annotate test-data/MADE1.nhmmscan_out @ 7:b28e8ed99424 draft default tip

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
author iuc
date Wed, 21 Jul 2021 14:11:12 +0000
parents b4fe2f703b4b
children
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
3
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
1 # nhmmscan :: search DNA sequence(s) against a DNA profile database
7
b28e8ed99424 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
iuc
parents: 5
diff changeset
2 # HMMER 3.3.2 (Nov 2020); http://hmmer.org/
b28e8ed99424 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
iuc
parents: 5
diff changeset
3 # Copyright (C) 2020 Howard Hughes Medical Institute.
4
be0cc39776f9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7c3ac4ad5a64b737e1b8f73c522e006097596f1d
iuc
parents: 3
diff changeset
4 # Freely distributed under the BSD open source license.
3
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
7
b28e8ed99424 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
iuc
parents: 5
diff changeset
6 # query sequence file: /tmp/tmp2vk0_a8v/files/7/d/6/dataset_7d62e9c6-1db3-4a28-9770-d56c56ccfb17.dat
4
be0cc39776f9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7c3ac4ad5a64b737e1b8f73c522e006097596f1d
iuc
parents: 3
diff changeset
7 # target HMM database: localref.hmm
7
b28e8ed99424 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
iuc
parents: 5
diff changeset
8 # per-seq hits tabular output: /tmp/tmp2vk0_a8v/files/7/0/4/dataset_70487df9-4948-42c0-a250-638bcc64487a.dat
b28e8ed99424 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
iuc
parents: 5
diff changeset
9 # hits output in Dfam format: /tmp/tmp2vk0_a8v/files/8/0/f/dataset_80fdcb47-0041-4a2c-bc0a-4820ac3c27d0.dat
3
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
10 # max ASCII text line length: unlimited
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
11 # Vit filter P threshold: <= 0.001
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
12 # Fwd filter P threshold: <= 1e-05
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
13 # random number seed set to: 4
7
b28e8ed99424 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
iuc
parents: 5
diff changeset
14 # number of worker threads: 0
3
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
15 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
16
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
17 Query: humanchr1/239220001-239550000 [L=330000]
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
18 Scores for complete hit:
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
19 E-value score bias Model start end Description
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
20 ------- ------ ----- -------- ----- ----- -----------
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
21 4e-11 41.3 7.5 MADE1 302390 302466 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
22 1.9e-08 32.8 8.3 MADE1 174456 174498 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
23 6.3e-08 31.0 6.7 MADE1 302466 302389 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
24 4.9e-06 25.0 7.0 MADE1 174493 174456 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
3
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
25 ------ inclusion threshold ------
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
26 2.2 6.9 7.2 MADE1 304073 304103 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
3
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
27
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
28
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
29 Annotation for each hit (and alignments):
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
30 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
31 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
32 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
33 ! 41.3 7.5 4e-11 4 80 .] 302390 302466 .. 302387 302466 .. 80 0.88
3
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
34
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
35 Alignment:
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
36 score: 41.3 bits
3
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
37 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
38 MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
39 ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc aaaa g a t ctttt caccaa ctaa
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
40 humanchr1/239220001-239550000 302390 GGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCttttAAAA---GT-AATGCTTTTACACCAATCTAA 302466
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
41 89*******************************************966644554...34.4578**************997 PP
3
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
42
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
43 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
44 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
45 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
46 ! 32.8 8.3 1.9e-08 1 43 [. 174456 174498 .. 174456 174518 .. 80 0.91
3
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
47
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
48 Alignment:
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
49 score: 32.8 bits
3
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
50 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
51 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
52 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
53 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
54 589************************************9986 PP
3
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
55
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
56 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
57 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
58 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
59 ! 31.0 6.7 6.3e-08 1 78 [. 302466 302389 .. 302466 302387 .. 80 0.80
3
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
60
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
61 Alignment:
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
62 score: 31.0 bits
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
63 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
64 MADE1 1 ttaggttggtgcaaaagtaattgcggttttt....gccattacttttaatggcaaaaaccgcaattacttttgcaccaacct 78
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
65 ttag ttggtg aaaag a t tttt gc atta +aatggcaaaaacc caatt ttttgcacc acc
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
66 humanchr1/239220001-239550000 302466 TTAGATTGGTGTAAAAGCATT-A---CTTTTaaaaGCAATTAAAAGCAATGGCAAAAACCACAATTGATTTTGCACCGACCA 302389
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
67 6899************97543.2...23333455566666666666799*****************************9985 PP
3
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
68
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
69 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
70 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
71 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
72 ! 25.0 7.0 4.9e-06 43 80 .] 174493 174456 .. 174513 174456 .. 80 0.94
3
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
73
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
74 Alignment:
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
75 score: 25.0 bits
3
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
76 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
77 MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
78 taatg caaaaacc caattacttttgcac aacctaa
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
79 humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
80 5899*******************************986 PP
3
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
81
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
82 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
83 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
84 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
85 ? 6.9 7.2 2.2 41 71 .. 304073 304103 .. 304053 304109 .. 80 0.85
3
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
86
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
87 Alignment:
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
88 score: 6.9 bits
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
89 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
90 MADE1 41 tttaatggcaaaaaccgcaattacttttgca 71
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
91 tt a tgg aaaaa ca tta ttttgca
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
92 humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCA 304103
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
93 456789************************8 PP
3
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
94
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
95
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
96
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
97 Internal pipeline statistics summary:
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
98 -------------------------------------
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
99 Query sequence(s): 1 (660000 residues searched)
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
100 Target model(s): 1 (80 nodes)
5
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
101 Residues passing SSV filter: 60770 (0.0921); expected (0.02)
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
102 Residues passing bias filter: 35792 (0.0542); expected (0.02)
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
103 Residues passing Vit filter: 1612 (0.00244); expected (0.001)
b4fe2f703b4b "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
iuc
parents: 4
diff changeset
104 Residues passing Fwd filter: 1194 (0.00181); expected (1e-05)
4
be0cc39776f9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 7c3ac4ad5a64b737e1b8f73c522e006097596f1d
iuc
parents: 3
diff changeset
105 Total number of hits: 5 (0.000405)
7
b28e8ed99424 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
iuc
parents: 5
diff changeset
106 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
b28e8ed99424 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
iuc
parents: 5
diff changeset
107 # Mc/sec: 2765.21
3
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
108 //
c8e81e43bff1 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit fa7dec5f222510d58f566f4799a04e3731fa03f6
iuc
parents:
diff changeset
109 [ok]