diff test-data/MADE1.out @ 7:b28e8ed99424 draft default tip

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hmmer3 commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
author iuc
date Wed, 21 Jul 2021 14:11:12 +0000
parents b4fe2f703b4b
children
line wrap: on
line diff
--- a/test-data/MADE1.out	Thu Jan 14 15:42:52 2021 +0000
+++ b/test-data/MADE1.out	Wed Jul 21 14:11:12 2021 +0000
@@ -1,79 +1,45 @@
 # hmmscan :: search sequence(s) against a profile database
-# HMMER 3.3 (Nov 2019); http://hmmer.org/
-# Copyright (C) 2019 Howard Hughes Medical Institute.
+# HMMER 3.3.2 (Nov 2020); http://hmmer.org/
+# Copyright (C) 2020 Howard Hughes Medical Institute.
 # Freely distributed under the BSD open source license.
 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
-# query sequence file:             /tmp/tmpqydies2m/files/5/d/3/dataset_5d34ccc7-9920-470e-9f13-678ab2ecd29d.dat
+# query sequence file:             /tmp/tmpgjabmh94/files/d/c/f/dataset_dcfa47ad-e0da-4c8c-a808-c5bbd7eb2eda.dat
 # target HMM database:             localref.hmm
-# per-seq hits tabular output:     /tmp/tmpqydies2m/files/1/d/a/dataset_1da10e33-3e1c-48fc-abfb-7e3c263ec0df.dat
-# per-dom hits tabular output:     /tmp/tmpqydies2m/files/7/2/3/dataset_723f3cf1-e0de-4616-aec7-dd16680f3be3.dat
-# pfam-style tabular hit output:   /tmp/tmpqydies2m/files/7/3/4/dataset_734c7f25-0a22-431b-9a7a-58849fcd6009.dat
+# per-seq hits tabular output:     /tmp/tmpgjabmh94/files/9/8/3/dataset_9834554f-8f1e-4161-9c16-f4bd5042207c.dat
+# per-dom hits tabular output:     /tmp/tmpgjabmh94/files/8/e/b/dataset_8ebf81cb-d0c9-41a3-a725-c9e2f0d65d82.dat
+# pfam-style tabular hit output:   /tmp/tmpgjabmh94/files/1/f/0/dataset_1f08bd39-0984-447e-b71e-7bf3442d708d.dat
 # max ASCII text line length:      unlimited
 # Vit filter P threshold:       <= 0.001
 # Fwd filter P threshold:       <= 1e-05
 # random number seed set to:       4
-# number of worker threads:        1
+# number of worker threads:        0
 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
 
-Query:       humanchr1/239220001-239550000  [L=330000]
+Query:       humanchr1/239220001-239550000  [L=59940]
 Scores for complete sequence (score includes all domains):
    --- full sequence ---   --- best 1 domain ---    -#dom-
     E-value  score  bias    E-value  score  bias    exp  N  Model    Description
     ------- ------ -----    ------- ------ -----   ---- --  -------- -----------
-    9.3e-18   51.2  26.3    1.3e-12   34.8   0.7    8.6  4  MADE1     MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+
+   [No hits detected that satisfy reporting thresholds]
 
 
 Domain annotation for each model (and alignments):
->> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
-   #    score  bias  c-Evalue  i-Evalue hmmfrom  hmm to    alifrom  ali to    envfrom  env to     acc
- ---   ------ ----- --------- --------- ------- -------    ------- -------    ------- -------    ----
-   1 !   27.4   0.6   2.4e-10   2.4e-10       1      43 [.  174456  174498 ..  174456  174520 .. 0.93
-   2 ?   -8.4   5.8         1         1      12      79 ..  197274  197341 ..  197272  197342 .. 0.86
-   3 !   34.8   0.7   1.3e-12   1.3e-12       2      80 .]  302388  302466 ..  302387  302466 .. 0.87
-   4 ?    1.4   0.4     0.033     0.033      27      74 ..  304060  304106 ..  304029  304108 .. 0.71
 
-  Alignments for each domain:
-  == domain 1  score: 27.4 bits;  conditional E-value: 2.4e-10
-                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
-                          MADE1      1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43    
-                                       ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt
-  humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498
-                                       79**************************************997 PP
-
-  == domain 2  score: -8.4 bits;  conditional E-value: 1
-                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
-                          MADE1     12 caaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaaccta 79    
-                                       caa  gtaatt +  tttt  c att   ttt  t  c aaa  c c  tta tt t  ac  a cta
-  humanchr1/239220001-239550000 197274 CAATGGTAATTTTATTTTTAACTATTTTATTTTTTAACTAAACTCACTTTTATTTATTTACATATCTA 197341
-                                       567789*******************999999999999*****99999999999988877777776666 PP
-
-  == domain 3  score: 34.8 bits;  conditional E-value: 1.3e-12
-                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
-                          MADE1      2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaacctaa 80    
-                                       t ggt ggtgcaaaa  aattg+ggtttttgccatt cttttaat gc    a     a t ctttt caccaa ctaa
-  humanchr1/239220001-239550000 302388 TTGGTCGGTGCAAAATCAATTGTGGTTTTTGCCATTGCTTTTAATTGCTTTTAAAAGTAATGCTTTTACACCAATCTAA 302466
-                                       6799*****************************************99953333333345578**************997 PP
-
-  == domain 4  score: 1.4 bits;  conditional E-value: 0.033
-                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
-                          MADE1     27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcacca 74    
-                                       tttt g c  ta  tt a tgg aaaaa + ca tta ttttgca  a
-  humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTA 304106
-                                       334444443333.356788*************************9766 PP
-
+   [No targets detected that satisfy reporting thresholds]
 
 
 Internal pipeline statistics summary:
 -------------------------------------
-Query sequence(s):                         1  (330000 residues searched)
+Query sequence(s):                         1  (59940 residues searched)
 Target model(s):                           1  (80 nodes)
-Passed MSV filter:                         1  (1); expected 0.0 (0.02)
-Passed bias filter:                        1  (1); expected 0.0 (0.02)
-Passed Vit filter:                         1  (1); expected 0.0 (0.001)
-Passed Fwd filter:                         1  (1); expected 0.0 (1e-05)
+Passed MSV filter:                         0  (0); expected 0.0 (0.02)
+Passed bias filter:                        0  (0); expected 0.0 (0.02)
+Passed Vit filter:                         0  (0); expected 0.0 (0.001)
+Passed Fwd filter:                         0  (0); expected 0.0 (1e-05)
 Initial search space (Z):                  1  [actual number of targets]
-Domain search space  (domZ):               1  [number of targets reported over threshold]
-# CPU time: 0.21u 0.01s 00:00:00.22 Elapsed: 00:00:00.22
-# Mc/sec: 117.29
+Domain search space  (domZ):               0  [number of targets reported over threshold]
+# CPU time: 0.00u 0.00s 00:00:00.00 Elapsed: 00:00:00.00
+# Mc/sec: 7920.43
 //
 [ok]