Mercurial > repos > iuc > hisat2

changeset 25:3fb01a8c902d draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hisat2 commit b7df8879a0f5d75c8562700fe9b5dc9e8173a652
author iuc
date Sat, 26 Jan 2019 04:45:24 -0500
parents 61ee47027bd3
children 0c16cad5e03b
files hisat2.xml test-data/hisat_input_1_split_forward.fastq test-data/hisat_output_spliced_1.bam test-data/novel_splicesite_out.tab
diffstat 4 files changed, 72 insertions(+), 2 deletions(-) [+]
line wrap: on
line diff
--- a/hisat2.xml	Thu Nov 15 10:31:25 2018 -0500
+++ b/hisat2.xml	Sat Jan 26 04:45:24 2019 -0500
@@ -1,4 +1,4 @@
-<tool id="hisat2" name="HISAT2" version="2.1.0+galaxy3" profile="17.01">
+<tool id="hisat2" name="HISAT2" version="2.1.0+galaxy4" profile="17.01">
     <description>A fast and sensitive alignment program</description>
     <macros>
         <import>hisat2_macros.xml</import>
@@ -280,7 +280,11 @@
     --min-intronlen ${adv.spliced_options.min_intron}
     --max-intronlen ${adv.spliced_options.max_intron}
     ${adv.spliced_options.tma}
-
+	
+    #if str($adv.spliced_options.novel_splicesite_outfile) == "true":
+       --novel-splicesite-outfile '$novel_splicesite_output'
+    #end if
+	
     #if str($adv.spliced_options.notmplen):
         ${adv.spliced_options.notmplen}
     #end if
@@ -523,6 +527,7 @@
                         <option value="--dta-cufflinks">Report alignments tailored specifically for Cufflinks</option>
                     </param>
                     <param name="notmplen" argument="--no-templatelen-adjustment" type="boolean" truevalue="--no-templatelen-adjustment" falsevalue="" label="Disable automatic template length adjustment for RNA-seq reads" help="Default: false" />
+                    <param name="novel_splicesite_outfile" type="boolean" checked="false" label="reports a list of novel splice sites" help="Default: false" />
                 </when>
             </conditional>
 
@@ -603,6 +608,13 @@
           <expand macro="dbKeyActions" />
         </data>
 
+        <!-- Novel Splice file -->
+        <data name="novel_splicesite_output"  format="tabular" label="${tool.name} on ${on_string}: Novel Splice Sites" >
+          <filter>adv['spliced_options']['spliced_options_selector'] == 'advanced' and adv['spliced_options']['novel_splicesite_outfile'] is True</filter>
+          <expand macro="dbKeyActions" />
+        </data>
+
+
     </outputs>
 
     <!-- Define tests -->
@@ -616,6 +628,7 @@
             <param name="input_1" ftype="fastqsanger" value="hisat_input_1_forward.fastq" />
             <param name="input_2" ftype="fastqsanger" value="hisat_input_1_reverse.fastq" />
             <param name="adv|reporting_options|reporting_options_selector" value="advanced"/>
+            <param name="novel_splicesite_outfile" value="false" />
             <output name="output_alignments" file="hisat_output_1.bam" ftype="bam" lines_diff="2" />
         </test>
         <!-- Ensure advanced scoring options work -->
@@ -770,6 +783,18 @@
             <param name="input_1" ftype="fasta" value="hisat_input_1_interleaved.fasta" />
             <output name="output_alignments" file="hisat_output_1_noqual.bam" ftype="bam" lines_diff="2" />
         </test>
+        <!-- Ensure novel splicesite file output works -->
+        <test>
+            <param name="type" value="single" />
+            <param name="source" value="history" />
+            <param name="history_item" ftype="fasta" value="phiX.fa" />
+            <param name="input_1" ftype="fastqsanger" value="hisat_input_1_split_forward.fastq" />
+            <param name="rna_strandness" value="R" />
+            <param name="adv|spliced_options|spliced_options_selector" value="advanced"/>
+            <param name="adv|spliced_options|novel_splicesite_outfile" value="true" />
+            <output name="output_alignments" file="hisat_output_spliced_1.bam" ftype="bam" lines_diff="2" />
+            <output name="novel_splicesite_output" file="novel_splicesite_out.tab" ftype="tabular" />
+        </test>
     </tests>
 
     <help><![CDATA[
@@ -1072,6 +1097,10 @@
 
     --no-templatelen-adjustment
             Disables template length adjustment for RNA-seq reads.
+    
+    --novel-splicesite-outfile
+			In this mode, HISAT2 reports a list of splice sites in the file :
+				chromosome name <tab> genomic position of the flanking base on the left side of an intron <tab> genomic position of the flanking base on the right <tab> strand (+, -, and .) '.' indicates an unknown strand for non-canonical splice sites.
 
 -----
 
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/hisat_input_1_split_forward.fastq	Sat Jan 26 04:45:24 2019 -0500
@@ -0,0 +1,40 @@
+@phiX174_1980_2501_0:1:0_3:0:0_0/1
+TTAGGTGTGTGTAAAACAGGTGCCGAAGAAGCTGGATTAACAGAATTGAGAACCAGCTTATCAGAAAAAA
++
+2222222222222222222222222222222222222222222222222222222222222222222222
+@phiX174_1542_1965_0:0:0_0:0:0_1/1
+CTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGCA
++
+2222222222222222222222222222222222222222222222222222222222222222222222
+@phiX174_2950_3377_0:0:0_2:0:0_2/1
+CTCAAATCCGGCGTCAACCATACCAGCATAGGAAGCATCAGCACCAGCACGCTCCCAAGCATTAATCTCA
++
+2222222222222222222222222222222222222222222222222222222222222222222222
+@phiX174_2259_2739_1:0:0_1:0:0_3/1
+CTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAACGCCGAAGCGGTAAAAAAT
++
+2222222222222222222222222222222222222222222222222222222222222222222222
+@phiX174_1141_1609_1:0:0_1:0:0_4/1
+TGGCGCTCTCCGTCTTTCTCCATTTCGTCGTGGCCTTGCTATTGACTCTACTGTAGACATTTTTACTTTT
++
+2222222222222222222222222222222222222222222222222222222222222222222222
+@phiX174_185_708_0:0:0_1:0:0_5/1
+CCTTTCGCCATCAACTAACGATTCTGTCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCT
++
+2222222222222222222222222222222222222222222222222222222222222222222222
+@phiX174_1363_1914_3:0:0_0:0:0_6/1
+GCGTTAAGGTACTGAATCTCTTTAGTCGCAGTAGGCGGAAAACGAACAAGCGCAAGAGTAAACATAGTGC
++
+2222222222222222222222222222222222222222222222222222222222222222222222
+@phiX174_3199_3732_0:0:0_1:0:0_7/1
+CTGGCACTTCTGCCGTTTCTGATAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAA
++
+2222222222222222222222222222222222222222222222222222222222222222222222
+@phiX174_36_572_1:0:0_0:0:0_8/1
+ACCATAAACGCAAGCCTCAACGCAGCGACGAGCACGAGAGCGGTCAGTAGCAATCCAAACTTTGTTACTC
++
+2222222222222222222222222222222222222222222222222222222222222222222222
+@phiX174_2128_2577_0:0:0_4:0:0_9/1
+TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGACCATGATTATGACCAGTGTTTCCAGTCCGTTCAG
++
+2222222222222222222222222222222222222222222222222222222222222222222222
Binary file test-data/hisat_output_spliced_1.bam has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/novel_splicesite_out.tab	Sat Jan 26 04:45:24 2019 -0500
@@ -0,0 +1,1 @@
+phiX174	2064	2162	.