comparison test-data/MADE1.out @ 7:b28e8ed99424 draft default tip

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
author iuc
date Wed, 21 Jul 2021 14:11:12 +0000
parents b4fe2f703b4b
children
comparison
equal deleted inserted replaced
6:314b778b8ffa 7:b28e8ed99424
1 # hmmscan :: search sequence(s) against a profile database 1 # hmmscan :: search sequence(s) against a profile database
2 # HMMER 3.3 (Nov 2019); http://hmmer.org/ 2 # HMMER 3.3.2 (Nov 2020); http://hmmer.org/
3 # Copyright (C) 2019 Howard Hughes Medical Institute. 3 # Copyright (C) 2020 Howard Hughes Medical Institute.
4 # Freely distributed under the BSD open source license. 4 # Freely distributed under the BSD open source license.
5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
6 # query sequence file: /tmp/tmpqydies2m/files/5/d/3/dataset_5d34ccc7-9920-470e-9f13-678ab2ecd29d.dat 6 # query sequence file: /tmp/tmpgjabmh94/files/d/c/f/dataset_dcfa47ad-e0da-4c8c-a808-c5bbd7eb2eda.dat
7 # target HMM database: localref.hmm 7 # target HMM database: localref.hmm
8 # per-seq hits tabular output: /tmp/tmpqydies2m/files/1/d/a/dataset_1da10e33-3e1c-48fc-abfb-7e3c263ec0df.dat 8 # per-seq hits tabular output: /tmp/tmpgjabmh94/files/9/8/3/dataset_9834554f-8f1e-4161-9c16-f4bd5042207c.dat
9 # per-dom hits tabular output: /tmp/tmpqydies2m/files/7/2/3/dataset_723f3cf1-e0de-4616-aec7-dd16680f3be3.dat 9 # per-dom hits tabular output: /tmp/tmpgjabmh94/files/8/e/b/dataset_8ebf81cb-d0c9-41a3-a725-c9e2f0d65d82.dat
10 # pfam-style tabular hit output: /tmp/tmpqydies2m/files/7/3/4/dataset_734c7f25-0a22-431b-9a7a-58849fcd6009.dat 10 # pfam-style tabular hit output: /tmp/tmpgjabmh94/files/1/f/0/dataset_1f08bd39-0984-447e-b71e-7bf3442d708d.dat
11 # max ASCII text line length: unlimited 11 # max ASCII text line length: unlimited
12 # Vit filter P threshold: <= 0.001 12 # Vit filter P threshold: <= 0.001
13 # Fwd filter P threshold: <= 1e-05 13 # Fwd filter P threshold: <= 1e-05
14 # random number seed set to: 4 14 # random number seed set to: 4
15 # number of worker threads: 1 15 # number of worker threads: 0
16 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - 16 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
17 17
18 Query: humanchr1/239220001-239550000 [L=330000] 18 Query: humanchr1/239220001-239550000 [L=59940]
19 Scores for complete sequence (score includes all domains): 19 Scores for complete sequence (score includes all domains):
20 --- full sequence --- --- best 1 domain --- -#dom- 20 --- full sequence --- --- best 1 domain --- -#dom-
21 E-value score bias E-value score bias exp N Model Description 21 E-value score bias E-value score bias exp N Model Description
22 ------- ------ ----- ------- ------ ----- ---- -- -------- ----------- 22 ------- ------ ----- ------- ------ ----- ---- -- -------- -----------
23 9.3e-18 51.2 26.3 1.3e-12 34.8 0.7 8.6 4 MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon 23
24 [No hits detected that satisfy reporting thresholds]
24 25
25 26
26 Domain annotation for each model (and alignments): 27 Domain annotation for each model (and alignments):
27 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
28 # score bias c-Evalue i-Evalue hmmfrom hmm to alifrom ali to envfrom env to acc
29 --- ------ ----- --------- --------- ------- ------- ------- ------- ------- ------- ----
30 1 ! 27.4 0.6 2.4e-10 2.4e-10 1 43 [. 174456 174498 .. 174456 174520 .. 0.93
31 2 ? -8.4 5.8 1 1 12 79 .. 197274 197341 .. 197272 197342 .. 0.86
32 3 ! 34.8 0.7 1.3e-12 1.3e-12 2 80 .] 302388 302466 .. 302387 302466 .. 0.87
33 4 ? 1.4 0.4 0.033 0.033 27 74 .. 304060 304106 .. 304029 304108 .. 0.71
34 28
35 Alignments for each domain: 29 [No targets detected that satisfy reporting thresholds]
36 == domain 1 score: 27.4 bits; conditional E-value: 2.4e-10
37 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
38 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43
39 ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt
40 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498
41 79**************************************997 PP
42
43 == domain 2 score: -8.4 bits; conditional E-value: 1
44 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
45 MADE1 12 caaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaaccta 79
46 caa gtaatt + tttt c att ttt t c aaa c c tta tt t ac a cta
47 humanchr1/239220001-239550000 197274 CAATGGTAATTTTATTTTTAACTATTTTATTTTTTAACTAAACTCACTTTTATTTATTTACATATCTA 197341
48 567789*******************999999999999*****99999999999988877777776666 PP
49
50 == domain 3 score: 34.8 bits; conditional E-value: 1.3e-12
51 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
52 MADE1 2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaacctaa 80
53 t ggt ggtgcaaaa aattg+ggtttttgccatt cttttaat gc a a t ctttt caccaa ctaa
54 humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTTTTAAAAGTAATGCTTTTACACCAATCTAA 302466
55 6799*****************************************99953333333345578**************997 PP
56
57 == domain 4 score: 1.4 bits; conditional E-value: 0.033
58 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
59 MADE1 27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcacca 74
60 tttt g c ta tt a tgg aaaaa + ca tta ttttgca a
61 humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTA 304106
62 334444443333.356788*************************9766 PP
63
64 30
65 31
66 Internal pipeline statistics summary: 32 Internal pipeline statistics summary:
67 ------------------------------------- 33 -------------------------------------
68 Query sequence(s): 1 (330000 residues searched) 34 Query sequence(s): 1 (59940 residues searched)
69 Target model(s): 1 (80 nodes) 35 Target model(s): 1 (80 nodes)
70 Passed MSV filter: 1 (1); expected 0.0 (0.02) 36 Passed MSV filter: 0 (0); expected 0.0 (0.02)
71 Passed bias filter: 1 (1); expected 0.0 (0.02) 37 Passed bias filter: 0 (0); expected 0.0 (0.02)
72 Passed Vit filter: 1 (1); expected 0.0 (0.001) 38 Passed Vit filter: 0 (0); expected 0.0 (0.001)
73 Passed Fwd filter: 1 (1); expected 0.0 (1e-05) 39 Passed Fwd filter: 0 (0); expected 0.0 (1e-05)
74 Initial search space (Z): 1 [actual number of targets] 40 Initial search space (Z): 1 [actual number of targets]
75 Domain search space (domZ): 1 [number of targets reported over threshold] 41 Domain search space (domZ): 0 [number of targets reported over threshold]
76 # CPU time: 0.21u 0.01s 00:00:00.22 Elapsed: 00:00:00.22 42 # CPU time: 0.00u 0.00s 00:00:00.00 Elapsed: 00:00:00.00
77 # Mc/sec: 117.29 43 # Mc/sec: 7920.43
78 // 44 //
79 [ok] 45 [ok]