_id "XLOC_000085"; gene_name "Xkr4"; oId "CUFF.95.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS91";
-chr1	Cufflinks	exon	3447762	3447788	.	.	.	transcript_id "TCONS_00000048"; gene_id "XLOC_000085"; exon_number "1";
-chr1	Cufflinks	transcript	3450907	3450965	.	.	.	transcript_id "TCONS_00000049"; gene_id "XLOC_000086"; gene_name "Xkr4"; oId "CUFF.97.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS92";
-chr1	Cufflinks	exon	3450907	3450965	.	.	.	transcript_id "TCONS_00000049"; gene_id "XLOC_000086"; exon_number "1";
-chr1	Cufflinks	transcript	3451052	3451109	.	.	.	transcript_id "TCONS_00000050"; gene_id "XLOC_000087"; gene_name "Xkr4"; oId "CUFF.99.1"; cmp_ref "Xkr4"; class_code "i"; tss_id "TSS93";
-chr1	Cufflinks	exon	3451052	3451109	.	.	.	transcript_id "TCONS_00000050"; gene_id "XLOC_000087"; exon_number "1";
+chr1	Cufflinks	transcript	12	20	.	+	.	transcript_id "TCONS_00000006"; gene_id "XLOC_000001"; oId "CUFF.3.1"; tss_id "TSS1";
+chr1	Cufflinks	exon	12	20	.	+	.	transcript_id "TCONS_00000006"; gene_id "XLOC_000001"; exon_number "1";
+chr1	Cufflinks	transcript	32	40	.	+	.	transcript_id "TCONS_00000001"; gene_id "XLOC_000002"; oId "CUFF.7.1"; tss_id "TSS2";
+chr1	Cufflinks	exon	32	40	.	+	.	transcript_id "TCONS_00000001"; gene_id "XLOC_000002"; exon_number "1";
+chr1	Cufflinks	transcript	42	47	.	+	.	transcript_id "TCONS_00000007"; gene_id "XLOC_000003"; oId "CUFF.7.1"; contained_in "TCONS_00000002"; tss_id "TSS3";
+chr1	Cufflinks	exon	42	47	.	+	.	transcript_id "TCONS_00000007"; gene_id "XLOC_000003"; exon_number "1";
+chr1	Cufflinks	transcript	42	50	.	+	.	transcript_id "TCONS_00000002"; gene_id "XLOC_000003"; oId "CUFF.9.1"; tss_id "TSS3";
+chr1	Cufflinks	exon	42	50	.	+	.	transcript_id "TCONS_00000002"; gene_id "XLOC_000003"; exon_number "1";
+chr1	Cufflinks	transcript	52	60	.	+	.	transcript_id "TCONS_00000003"; gene_id "XLOC_000004"; oId "CUFF.10.1"; tss_id "TSS4";
+chr1	Cufflinks	exon	52	60	.	+	.	transcript_id "TCONS_00000003"; gene_id "XLOC_000004"; exon_number "1";
+chr1	Cufflinks	transcript	2	10	.	-	.	transcript_id "TCONS_00000004"; gene_id "XLOC_000005"; oId "CUFF.1.1"; tss_id "TSS5";
+chr1	Cufflinks	exon	2	10	.	-	.	transcript_id "TCONS_00000004"; gene_id "XLOC_000005"; exon_number "1";
+chr1	Cufflinks	transcript	15	20	.	-	.	transcript_id "TCONS_00000005"; gene_id "XLOC_000006"; oId "CUFF.3.1"; tss_id "TSS6";
+chr1	Cufflinks	exon	15	20	.	-	.	transcript_id "TCONS_00000005"; gene_id "XLOC_000006"; exon_number "1";
+chr1	Cufflinks	transcript	22	30	.	-	.	transcript_id "TCONS_00000008"; gene_id "XLOC_000007"; oId "CUFF.5.1"; tss_id "TSS7";
+chr1	Cufflinks	exon	22	30	.	-	.	transcript_id "TCONS_00000008"; gene_id "XLOC_000007"; exon_number "1";
--- a/test-data/gffcompare_out1.loci	Tue Feb 05 15:51:44 2019 -0500
+++ b/test-data/gffcompare_out1.loci	Mon May 27 13:54:15 2019 -0400
@@ -1,87 +1,7 @@
-XLOC_000001	chr1[-]3204563-3661579	Xkr4|Xkr4	CUFF.13.1	-
-XLOC_000002	chr1[.]3111450-3111490	-	CUFF.1.1	-
-XLOC_000003	chr1[.]3111546-3111576	-	CUFF.3.1	-
-XLOC_000004	chr1[.]3174766-3174792	-	-	CUFF.1.1
-XLOC_000005	chr1[.]3187402-3187428	-	-	CUFF.3.1
-XLOC_000006	chr1[.]3188522-3188548	-	-	CUFF.5.1
-XLOC_000007	chr1[.]3189811-3190789	-	CUFF.29.1,CUFF.31.1,CUFF.33.1	CUFF.11.1
-XLOC_000008	chr1[.]3190859-3191434	-	-	CUFF.7.1
-XLOC_000009	chr1[.]3191513-3192077	-	CUFF.35.1,CUFF.37.1	CUFF.9.1
-XLOC_000010	chr1[.]3192251-3192336	-	-	CUFF.13.1
-XLOC_000011	chr1[.]3192442-3192494	-	CUFF.39.1	-
-XLOC_000012	chr1[.]3192551-3192629	-	CUFF.41.1	-
-XLOC_000013	chr1[.]3192650-3192676	-	-	CUFF.15.1
-XLOC_000014	chr1[.]3192732-3192811	-	CUFF.43.1	-
-XLOC_000015	chr1[.]3192941-3193042	-	CUFF.45.1	-
-XLOC_000016	chr1[.]3194186-3194226	-	CUFF.47.1	-
-XLOC_000017	chr1[.]3194303-3194329	-	CUFF.49.1	-
-XLOC_000018	chr1[.]3194707-3194733	-	-	CUFF.17.1
-XLOC_000019	chr1[.]3195084-3195110	-	CUFF.51.1	-
-XLOC_000020	chr1[.]3195451-3195477	-	CUFF.53.1	-
-XLOC_000021	chr1[.]3197090-3197116	-	CUFF.55.1	-
-XLOC_000022	chr1[.]3197247-3197273	-	CUFF.57.1	-
-XLOC_000023	chr1[.]3197347-3197373	-	CUFF.59.1	-
-XLOC_000024	chr1[.]3197426-3197452	-	-	CUFF.19.1
-XLOC_000025	chr1[.]3200023-3200191	-	CUFF.7.1	CUFF.23.1
-XLOC_000026	chr1[.]3200326-3200352	-	CUFF.5.1	-
-XLOC_000027	chr1[.]3200431-3200457	-	-	CUFF.21.1
-XLOC_000028	chr1[.]3201008-3201039	-	-	CUFF.26.1
-XLOC_000029	chr1[.]3201078-3201481	-	CUFF.9.1	CUFF.25.1
-XLOC_000030	chr1[.]3201597-3201666	-	-	CUFF.29.1
-XLOC_000031	chr1[.]3201673-3201699	-	CUFF.11.1	-
-XLOC_000032	chr1[.]3201726-3201809	-	-	CUFF.31.1
-XLOC_000033	chr1[.]3211522-3211561	-	-	CUFF.33.1
-XLOC_000034	chr1[.]3212214-3212292	-	CUFF.15.1	-
-XLOC_000035	chr1[.]3212368-3212439	-	CUFF.19.1	-
-XLOC_000036	chr1[.]3212718-3212801	-	-	CUFF.35.1
-XLOC_000037	chr1[.]3213096-3213242	-	CUFF.17.1	CUFF.37.1
-XLOC_000038	chr1[.]3240607-3240633	-	-	CUFF.39.1
-XLOC_000039	chr1[.]3242480-3242512	-	-	CUFF.41.1
-XLOC_000040	chr1[.]3242634-3242923	-	CUFF.25.1	-
-XLOC_000041	chr1[.]3242925-3243005	-	-	CUFF.43.1
-XLOC_000042	chr1[.]3243019-3243079	-	CUFF.21.1	-
-XLOC_000043	chr1[.]3243109-3243154	-	-	CUFF.45.1
-XLOC_000044	chr1[.]3243348-3243401	-	CUFF.23.1	-
-XLOC_000045	chr1[.]3254080-3254106	-	-	CUFF.47.1
-XLOC_000046	chr1[.]3256975-3257011	-	CUFF.27.1	-
-XLOC_000047	chr1[.]3277156-3277182	-	-	CUFF.49.1
-XLOC_000048	chr1[.]3277191-3277218	-	CUFF.61.1	-
-XLOC_000049	chr1[.]3277914-3278390	-	CUFF.63.1	CUFF.51.1
-XLOC_000050	chr1[.]3280118-3280144	-	-	CUFF.53.1
-XLOC_000051	chr1[.]3280499-3280525	-	-	CUFF.55.1
-XLOC_000052	chr1[.]3280687-3280741	-	CUFF.65.1	-
-XLOC_000053	chr1[.]3282505-3282531	-	-	CUFF.57.1
-XLOC_000054	chr1[.]3282651-3282677	-	-	CUFF.59.1
-XLOC_000055	chr1[.]3282761-3282832	-	-	CUFF.61.1
-XLOC_000056	chr1[.]3284967-3284993	-	-	CUFF.63.1
-XLOC_000057	chr1[.]3290489-3290553	-	CUFF.67.1	-
-XLOC_000058	chr1[.]3290799-3290859	-	-	CUFF.65.1
-XLOC_000059	chr1[.]3290920-3291273	-	CUFF.69.1,CUFF.71.1	CUFF.69.1
-XLOC_000060	chr1[.]3299444-3299664	-	CUFF.73.1	CUFF.67.1
-XLOC_000061	chr1[.]3299692-3299733	-	-	CUFF.71.1
-XLOC_000062	chr1[.]3300052-3300078	-	CUFF.75.1	-
-XLOC_000063	chr1[.]3307749-3307775	-	-	CUFF.73.1
-XLOC_000064	chr1[.]3318621-3318647	-	-	CUFF.75.1
-XLOC_000065	chr1[.]3319000-3319051	-	CUFF.77.1	-
-XLOC_000066	chr1[.]3330528-3330554	-	-	CUFF.77.1
-XLOC_000067	chr1[.]3351241-3351311	-	-	CUFF.79.1
-XLOC_000068	chr1[.]3355888-3356119	-	CUFF.79.1	CUFF.81.1
-XLOC_000069	chr1[.]3356181-3356225	-	-	CUFF.83.1
-XLOC_000070	chr1[.]3363077-3363176	-	-	CUFF.85.1
-XLOC_000071	chr1[.]3363215-3363278	-	CUFF.81.1	-
-XLOC_000072	chr1[.]3363388-3363446	-	-	CUFF.87.1
-XLOC_000073	chr1[.]3363754-3363849	-	CUFF.83.1	-
-XLOC_000074	chr1[.]3364872-3364919	-	-	CUFF.89.1
-XLOC_000075	chr1[.]3367136-3367162	-	CUFF.85.1	-
-XLOC_000076	chr1[.]3367211-3367237	-	-	CUFF.91.1
-XLOC_000077	chr1[.]3367334-3367382	-	CUFF.87.1	-
-XLOC_000078	chr1[.]3369581-3369607	-	-	CUFF.93.1
-XLOC_000079	chr1[.]3375002-3375028	-	-	CUFF.95.1
-XLOC_000080	chr1[.]3377212-3377262	-	CUFF.89.1	-
-XLOC_000081	chr1[.]3379889-3379915	-	-	CUFF.97.1
-XLOC_000082	chr1[.]3386740-3386836	-	-	CUFF.99.1
-XLOC_000083	chr1[.]3391326-3391352	-	CUFF.91.1	-
-XLOC_000084	chr1[.]3435842-3435880	-	CUFF.93.1	-
-XLOC_000085	chr1[.]3447762-3447788	-	CUFF.95.1	-
-XLOC_000086	chr1[.]3450907-3450965	-	CUFF.97.1	-
-XLOC_000087	chr1[.]3451052-3451109	-	CUFF.99.1	-
+XLOC_000001	chr1[+]12-20	-	-	CUFF.3.1
+XLOC_000002	chr1[+]32-40	-	CUFF.7.1	-
+XLOC_000003	chr1[+]42-50	-	CUFF.9.1	CUFF.7.1
+XLOC_000004	chr1[+]52-60	-	CUFF.10.1	-
+XLOC_000005	chr1[-]2-10	-	CUFF.1.1	CUFF.1.1
+XLOC_000006	chr1[-]15-20	-	CUFF.3.1	-
+XLOC_000007	chr1[-]22-30	-	-	CUFF.5.1
--- a/test-data/gffcompare_out1.stats	Tue Feb 05 15:51:44 2019 -0500
+++ b/test-data/gffcompare_out1.stats	Mon May 27 13:54:15 2019 -0400
@@ -1,35 +1,15 @@
-# gffcompare v0.10.6 | Command line was:
-#gffcompare -r /tmp/tmp7AvPf0/files/000/dataset_3.dat -R -e 100 -d 100 -p TCONS gffcompare_in1_gtf gffcompare_in2_gtf
+# gffcompare v0.11.2 | Command line was:
+#gffcompare -e 100 -d 100 -p TCONS gffcompare_in1_gtf gffcompare_in2_gtf
 #
 
 #= Summary for dataset: gffcompare_in1_gtf 
-#     Query mRNAs :      50 in      50 loci  (0 multi-exon transcripts)
+#     Query mRNAs :       5 in       5 loci  (0 multi-exon transcripts)
 #            (0 multi-transcript loci, ~1.0 transcripts per locus)
-# Reference mRNAs :       1 in       1 loci  (1 multi-exon)
-# Super-loci w/ reference transcripts:        1
-#-----------------| Sensitivity | Precision  |
-        Base level:     2.2     |     2.3    |
-        Exon level:     0.0     |     0.0    |
-      Intron level:     0.0     |    -nan    |
-Intron chain level:     0.0     |    -nan    |
-  Transcript level:     0.0     |     0.0    |
-       Locus level:     0.0     |     0.0    |
-
-     Matching intron chains:       0
-       Matching transcripts:       0
-              Matching loci:       0
-
-          Missed exons:       2/3	( 66.7%)
-           Novel exons:      49/50	( 98.0%)
-        Missed introns:       2/2	(100.0%)
-           Missed loci:       0/1	(  0.0%)
-            Novel loci:      49/50	( 98.0%)
 
 #= Summary for dataset: gffcompare_in2_gtf 
-#     Query mRNAs :      50 in      50 loci  (0 multi-exon transcripts)
+#     Query mRNAs :       4 in       4 loci  (0 multi-exon transcripts)
 #            (0 multi-transcript loci, ~1.0 transcripts per locus)
-# Reference mRNAs :       0 in       0 loci  (0 multi-exon)
 
- Total union super-loci across all input datasets: 87 
+ Total union super-loci across all input datasets: 7 
   (0 multi-transcript, ~1.1 transcripts per locus)
-100 out of 100 consensus transcripts written in gffcmp.combined.gtf (0 discarded as redundant)
+8 out of 8 consensus transcripts written in gffcmp.combined.gtf (0 discarded as redundant)
--- a/test-data/gffcompare_out1.tracking	Tue Feb 05 15:51:44 2019 -0500
+++ b/test-data/gffcompare_out1.tracking	Mon May 27 13:54:15 2019 -0400
@@ -1,100 +1,8 @@
-TCONS_00000001	XLOC_000001	Xkr4|Xkr4	c	q1:CUFF.13|CUFF.13.1|1|10.695258|0.000000|0.683544|79	-
-TCONS_00000002	XLOC_000002	-	u	q1:CUFF.1|CUFF.1.1|1|20.607936|0.000000|1.317073|41	-
-TCONS_00000003	XLOC_000003	-	u	q1:CUFF.3|CUFF.3.1|1|27.255658|0.000000|1.741935|31	-
-TCONS_00000004	XLOC_000007	-	u	q1:CUFF.29|CUFF.29.1|1|107.103219|0.000000|6.845070|142	-
-TCONS_00000005	XLOC_000007	-	u	q1:CUFF.31|CUFF.31.1|1|122.650461|0.000000|7.838710|31	-
-TCONS_00000006	XLOC_000007	-	u	q1:CUFF.33|CUFF.33.1|1|109.527366|0.000000|7.000000|27	-
-TCONS_00000007	XLOC_000009	-	u	q1:CUFF.35|CUFF.35.1|1|96.747183|0.000000|6.183206|131	-
-TCONS_00000008	XLOC_000009	-	u	q1:CUFF.37|CUFF.37.1|1|104.085013|0.000000|6.652174|69	-
-TCONS_00000009	XLOC_000011	-	u	q1:CUFF.39|CUFF.39.1|1|23.912983|0.000000|1.528302|53	-
-TCONS_00000010	XLOC_000012	-	u	q1:CUFF.41|CUFF.41.1|1|10.695258|0.000000|0.683544|79	-
-TCONS_00000011	XLOC_000014	-	u	q1:CUFF.43|CUFF.43.1|1|10.561567|0.000000|0.675000|80	-
-TCONS_00000012	XLOC_000015	-	u	q1:CUFF.45|CUFF.45.1|1|20.708956|0.000000|1.323529|102	-
-TCONS_00000013	XLOC_000016	-	u	q1:CUFF.47|CUFF.47.1|1|20.607936|0.000000|1.317073|41	-
-TCONS_00000014	XLOC_000017	-	u	q1:CUFF.49|CUFF.49.1|1|15.646767|0.000000|1.000000|27	-
-TCONS_00000015	XLOC_000019	-	u	q1:CUFF.51|CUFF.51.1|1|31.293533|0.000000|2.000000|27	-
-TCONS_00000016	XLOC_000020	-	u	q1:CUFF.53|CUFF.53.1|1|31.293533|0.000000|2.000000|27	-
-TCONS_00000017	XLOC_000021	-	u	q1:CUFF.55|CUFF.55.1|1|31.293533|0.000000|2.000000|27	-
-TCONS_00000018	XLOC_000022	-	u	q1:CUFF.57|CUFF.57.1|1|15.646767|0.000000|1.000000|27	-
-TCONS_00000019	XLOC_000023	-	u	q1:CUFF.59|CUFF.59.1|1|15.646767|0.000000|1.000000|27	-
-TCONS_00000020	XLOC_000025	-	u	q1:CUFF.7|CUFF.7.1|1|9.999117|0.000000|0.639053|169	-
-TCONS_00000021	XLOC_000026	-	u	q1:CUFF.5|CUFF.5.1|1|31.293533|0.000000|2.000000|27	-
-TCONS_00000022	XLOC_000029	-	u	q1:CUFF.9|CUFF.9.1|1|17.776896|0.000000|1.136139|404	-
-TCONS_00000023	XLOC_000031	-	u	q1:CUFF.11|CUFF.11.1|1|31.293533|0.000000|2.000000|27	-
-TCONS_00000024	XLOC_000034	Xkr4|Xkr4	i	q1:CUFF.15|CUFF.15.1|1|10.695258|0.000000|0.683544|79	-
-TCONS_00000025	XLOC_000035	Xkr4|Xkr4	i	q1:CUFF.19|CUFF.19.1|1|29.337687|0.000000|1.875000|72	-
-TCONS_00000026	XLOC_000037	Xkr4|Xkr4	i	q1:CUFF.17|CUFF.17.1|1|8.710571|0.000000|0.556701|97	-
-TCONS_00000027	XLOC_000040	Xkr4|Xkr4	i	q1:CUFF.25|CUFF.25.1|1|14.567679|0.000000|0.931034|290	-
-TCONS_00000028	XLOC_000042	Xkr4|Xkr4	i	q1:CUFF.21|CUFF.21.1|1|13.851236|0.000000|0.885246|61	-
-TCONS_00000029	XLOC_000044	Xkr4|Xkr4	i	q1:CUFF.23|CUFF.23.1|1|23.470150|0.000000|1.500000|54	-
-TCONS_00000030	XLOC_000046	Xkr4|Xkr4	i	q1:CUFF.27|CUFF.27.1|1|34.253732|0.000000|2.189189|37	-
-TCONS_00000031	XLOC_000048	Xkr4|Xkr4	i	q1:CUFF.61|CUFF.61.1|1|45.263860|0.000000|2.892857|28	-
-TCONS_00000032	XLOC_000049	Xkr4|Xkr4	i	q1:CUFF.63|CUFF.63.1|1|15.646767|0.000000|1.000000|27	-
-TCONS_00000033	XLOC_000052	Xkr4|Xkr4	i	q1:CUFF.65|CUFF.65.1|1|15.362280|0.000000|0.981818|55	-
-TCONS_00000034	XLOC_000057	Xkr4|Xkr4	i	q1:CUFF.67|CUFF.67.1|1|12.998852|0.000000|0.830769|65	-
-TCONS_00000035	XLOC_000059	Xkr4|Xkr4	i	q1:CUFF.69|CUFF.69.1|1|10.058636|0.000000|0.642857|84	-
-TCONS_00000036	XLOC_000059	Xkr4|Xkr4	i	q1:CUFF.71|CUFF.71.1|1|8.621688|0.000000|0.551020|98	-
-TCONS_00000037	XLOC_000060	Xkr4|Xkr4	i	q1:CUFF.73|CUFF.73.1|1|15.362280|0.000000|0.981818|55	-
-TCONS_00000038	XLOC_000062	Xkr4|Xkr4	i	q1:CUFF.75|CUFF.75.1|1|31.293533|0.000000|2.000000|27	-
-TCONS_00000039	XLOC_000065	Xkr4|Xkr4	i	q1:CUFF.77|CUFF.77.1|1|16.248565|0.000000|1.038462|52	-
-TCONS_00000040	XLOC_000068	Xkr4|Xkr4	i	q1:CUFF.79|CUFF.79.1|1|31.293533|0.000000|2.000000|27	-
-TCONS_00000041	XLOC_000071	Xkr4|Xkr4	i	q1:CUFF.81|CUFF.81.1|1|13.201959|0.000000|0.843750|64	-
-TCONS_00000042	XLOC_000073	Xkr4|Xkr4	i	q1:CUFF.83|CUFF.83.1|1|13.201959|0.000000|0.843750|96	-
-TCONS_00000043	XLOC_000075	Xkr4|Xkr4	i	q1:CUFF.85|CUFF.85.1|1|31.293533|0.000000|2.000000|27	-
-TCONS_00000044	XLOC_000077	Xkr4|Xkr4	i	q1:CUFF.87|CUFF.87.1|1|17.243375|0.000000|1.102041|49	-
-TCONS_00000045	XLOC_000080	Xkr4|Xkr4	i	q1:CUFF.89|CUFF.89.1|1|16.567165|0.000000|1.058824|51	-
-TCONS_00000046	XLOC_000083	Xkr4|Xkr4	i	q1:CUFF.91|CUFF.91.1|1|31.293533|0.000000|2.000000|27	-
-TCONS_00000047	XLOC_000084	Xkr4|Xkr4	i	q1:CUFF.93|CUFF.93.1|1|21.664754|0.000000|1.384615|39	-
-TCONS_00000048	XLOC_000085	Xkr4|Xkr4	i	q1:CUFF.95|CUFF.95.1|1|46.940300|0.000000|3.000000|27	-
-TCONS_00000049	XLOC_000086	Xkr4|Xkr4	i	q1:CUFF.97|CUFF.97.1|1|21.481154|0.000000|1.372881|59	-
-TCONS_00000050	XLOC_000087	Xkr4|Xkr4	i	q1:CUFF.99|CUFF.99.1|1|14.567679|0.000000|0.931034|58	-
-TCONS_00000051	XLOC_000004	-	u	-	q2:CUFF.1|CUFF.1.1|1|35.211287|0.000000|2.000000|27
-TCONS_00000052	XLOC_000005	-	u	-	q2:CUFF.3|CUFF.3.1|1|35.211287|0.000000|2.000000|27
-TCONS_00000053	XLOC_000006	-	u	-	q2:CUFF.5|CUFF.5.1|1|21.226627|0.000000|1.205672|27
-TCONS_00000054	XLOC_000007	-	u	-	q2:CUFF.11|CUFF.11.1|1|32.531777|0.000000|1.847804|979
-TCONS_00000055	XLOC_000008	-	u	-	q2:CUFF.7|CUFF.7.1|1|29.709524|0.000000|1.687500|576
-TCONS_00000056	XLOC_000009	-	u	-	q2:CUFF.9|CUFF.9.1|1|34.072933|0.000000|1.935341|565
-TCONS_00000057	XLOC_000010	-	u	-	q2:CUFF.13|CUFF.13.1|1|16.582060|0.000000|0.941860|86
-TCONS_00000058	XLOC_000013	-	u	-	q2:CUFF.15|CUFF.15.1|1|35.211287|0.000000|2.000000|27
-TCONS_00000059	XLOC_000018	-	u	-	q2:CUFF.17|CUFF.17.1|1|35.211287|0.000000|2.000000|27
-TCONS_00000060	XLOC_000024	-	u	-	q2:CUFF.19|CUFF.19.1|1|35.211287|0.000000|2.000000|27
-TCONS_00000061	XLOC_000025	-	u	-	q2:CUFF.23|CUFF.23.1|1|16.205195|0.000000|0.920455|88
-TCONS_00000062	XLOC_000027	-	u	-	q2:CUFF.21|CUFF.21.1|1|35.211287|0.000000|2.000000|27
-TCONS_00000063	XLOC_000028	-	u	-	q2:CUFF.26|CUFF.26.1|1|29.709524|0.000000|1.687500|32
-TCONS_00000064	XLOC_000029	-	u	-	q2:CUFF.25|CUFF.25.1|1|35.211287|0.000000|2.000000|27
-TCONS_00000065	XLOC_000030	-	u	-	q2:CUFF.29|CUFF.29.1|1|13.581496|0.000000|0.771429|70
-TCONS_00000066	XLOC_000032	-	u	-	q2:CUFF.31|CUFF.31.1|1|22.635827|0.000000|1.285714|84
-TCONS_00000067	XLOC_000033	Xkr4|Xkr4	i	-	q2:CUFF.33|CUFF.33.1|1|23.767619|0.000000|1.350000|40
-TCONS_00000068	XLOC_000036	Xkr4|Xkr4	i	-	q2:CUFF.35|CUFF.35.1|1|11.317914|0.000000|0.642857|84
-TCONS_00000069	XLOC_000037	Xkr4|Xkr4	i	-	q2:CUFF.37|CUFF.37.1|1|11.500461|0.000000|0.653226|124
-TCONS_00000070	XLOC_000038	Xkr4|Xkr4	i	-	q2:CUFF.39|CUFF.39.1|1|52.816931|0.000000|3.000000|27
-TCONS_00000071	XLOC_000039	Xkr4|Xkr4	i	-	q2:CUFF.41|CUFF.41.1|1|43.213852|0.000000|2.454545|33
-TCONS_00000072	XLOC_000041	Xkr4|Xkr4	i	-	q2:CUFF.43|CUFF.43.1|1|23.474191|0.000000|1.333333|81
-TCONS_00000073	XLOC_000043	Xkr4|Xkr4	i	-	q2:CUFF.45|CUFF.45.1|1|20.667495|0.000000|1.173913|46
-TCONS_00000074	XLOC_000045	Xkr4|Xkr4	i	-	q2:CUFF.47|CUFF.47.1|1|35.211287|0.000000|2.000000|27
-TCONS_00000075	XLOC_000047	Xkr4|Xkr4	i	-	q2:CUFF.49|CUFF.49.1|1|35.211287|0.000000|2.000000|27
-TCONS_00000076	XLOC_000049	Xkr4|Xkr4	i	-	q2:CUFF.51|CUFF.51.1|1|14.948188|0.000000|0.849057|477
-TCONS_00000077	XLOC_000050	Xkr4|Xkr4	i	-	q2:CUFF.53|CUFF.53.1|1|52.816931|0.000000|3.000000|27
-TCONS_00000078	XLOC_000051	Xkr4|Xkr4	i	-	q2:CUFF.55|CUFF.55.1|1|35.211287|0.000000|2.000000|27
-TCONS_00000079	XLOC_000053	Xkr4|Xkr4	i	-	q2:CUFF.57|CUFF.57.1|1|35.211287|0.000000|2.000000|27
-TCONS_00000080	XLOC_000054	Xkr4|Xkr4	i	-	q2:CUFF.59|CUFF.59.1|1|35.211287|0.000000|2.000000|27
-TCONS_00000081	XLOC_000055	Xkr4|Xkr4	i	-	q2:CUFF.61|CUFF.61.1|1|13.204233|0.000000|0.750000|72
-TCONS_00000082	XLOC_000056	Xkr4|Xkr4	i	-	q2:CUFF.63|CUFF.63.1|1|35.211287|0.000000|2.000000|27
-TCONS_00000083	XLOC_000058	Xkr4|Xkr4	i	-	q2:CUFF.65|CUFF.65.1|1|31.170648|0.000000|1.770492|61
-TCONS_00000084	XLOC_000059	Xkr4|Xkr4	i	-	q2:CUFF.69|CUFF.69.1|1|18.799247|0.000000|1.067797|354
-TCONS_00000085	XLOC_000060	Xkr4|Xkr4	i	-	q2:CUFF.67|CUFF.67.1|1|15.681351|0.000000|0.890700|197
-TCONS_00000086	XLOC_000061	Xkr4|Xkr4	i	-	q2:CUFF.71|CUFF.71.1|1|22.635827|0.000000|1.285714|42
-TCONS_00000087	XLOC_000063	Xkr4|Xkr4	i	-	q2:CUFF.73|CUFF.73.1|1|35.211287|0.000000|2.000000|27
-TCONS_00000088	XLOC_000064	Xkr4|Xkr4	i	-	q2:CUFF.75|CUFF.75.1|1|52.816931|0.000000|3.000000|27
-TCONS_00000089	XLOC_000066	Xkr4|Xkr4	i	-	q2:CUFF.77|CUFF.77.1|1|17.605644|0.000000|1.000000|27
-TCONS_00000090	XLOC_000067	Xkr4|Xkr4	i	-	q2:CUFF.79|CUFF.79.1|1|13.390208|0.000000|0.760563|71
-TCONS_00000091	XLOC_000068	Xkr4|Xkr4	i	-	q2:CUFF.81|CUFF.81.1|1|11.211141|0.000000|0.636792|212
-TCONS_00000092	XLOC_000069	Xkr4|Xkr4	i	-	q2:CUFF.83|CUFF.83.1|1|21.126772|0.000000|1.200000|45
-TCONS_00000093	XLOC_000070	Xkr4|Xkr4	i	-	q2:CUFF.85|CUFF.85.1|1|19.014095|0.000000|1.080000|100
-TCONS_00000094	XLOC_000072	Xkr4|Xkr4	i	-	q2:CUFF.87|CUFF.87.1|1|24.170460|0.000000|1.372881|59
-TCONS_00000095	XLOC_000074	Xkr4|Xkr4	i	-	q2:CUFF.89|CUFF.89.1|1|29.709524|0.000000|1.687500|48
-TCONS_00000096	XLOC_000076	Xkr4|Xkr4	i	-	q2:CUFF.91|CUFF.91.1|1|35.211287|0.000000|2.000000|27
-TCONS_00000097	XLOC_000078	Xkr4|Xkr4	i	-	q2:CUFF.93|CUFF.93.1|1|35.211287|0.000000|2.000000|27
-TCONS_00000098	XLOC_000079	Xkr4|Xkr4	i	-	q2:CUFF.95|CUFF.95.1|1|35.211287|0.000000|2.000000|27
-TCONS_00000099	XLOC_000081	Xkr4|Xkr4	i	-	q2:CUFF.97|CUFF.97.1|1|35.211287|0.000000|2.000000|27
-TCONS_00000100	XLOC_000082	Xkr4|Xkr4	i	-	q2:CUFF.99|CUFF.99.1|1|19.602160|0.000000|1.113402|97
+TCONS_00000001	XLOC_000002	-	u	q1:CUFF.7|CUFF.7.1|1|9.999117|0.000000|0.639053|9	-
+TCONS_00000002	XLOC_000003	-	u	q1:CUFF.9|CUFF.9.1|1|17.776896|0.000000|1.136139|9	-
+TCONS_00000003	XLOC_000004	-	u	q1:CUFF.10|CUFF.10.1|1|17.776896|0.000000|1.136139|9	-
+TCONS_00000004	XLOC_000005	-	u	q1:CUFF.1|CUFF.1.1|1|20.607936|0.000000|1.317073|9	q2:CUFF.1|CUFF.1.1|1|35.211287|0.000000|2.000000|9
+TCONS_00000005	XLOC_000006	-	u	q1:CUFF.3|CUFF.3.1|1|27.255658|0.000000|1.741935|6	-
+TCONS_00000006	XLOC_000001	-	u	-	q2:CUFF.3|CUFF.3.1|1|35.211287|0.000000|2.000000|9
+TCONS_00000007	XLOC_000003	-	u	-	q2:CUFF.7|CUFF.7.1|1|29.709524|0.000000|1.687500|6
+TCONS_00000008	XLOC_000007	-	u	-	q2:CUFF.5|CUFF.5.1|1|21.226627|0.000000|1.205672|9
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gffcompare_out2-1.refmap	Mon May 27 13:54:15 2019 -0400
@@ -0,0 +1,2 @@
+ref_gene_id	ref_id	class_code	qry_id_list
+Lypla1	Lypla1	c	CUFF.7|CUFF.7.1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gffcompare_out2-1.tmap	Mon May 27 13:54:15 2019 -0400
@@ -0,0 +1,6 @@
+ref_gene_id	ref_id	class_code	qry_gene_id	qry_id	num_exons	FPKM	TPM		cov	len	major_iso_id	ref_match_len
+-	-	u	CUFF.1	CUFF.1.1	1	20.607936	0.000000	1.317073	9	CUFF.1.1	-
+-	-	u	CUFF.3	CUFF.3.1	1	27.255658	0.000000	1.741935	6	CUFF.3.1	-
+Lypla1	Lypla1	c	CUFF.7	CUFF.7.1	1	9.999117	0.000000	0.639053	9	CUFF.7.1	19
+Lypla1	Lypla1	c	CUFF.9	CUFF.9.1	1	17.776896	0.000000	1.136139	9	CUFF.9.1	19
+Lypla1	Lypla1	p	CUFF.10	CUFF.10.1	1	17.776896	0.000000	1.136139	9	CUFF.10.1	19
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gffcompare_out2-2.refmap	Mon May 27 13:54:15 2019 -0400
@@ -0,0 +1,2 @@
+ref_gene_id	ref_id	class_code	qry_id_list
+Lypla1	Lypla1	c	CUFF.7|CUFF.7.1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gffcompare_out2-2.tmap	Mon May 27 13:54:15 2019 -0400
@@ -0,0 +1,5 @@
+ref_gene_id	ref_id	class_code	qry_gene_id	qry_id	num_exons	FPKM	TPM		cov	len	major_iso_id	ref_match_len
+-	-	u	CUFF.1	CUFF.1.1	1	35.211287	0.000000	2.000000	9	CUFF.1.1	-
+-	-	u	CUFF.3	CUFF.3.1	1	35.211287	0.000000	2.000000	9	CUFF.3.1	-
+-	-	u	CUFF.5	CUFF.5.1	1	21.226627	0.000000	1.205672	9	CUFF.5.1	-
+Lypla1	Lypla1	c	CUFF.7	CUFF.7.1	1	29.709524	0.000000	1.687500	6	CUFF.7.1	19
--- a/test-data/gffcompare_out2.gtf	Tue Feb 05 15:51:44 2019 -0500
+++ b/test-data/gffcompare_out2.gtf	Mon May 27 13:54:15 2019 -0400
@@ -1,206 +1,16 @@
-chr1	StringTie	transcript	160930303	160940234	.	+	.	transcript_id "MSTRG.3.1"; gene_id "MSTRG.3"; gene_name "uc007del.2"; xloc "XLOC_000001"; cmp_ref "uc007del.2"; class_code "c"; tss_id "TSS1";
-chr1	StringTie	exon	160930303	160930344	.	+	.	transcript_id "MSTRG.3.1"; gene_id "MSTRG.3"; exon_number "1";
-chr1	StringTie	exon	160938112	160938232	.	+	.	transcript_id "MSTRG.3.1"; gene_id "MSTRG.3"; exon_number "2";
-chr1	StringTie	exon	160939995	160940234	.	+	.	transcript_id "MSTRG.3.1"; gene_id "MSTRG.3"; exon_number "3";
-chr1	StringTie	transcript	160940817	160967997	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; gene_name "uc007del.2"; xloc "XLOC_000001"; cmp_ref "uc007del.2"; class_code "c"; tss_id "TSS2";
-chr1	StringTie	exon	160940817	160940994	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "1";
-chr1	StringTie	exon	160942528	160942728	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "2";
-chr1	StringTie	exon	160946534	160946666	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "3";
-chr1	StringTie	exon	160948307	160948425	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "4";
-chr1	StringTie	exon	160950222	160950334	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "5";
-chr1	StringTie	exon	160950841	160951122	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "6";
-chr1	StringTie	exon	160951615	160951829	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "7";
-chr1	StringTie	exon	160954784	160955151	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "8";
-chr1	StringTie	exon	160955815	160955979	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "9";
-chr1	StringTie	exon	160959401	160959553	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "10";
-chr1	StringTie	exon	160962271	160962484	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "11";
-chr1	StringTie	exon	160963479	160963569	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "12";
-chr1	StringTie	exon	160963708	160963840	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "13";
-chr1	StringTie	exon	160964950	160965120	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "14";
-chr1	StringTie	exon	160965673	160965788	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "15";
-chr1	StringTie	exon	160967647	160967997	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "16";
-chr1	StringTie	transcript	160968644	160972020	.	+	.	transcript_id "MSTRG.5.1"; gene_id "MSTRG.5"; gene_name "uc007del.2"; xloc "XLOC_000001"; cmp_ref "uc007del.2"; class_code "c"; tss_id "TSS3";
-chr1	StringTie	exon	160968644	160972020	.	+	.	transcript_id "MSTRG.5.1"; gene_id "MSTRG.5"; exon_number "1";
-chr1	StringTie	transcript	160972938	160974977	.	+	.	transcript_id "MSTRG.6.1"; gene_id "MSTRG.6"; gene_name "uc007del.2"; xloc "XLOC_000001"; cmp_ref "uc007del.2"; class_code "c"; tss_id "TSS4";
-chr1	StringTie	exon	160972938	160974977	.	+	.	transcript_id "MSTRG.6.1"; gene_id "MSTRG.6"; exon_number "1";
-chr1	StringTie	transcript	161003085	161003516	.	+	.	transcript_id "MSTRG.7.1"; gene_id "MSTRG.7"; xloc "XLOC_000002"; class_code "u"; tss_id "TSS5";
-chr1	StringTie	exon	161003085	161003516	.	+	.	transcript_id "MSTRG.7.1"; gene_id "MSTRG.7"; exon_number "1";
-chr1	StringTie	transcript	161006151	161006466	.	+	.	transcript_id "MSTRG.10.1"; gene_id "MSTRG.10"; xloc "XLOC_000003"; class_code "u"; tss_id "TSS6";
-chr1	StringTie	exon	161006151	161006466	.	+	.	transcript_id "MSTRG.10.1"; gene_id "MSTRG.10"; exon_number "1";
-chr1	StringTie	transcript	161008375	161008625	.	+	.	transcript_id "MSTRG.12.1"; gene_id "MSTRG.12"; xloc "XLOC_000004"; class_code "u"; tss_id "TSS7";
-chr1	StringTie	exon	161008375	161008625	.	+	.	transcript_id "MSTRG.12.1"; gene_id "MSTRG.12"; exon_number "1";
-chr1	StringTie	transcript	161009768	161010195	.	+	.	transcript_id "MSTRG.13.1"; gene_id "MSTRG.13"; xloc "XLOC_000005"; class_code "u"; tss_id "TSS8";
-chr1	StringTie	exon	161009768	161010195	.	+	.	transcript_id "MSTRG.13.1"; gene_id "MSTRG.13"; exon_number "1";
-chr1	StringTie	transcript	161019713	161019962	.	+	.	transcript_id "MSTRG.14.1"; gene_id "MSTRG.14"; gene_name "uc007der.1"; xloc "XLOC_000006"; cmp_ref "uc007der.1"; class_code "x"; tss_id "TSS9";
-chr1	StringTie	exon	161019713	161019962	.	+	.	transcript_id "MSTRG.14.1"; gene_id "MSTRG.14"; exon_number "1";
-chr1	StringTie	transcript	161034351	161038539	.	+	.	transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; gene_name "uc007dev.1"; xloc "XLOC_000007"; cmp_ref "uc007dev.1"; class_code "j"; tss_id "TSS10";
-chr1	StringTie	exon	161034351	161034719	.	+	.	transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "1";
-chr1	StringTie	exon	161035752	161035804	.	+	.	transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "2";
-chr1	StringTie	exon	161035983	161036014	.	+	.	transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "3";
-chr1	StringTie	exon	161036208	161036244	.	+	.	transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "4";
-chr1	StringTie	exon	161036549	161036579	.	+	.	transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "5";
-chr1	StringTie	exon	161036820	161036852	.	+	.	transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "6";
-chr1	StringTie	exon	161037288	161037315	.	+	.	transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "7";
-chr1	StringTie	exon	161037505	161037547	.	+	.	transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "8";
-chr1	StringTie	exon	161037995	161038037	.	+	.	transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "9";
-chr1	StringTie	exon	161038225	161038272	.	+	.	transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "10";
-chr1	StringTie	exon	161038457	161038539	.	+	.	transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "11";
-chr1	StringTie	transcript	161034584	161038539	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; gene_name "uc007dev.1"; xloc "XLOC_000007"; cmp_ref "uc007dev.1"; class_code "j"; tss_id "TSS11";
-chr1	StringTie	exon	161034584	161034719	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "1";
-chr1	StringTie	exon	161035752	161035804	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "2";
-chr1	StringTie	exon	161035983	161036014	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "3";
-chr1	StringTie	exon	161036208	161036244	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "4";
-chr1	StringTie	exon	161036549	161036579	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "5";
-chr1	StringTie	exon	161036820	161036852	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "6";
-chr1	StringTie	exon	161037124	161037164	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "7";
-chr1	StringTie	exon	161037288	161037315	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "8";
-chr1	StringTie	exon	161037505	161037547	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "9";
-chr1	StringTie	exon	161037995	161038037	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "10";
-chr1	StringTie	exon	161038225	161038272	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "11";
-chr1	StringTie	exon	161038457	161038539	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "12";
-chr1	StringTie	transcript	161034642	161038338	.	+	.	transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; gene_name "uc007dev.1"; xloc "XLOC_000007"; cmp_ref "uc007dev.1"; class_code "j"; tss_id "TSS11";
-chr1	StringTie	exon	161034642	161035194	.	+	.	transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "1";
-chr1	StringTie	exon	161035752	161035804	.	+	.	transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "2";
-chr1	StringTie	exon	161035983	161036014	.	+	.	transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "3";
-chr1	StringTie	exon	161036208	161036244	.	+	.	transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "4";
-chr1	StringTie	exon	161036549	161036579	.	+	.	transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "5";
-chr1	StringTie	exon	161036820	161036852	.	+	.	transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "6";
-chr1	StringTie	exon	161037124	161037164	.	+	.	transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "7";
-chr1	StringTie	exon	161037288	161037315	.	+	.	transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "8";
-chr1	StringTie	exon	161037505	161037547	.	+	.	transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "9";
-chr1	StringTie	exon	161037995	161038037	.	+	.	transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "10";
-chr1	StringTie	exon	161038225	161038338	.	+	.	transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "11";
-chr1	StringTie	transcript	161035095	161038539	.	+	.	transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; gene_name "uc007dev.1"; xloc "XLOC_000007"; cmp_ref "uc007dev.1"; class_code "j"; tss_id "TSS12";
-chr1	StringTie	exon	161035095	161035194	.	+	.	transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "1";
-chr1	StringTie	exon	161035752	161035804	.	+	.	transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "2";
-chr1	StringTie	exon	161035983	161036014	.	+	.	transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "3";
-chr1	StringTie	exon	161036208	161036244	.	+	.	transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "4";
-chr1	StringTie	exon	161036549	161036579	.	+	.	transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "5";
-chr1	StringTie	exon	161036820	161036852	.	+	.	transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "6";
-chr1	StringTie	exon	161037288	161037315	.	+	.	transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "7";
-chr1	StringTie	exon	161037505	161037547	.	+	.	transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "8";
-chr1	StringTie	exon	161037995	161038037	.	+	.	transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "9";
-chr1	StringTie	exon	161038225	161038272	.	+	.	transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "10";
-chr1	StringTie	exon	161038457	161038539	.	+	.	transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "11";
-chr1	StringTie	transcript	161035164	161038539	.	+	.	transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; gene_name "uc007dev.1"; xloc "XLOC_000007"; cmp_ref "uc007dev.1"; class_code "="; tss_id "TSS12";
-chr1	StringTie	exon	161035164	161035194	.	+	.	transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "1";
-chr1	StringTie	exon	161035752	161035804	.	+	.	transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "2";
-chr1	StringTie	exon	161035983	161036014	.	+	.	transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "3";
-chr1	StringTie	exon	161036208	161036579	.	+	.	transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "4";
-chr1	StringTie	exon	161036820	161036852	.	+	.	transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "5";
-chr1	StringTie	exon	161037124	161037164	.	+	.	transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "6";
-chr1	StringTie	exon	161037288	161037315	.	+	.	transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "7";
-chr1	StringTie	exon	161037505	161037547	.	+	.	transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "8";
-chr1	StringTie	exon	161037995	161038037	.	+	.	transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "9";
-chr1	StringTie	exon	161038225	161038272	.	+	.	transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "10";
-chr1	StringTie	exon	161038457	161038539	.	+	.	transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "11";
-chr1	StringTie	transcript	161041562	161070639	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; gene_name "uc007dey.2"; xloc "XLOC_000008"; cmp_ref "uc007dey.2"; class_code "s"; tss_id "TSS13";
-chr1	StringTie	exon	161041562	161041930	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "1";
-chr1	StringTie	exon	161043613	161043688	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "2";
-chr1	StringTie	exon	161044959	161045069	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "3";
-chr1	StringTie	exon	161045258	161045476	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "4";
-chr1	StringTie	exon	161046777	161046929	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "5";
-chr1	StringTie	exon	161049938	161050000	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "6";
-chr1	StringTie	exon	161051331	161051438	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "7";
-chr1	StringTie	exon	161056461	161056530	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "8";
-chr1	StringTie	exon	161057447	161057553	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "9";
-chr1	StringTie	exon	161060045	161060091	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "10";
-chr1	StringTie	exon	161060736	161060859	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "11";
-chr1	StringTie	exon	161062782	161062877	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "12";
-chr1	StringTie	exon	161063247	161063348	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "13";
-chr1	StringTie	exon	161065225	161065291	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "14";
-chr1	StringTie	exon	161069080	161069179	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "15";
-chr1	StringTie	exon	161069993	161070639	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "16";
-chr1	StringTie	transcript	161045151	161056533	.	+	.	transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; gene_name "uc007dey.2"; xloc "XLOC_000008"; cmp_ref "uc007dey.2"; class_code "s"; tss_id "TSS14";
-chr1	StringTie	exon	161045151	161045476	.	+	.	transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; exon_number "1";
-chr1	StringTie	exon	161046777	161046929	.	+	.	transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; exon_number "2";
-chr1	StringTie	exon	161049938	161050000	.	+	.	transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; exon_number "3";
-chr1	StringTie	exon	161051331	161051438	.	+	.	transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; exon_number "4";
-chr1	StringTie	exon	161053941	161054120	.	+	.	transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; exon_number "5";
-chr1	StringTie	exon	161056461	161056533	.	+	.	transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; exon_number "6";
-chr1	StringTie	transcript	161070945	161078458	.	+	.	transcript_id "MSTRG.20.1"; gene_id "MSTRG.20"; gene_name "uc007dfd.3"; xloc "XLOC_000009"; cmp_ref "uc007dfd.3"; class_code "c"; tss_id "TSS15";
-chr1	StringTie	exon	161070945	161071356	.	+	.	transcript_id "MSTRG.20.1"; gene_id "MSTRG.20"; exon_number "1";
-chr1	StringTie	exon	161074757	161074930	.	+	.	transcript_id "MSTRG.20.1"; gene_id "MSTRG.20"; exon_number "2";
-chr1	StringTie	exon	161078329	161078458	.	+	.	transcript_id "MSTRG.20.1"; gene_id "MSTRG.20"; exon_number "3";
-chr1	StringTie	transcript	161082956	161083421	.	+	.	transcript_id "MSTRG.21.1"; gene_id "MSTRG.21"; gene_name "uc007dfe.4"; xloc "XLOC_000009"; cmp_ref "uc007dfe.4"; class_code "c"; tss_id "TSS16";
-chr1	StringTie	exon	161082956	161083421	.	+	.	transcript_id "MSTRG.21.1"; gene_id "MSTRG.21"; exon_number "1";
-chr1	StringTie	transcript	161084121	161084344	.	+	.	transcript_id "MSTRG.22.1"; gene_id "MSTRG.22"; gene_name "uc007dfe.4"; xloc "XLOC_000009"; cmp_ref "uc007dfe.4"; class_code "c"; tss_id "TSS17";
-chr1	StringTie	exon	161084121	161084344	.	+	.	transcript_id "MSTRG.22.1"; gene_id "MSTRG.22"; exon_number "1";
-chr1	StringTie	transcript	161085014	161086329	.	+	.	transcript_id "MSTRG.23.1"; gene_id "MSTRG.23"; gene_name "uc056yep.1"; xloc "XLOC_000009"; cmp_ref "uc056yep.1"; class_code "c"; tss_id "TSS18";
-chr1	StringTie	exon	161085014	161086329	.	+	.	transcript_id "MSTRG.23.1"; gene_id "MSTRG.23"; exon_number "1";
-chr1	StringTie	transcript	161088497	161088913	.	+	.	transcript_id "MSTRG.24.1"; gene_id "MSTRG.24"; gene_name "uc007dff.1"; xloc "XLOC_000010"; cmp_ref "uc007dff.1"; class_code "x"; tss_id "TSS19";
-chr1	StringTie	exon	161088497	161088913	.	+	.	transcript_id "MSTRG.24.1"; gene_id "MSTRG.24"; exon_number "1";
-chr1	StringTie	transcript	161089415	161131512	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; gene_name "uc007dff.1"; xloc "XLOC_000011"; cmp_ref "uc007dff.1"; class_code "s"; tss_id "TSS20";
-chr1	StringTie	exon	161089415	161090511	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "1";
-chr1	StringTie	exon	161093681	161093787	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "2";
-chr1	StringTie	exon	161095529	161095737	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "3";
-chr1	StringTie	exon	161098263	161098396	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "4";
-chr1	StringTie	exon	161099142	161099285	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "5";
-chr1	StringTie	exon	161101451	161101634	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "6";
-chr1	StringTie	exon	161102979	161103094	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "7";
-chr1	StringTie	exon	161105401	161105495	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "8";
-chr1	StringTie	exon	161106707	161106865	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "9";
-chr1	StringTie	exon	161109222	161109795	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "10";
-chr1	StringTie	exon	161130389	161130452	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "11";
-chr1	StringTie	exon	161131363	161131512	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "12";
-chr1	StringTie	transcript	161123665	161123877	.	+	.	transcript_id "MSTRG.28.1"; gene_id "MSTRG.28"; gene_name "uc007dff.1"; xloc "XLOC_000012"; cmp_ref "uc007dff.1"; class_code "i"; tss_id "TSS21";
-chr1	StringTie	exon	161123665	161123877	.	+	.	transcript_id "MSTRG.28.1"; gene_id "MSTRG.28"; exon_number "1";
-chr1	StringTie	transcript	29485012	29485458	.	-	.	transcript_id "MSTRG.1.1"; gene_id "MSTRG.1"; xloc "XLOC_000013"; class_code "u"; tss_id "TSS22";
-chr1	StringTie	exon	29485012	29485458	.	-	.	transcript_id "MSTRG.1.1"; gene_id "MSTRG.1"; exon_number "1";
-chr1	StringTie	transcript	86909344	86909692	.	-	.	transcript_id "MSTRG.2.1"; gene_id "MSTRG.2"; xloc "XLOC_000014"; class_code "u"; tss_id "TSS23";
-chr1	StringTie	exon	86909344	86909692	.	-	.	transcript_id "MSTRG.2.1"; gene_id "MSTRG.2"; exon_number "1";
-chr1	StringTie	transcript	161003658	161004769	.	-	.	transcript_id "MSTRG.8.1"; gene_id "MSTRG.8"; xloc "XLOC_000015"; class_code "u"; tss_id "TSS24";
-chr1	StringTie	exon	161003658	161004769	.	-	.	transcript_id "MSTRG.8.1"; gene_id "MSTRG.8"; exon_number "1";
-chr1	StringTie	transcript	161005030	161005802	.	-	.	transcript_id "MSTRG.9.1"; gene_id "MSTRG.9"; xloc "XLOC_000016"; class_code "u"; tss_id "TSS25";
-chr1	StringTie	exon	161005030	161005802	.	-	.	transcript_id "MSTRG.9.1"; gene_id "MSTRG.9"; exon_number "1";
-chr1	StringTie	transcript	161007444	161007700	.	-	.	transcript_id "MSTRG.11.1"; gene_id "MSTRG.11"; xloc "XLOC_000017"; class_code "u"; tss_id "TSS26";
-chr1	StringTie	exon	161007444	161007700	.	-	.	transcript_id "MSTRG.11.1"; gene_id "MSTRG.11"; exon_number "1";
-chr1	StringTie	transcript	161032044	161032396	.	-	.	transcript_id "MSTRG.15.1"; gene_id "MSTRG.15"; gene_name "uc007des.1"; xloc "XLOC_000018"; cmp_ref "uc007des.1"; class_code "c"; tss_id "TSS27";
-chr1	StringTie	exon	161032044	161032396	.	-	.	transcript_id "MSTRG.15.1"; gene_id "MSTRG.15"; exon_number "1";
-chr1	StringTie	transcript	161041525	161050001	.	-	.	transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; gene_name "uc007dey.2"; xloc "XLOC_000019"; cmp_ref "uc007dey.2"; class_code "c"; tss_id "TSS28";
-chr1	StringTie	exon	161041525	161041930	.	-	.	transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; exon_number "1";
-chr1	StringTie	exon	161043613	161043688	.	-	.	transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; exon_number "2";
-chr1	StringTie	exon	161044959	161045069	.	-	.	transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; exon_number "3";
-chr1	StringTie	exon	161045258	161045476	.	-	.	transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; exon_number "4";
-chr1	StringTie	exon	161046777	161046929	.	-	.	transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; exon_number "5";
-chr1	StringTie	exon	161049938	161050001	.	-	.	transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; exon_number "6";
-chr1	StringTie	transcript	161051330	161070504	.	-	.	transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; gene_name "uc007dey.2"; xloc "XLOC_000019"; cmp_ref "uc007dey.2"; class_code "c"; tss_id "TSS29";
-chr1	StringTie	exon	161051330	161051438	.	-	.	transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "1";
-chr1	StringTie	exon	161053941	161054120	.	-	.	transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "2";
-chr1	StringTie	exon	161056461	161056530	.	-	.	transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "3";
-chr1	StringTie	exon	161057447	161057553	.	-	.	transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "4";
-chr1	StringTie	exon	161060045	161060091	.	-	.	transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "5";
-chr1	StringTie	exon	161060736	161060859	.	-	.	transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "6";
-chr1	StringTie	exon	161062782	161062877	.	-	.	transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "7";
-chr1	StringTie	exon	161063247	161063348	.	-	.	transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "8";
-chr1	StringTie	exon	161065225	161065291	.	-	.	transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "9";
-chr1	StringTie	exon	161069080	161069179	.	-	.	transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "10";
-chr1	StringTie	exon	161069993	161070504	.	-	.	transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "11";
-chr1	StringTie	transcript	161051331	161070649	.	-	.	transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; gene_name "uc007dey.2"; xloc "XLOC_000019"; cmp_ref "uc007dey.2"; class_code "j"; tss_id "TSS30";
-chr1	StringTie	exon	161051331	161051438	.	-	.	transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "1";
-chr1	StringTie	exon	161056461	161056530	.	-	.	transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "2";
-chr1	StringTie	exon	161057447	161057553	.	-	.	transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "3";
-chr1	StringTie	exon	161060045	161060091	.	-	.	transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "4";
-chr1	StringTie	exon	161060736	161060859	.	-	.	transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "5";
-chr1	StringTie	exon	161062782	161062877	.	-	.	transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "6";
-chr1	StringTie	exon	161063247	161063348	.	-	.	transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "7";
-chr1	StringTie	exon	161065225	161065291	.	-	.	transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "8";
-chr1	StringTie	exon	161069080	161069179	.	-	.	transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "9";
-chr1	StringTie	exon	161069993	161070649	.	-	.	transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "10";
-chr1	StringTie	transcript	161088915	161090275	.	-	.	transcript_id "MSTRG.25.1"; gene_id "MSTRG.25"; gene_name "uc007dff.1"; xloc "XLOC_000020"; cmp_ref "uc007dff.1"; class_code "c"; tss_id "TSS31";
-chr1	StringTie	exon	161088915	161090275	.	-	.	transcript_id "MSTRG.25.1"; gene_id "MSTRG.25"; exon_number "1";
-chr1	StringTie	transcript	161090412	161131492	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; gene_name "uc007dff.1"; xloc "XLOC_000020"; cmp_ref "uc007dff.1"; class_code "="; tss_id "TSS32";
-chr1	StringTie	exon	161090412	161090511	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "1";
-chr1	StringTie	exon	161093681	161093787	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "2";
-chr1	StringTie	exon	161095529	161095737	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "3";
-chr1	StringTie	exon	161098263	161098396	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "4";
-chr1	StringTie	exon	161099142	161099285	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "5";
-chr1	StringTie	exon	161101451	161101634	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "6";
-chr1	StringTie	exon	161102979	161103094	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "7";
-chr1	StringTie	exon	161105401	161105495	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "8";
-chr1	StringTie	exon	161106707	161106865	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "9";
-chr1	StringTie	exon	161109222	161109795	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "10";
-chr1	StringTie	exon	161130389	161130452	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "11";
-chr1	StringTie	exon	161131363	161131492	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "12";
-chr1	StringTie	transcript	192074156	192074378	.	-	.	transcript_id "MSTRG.29.1"; gene_id "MSTRG.29"; xloc "XLOC_000021"; class_code "u"; tss_id "TSS33";
-chr1	StringTie	exon	192074156	192074378	.	-	.	transcript_id "MSTRG.29.1"; gene_id "MSTRG.29"; exon_number "1";
+chr1	Cufflinks	transcript	12	20	.	+	.	transcript_id "TCONS_00000006"; gene_id "XLOC_000001"; oId "CUFF.3.1"; class_code "u"; tss_id "TSS1";
+chr1	Cufflinks	exon	12	20	.	+	.	transcript_id "TCONS_00000006"; gene_id "XLOC_000001"; exon_number "1";
+chr1	Cufflinks	transcript	32	40	.	+	.	transcript_id "TCONS_00000001"; gene_id "XLOC_000002"; gene_name "Lypla1"; oId "CUFF.7.1"; cmp_ref "Lypla1"; class_code "c"; tss_id "TSS2";
+chr1	Cufflinks	exon	32	40	.	+	.	transcript_id "TCONS_00000001"; gene_id "XLOC_000002"; exon_number "1";
+chr1	Cufflinks	transcript	42	47	.	+	.	transcript_id "TCONS_00000007"; gene_id "XLOC_000002"; gene_name "Lypla1"; oId "CUFF.7.1"; contained_in "TCONS_00000002"; cmp_ref "Lypla1"; class_code "c"; tss_id "TSS3";
+chr1	Cufflinks	exon	42	47	.	+	.	transcript_id "TCONS_00000007"; gene_id "XLOC_000002"; exon_number "1";
+chr1	Cufflinks	transcript	42	50	.	+	.	transcript_id "TCONS_00000002"; gene_id "XLOC_000002"; gene_name "Lypla1"; oId "CUFF.9.1"; cmp_ref "Lypla1"; class_code "c"; tss_id "TSS3";
+chr1	Cufflinks	exon	42	50	.	+	.	transcript_id "TCONS_00000002"; gene_id "XLOC_000002"; exon_number "1";
+chr1	Cufflinks	transcript	52	60	.	+	.	transcript_id "TCONS_00000003"; gene_id "XLOC_000003"; gene_name "Lypla1"; oId "CUFF.10.1"; cmp_ref "Lypla1"; class_code "p"; tss_id "TSS4";
+chr1	Cufflinks	exon	52	60	.	+	.	transcript_id "TCONS_00000003"; gene_id "XLOC_000003"; exon_number "1";
+chr1	Cufflinks	transcript	2	10	.	-	.	transcript_id "TCONS_00000004"; gene_id "XLOC_000004"; oId "CUFF.1.1"; class_code "u"; tss_id "TSS5";
+chr1	Cufflinks	exon	2	10	.	-	.	transcript_id "TCONS_00000004"; gene_id "XLOC_000004"; exon_number "1";
+chr1	Cufflinks	transcript	15	20	.	-	.	transcript_id "TCONS_00000005"; gene_id "XLOC_000005"; oId "CUFF.3.1"; class_code "u"; tss_id "TSS6";
+chr1	Cufflinks	exon	15	20	.	-	.	transcript_id "TCONS_00000005"; gene_id "XLOC_000005"; exon_number "1";
+chr1	Cufflinks	transcript	22	30	.	-	.	transcript_id "TCONS_00000008"; gene_id "XLOC_000006"; oId "CUFF.5.1"; class_code "u"; tss_id "TSS7";
+chr1	Cufflinks	exon	22	30	.	-	.	transcript_id "TCONS_00000008"; gene_id "XLOC_000006"; exon_number "1";
--- a/test-data/gffcompare_out2.loci	Tue Feb 05 15:51:44 2019 -0500
+++ b/test-data/gffcompare_out2.loci	Mon May 27 13:54:15 2019 -0400
@@ -1,21 +1,6 @@
-XLOC_000001	chr1[+]160930303-160974977	uc007del.2|uc007del.2	MSTRG.4.1,MSTRG.5.1,MSTRG.6.1,MSTRG.3.1
-XLOC_000002	chr1[+]161003085-161003516	-	MSTRG.7.1
-XLOC_000003	chr1[+]161006151-161006466	-	MSTRG.10.1
-XLOC_000004	chr1[+]161008375-161008625	-	MSTRG.12.1
-XLOC_000005	chr1[+]161009768-161010195	-	MSTRG.13.1
-XLOC_000006	chr1[+]161019713-161019962	-	MSTRG.14.1
-XLOC_000007	chr1[+]161034351-161038539	uc007det.1|uc007det.1,uc007deu.1|uc007deu.1,uc007dev.1|uc007dev.1,uc007dew.1|uc007dew.1,uc011wun.1|uc011wun.1,uc007dex.1|uc007dex.1	MSTRG.16.1,MSTRG.16.2,MSTRG.16.3,MSTRG.16.4,MSTRG.16.5
-XLOC_000008	chr1[+]161041562-161070639	-	MSTRG.18.1,MSTRG.18.2
-XLOC_000009	chr1[+]161070945-161086329	uc007dfe.4|uc007dfe.4,uc007dfc.3|uc007dfc.3,uc007dfd.3|uc007dfd.3,uc056yep.1|uc056yep.1	MSTRG.20.1,MSTRG.21.1,MSTRG.22.1,MSTRG.23.1
-XLOC_000010	chr1[+]161088497-161088913	-	MSTRG.24.1
-XLOC_000011	chr1[+]161089415-161131512	-	MSTRG.26.1
-XLOC_000012	chr1[+]161123665-161123877	-	MSTRG.28.1
-XLOC_000013	chr1[-]29485012-29485458	-	MSTRG.1.1
-XLOC_000014	chr1[-]86909344-86909692	-	MSTRG.2.1
-XLOC_000015	chr1[-]161003658-161004769	-	MSTRG.8.1
-XLOC_000016	chr1[-]161005030-161005802	-	MSTRG.9.1
-XLOC_000017	chr1[-]161007444-161007700	-	MSTRG.11.1
-XLOC_000018	chr1[-]161019713-161034848	uc007der.1|uc007der.1,uc007des.1|uc007des.1	MSTRG.15.1
-XLOC_000019	chr1[-]161041525-161070649	uc007dey.2|uc007dey.2,uc007dez.2|uc007dez.2	MSTRG.17.1,MSTRG.19.1,MSTRG.19.2
-XLOC_000020	chr1[-]161088497-161131492	uc007dff.1|uc007dff.1,uc007dfg.1|uc007dfg.1,uc007dfh.1|uc007dfh.1,uc007dfi.1|uc007dfi.1	MSTRG.25.1,MSTRG.27.1
-XLOC_000021	chr1[-]192074156-192074378	-	MSTRG.29.1
+XLOC_000001	chr1[+]12-20	-	-	CUFF.3.1
+XLOC_000002	chr1[+]32-50	Lypla1|Lypla1	CUFF.7.1,CUFF.9.1	CUFF.7.1
+XLOC_000003	chr1[+]52-60	-	CUFF.10.1	-
+XLOC_000004	chr1[-]2-10	-	CUFF.1.1	CUFF.1.1
+XLOC_000005	chr1[-]15-20	-	CUFF.3.1	-
+XLOC_000006	chr1[-]22-30	-	-	CUFF.5.1
--- a/test-data/gffcompare_out2.stats	Tue Feb 05 15:51:44 2019 -0500
+++ b/test-data/gffcompare_out2.stats	Mon May 27 13:54:15 2019 -0400
@@ -1,30 +1,47 @@
-# gffcompare v0.10.6 | Command line was:
-#gffcompare -r /tmp/tmp7AvPf0/files/000/dataset_13.dat -R -T -e 100 -d 100 -p TCONS gffcompare_in4_gtf
+# gffcompare v0.11.2 | Command line was:
+#gffcompare -r ref_annotation -e 100 -d 100 -p TCONS gffcompare_in1_gtf gffcompare_in2_gtf
 #
 
-#= Summary for dataset: gffcompare_in4_gtf 
-#     Query mRNAs :      35 in      29 loci  (15 multi-exon transcripts)
-#            (3 multi-transcript loci, ~1.2 transcripts per locus)
-# Reference mRNAs :      20 in       7 loci  (19 multi-exon)
-# Super-loci w/ reference transcripts:        6
+#= Summary for dataset: gffcompare_in1_gtf 
+#     Query mRNAs :       5 in       5 loci  (0 multi-exon transcripts)
+#            (0 multi-transcript loci, ~1.0 transcripts per locus)
+# Reference mRNAs :       1 in       1 loci  (0 multi-exon)
+# Super-loci w/ reference transcripts:        1
 #-----------------| Sensitivity | Precision  |
-        Base level:    72.6     |    60.7    |
-        Exon level:    80.0     |    55.7    |
-      Intron level:    81.2     |    64.4    |
-Intron chain level:    10.5     |    13.3    |
-  Transcript level:    10.0     |     5.7    |
-       Locus level:    28.6     |     6.9    |
+        Base level:    94.7     |    42.9    |
+        Exon level:   100.0     |    40.0    |
+  Transcript level:     0.0     |     0.0    |
+       Locus level:     0.0     |     0.0    |
+
+     Matching intron chains:       0
+       Matching transcripts:       0
+              Matching loci:       0
+
+          Missed exons:       0/1	(  0.0%)
+           Novel exons:       3/5	( 60.0%)
+           Missed loci:       0/1	(  0.0%)
+            Novel loci:       3/5	( 60.0%)
 
-     Matching intron chains:       2
-       Matching transcripts:       2
-              Matching loci:       2
+#= Summary for dataset: gffcompare_in2_gtf 
+#     Query mRNAs :       4 in       4 loci  (0 multi-exon transcripts)
+#            (0 multi-transcript loci, ~1.0 transcripts per locus)
+# Reference mRNAs :       1 in       1 loci  (0 multi-exon)
+# Super-loci w/ reference transcripts:        1
+#-----------------| Sensitivity | Precision  |
+        Base level:    31.6     |    18.2    |
+        Exon level:   100.0     |    25.0    |
+  Transcript level:     0.0     |     0.0    |
+       Locus level:     0.0     |     0.0    |
 
-          Missed exons:       3/85	(  3.5%)
-           Novel exons:      46/122	( 37.7%)
-        Missed introns:      11/69	( 15.9%)
-         Novel introns:      28/87	( 32.2%)
-           Missed loci:       0/7	(  0.0%)
-            Novel loci:      15/29	( 51.7%)
+     Matching intron chains:       0
+       Matching transcripts:       0
+              Matching loci:       0
 
- Total union super-loci across all input datasets: 21 
-35 out of 35 consensus transcripts written in gffcmp.annotated.gtf (0 discarded as redundant)
+          Missed exons:       0/1	(  0.0%)
+           Novel exons:       3/4	( 75.0%)
+           Missed loci:       0/1	(  0.0%)
+            Novel loci:       3/4	( 75.0%)
+
+ Total union super-loci across all input datasets: 6 
+  (0 multi-transcript, ~1.3 transcripts per locus)
+8 out of 8 consensus transcripts written in gffcmp.combined.gtf (0 discarded as redundant)
--- a/test-data/gffcompare_out2.tracking	Tue Feb 05 15:51:44 2019 -0500
+++ b/test-data/gffcompare_out2.tracking	Mon May 27 13:54:15 2019 -0400
@@ -1,35 +1,8 @@
-TCONS_00000001	XLOC_000001	uc007del.2|uc007del.2	c	q1:MSTRG.3|MSTRG.3.1|3|0.000000|0.000000|0.000000|403
-TCONS_00000002	XLOC_000001	uc007del.2|uc007del.2	c	q1:MSTRG.4|MSTRG.4.1|16|0.000000|0.000000|0.000000|3003
-TCONS_00000003	XLOC_000001	uc007del.2|uc007del.2	c	q1:MSTRG.5|MSTRG.5.1|1|0.000000|0.000000|0.000000|3377
-TCONS_00000004	XLOC_000001	uc007del.2|uc007del.2	c	q1:MSTRG.6|MSTRG.6.1|1|0.000000|0.000000|0.000000|2040
-TCONS_00000005	XLOC_000002	-	u	q1:MSTRG.7|MSTRG.7.1|1|0.000000|0.000000|0.000000|432
-TCONS_00000006	XLOC_000003	-	u	q1:MSTRG.10|MSTRG.10.1|1|0.000000|0.000000|0.000000|316
-TCONS_00000007	XLOC_000004	-	u	q1:MSTRG.12|MSTRG.12.1|1|0.000000|0.000000|0.000000|251
-TCONS_00000008	XLOC_000005	-	u	q1:MSTRG.13|MSTRG.13.1|1|0.000000|0.000000|0.000000|428
-TCONS_00000009	XLOC_000006	uc007der.1|uc007der.1	x	q1:MSTRG.14|MSTRG.14.1|1|0.000000|0.000000|0.000000|250
-TCONS_00000010	XLOC_000007	uc007dev.1|uc007dev.1	j	q1:MSTRG.16|MSTRG.16.1|11|0.000000|0.000000|0.000000|800
-TCONS_00000011	XLOC_000007	uc007dev.1|uc007dev.1	j	q1:MSTRG.16|MSTRG.16.2|12|0.000000|0.000000|0.000000|608
-TCONS_00000012	XLOC_000007	uc007dev.1|uc007dev.1	j	q1:MSTRG.16|MSTRG.16.3|11|0.000000|0.000000|0.000000|1008
-TCONS_00000013	XLOC_000007	uc007dev.1|uc007dev.1	j	q1:MSTRG.16|MSTRG.16.4|11|0.000000|0.000000|0.000000|531
-TCONS_00000014	XLOC_000007	uc007dev.1|uc007dev.1	=	q1:MSTRG.16|MSTRG.16.5|11|0.000000|0.000000|0.000000|807
-TCONS_00000015	XLOC_000008	uc007dey.2|uc007dey.2	s	q1:MSTRG.18|MSTRG.18.1|16|0.000000|0.000000|0.000000|2459
-TCONS_00000016	XLOC_000008	uc007dey.2|uc007dey.2	s	q1:MSTRG.18|MSTRG.18.2|6|0.000000|0.000000|0.000000|903
-TCONS_00000017	XLOC_000009	uc007dfd.3|uc007dfd.3	c	q1:MSTRG.20|MSTRG.20.1|3|0.000000|0.000000|0.000000|716
-TCONS_00000018	XLOC_000009	uc007dfe.4|uc007dfe.4	c	q1:MSTRG.21|MSTRG.21.1|1|0.000000|0.000000|0.000000|466
-TCONS_00000019	XLOC_000009	uc007dfe.4|uc007dfe.4	c	q1:MSTRG.22|MSTRG.22.1|1|0.000000|0.000000|0.000000|224
-TCONS_00000020	XLOC_000009	uc056yep.1|uc056yep.1	c	q1:MSTRG.23|MSTRG.23.1|1|0.000000|0.000000|0.000000|1316
-TCONS_00000021	XLOC_000010	uc007dff.1|uc007dff.1	x	q1:MSTRG.24|MSTRG.24.1|1|0.000000|0.000000|0.000000|417
-TCONS_00000022	XLOC_000011	uc007dff.1|uc007dff.1	s	q1:MSTRG.26|MSTRG.26.1|12|0.000000|0.000000|0.000000|3033
-TCONS_00000023	XLOC_000012	uc007dff.1|uc007dff.1	i	q1:MSTRG.28|MSTRG.28.1|1|0.000000|0.000000|0.000000|213
-TCONS_00000024	XLOC_000013	-	u	q1:MSTRG.1|MSTRG.1.1|1|0.000000|0.000000|0.000000|447
-TCONS_00000025	XLOC_000014	-	u	q1:MSTRG.2|MSTRG.2.1|1|0.000000|0.000000|0.000000|349
-TCONS_00000026	XLOC_000015	-	u	q1:MSTRG.8|MSTRG.8.1|1|0.000000|0.000000|0.000000|1112
-TCONS_00000027	XLOC_000016	-	u	q1:MSTRG.9|MSTRG.9.1|1|0.000000|0.000000|0.000000|773
-TCONS_00000028	XLOC_000017	-	u	q1:MSTRG.11|MSTRG.11.1|1|0.000000|0.000000|0.000000|257
-TCONS_00000029	XLOC_000018	uc007des.1|uc007des.1	c	q1:MSTRG.15|MSTRG.15.1|1|0.000000|0.000000|0.000000|353
-TCONS_00000030	XLOC_000019	uc007dey.2|uc007dey.2	c	q1:MSTRG.17|MSTRG.17.1|6|0.000000|0.000000|0.000000|1029
-TCONS_00000031	XLOC_000019	uc007dey.2|uc007dey.2	c	q1:MSTRG.19|MSTRG.19.1|11|0.000000|0.000000|0.000000|1514
-TCONS_00000032	XLOC_000019	uc007dey.2|uc007dey.2	j	q1:MSTRG.19|MSTRG.19.2|10|0.000000|0.000000|0.000000|1478
-TCONS_00000033	XLOC_000020	uc007dff.1|uc007dff.1	c	q1:MSTRG.25|MSTRG.25.1|1|0.000000|0.000000|0.000000|1361
-TCONS_00000034	XLOC_000020	uc007dff.1|uc007dff.1	=	q1:MSTRG.27|MSTRG.27.1|12|0.000000|0.000000|0.000000|2016
-TCONS_00000035	XLOC_000021	-	u	q1:MSTRG.29|MSTRG.29.1|1|0.000000|0.000000|0.000000|223
+TCONS_00000001	XLOC_000002	Lypla1|Lypla1	c	q1:CUFF.7|CUFF.7.1|1|9.999117|0.000000|0.639053|9	-
+TCONS_00000002	XLOC_000002	Lypla1|Lypla1	c	q1:CUFF.9|CUFF.9.1|1|17.776896|0.000000|1.136139|9	-
+TCONS_00000003	XLOC_000003	Lypla1|Lypla1	p	q1:CUFF.10|CUFF.10.1|1|17.776896|0.000000|1.136139|9	-
+TCONS_00000004	XLOC_000004	-	u	q1:CUFF.1|CUFF.1.1|1|20.607936|0.000000|1.317073|9	q2:CUFF.1|CUFF.1.1|1|35.211287|0.000000|2.000000|9
+TCONS_00000005	XLOC_000005	-	u	q1:CUFF.3|CUFF.3.1|1|27.255658|0.000000|1.741935|6	-
+TCONS_00000006	XLOC_000001	-	u	-	q2:CUFF.3|CUFF.3.1|1|35.211287|0.000000|2.000000|9
+TCONS_00000007	XLOC_000002	Lypla1|Lypla1	c	-	q2:CUFF.7|CUFF.7.1|1|29.709524|0.000000|1.687500|6
+TCONS_00000008	XLOC_000006	-	u	-	q2:CUFF.5|CUFF.5.1|1|21.226627|0.000000|1.205672|9
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gffcompare_out3.gtf	Mon May 27 13:54:15 2019 -0400
@@ -0,0 +1,206 @@
+chr1	StringTie	transcript	160930303	160940234	.	+	.	transcript_id "MSTRG.3.1"; gene_id "MSTRG.3"; gene_name "uc007del.2"; xloc "XLOC_000001"; cmp_ref "uc007del.2"; class_code "c"; tss_id "TSS1";
+chr1	StringTie	exon	160930303	160930344	.	+	.	transcript_id "MSTRG.3.1"; gene_id "MSTRG.3"; exon_number "1";
+chr1	StringTie	exon	160938112	160938232	.	+	.	transcript_id "MSTRG.3.1"; gene_id "MSTRG.3"; exon_number "2";
+chr1	StringTie	exon	160939995	160940234	.	+	.	transcript_id "MSTRG.3.1"; gene_id "MSTRG.3"; exon_number "3";
+chr1	StringTie	transcript	160940817	160967997	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; gene_name "uc007del.2"; xloc "XLOC_000001"; cmp_ref "uc007del.2"; class_code "c"; tss_id "TSS2";
+chr1	StringTie	exon	160940817	160940994	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "1";
+chr1	StringTie	exon	160942528	160942728	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "2";
+chr1	StringTie	exon	160946534	160946666	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "3";
+chr1	StringTie	exon	160948307	160948425	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "4";
+chr1	StringTie	exon	160950222	160950334	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "5";
+chr1	StringTie	exon	160950841	160951122	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "6";
+chr1	StringTie	exon	160951615	160951829	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "7";
+chr1	StringTie	exon	160954784	160955151	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "8";
+chr1	StringTie	exon	160955815	160955979	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "9";
+chr1	StringTie	exon	160959401	160959553	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "10";
+chr1	StringTie	exon	160962271	160962484	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "11";
+chr1	StringTie	exon	160963479	160963569	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "12";
+chr1	StringTie	exon	160963708	160963840	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "13";
+chr1	StringTie	exon	160964950	160965120	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "14";
+chr1	StringTie	exon	160965673	160965788	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "15";
+chr1	StringTie	exon	160967647	160967997	.	+	.	transcript_id "MSTRG.4.1"; gene_id "MSTRG.4"; exon_number "16";
+chr1	StringTie	transcript	160968644	160972020	.	+	.	transcript_id "MSTRG.5.1"; gene_id "MSTRG.5"; gene_name "uc007del.2"; xloc "XLOC_000001"; cmp_ref "uc007del.2"; class_code "c"; tss_id "TSS3";
+chr1	StringTie	exon	160968644	160972020	.	+	.	transcript_id "MSTRG.5.1"; gene_id "MSTRG.5"; exon_number "1";
+chr1	StringTie	transcript	160972938	160974977	.	+	.	transcript_id "MSTRG.6.1"; gene_id "MSTRG.6"; gene_name "uc007del.2"; xloc "XLOC_000001"; cmp_ref "uc007del.2"; class_code "c"; tss_id "TSS4";
+chr1	StringTie	exon	160972938	160974977	.	+	.	transcript_id "MSTRG.6.1"; gene_id "MSTRG.6"; exon_number "1";
+chr1	StringTie	transcript	161003085	161003516	.	+	.	transcript_id "MSTRG.7.1"; gene_id "MSTRG.7"; xloc "XLOC_000002"; class_code "u"; tss_id "TSS5";
+chr1	StringTie	exon	161003085	161003516	.	+	.	transcript_id "MSTRG.7.1"; gene_id "MSTRG.7"; exon_number "1";
+chr1	StringTie	transcript	161006151	161006466	.	+	.	transcript_id "MSTRG.10.1"; gene_id "MSTRG.10"; xloc "XLOC_000003"; class_code "u"; tss_id "TSS6";
+chr1	StringTie	exon	161006151	161006466	.	+	.	transcript_id "MSTRG.10.1"; gene_id "MSTRG.10"; exon_number "1";
+chr1	StringTie	transcript	161008375	161008625	.	+	.	transcript_id "MSTRG.12.1"; gene_id "MSTRG.12"; xloc "XLOC_000004"; class_code "u"; tss_id "TSS7";
+chr1	StringTie	exon	161008375	161008625	.	+	.	transcript_id "MSTRG.12.1"; gene_id "MSTRG.12"; exon_number "1";
+chr1	StringTie	transcript	161009768	161010195	.	+	.	transcript_id "MSTRG.13.1"; gene_id "MSTRG.13"; xloc "XLOC_000005"; class_code "u"; tss_id "TSS8";
+chr1	StringTie	exon	161009768	161010195	.	+	.	transcript_id "MSTRG.13.1"; gene_id "MSTRG.13"; exon_number "1";
+chr1	StringTie	transcript	161019713	161019962	.	+	.	transcript_id "MSTRG.14.1"; gene_id "MSTRG.14"; gene_name "uc007der.1"; xloc "XLOC_000006"; cmp_ref "uc007der.1"; class_code "x"; tss_id "TSS9";
+chr1	StringTie	exon	161019713	161019962	.	+	.	transcript_id "MSTRG.14.1"; gene_id "MSTRG.14"; exon_number "1";
+chr1	StringTie	transcript	161034351	161038539	.	+	.	transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; gene_name "uc007dev.1"; xloc "XLOC_000007"; cmp_ref "uc007dev.1"; class_code "j"; tss_id "TSS10";
+chr1	StringTie	exon	161034351	161034719	.	+	.	transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "1";
+chr1	StringTie	exon	161035752	161035804	.	+	.	transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "2";
+chr1	StringTie	exon	161035983	161036014	.	+	.	transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "3";
+chr1	StringTie	exon	161036208	161036244	.	+	.	transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "4";
+chr1	StringTie	exon	161036549	161036579	.	+	.	transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "5";
+chr1	StringTie	exon	161036820	161036852	.	+	.	transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "6";
+chr1	StringTie	exon	161037288	161037315	.	+	.	transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "7";
+chr1	StringTie	exon	161037505	161037547	.	+	.	transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "8";
+chr1	StringTie	exon	161037995	161038037	.	+	.	transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "9";
+chr1	StringTie	exon	161038225	161038272	.	+	.	transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "10";
+chr1	StringTie	exon	161038457	161038539	.	+	.	transcript_id "MSTRG.16.1"; gene_id "MSTRG.16"; exon_number "11";
+chr1	StringTie	transcript	161034584	161038539	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; gene_name "uc007dev.1"; xloc "XLOC_000007"; cmp_ref "uc007dev.1"; class_code "j"; tss_id "TSS11";
+chr1	StringTie	exon	161034584	161034719	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "1";
+chr1	StringTie	exon	161035752	161035804	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "2";
+chr1	StringTie	exon	161035983	161036014	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "3";
+chr1	StringTie	exon	161036208	161036244	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "4";
+chr1	StringTie	exon	161036549	161036579	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "5";
+chr1	StringTie	exon	161036820	161036852	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "6";
+chr1	StringTie	exon	161037124	161037164	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "7";
+chr1	StringTie	exon	161037288	161037315	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "8";
+chr1	StringTie	exon	161037505	161037547	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "9";
+chr1	StringTie	exon	161037995	161038037	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "10";
+chr1	StringTie	exon	161038225	161038272	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "11";
+chr1	StringTie	exon	161038457	161038539	.	+	.	transcript_id "MSTRG.16.2"; gene_id "MSTRG.16"; exon_number "12";
+chr1	StringTie	transcript	161034642	161038338	.	+	.	transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; gene_name "uc007dev.1"; xloc "XLOC_000007"; cmp_ref "uc007dev.1"; class_code "j"; tss_id "TSS11";
+chr1	StringTie	exon	161034642	161035194	.	+	.	transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "1";
+chr1	StringTie	exon	161035752	161035804	.	+	.	transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "2";
+chr1	StringTie	exon	161035983	161036014	.	+	.	transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "3";
+chr1	StringTie	exon	161036208	161036244	.	+	.	transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "4";
+chr1	StringTie	exon	161036549	161036579	.	+	.	transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "5";
+chr1	StringTie	exon	161036820	161036852	.	+	.	transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "6";
+chr1	StringTie	exon	161037124	161037164	.	+	.	transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "7";
+chr1	StringTie	exon	161037288	161037315	.	+	.	transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "8";
+chr1	StringTie	exon	161037505	161037547	.	+	.	transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "9";
+chr1	StringTie	exon	161037995	161038037	.	+	.	transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "10";
+chr1	StringTie	exon	161038225	161038338	.	+	.	transcript_id "MSTRG.16.3"; gene_id "MSTRG.16"; exon_number "11";
+chr1	StringTie	transcript	161035095	161038539	.	+	.	transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; gene_name "uc007dev.1"; xloc "XLOC_000007"; cmp_ref "uc007dev.1"; class_code "j"; tss_id "TSS12";
+chr1	StringTie	exon	161035095	161035194	.	+	.	transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "1";
+chr1	StringTie	exon	161035752	161035804	.	+	.	transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "2";
+chr1	StringTie	exon	161035983	161036014	.	+	.	transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "3";
+chr1	StringTie	exon	161036208	161036244	.	+	.	transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "4";
+chr1	StringTie	exon	161036549	161036579	.	+	.	transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "5";
+chr1	StringTie	exon	161036820	161036852	.	+	.	transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "6";
+chr1	StringTie	exon	161037288	161037315	.	+	.	transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "7";
+chr1	StringTie	exon	161037505	161037547	.	+	.	transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "8";
+chr1	StringTie	exon	161037995	161038037	.	+	.	transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "9";
+chr1	StringTie	exon	161038225	161038272	.	+	.	transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "10";
+chr1	StringTie	exon	161038457	161038539	.	+	.	transcript_id "MSTRG.16.4"; gene_id "MSTRG.16"; exon_number "11";
+chr1	StringTie	transcript	161035164	161038539	.	+	.	transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; gene_name "uc007dev.1"; xloc "XLOC_000007"; cmp_ref "uc007dev.1"; class_code "="; tss_id "TSS12";
+chr1	StringTie	exon	161035164	161035194	.	+	.	transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "1";
+chr1	StringTie	exon	161035752	161035804	.	+	.	transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "2";
+chr1	StringTie	exon	161035983	161036014	.	+	.	transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "3";
+chr1	StringTie	exon	161036208	161036579	.	+	.	transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "4";
+chr1	StringTie	exon	161036820	161036852	.	+	.	transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "5";
+chr1	StringTie	exon	161037124	161037164	.	+	.	transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "6";
+chr1	StringTie	exon	161037288	161037315	.	+	.	transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "7";
+chr1	StringTie	exon	161037505	161037547	.	+	.	transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "8";
+chr1	StringTie	exon	161037995	161038037	.	+	.	transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "9";
+chr1	StringTie	exon	161038225	161038272	.	+	.	transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "10";
+chr1	StringTie	exon	161038457	161038539	.	+	.	transcript_id "MSTRG.16.5"; gene_id "MSTRG.16"; exon_number "11";
+chr1	StringTie	transcript	161041562	161070639	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; gene_name "uc007dey.2"; xloc "XLOC_000008"; cmp_ref "uc007dey.2"; class_code "s"; tss_id "TSS13";
+chr1	StringTie	exon	161041562	161041930	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "1";
+chr1	StringTie	exon	161043613	161043688	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "2";
+chr1	StringTie	exon	161044959	161045069	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "3";
+chr1	StringTie	exon	161045258	161045476	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "4";
+chr1	StringTie	exon	161046777	161046929	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "5";
+chr1	StringTie	exon	161049938	161050000	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "6";
+chr1	StringTie	exon	161051331	161051438	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "7";
+chr1	StringTie	exon	161056461	161056530	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "8";
+chr1	StringTie	exon	161057447	161057553	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "9";
+chr1	StringTie	exon	161060045	161060091	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "10";
+chr1	StringTie	exon	161060736	161060859	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "11";
+chr1	StringTie	exon	161062782	161062877	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "12";
+chr1	StringTie	exon	161063247	161063348	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "13";
+chr1	StringTie	exon	161065225	161065291	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "14";
+chr1	StringTie	exon	161069080	161069179	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "15";
+chr1	StringTie	exon	161069993	161070639	.	+	.	transcript_id "MSTRG.18.1"; gene_id "MSTRG.18"; exon_number "16";
+chr1	StringTie	transcript	161045151	161056533	.	+	.	transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; gene_name "uc007dey.2"; xloc "XLOC_000008"; cmp_ref "uc007dey.2"; class_code "s"; tss_id "TSS14";
+chr1	StringTie	exon	161045151	161045476	.	+	.	transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; exon_number "1";
+chr1	StringTie	exon	161046777	161046929	.	+	.	transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; exon_number "2";
+chr1	StringTie	exon	161049938	161050000	.	+	.	transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; exon_number "3";
+chr1	StringTie	exon	161051331	161051438	.	+	.	transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; exon_number "4";
+chr1	StringTie	exon	161053941	161054120	.	+	.	transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; exon_number "5";
+chr1	StringTie	exon	161056461	161056533	.	+	.	transcript_id "MSTRG.18.2"; gene_id "MSTRG.18"; exon_number "6";
+chr1	StringTie	transcript	161070945	161078458	.	+	.	transcript_id "MSTRG.20.1"; gene_id "MSTRG.20"; gene_name "uc007dfd.3"; xloc "XLOC_000009"; cmp_ref "uc007dfd.3"; class_code "c"; tss_id "TSS15";
+chr1	StringTie	exon	161070945	161071356	.	+	.	transcript_id "MSTRG.20.1"; gene_id "MSTRG.20"; exon_number "1";
+chr1	StringTie	exon	161074757	161074930	.	+	.	transcript_id "MSTRG.20.1"; gene_id "MSTRG.20"; exon_number "2";
+chr1	StringTie	exon	161078329	161078458	.	+	.	transcript_id "MSTRG.20.1"; gene_id "MSTRG.20"; exon_number "3";
+chr1	StringTie	transcript	161082956	161083421	.	+	.	transcript_id "MSTRG.21.1"; gene_id "MSTRG.21"; gene_name "uc007dfe.4"; xloc "XLOC_000009"; cmp_ref "uc007dfe.4"; class_code "c"; tss_id "TSS16";
+chr1	StringTie	exon	161082956	161083421	.	+	.	transcript_id "MSTRG.21.1"; gene_id "MSTRG.21"; exon_number "1";
+chr1	StringTie	transcript	161084121	161084344	.	+	.	transcript_id "MSTRG.22.1"; gene_id "MSTRG.22"; gene_name "uc007dfe.4"; xloc "XLOC_000009"; cmp_ref "uc007dfe.4"; class_code "c"; tss_id "TSS17";
+chr1	StringTie	exon	161084121	161084344	.	+	.	transcript_id "MSTRG.22.1"; gene_id "MSTRG.22"; exon_number "1";
+chr1	StringTie	transcript	161085014	161086329	.	+	.	transcript_id "MSTRG.23.1"; gene_id "MSTRG.23"; gene_name "uc056yep.1"; xloc "XLOC_000009"; cmp_ref "uc056yep.1"; class_code "c"; tss_id "TSS18";
+chr1	StringTie	exon	161085014	161086329	.	+	.	transcript_id "MSTRG.23.1"; gene_id "MSTRG.23"; exon_number "1";
+chr1	StringTie	transcript	161088497	161088913	.	+	.	transcript_id "MSTRG.24.1"; gene_id "MSTRG.24"; gene_name "uc007dff.1"; xloc "XLOC_000010"; cmp_ref "uc007dff.1"; class_code "x"; tss_id "TSS19";
+chr1	StringTie	exon	161088497	161088913	.	+	.	transcript_id "MSTRG.24.1"; gene_id "MSTRG.24"; exon_number "1";
+chr1	StringTie	transcript	161089415	161131512	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; gene_name "uc007dff.1"; xloc "XLOC_000011"; cmp_ref "uc007dff.1"; class_code "s"; tss_id "TSS20";
+chr1	StringTie	exon	161089415	161090511	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "1";
+chr1	StringTie	exon	161093681	161093787	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "2";
+chr1	StringTie	exon	161095529	161095737	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "3";
+chr1	StringTie	exon	161098263	161098396	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "4";
+chr1	StringTie	exon	161099142	161099285	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "5";
+chr1	StringTie	exon	161101451	161101634	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "6";
+chr1	StringTie	exon	161102979	161103094	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "7";
+chr1	StringTie	exon	161105401	161105495	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "8";
+chr1	StringTie	exon	161106707	161106865	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "9";
+chr1	StringTie	exon	161109222	161109795	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "10";
+chr1	StringTie	exon	161130389	161130452	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "11";
+chr1	StringTie	exon	161131363	161131512	.	+	.	transcript_id "MSTRG.26.1"; gene_id "MSTRG.26"; exon_number "12";
+chr1	StringTie	transcript	161123665	161123877	.	+	.	transcript_id "MSTRG.28.1"; gene_id "MSTRG.28"; gene_name "uc007dff.1"; xloc "XLOC_000012"; cmp_ref "uc007dff.1"; class_code "i"; tss_id "TSS21";
+chr1	StringTie	exon	161123665	161123877	.	+	.	transcript_id "MSTRG.28.1"; gene_id "MSTRG.28"; exon_number "1";
+chr1	StringTie	transcript	29485012	29485458	.	-	.	transcript_id "MSTRG.1.1"; gene_id "MSTRG.1"; xloc "XLOC_000013"; class_code "u"; tss_id "TSS22";
+chr1	StringTie	exon	29485012	29485458	.	-	.	transcript_id "MSTRG.1.1"; gene_id "MSTRG.1"; exon_number "1";
+chr1	StringTie	transcript	86909344	86909692	.	-	.	transcript_id "MSTRG.2.1"; gene_id "MSTRG.2"; xloc "XLOC_000014"; class_code "u"; tss_id "TSS23";
+chr1	StringTie	exon	86909344	86909692	.	-	.	transcript_id "MSTRG.2.1"; gene_id "MSTRG.2"; exon_number "1";
+chr1	StringTie	transcript	161003658	161004769	.	-	.	transcript_id "MSTRG.8.1"; gene_id "MSTRG.8"; xloc "XLOC_000015"; class_code "u"; tss_id "TSS24";
+chr1	StringTie	exon	161003658	161004769	.	-	.	transcript_id "MSTRG.8.1"; gene_id "MSTRG.8"; exon_number "1";
+chr1	StringTie	transcript	161005030	161005802	.	-	.	transcript_id "MSTRG.9.1"; gene_id "MSTRG.9"; xloc "XLOC_000016"; class_code "u"; tss_id "TSS25";
+chr1	StringTie	exon	161005030	161005802	.	-	.	transcript_id "MSTRG.9.1"; gene_id "MSTRG.9"; exon_number "1";
+chr1	StringTie	transcript	161007444	161007700	.	-	.	transcript_id "MSTRG.11.1"; gene_id "MSTRG.11"; xloc "XLOC_000017"; class_code "u"; tss_id "TSS26";
+chr1	StringTie	exon	161007444	161007700	.	-	.	transcript_id "MSTRG.11.1"; gene_id "MSTRG.11"; exon_number "1";
+chr1	StringTie	transcript	161032044	161032396	.	-	.	transcript_id "MSTRG.15.1"; gene_id "MSTRG.15"; gene_name "uc007des.1"; xloc "XLOC_000018"; cmp_ref "uc007des.1"; class_code "c"; tss_id "TSS27";
+chr1	StringTie	exon	161032044	161032396	.	-	.	transcript_id "MSTRG.15.1"; gene_id "MSTRG.15"; exon_number "1";
+chr1	StringTie	transcript	161041525	161050001	.	-	.	transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; gene_name "uc007dey.2"; xloc "XLOC_000019"; cmp_ref "uc007dey.2"; class_code "c"; tss_id "TSS28";
+chr1	StringTie	exon	161041525	161041930	.	-	.	transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; exon_number "1";
+chr1	StringTie	exon	161043613	161043688	.	-	.	transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; exon_number "2";
+chr1	StringTie	exon	161044959	161045069	.	-	.	transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; exon_number "3";
+chr1	StringTie	exon	161045258	161045476	.	-	.	transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; exon_number "4";
+chr1	StringTie	exon	161046777	161046929	.	-	.	transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; exon_number "5";
+chr1	StringTie	exon	161049938	161050001	.	-	.	transcript_id "MSTRG.17.1"; gene_id "MSTRG.17"; exon_number "6";
+chr1	StringTie	transcript	161051330	161070504	.	-	.	transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; gene_name "uc007dey.2"; xloc "XLOC_000019"; cmp_ref "uc007dey.2"; class_code "c"; tss_id "TSS29";
+chr1	StringTie	exon	161051330	161051438	.	-	.	transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "1";
+chr1	StringTie	exon	161053941	161054120	.	-	.	transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "2";
+chr1	StringTie	exon	161056461	161056530	.	-	.	transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "3";
+chr1	StringTie	exon	161057447	161057553	.	-	.	transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "4";
+chr1	StringTie	exon	161060045	161060091	.	-	.	transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "5";
+chr1	StringTie	exon	161060736	161060859	.	-	.	transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "6";
+chr1	StringTie	exon	161062782	161062877	.	-	.	transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "7";
+chr1	StringTie	exon	161063247	161063348	.	-	.	transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "8";
+chr1	StringTie	exon	161065225	161065291	.	-	.	transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "9";
+chr1	StringTie	exon	161069080	161069179	.	-	.	transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "10";
+chr1	StringTie	exon	161069993	161070504	.	-	.	transcript_id "MSTRG.19.1"; gene_id "MSTRG.19"; exon_number "11";
+chr1	StringTie	transcript	161051331	161070649	.	-	.	transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; gene_name "uc007dey.2"; xloc "XLOC_000019"; cmp_ref "uc007dey.2"; class_code "j"; tss_id "TSS30";
+chr1	StringTie	exon	161051331	161051438	.	-	.	transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "1";
+chr1	StringTie	exon	161056461	161056530	.	-	.	transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "2";
+chr1	StringTie	exon	161057447	161057553	.	-	.	transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "3";
+chr1	StringTie	exon	161060045	161060091	.	-	.	transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "4";
+chr1	StringTie	exon	161060736	161060859	.	-	.	transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "5";
+chr1	StringTie	exon	161062782	161062877	.	-	.	transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "6";
+chr1	StringTie	exon	161063247	161063348	.	-	.	transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "7";
+chr1	StringTie	exon	161065225	161065291	.	-	.	transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "8";
+chr1	StringTie	exon	161069080	161069179	.	-	.	transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "9";
+chr1	StringTie	exon	161069993	161070649	.	-	.	transcript_id "MSTRG.19.2"; gene_id "MSTRG.19"; exon_number "10";
+chr1	StringTie	transcript	161088915	161090275	.	-	.	transcript_id "MSTRG.25.1"; gene_id "MSTRG.25"; gene_name "uc007dff.1"; xloc "XLOC_000020"; cmp_ref "uc007dff.1"; class_code "c"; tss_id "TSS31";
+chr1	StringTie	exon	161088915	161090275	.	-	.	transcript_id "MSTRG.25.1"; gene_id "MSTRG.25"; exon_number "1";
+chr1	StringTie	transcript	161090412	161131492	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; gene_name "uc007dff.1"; xloc "XLOC_000020"; cmp_ref "uc007dff.1"; class_code "="; tss_id "TSS32";
+chr1	StringTie	exon	161090412	161090511	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "1";
+chr1	StringTie	exon	161093681	161093787	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "2";
+chr1	StringTie	exon	161095529	161095737	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "3";
+chr1	StringTie	exon	161098263	161098396	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "4";
+chr1	StringTie	exon	161099142	161099285	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "5";
+chr1	StringTie	exon	161101451	161101634	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "6";
+chr1	StringTie	exon	161102979	161103094	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "7";
+chr1	StringTie	exon	161105401	161105495	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "8";
+chr1	StringTie	exon	161106707	161106865	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "9";
+chr1	StringTie	exon	161109222	161109795	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "10";
+chr1	StringTie	exon	161130389	161130452	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "11";
+chr1	StringTie	exon	161131363	161131492	.	-	.	transcript_id "MSTRG.27.1"; gene_id "MSTRG.27"; exon_number "12";
+chr1	StringTie	transcript	192074156	192074378	.	-	.	transcript_id "MSTRG.29.1"; gene_id "MSTRG.29"; xloc "XLOC_000021"; class_code "u"; tss_id "TSS33";
+chr1	StringTie	exon	192074156	192074378	.	-	.	transcript_id "MSTRG.29.1"; gene_id "MSTRG.29"; exon_number "1";
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gffcompare_out3.loci	Mon May 27 13:54:15 2019 -0400
@@ -0,0 +1,21 @@
+XLOC_000001	chr1[+]160930303-160974977	uc007del.2|uc007del.2	MSTRG.4.1,MSTRG.5.1,MSTRG.6.1,MSTRG.3.1
+XLOC_000002	chr1[+]161003085-161003516	-	MSTRG.7.1
+XLOC_000003	chr1[+]161006151-161006466	-	MSTRG.10.1
+XLOC_000004	chr1[+]161008375-161008625	-	MSTRG.12.1
+XLOC_000005	chr1[+]161009768-161010195	-	MSTRG.13.1
+XLOC_000006	chr1[+]161019713-161019962	-	MSTRG.14.1
+XLOC_000007	chr1[+]161034351-161038539	uc007det.1|uc007det.1,uc007deu.1|uc007deu.1,uc007dev.1|uc007dev.1,uc007dew.1|uc007dew.1,uc011wun.1|uc011wun.1,uc007dex.1|uc007dex.1	MSTRG.16.1,MSTRG.16.2,MSTRG.16.3,MSTRG.16.4,MSTRG.16.5
+XLOC_000008	chr1[+]161041562-161070639	-	MSTRG.18.1,MSTRG.18.2
+XLOC_000009	chr1[+]161070945-161086329	uc007dfe.4|uc007dfe.4,uc007dfc.3|uc007dfc.3,uc007dfd.3|uc007dfd.3,uc056yep.1|uc056yep.1	MSTRG.20.1,MSTRG.21.1,MSTRG.22.1,MSTRG.23.1
+XLOC_000010	chr1[+]161088497-161088913	-	MSTRG.24.1
+XLOC_000011	chr1[+]161089415-161131512	-	MSTRG.26.1
+XLOC_000012	chr1[+]161123665-161123877	-	MSTRG.28.1
+XLOC_000013	chr1[-]29485012-29485458	-	MSTRG.1.1
+XLOC_000014	chr1[-]86909344-86909692	-	MSTRG.2.1
+XLOC_000015	chr1[-]161003658-161004769	-	MSTRG.8.1
+XLOC_000016	chr1[-]161005030-161005802	-	MSTRG.9.1
+XLOC_000017	chr1[-]161007444-161007700	-	MSTRG.11.1
+XLOC_000018	chr1[-]161019713-161034848	uc007der.1|uc007der.1,uc007des.1|uc007des.1	MSTRG.15.1
+XLOC_000019	chr1[-]161041525-161070649	uc007dey.2|uc007dey.2,uc007dez.2|uc007dez.2	MSTRG.17.1,MSTRG.19.1,MSTRG.19.2
+XLOC_000020	chr1[-]161088497-161131492	uc007dff.1|uc007dff.1,uc007dfg.1|uc007dfg.1,uc007dfh.1|uc007dfh.1,uc007dfi.1|uc007dfi.1	MSTRG.25.1,MSTRG.27.1
+XLOC_000021	chr1[-]192074156-192074378	-	MSTRG.29.1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gffcompare_out3.stats	Mon May 27 13:54:15 2019 -0400
@@ -0,0 +1,30 @@
+# gffcompare v0.10.6 | Command line was:
+#gffcompare -r ref_annotation -R -T -e 100 -d 100 -p TCONS gffcompare_in4_gtf
+#
+
+#= Summary for dataset: gffcompare_in4_gtf 
+#     Query mRNAs :      35 in      29 loci  (15 multi-exon transcripts)
+#            (3 multi-transcript loci, ~1.2 transcripts per locus)
+# Reference mRNAs :      20 in       7 loci  (19 multi-exon)
+# Super-loci w/ reference transcripts:        6
+#-----------------| Sensitivity | Precision  |
+        Base level:    72.6     |    60.7    |
+        Exon level:    80.0     |    55.7    |
+      Intron level:    81.2     |    64.4    |
+Intron chain level:    10.5     |    13.3    |
+  Transcript level:    10.0     |     5.7    |
+       Locus level:    28.6     |     6.9    |
+
+     Matching intron chains:       2
+       Matching transcripts:       2
+              Matching loci:       2
+
+          Missed exons:       3/85	(  3.5%)
+           Novel exons:      46/122	( 37.7%)
+        Missed introns:      11/69	( 15.9%)
+         Novel introns:      28/87	( 32.2%)
+           Missed loci:       0/7	(  0.0%)
+            Novel loci:      15/29	( 51.7%)
+
+ Total union super-loci across all input datasets: 21 
+35 out of 35 consensus transcripts written in gffcmp.annotated.gtf (0 discarded as redundant)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gffcompare_out3.tracking	Mon May 27 13:54:15 2019 -0400
@@ -0,0 +1,35 @@
+TCONS_00000001	XLOC_000001	uc007del.2|uc007del.2	c	q1:MSTRG.3|MSTRG.3.1|3|0.000000|0.000000|0.000000|403
+TCONS_00000002	XLOC_000001	uc007del.2|uc007del.2	c	q1:MSTRG.4|MSTRG.4.1|16|0.000000|0.000000|0.000000|3003
+TCONS_00000003	XLOC_000001	uc007del.2|uc007del.2	c	q1:MSTRG.5|MSTRG.5.1|1|0.000000|0.000000|0.000000|3377
+TCONS_00000004	XLOC_000001	uc007del.2|uc007del.2	c	q1:MSTRG.6|MSTRG.6.1|1|0.000000|0.000000|0.000000|2040
+TCONS_00000005	XLOC_000002	-	u	q1:MSTRG.7|MSTRG.7.1|1|0.000000|0.000000|0.000000|432
+TCONS_00000006	XLOC_000003	-	u	q1:MSTRG.10|MSTRG.10.1|1|0.000000|0.000000|0.000000|316
+TCONS_00000007	XLOC_000004	-	u	q1:MSTRG.12|MSTRG.12.1|1|0.000000|0.000000|0.000000|251
+TCONS_00000008	XLOC_000005	-	u	q1:MSTRG.13|MSTRG.13.1|1|0.000000|0.000000|0.000000|428
+TCONS_00000009	XLOC_000006	uc007der.1|uc007der.1	x	q1:MSTRG.14|MSTRG.14.1|1|0.000000|0.000000|0.000000|250
+TCONS_00000010	XLOC_000007	uc007dev.1|uc007dev.1	j	q1:MSTRG.16|MSTRG.16.1|11|0.000000|0.000000|0.000000|800
+TCONS_00000011	XLOC_000007	uc007dev.1|uc007dev.1	j	q1:MSTRG.16|MSTRG.16.2|12|0.000000|0.000000|0.000000|608
+TCONS_00000012	XLOC_000007	uc007dev.1|uc007dev.1	j	q1:MSTRG.16|MSTRG.16.3|11|0.000000|0.000000|0.000000|1008
+TCONS_00000013	XLOC_000007	uc007dev.1|uc007dev.1	j	q1:MSTRG.16|MSTRG.16.4|11|0.000000|0.000000|0.000000|531
+TCONS_00000014	XLOC_000007	uc007dev.1|uc007dev.1	=	q1:MSTRG.16|MSTRG.16.5|11|0.000000|0.000000|0.000000|807
+TCONS_00000015	XLOC_000008	uc007dey.2|uc007dey.2	s	q1:MSTRG.18|MSTRG.18.1|16|0.000000|0.000000|0.000000|2459
+TCONS_00000016	XLOC_000008	uc007dey.2|uc007dey.2	s	q1:MSTRG.18|MSTRG.18.2|6|0.000000|0.000000|0.000000|903
+TCONS_00000017	XLOC_000009	uc007dfd.3|uc007dfd.3	c	q1:MSTRG.20|MSTRG.20.1|3|0.000000|0.000000|0.000000|716
+TCONS_00000018	XLOC_000009	uc007dfe.4|uc007dfe.4	c	q1:MSTRG.21|MSTRG.21.1|1|0.000000|0.000000|0.000000|466
+TCONS_00000019	XLOC_000009	uc007dfe.4|uc007dfe.4	c	q1:MSTRG.22|MSTRG.22.1|1|0.000000|0.000000|0.000000|224
+TCONS_00000020	XLOC_000009	uc056yep.1|uc056yep.1	c	q1:MSTRG.23|MSTRG.23.1|1|0.000000|0.000000|0.000000|1316
+TCONS_00000021	XLOC_000010	uc007dff.1|uc007dff.1	x	q1:MSTRG.24|MSTRG.24.1|1|0.000000|0.000000|0.000000|417
+TCONS_00000022	XLOC_000011	uc007dff.1|uc007dff.1	s	q1:MSTRG.26|MSTRG.26.1|12|0.000000|0.000000|0.000000|3033
+TCONS_00000023	XLOC_000012	uc007dff.1|uc007dff.1	i	q1:MSTRG.28|MSTRG.28.1|1|0.000000|0.000000|0.000000|213
+TCONS_00000024	XLOC_000013	-	u	q1:MSTRG.1|MSTRG.1.1|1|0.000000|0.000000|0.000000|447
+TCONS_00000025	XLOC_000014	-	u	q1:MSTRG.2|MSTRG.2.1|1|0.000000|0.000000|0.000000|349
+TCONS_00000026	XLOC_000015	-	u	q1:MSTRG.8|MSTRG.8.1|1|0.000000|0.000000|0.000000|1112
+TCONS_00000027	XLOC_000016	-	u	q1:MSTRG.9|MSTRG.9.1|1|0.000000|0.000000|0.000000|773
+TCONS_00000028	XLOC_000017	-	u	q1:MSTRG.11|MSTRG.11.1|1|0.000000|0.000000|0.000000|257
+TCONS_00000029	XLOC_000018	uc007des.1|uc007des.1	c	q1:MSTRG.15|MSTRG.15.1|1|0.000000|0.000000|0.000000|353
+TCONS_00000030	XLOC_000019	uc007dey.2|uc007dey.2	c	q1:MSTRG.17|MSTRG.17.1|6|0.000000|0.000000|0.000000|1029
+TCONS_00000031	XLOC_000019	uc007dey.2|uc007dey.2	c	q1:MSTRG.19|MSTRG.19.1|11|0.000000|0.000000|0.000000|1514
+TCONS_00000032	XLOC_000019	uc007dey.2|uc007dey.2	j	q1:MSTRG.19|MSTRG.19.2|10|0.000000|0.000000|0.000000|1478
+TCONS_00000033	XLOC_000020	uc007dff.1|uc007dff.1	c	q1:MSTRG.25|MSTRG.25.1|1|0.000000|0.000000|0.000000|1361
+TCONS_00000034	XLOC_000020	uc007dff.1|uc007dff.1	=	q1:MSTRG.27|MSTRG.27.1|12|0.000000|0.000000|0.000000|2016
+TCONS_00000035	XLOC_000021	-	u	q1:MSTRG.29|MSTRG.29.1|1|0.000000|0.000000|0.000000|223
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sequence.fa	Mon May 27 13:54:15 2019 -0400
@@ -0,0 +1,2 @@
+>chr1
+AGACACGACCTGCTCGGGTGAGCATCCTTAATTCGAGACAATGTCTAATCAATTGCCACGTATTCAGCTGCCGAACGTAGTGGGCACCACGAGTTTGGTT
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/gene_sets.loc.sample	Mon May 27 13:54:15 2019 -0400
@@ -0,0 +1,14 @@
+# This is a sample file that enables tools to use gene/exon annotations in the GFF/GTF format.
+# 
+# The gene_sets.loc file syntax is:
+#<unique_build_id>	<dbkey>	<display_name>	<path>
+# 
+# Please ensure that the above fields are tab separated.
+# 
+# In case you have TWO or MORE providers PER dbkey, the one mentioned
+# first in the file, should have the "default" priority.
+#
+#Example:
+#
+#Homo_sapiens.GRCh37.74	hg19	GRCh37 (hg19) annotation from Ensembl, release 74	/depot/data2/galaxy/hg19/gene_sets/Homo_sapiens.GRCh37.74.gtf
+#Homo_sapiens.NCBI36.54	hg18	hg18 annotation from Ensembl, release 54	/depot/data2/galaxy/hg18/gene_sets/Homo_sapiens.NCBI36.54.gtf
--- a/tool_data_table_conf.xml.sample	Tue Feb 05 15:51:44 2019 -0500
+++ b/tool_data_table_conf.xml.sample	Mon May 27 13:54:15 2019 -0400
@@ -1,4 +1,9 @@
 <tables>
+    <!-- Location of all GFF/GTF files -->
+    <table name="gene_sets" comment_char="#">
+        <columns>value, dbkey, name, path</columns>
+        <file path="tool-data/gene_sets.loc" />
+    </table>
     <!-- Location of SAMTools indexed FASTA files -->
     <table name="fasta_indexes" comment_char="#">
         <columns>value, dbkey, name, path</columns>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.test	Mon May 27 13:54:15 2019 -0400
@@ -0,0 +1,12 @@
+<tables>
+    <!-- Location of all GFF/GTF files -->
+    <table name="gene_sets" comment_char="#">
+        <columns>value, dbkey, name, path</columns>
+        <file path="${__HERE__}/test-data/gene_sets.loc" />
+    </table>
+    <!-- Location of SAMTools indexed FASTA files -->
+    <table name="fasta_indexes" comment_char="#">
+        <columns>value, dbkey, name, path</columns>
+        <file path="${__HERE__}/test-data/fasta_indexes.loc" />
+    </table>
+</tables>