Mercurial > repos > iuc > hmmer_hmmalign
annotate test-data/MADE1.nhmmscan_out @ 7:24fa8e890f08 draft
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
| author | iuc |
|---|---|
| date | Wed, 21 Jul 2021 14:15:36 +0000 |
| parents | b2453ee52845 |
| children |
| rev | line source |
|---|---|
|
3
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
1 # nhmmscan :: search DNA sequence(s) against a DNA profile database |
|
7
24fa8e890f08
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
iuc
parents:
5
diff
changeset
|
2 # HMMER 3.3.2 (Nov 2020); http://hmmer.org/ |
|
24fa8e890f08
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
iuc
parents:
5
diff
changeset
|
3 # Copyright (C) 2020 Howard Hughes Medical Institute. |
|
4
ca0b674e895b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7c3ac4ad5a64b737e1b8f73c522e006097596f1d
iuc
parents:
3
diff
changeset
|
4 # Freely distributed under the BSD open source license. |
|
3
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - |
|
7
24fa8e890f08
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
iuc
parents:
5
diff
changeset
|
6 # query sequence file: /tmp/tmp2vk0_a8v/files/7/d/6/dataset_7d62e9c6-1db3-4a28-9770-d56c56ccfb17.dat |
|
4
ca0b674e895b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7c3ac4ad5a64b737e1b8f73c522e006097596f1d
iuc
parents:
3
diff
changeset
|
7 # target HMM database: localref.hmm |
|
7
24fa8e890f08
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
iuc
parents:
5
diff
changeset
|
8 # per-seq hits tabular output: /tmp/tmp2vk0_a8v/files/7/0/4/dataset_70487df9-4948-42c0-a250-638bcc64487a.dat |
|
24fa8e890f08
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
iuc
parents:
5
diff
changeset
|
9 # hits output in Dfam format: /tmp/tmp2vk0_a8v/files/8/0/f/dataset_80fdcb47-0041-4a2c-bc0a-4820ac3c27d0.dat |
|
3
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
10 # max ASCII text line length: unlimited |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
11 # Vit filter P threshold: <= 0.001 |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
12 # Fwd filter P threshold: <= 1e-05 |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
13 # random number seed set to: 4 |
|
7
24fa8e890f08
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
iuc
parents:
5
diff
changeset
|
14 # number of worker threads: 0 |
|
3
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
15 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
16 |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
17 Query: humanchr1/239220001-239550000 [L=330000] |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
18 Scores for complete hit: |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
19 E-value score bias Model start end Description |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
20 ------- ------ ----- -------- ----- ----- ----------- |
|
5
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
21 4e-11 41.3 7.5 MADE1 302390 302466 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
|
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
22 1.9e-08 32.8 8.3 MADE1 174456 174498 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
|
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
23 6.3e-08 31.0 6.7 MADE1 302466 302389 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
|
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
24 4.9e-06 25.0 7.0 MADE1 174493 174456 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
|
3
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
25 ------ inclusion threshold ------ |
|
5
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
26 2.2 6.9 7.2 MADE1 304073 304103 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
|
3
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
27 |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
28 |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
29 Annotation for each hit (and alignments): |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
30 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
31 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
32 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- |
|
5
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
33 ! 41.3 7.5 4e-11 4 80 .] 302390 302466 .. 302387 302466 .. 80 0.88 |
|
3
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
34 |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
35 Alignment: |
|
5
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
36 score: 41.3 bits |
|
3
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
37 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
38 MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80 |
|
5
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
39 ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc aaaa g a t ctttt caccaa ctaa |
|
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
40 humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttAAAA---GT-AATGCTTTTACACCAATCTAA 302466 |
|
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
41 89*******************************************966644554...34.4578**************997 PP |
|
3
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
42 |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
43 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
44 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
45 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- |
|
5
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
46 ! 32.8 8.3 1.9e-08 1 43 [. 174456 174498 .. 174456 174518 .. 80 0.91 |
|
3
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
47 |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
48 Alignment: |
|
5
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
49 score: 32.8 bits |
|
3
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
50 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
51 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43 |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
52 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
53 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498 |
|
5
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
54 589************************************9986 PP |
|
3
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
55 |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
56 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
57 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
58 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- |
|
5
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
59 ! 31.0 6.7 6.3e-08 1 78 [. 302466 302389 .. 302466 302387 .. 80 0.80 |
|
3
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
60 |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
61 Alignment: |
|
5
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
62 score: 31.0 bits |
|
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
63 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF |
|
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
64 MADE1 1 ttaggttggtgcaaaagtaattgcggttttt....gccattacttttaatggcaaaaaccgcaattacttttgcaccaacct 78 |
|
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
65 ttag ttggtg aaaag a t tttt gc atta +aatggcaaaaacc caatt ttttgcacc acc |
|
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
66 humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAGCATT-A---CTTTTaaaaGCAATTAAAAGCAATGGCAAAAACCACAATTGATTTTGCACCGACCA 302389 |
|
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
67 6899************97543.2...23333455566666666666799*****************************9985 PP |
|
3
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
68 |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
69 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
70 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
71 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- |
|
5
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
72 ! 25.0 7.0 4.9e-06 43 80 .] 174493 174456 .. 174513 174456 .. 80 0.94 |
|
3
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
73 |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
74 Alignment: |
|
5
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
75 score: 25.0 bits |
|
3
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
76 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
77 MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80 |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
78 taatg caaaaacc caattacttttgcac aacctaa |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
79 humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456 |
|
5
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
80 5899*******************************986 PP |
|
3
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
81 |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
82 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
83 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
84 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ---- |
|
5
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
85 ? 6.9 7.2 2.2 41 71 .. 304073 304103 .. 304053 304109 .. 80 0.85 |
|
3
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
86 |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
87 Alignment: |
|
5
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
88 score: 6.9 bits |
|
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
89 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF |
|
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
90 MADE1 41 tttaatggcaaaaaccgcaattacttttgca 71 |
|
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
91 tt a tgg aaaaa ca tta ttttgca |
|
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
92 humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCA 304103 |
|
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
93 456789************************8 PP |
|
3
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
94 |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
95 |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
96 |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
97 Internal pipeline statistics summary: |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
98 ------------------------------------- |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
99 Query sequence(s): 1 (660000 residues searched) |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
100 Target model(s): 1 (80 nodes) |
|
5
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
101 Residues passing SSV filter: 60770 (0.0921); expected (0.02) |
|
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
102 Residues passing bias filter: 35792 (0.0542); expected (0.02) |
|
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
103 Residues passing Vit filter: 1612 (0.00244); expected (0.001) |
|
b2453ee52845
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents:
4
diff
changeset
|
104 Residues passing Fwd filter: 1194 (0.00181); expected (1e-05) |
|
4
ca0b674e895b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7c3ac4ad5a64b737e1b8f73c522e006097596f1d
iuc
parents:
3
diff
changeset
|
105 Total number of hits: 5 (0.000405) |
|
7
24fa8e890f08
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
iuc
parents:
5
diff
changeset
|
106 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01 |
|
24fa8e890f08
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
iuc
parents:
5
diff
changeset
|
107 # Mc/sec: 2765.21 |
|
3
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
108 // |
|
a9c62fc8187b
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff
changeset
|
109 [ok] |
