changeset 0:f239ab5f45f4 draft

planemo upload for repository commit 4261b86af790a3535c0b9a8122f92225f8f67b47
author iuc
date Sat, 25 Jun 2016 15:07:17 -0400
children d15979968b74
files macros.xml nhmmer.xml readme.rst test-data/MADE1.hmm test-data/MADE1.out test-data/MADE1.out.domtblout test-data/MADE1.out.pfamtblout test-data/MADE1.out.tblout test-data/MADE1.sto test-data/dna_target.fa test-data/fn3.hmm test-data/fn3.keys test-data/fn3.out test-data/fn3.sto test-data/globins-45-align.sto test-data/globins-masked.sto test-data/globins.domtblout test-data/globins.pfamtblout test-data/globins.tblout test-data/globins4-emit-1.sto test-data/globins4-emit.sto test-data/globins4.hmm test-data/globins4.hmm.bin test-data/globins4.hmm2 test-data/globins4.out test-data/globins4.sto test-data/globins45.fa test-data/jackhmmer.domtblout test-data/jackhmmer.out test-data/jackhmmer.tblout test-data/nhmmer.out test-data/phmmer.domtblout test-data/phmmer.out test-data/phmmer.pfamtblout test-data/phmmer.tblout test-data/uniprot_globins_match.out test-data/uniprot_matches.fasta tool_dependencies.xml
diffstat 39 files changed, 39988 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/	Sat Jun 25 15:07:17 2016 -0400
@@ -0,0 +1,39 @@
+# Necessary
+- output names on `$(grep tblout *.xml)`
+- Help text
+- HmmPress datatypes
+- Publicly available hmm databases? data manager needed? Locally installed, etc?
+- Use hmmpress databases in History/Locally Cached/etc
+# Programs
+- hmmstat
+- hmmsim
+- hmmc2
+- hmmlogo +skylign
+Easel toolkit
+- esl-afetch
+- esl-alimanip
+- esl-alimap
+- esl-alimask
+- esl-alimerge
+- esl-alipid
+- esl-alistat
+- esl-cluster
+- esl-compalign
+- esl-compstruct
+- esl-construct
+- esl-histplot
+- esl-mask
+- esl-reformat
+- esl-selectn
+- esl-seqrange
+- esl-seqstat
+- esl-sfetch
+- esl-shuffle
+- esl-ssdraw
+- esl-stranslate
+- esl-weight
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml	Sat Jun 25 15:07:17 2016 -0400
@@ -0,0 +1,1072 @@
+<?xml version="1.0"?>
+  <xml name="requirements">
+    <requirements>
+      <requirement type="package" version="3.1b2">hmmer</requirement>
+      <yield/>
+    </requirements>
+  </xml>
+  <token name="@WRAPPER_VERSION@">0.1</token>
+  <xml name="stdio">
+    <stdio>
+      <!-- Anything other than zero is an error -->
+      <exit_code range="1:"/>
+      <exit_code range=":-1"/>
+      <!-- In case the return code has not been set propery check stderr too -->
+      <regex match="Error:"/>
+      <regex match="Exception:"/>
+    </stdio>
+  </xml>
+  <token name="@THRESHOLDS@">
+-E $E
+--domE $domE
+#if $T:
+-T $T
+#end if
+#if $domT:
+--domT $domT
+#end if
+#if $incE:
+--incE $incE
+#end if
+#if $incT:
+--incT $incT
+#end if
+#if $incdomE:
+--incdomE $incdomE
+#end if
+#if $incdomT:
+--incdomT $incdomT
+#end if
+  </token>
+  <xml name="thresholds_xml">
+    <!-- Options controlling reporting thresholds -->
+    <param name="E" label="report sequences &lt;= this E-Value threshold in output" help="(-E)" value="10.0" type="float" min="0"/>
+    <param name="domE" label="report domains &lt;= this E-Value threshold in output" help="(--domE)" value="10.0" type="float" min="0"/>
+    <param name="T" label="report sequences &gt;= this score threshold in output" help="(-T)" type="float" optional="True"/>
+    <param name="domT" label="report domains &gt;= this score threshold in output" help="(--domT)" type="float" optional="True"/>
+    <!-- Options controlling inclusion (significance) thresholds -->
+    <param name="incE" label="consider sequences &lt;= this E-Value threshold as significant" help="(--incE)" type="float" optional="True"/>
+    <param name="incdomE" label="consider domains &lt;= this E-Value threshold as significant" help="(--incdomE)" type="float" optional="True"/>
+    <param name="incT" label="consider sequences &gt;= this score threshold as significant" help="(--incT)" type="float" optional="True"/>
+    <param name="incdomT" label="consider domains &gt;= this score threshold as significant" help="(--incdomT)" type="float" optional="True"/>
+  </xml>
+  <token name="@THRESHOLDS_NODOM@">
+-E $E
+#if $T:
+-T $T
+#end if
+#if $incE:
+--incE $incE
+#end if
+#if $incT:
+--incT $incT
+#end if
+  </token>
+  <xml name="thresholds_nodom">
+    <!-- Options controlling reporting thresholds -->
+    <param name="E" label="report sequences &lt;= this E-Value threshold in output" help="(-E)" value="10.0" type="float" min="0"/>
+    <param name="T" label="report sequences &gt;= this score threshold in output" help="(-T)" type="float" optional="True"/>
+    <!-- Options controlling inclusion (significance) thresholds -->
+    <param name="incE" label="consider sequences &lt;= this E-Value threshold as significant" help="(--incE)" type="float" optional="True"/>
+    <param name="incT" label="consider sequences &gt;= this score threshold as significant" help="(--incT)" type="float" optional="True"/>
+  </xml>
+  <token name="@ACCEL_HEUR@">
+--F1 $F1
+--F2 $F2
+--F3 $F3
+  </token>
+  <xml name="accel_heur_xml">
+    <!-- Options controlling acceleration heuristics -->
+    <param name="max" type="boolean" truevalue="--max" label="Turn all heuristic filters off (less speed, more power)" help="(--max)" falsevalue=""/>
+    <param name="F1" type="float" label="Stage 1 (MSV) threshold: promote hits w/ P &lt;= F1" help="(--F1)" value="0.02"/>
+    <param name="F2" type="float" label="Stage 2 (Vit) threshold: promote hits w/ P &lt;= F2" help="(--F2)" value="1e-3"/>
+    <param name="F3" type="float" label="Stage 3 (Fwd) threshold: promote hits w/ P &lt;= F3" help="(--F3)" value="1e-5"/>
+    <param name="nobias" type="boolean" truevalue="--nobias" label="Turn off composition bias filter" help="(--nobias)" falsevalue=""/>
+  </xml>
+  <token name="@EVAL_CALIB@">
+--EmL $EmL
+--EmN $EmN
+--EvL $EvL
+--EvN $EvN
+--EfL $EfL
+--EfN $EfN
+--Eft $Eft
+  </token>
+  <xml name="eval_calib_xml">
+    <!-- Control of E-value calibration -->
+    <param name="EmL" type="integer" value="200" min="1" help="(--EmL)" label="Length of sequences for MSV Gumbel mu fit"/>
+    <param name="EmN" type="integer" value="200" min="1" help="(--EmN)" label="Number of sequences for MSV Gumbel mu fit"/>
+    <param name="EvL" type="integer" value="200" min="1" help="(--EvL)" label="Length of sequences for Viterbi Gumbel mu fit"/>
+    <param name="EvN" type="integer" value="200" min="1" help="(--EvN)" label="Number of sequences for Viterbi Gumbel mu fit"/>
+    <param name="EfL" type="integer" value="100" min="1" help="(--EfL)" label="Length of sequences for Forward exp tail tau fit"/>
+    <param name="EfN" type="integer" value="200" min="1" help="(--EfN)" label="Number of sequences for Forward exp tail tau fit"/>
+    <param name="Eft" type="float" value="0.04" min="0" max="1" help="(--Eft)" label="tail mass for Forward exponential tail tau fit"/>
+  </xml>
+  <token name="@OFORMAT_WITH_OPTS_NOPFAM@">
+#if 'tblout' in str($oformat):
+    --tblout $tblout
+#end if
+#if 'domtblout' in str($oformat):
+    --domtblout $domtblout
+#end if
+$acc $noali $notextw
+  </token>
+  <xml name="oformat_with_opts_nopfam">
+    <!-- Options directing output -->
+    <param name="oformat" multiple="True" display="checkboxes" label="Output Formats" type="select">
+      <option value="tblout" selected="true">Table of per-sequence hits (--tblout)</option>
+      <option value="domtblout" selected="true">Table of per-domain hits (--domtblout)</option>
+    </param>
+    <param name="acc" type="boolean" truevalue="--acc" falsevalue="" label="Prefer accessions over names in output" help="(--acc)"/>
+    <param name="noali" type="boolean" truevalue="--noali" falsevalue="" label="Don't output alignments, so output is smaller" help="(--noali)"/>
+    <param name="notextw" type="boolean" truevalue="--notextw" falsevalue="" label="Unlimited ASCII text output line width" help="(--notextw)"/>
+  </xml>
+  <token name="@OFORMAT_WITH_OPTS@">
+#if 'tblout' in str($oformat):
+    --tblout $tblout
+#end if
+#if 'domtblout' in str($oformat):
+    --domtblout $domtblout
+#end if
+#if 'pfamtblout' in str($oformat):
+    --pfamtblout $pfamtblout
+#end if
+$acc $noali $notextw
+  </token>
+  <xml name="oformat_with_opts">
+    <!-- Options directing output -->
+    <param name="oformat" multiple="True" display="checkboxes" label="Output Formats" type="select">
+      <option value="tblout" selected="true">Table of per-sequence hits (--tblout)</option>
+      <option value="domtblout" selected="true">Table of per-domain hits (--domtblout)</option>
+      <option value="pfamtblout" selected="true">Table of hits and domains in Pfam format (--pfamtblout)</option>
+    </param>
+    <param name="acc" type="boolean" truevalue="--acc" falsevalue="" label="Prefer accessions over names in output" help="(--acc)"/>
+    <param name="noali" type="boolean" truevalue="--noali" falsevalue="" label="Don't output alignments, so output is smaller" help="(--noali)"/>
+    <param name="notextw" type="boolean" truevalue="--notextw" falsevalue="" label="Unlimited ASCII text output line width" help="(--notextw)"/>
+  </xml>
+  <xml name="oformat_test">
+      <param name="notextw" value="True" />
+  </xml>
+  <!-- TODO: tblout will match 'pfamtblout,dfamtblout' -->
+  <token name="@OFORMAT_WITH_OPTS_N@">
+#if 'tblout' in str($oformat):
+    --tblout $tblout
+#end if
+#if 'dfamtblout' in str($oformat):
+    --dfamtblout $dfamtblout
+#end if
+#if 'aliscoresout' in str($oformat):
+    --aliscoresout $aliscoresout
+#end if
+$acc $noali $notextw
+  </token>
+  <xml name="oformat_with_opts_n">
+    <!-- Options directing output -->
+    <param name="oformat" multiple="True" display="checkboxes" label="Output Formats" type="select">
+      <option value="tblout" selected="true">Table of hits (--tblout)</option>
+      <option value="dfamtblout" selected="true">Table of hits in Dfam format (--dfamtblout)</option>
+      <option value="aliscoresout">Scores for each position in each alignment to file (--aliscoresout)</option>
+    </param>
+    <param name="acc" type="boolean" truevalue="--acc" falsevalue="" label="Prefer accessions over names in output" help="(--acc)"/>
+    <param name="noali" type="boolean" truevalue="--noali" falsevalue="" label="Don't output alignments, so output is smaller" help="(--noali)"/>
+    <param name="notextw" type="boolean" truevalue="--notextw" falsevalue="" label="Unlimited ASCII text output line width" help="(--notextw)"/>
+  </xml>
+  <token name="@HSSI@">
+#if $hssi.hssi_select == "singlemx":
+    --popen $hssi.popen
+    --pextend $hssi.pextend
+#end if
+  </token>
+  <xml name="hssi">
+    <!-- Handling single sequence inputs -->
+    <conditional name="hssi">
+      <param name="hssi_select" type="select" label="Options for handling single sequence inputs">
+        <option value="false" selected="true">Disable</option>
+        <option value="singlemx">Use substitution score matrix for single-sequence inputs</option>
+      </param>
+      <when value="singlemx">
+        <param name="popen" type="float" value="0.02" label="Gap open probability" help="(--popen)" min="0.0" max="0.5"/>
+        <param name="pextend" type="float" value="0.4" label="Gap extend probability" help="(--pextend)" min="0.0" max="1.0"/>
+      </when>
+      <when value="false">
+      </when>
+      <!-- -mx <s>      : substitution score matrix (built-in matrices, with -singlemx)-->
+      <!-- -mxfile <f>  : read substitution score matrix from file <f> (with -singlemx)-->
+    </conditional>
+  </xml>
+  <token name="@CPU@">
+      --cpu \${GALAXY_SLOTS:-2}
+  </token>
+  <token name="@SEED@">
+      --seed $seed
+  </token>
+  <xml name="seed">
+    <param name="seed" label="RNG seed, 0 generates a random seed" value="42" type="integer" help="(--seed)" min="0"/>
+  </xml>
+  <xml name="seed_test">
+      <param name="seed" value="4" />
+  </xml>
+  <token name="@ADV_OPTS@">
+#if $Z:
+-Z $Z
+#end if
+#if $domZ:
+--domZ $domZ
+#end if
+  </token>
+  <xml name="adv_opts">
+    <!-- Other options -->
+    <param name="nonull2" type="boolean" truevalue="--nonull2" label="Turn off biased composition score corrections" help="(--nonull2)" falsevalue=""/>
+    <param name="Z" type="integer" label="# of comparisons done for E-value calculation" help="(-Z)" optional="True"/>
+    <param name="domZ" type="integer" label="# of significant sequences, for domain E-value calculation" help="(--domZ)" optional="True"/>
+  </xml>
+  <token name="@FORMAT_SELECTOR@">
+      $input_format_select
+  </token>
+  <xml name="format_selector">
+    <param name="input_format_select" type="select" label="Format of sequence and model">
+      <option value="--amino">Protein</option>
+      <option value="--dna">DNA</option>
+      <option value="--rna">RNA</option>
+    </param>
+  </xml>
+  <xml name="format_selector_noprot">
+    <param name="input_format_select" type="select" label="Format of sequence and model">
+      <option value="--dna">DNA</option>
+      <option value="--rna">RNA</option>
+    </param>
+  </xml>
+  <token name="@ARSWS@">
+#if $arsws.arsws_select == "--wblosum":
+--wid $arsws.wid
+#end if
+  </token>
+  <xml name="arsws">
+    <!-- Alternative relative sequence weighting strategies -->
+    <conditional name="arsws">
+      <param name="arsws_select" type="select" label="Alternative relative sequence weighting strategies">
+        <option value="--wpb" selected="true">Henikoff position-based weights (--wpb)</option>
+        <option value="--wgsc">Gerstein/Sonnhammer/Chothia tree weights (--wgsc)</option>
+        <option value="--wblosum">Henikoff simple filter weights (--wblosum)</option>
+        <option value="--wnone">don't do any relative weighting; set all to 1 (--wnnoe)</option>
+        <option value="--wgiven">use weights as given in MSA file (--wgiven)</option>
+      </param>
+      <when value="--wpb">
+      </when>
+      <when value="--wgsc">
+      </when>
+      <when value="--wblosum">
+        <param name="wid" label="Set identity cutoff" value="0.62" type="float" help="(--wid)"/>
+      </when>
+      <when value="--wnone">
+      </when>
+      <when value="--wgiven">
+      </when>
+    </conditional>
+  </xml>
+  <token name="@AEEWS@">
+#if $aeews.aeews_select != "":
+    #if $aeews.aeews_select == "eent":
+        --eset $aeews.eset
+        --ere $aeews.ere
+        --esigma $aeews.esigma
+    #elif $aeews.aeews_select == "eclust":
+        --eset $aeews.eset
+        --eid $aeews.eid
+    #end if
+#end if
+  </token>
+  <xml name="aeews">
+    <!-- Alternative effective sequence weighting strategies -->
+    <conditional name="aeews">
+      <param name="aeews_select" type="select" label="Alternative effective sequence weighting strategies">
+        <option value="">Disabled</option>
+        <option value="eent">Adjust eff seq # to achieve relative entropy target (--eent)</option>
+        <option value="eclust">Eff seq # is the # of single linkage clusters (--eclust)</option>
+        <option value="enone">No effective seq # weighting: just use nseq (--enone)</option>
+      </param>
+      <when value="">
+      </when>
+      <when value="eent">
+        <param name="eset" type="float" value="0" label="set eff seq # for all models" help="(--eset)"/>
+        <param name="ere" type="float" value="0" label="set minimum rel entropy/position" help="(--ere)"/>
+        <param name="esigma" type="float" value="45" label="set sigma param" help="(--esigma)"/>
+      </when>
+      <when value="eclust">
+        <param name="eset" type="float" value="0" label="set eff seq # for all models" help="(--eset)"/>
+        <param name="eid" type="float" value="0.62" label="set fractional identity cutoff" min="0" max="1" help="(--eid)"/>
+      </when>
+      <when value="enone">
+      </when>
+    </conditional>
+  </xml>
+  <token name="@CUT@">
+  </token>
+  <xml name="cut">
+    <param name="cut_ga" type="boolean" truevalue="--cut_ga" label="use profile's GA gathering cutoffs to set all thresholding" help="(--cut_ga)" falsevalue=""/>
+    <param name="cut_nc" type="boolean" truevalue="--cut_nc" label="use profile's NC gathering cutoffs to set all thresholding" help="(--cut_nc)" falsevalue=""/>
+    <param name="cut_tc" type="boolean" truevalue="--cut_tc" label="use profile's TC gathering cutoffs to set all thresholding" help="(--cut_tc)" falsevalue=""/>
+  </xml>
+  <token name="@MCSS@">
+#if $mcs.model_construction_strategy_select == "fast":
+--symfrac $mcs.symfrac
+#end if
+  </token>
+  <xml name="mcss">
+    <!-- Alternative model construction strategies -->
+    <conditional name="mcs">
+      <param name="model_construction_strategy_select" type="select" label="Model Construction Strategy">
+        <option value="fast" selected="true">Assign columns with &gt;= symfrac residues as consensus (--fast)</option>
+        <option value="hand">Manual construction (requires reference annotation) (--hand)</option>
+      </param>
+      <when value="fast">
+        <param name="symfrac" value="0.5" type="float" label="Sets sym fraction controlling --fast construction"/>
+      </when>
+      <when value="hand"></when>
+    </conditional>
+    <param name="fragthresh" label="Fraction of alignment length, under which sequences are excluded" help="HMMER infers fragments if the sequence length L is less than or equal to a fraction x times the alignment length in columns (--fragthresh)" value="0.5" optional="True" type="float" />
+  </xml>
+  <token name="@PRIOR@">
+  </token>
+  <xml name="prior">
+    <param name="aps_select" type="select" label="Alternative Prior Strategies">
+      <option value="" selected="true">Unspecified</option>
+      <option value="--pnone">Don't use any prior; parameters are frequencies (--pnone)</option>
+      <option value="--plaplace">Use a Laplace +1 prior (--plaplace)</option>
+    </param>
+  </xml>
+  <xml name="citation">
+    <citations>
+      <citation type="doi">10.1093/nar/gkr367</citation>
+    </citations>
+  </xml>
+  <token name="@LENGTHS@">
+#if $w_beta:
+--w_beta $w_beta
+#end if
+#if $w_length:
+--w_length $w_length
+#end if
+  </token>
+  <xml name="lengths">
+    <param name="w_beta" label="Tail mass at which window length is determined"
+        help="(--w_beta)" optional="True" type="float"/>
+    <param name="w_length" label="Window Length"
+        help="(--w_length)" optional="True" type="integer" />
+  </xml>
+  <xml name="input_hmm">
+    <param name="hmmfile" type="data" label="HMM model" format="hmm2,hmm3"/>
+  </xml>
+  <xml name="input_msa">
+    <param name="msafile" type="data" label="Multiple Sequence Alignment" format="stockholm,clustal,fasta"
+      help="in Stockholm, Clustal, or Fasta format. While this tool accepts fasta, please ensure that the sequences are not unaligned"/>
+  </xml>
+  <token name="@ACCEL_HEUR_HELP@"><![CDATA[
+Acceleration Heuristicts (--F1, --F2, --F3)
+**MSV filter**
+The sequence is aligned to the profile using a specialized model that
+allows multiple high-scoring local ungapped segments to match. The
+optimal alignment score (Viterbi score) is calculated under this multi-
+segment model, hence the term MSV, for “multi-segment Viterbi”. This is
+HMMER’s main speed heuristic. The MSV score is comparable to BLAST’s sum
+score (optimal sum of ungapped alignment segments). Roughly speaking,
+MSV is comparable to skipping the heuristic word hit and hit extension
+steps of the BLAST acceleration algorithm.
+The MSV filter is very, very fast. In addition to avoiding indel
+calculations in the dynamic programming table, it uses reduced precision
+scores scaled to 8-bit integers, enabling acceleration via 16-way
+parallel SIMD vector instructions.
+The MSV score is a true log-odds likelihood ratio, so it obeys
+conjectures about the expected score distribution (Eddy, 2008) that
+allow immediate and accurate calculation of the statistical significance
+(P- value) of the MSV bit score.
+By default, comparisons with a P-value of ≤ 0.02 pass this filter,
+meaning that about 2% of nonhomol- ogous sequences are expected to pass.
+You can use the --F1 option to change this threshold. For example, --F1
+<0.05> would pass 5% of the comparisons, making a search more sensitive
+but slower. Setting the threshold to ≥ 1.0 (--F1 99 for example) assures
+that all comparisons will pass. Shutting off the MSV filter may be
+worthwhile if you want to make sure you don’t miss comparisons that have
+a lot of scattered insertions and deletions. Alternatively, the --max
+option causes the MSV filter step (and all other filter steps) to be
+The MSV bit score is calculated as a log-odds score using the null model
+for comparison. No correction for a biased composition or repetitive
+sequence is done at this stage. For comparisons involving biased
+sequences and/or profiles, more than 2% of comparisons will pass the MSV
+filter. At the end of search output, there is a line like:
+    Passed MSV filter: 107917 (0.020272); expected 106468.8 (0.02)
+which tells you how many and what fraction of comparisons passed the MSV
+filter, versus how many (and what fraction) were expected.
+**Viterbi filter**
+The sequence is now aligned to the profile using a fast Viterbi algorithm for
+optimal gapped alignment.
+This Viterbi implementation is specialized for speed. It is implemented in
+8-way parallel SIMD vector instructions, using reduced precision scores that
+have been scaled to 16-bit integers. Only one row of the dynamic programming
+matrix is stored, so the routine only recovers the score, not the optimal
+alignment itself. The reduced representation has limited range; local alignment
+scores will not underflow, but high scoring comparisons can overflow and return
+infinity, in which case they automatically pass the filter.
+The final Viterbi filter bit score is then computed using the appropriate null
+model log likelihood (by default the biased composition filter model score, or
+if the biased filter is off, just the null model score). If the P-value of this
+score passes the Viterbi filter threshold, the sequence passes on to the next
+step of the pipeline.
+The --F2 <x> option controls the P-value threshold for passing the Viterbi
+filter score. The default is 0.001. The --max option bypasses all filters in
+the pipeline.  At the end of a search output, you will see a line like:
+    Passed Vit filter: 2207  (0.00443803); expected 497.3 (0.001)
+which tells you how many and what fraction of comparisons passed the Viterbi
+filter, versus how many were expected.
+**Forward filter/parser**
+The sequence is now aligned to the profile using the full Forward algorithm,
+which calculates the likelihood of the target sequence given the profile,
+summed over the ensemble of all possible alignments.
+This is a specialized time- and memory-efficient Forward implementation called
+the “Forward parser”. It is implemented in 4-way parallel SIMD vector
+instructions, in full precision (32-bit floating point). It stores just enough
+information that, in combination with the results of the Backward parser
+(below), posterior probabilities of start and stop points of alignments
+(domains) can be calculated in the domain definition step (below), although the
+detailed alignments themselves cannot be.
+The Forward filter bit score is calculated by correcting this score using the
+appropriate null model log likelihood (by default the biased composition filter
+model score, or if the biased filter is off, just the null model score). If the
+P-value of this bit score passes the Forward filter threshold, the sequence
+passes on to the next step of the pipeline.
+The bias filter score has no further effect in the pipeline. It is only used in
+filter stages. It has no effect on final reported bit scores or P-values.
+Biased composition compensation for final bit scores is done by a more complex
+domain-specific algorithm, described below.
+The --F3 <x> option controls the P-value threshold for passing the Forward
+filter score. The default is 1e-5. The --max option bypasses all filters in the
+pipeline.  At the end of a search output, you will see a line like:
+    Passed Fwd filter: 1076 (0.00216371); expected 5.0 (1e-05)
+which tells you how many and what fraction of comparisons passed the Forward
+filter, versus how many were expected.
+**Bias Filter Options**
+The --max option bypasses all filters in the pipeline, including the bias
+The --nobias option turns off (bypasses) the biased composition filter. The
+simple null model is used as a null hypothesis for MSV and in subsequent filter
+steps. The biased composition filter step compromises a small amount of
+sensitivity. Though it is good to have it on by default, you may want to shut
+it off if you know you will have no problem with biased composition hits.
+**Advanced Documentation**
+A more detailed look at the internals of the various filter pipelines was
+posted on the `developer's blog <>`__.
+The information posted there may be useful to those who are struggling with
+poor-scoring sequences.
+  <token name="@ADV_OPTS_HELP@"><![CDATA[
+Advanced Options
+can be too aggressive sometimes, causing you to miss homologs. You can turn the
+biased-composition score correction off with the --nonull2 option (and if
+you’re doing that, you may also want to set --nobias, to turn off another
+biased composition step called the bias filter, which affects which sequences
+get scored at all).
+Assert that the total number of targets in your searches is <x>, for the
+purposes of per-domain conditional E-value calculations, rather than the number
+of targets that passed the reporting thresholds.
+Assert that the total number of targets in your searches is <x>, for the
+purposes of per-sequence E-value calculations, rather than the actual number of
+targets seen.
+  <token name="@AEEWS_HELP@"><![CDATA[
+Effective Sequence Number
+After relative weights are determined, they are normalized to sum to a total
+effective sequence number, eff nseq. This number may be the actual number of
+sequences in the alignment, but it is almost always smaller than that. The
+default entropy weighting method (--eent) reduces the effective sequence num-
+ber to reduce the information content (relative entropy, or average expected
+score on true homologs) per consensus position. The target relative entropy is
+controlled by a two-parameter function, where the two parameters are settable
+with --ere and --esigma.
+Adjust effective sequence number to achieve a specific relative entropy per
+position (see --ere). This is the default.
+Set effective sequence number to the number of single-linkage clusters at a
+specific identity threshold (see --eid). This option is not recommended; it’s
+for experiments evaluating how much better --eent is.
+Turn off effective sequence number determination and just use the actual number
+of sequences. One reason you might want to do this is to try to maximize the
+relative entropy/position of your model, which may be useful for short models.
+Explicitly set the effective sequence number for all models to <x>.
+Set the minimum relative entropy/position target to <x>. Requires --eent. Default
+depends on the sequence alphabet. For protein sequences, it is 0.59 bits/position;
+for nucleotide sequences, it is 0.45 bits/position.
+Sets the minimum relative entropy contributed by an entire model alignment, over
+its whole length. This has the effect of making short models have higher relative
+entropy per position than --ere alone would give. The default is 45.0 bits.
+Sets the fractional pairwise identity cutoff used by single linkage clustering
+with the --eclust option. The default is 0.62.
+  <token name="@ARSWS_HELP@"><![CDATA[
+Options Controlling Relative Weights
+HMMER uses an ad hoc sequence weighting algorithm to downweight closely related
+sequences and up-weight distantly related ones. This has the effect of making
+models less biased by uneven phylogenetic representation. For example, two
+identical sequences would typically each receive half the weight that one
+sequence would. These options control which algorithm gets used.
+Use the Henikoff position-based sequence weighting scheme [Henikoff and
+Henikoff, J. Mol. Biol. 243:574, 1994]. This is the default.
+Use the Gerstein/Sonnhammer/Chothia weighting algorithm [Gerstein et al, J.
+Mol. Biol. 235:1067, 1994].
+Use the same clustering scheme that was used to weight data in calculating
+BLOSUM subsitution matrices [Henikoff and Henikoff, Proc. Natl. Acad. Sci
+89:10915, 1992]. Sequences are single-linkage clustered at an identity
+threshold (default 0.62; see --wid) and within each cluster of c sequences,
+each sequence gets rela- tive weight 1/c.
+No relative weights. All sequences are assigned uniform weight.
+Sets the identity threshold used by single-linkage clustering when using
+--wblosum.  Invalid with any other weighting scheme. Default is 0.62.
+  <token name="@BIAS_COMP_HELP@"><![CDATA[
+Bias Composition
+The next number, the bias, is a correction term for biased sequence composition
+that has been applied to the sequence bit score.1 For instance, for the top hit
+MYG PHYCA that scored 222.7 bits, the bias of 3.2 bits means that this sequence
+originally scored 225.9 bits, which was adjusted by the slight 3.2 bit biased-
+composition correction. The only time you really need to pay attention to the
+bias value is when it’s large, on the same order of magnitude as the sequence
+bit score. Sometimes (rarely) the bias correction isn’t aggressive enough, and
+allows a non-homolog to retain too much score.  Conversely, the bias correction
+can be too aggressive sometimes, causing you to miss homologs. You can turn the
+biased-composition score correction off with the --nonull2 option (and if
+you’re doing that, you may also want to set --nobias, to turn off another
+biased composition step called the bias filter, which affects which sequences
+get scored at all).
+  <token name="@CUT_HELP@"><![CDATA[
+Options for Model-specific Score Thresholding
+Curated profile databases may define specific bit score thresholds for each
+profile, superseding any thresholding based on statistical significance alone.
+To use these options, the profile must contain the appropriate (GA, TC, and/or
+NC) optional score threshold annotation; this is picked up by hmmbuild from
+Stockholm format alignment files. Each thresholding option has two scores: the
+per-sequence threshold <x1> and the per-domain threshold <x2> These act as if
+-T<x1> --incT<x1> --domT<x2> --incdomT<x2> has been applied specifically using
+each model’s curated thresholds.
+Use the GA (gathering) bit scores in the model to set per-sequence (GA1) and
+per-domain (GA2) reporting and inclusion thresholds. GA thresholds are
+generally considered to be the reliable curated thresholds defining family
+membership; for example, in Pfam, these thresholds define what gets included in
+Pfam Full alignments based on searches with Pfam Seed models.
+Use the NC (noise cutoff) bit score thresholds in the model to set
+per-sequence (NC1) and per-domain (NC2) reporting and inclusion thresholds. NC
+thresholds are generally considered to be the score of the highest-scoring
+known false positive.
+Use the NC (trusted cutoff) bit score thresholds in the model to set
+per-sequence (TC1) and per-domain (TC2) reporting and inclusion thresholds. TC
+thresholds are generally considered to be the score of the lowest-scoring known
+true positive that is above all known false positives.
+  <token name="@EVAL_CALIB_HELP@"><![CDATA[
+Options Controlling H3 Parameter Estimation Methods
+H3 uses three short random sequence simulations to estimating the location
+parameters for the expected score distributions for MSV scores, Viterbi scores,
+and Forward scores. These options allow these simulations to be modified.
+Sets the sequence length in simulation that estimates the location parameter mu
+for MSV E-values. Default is 200.
+Sets the number of sequences in simulation that estimates the location parameter
+mu for MSV E-values. Default is 200.
+Sets the sequence length in simulation that estimates the location parameter mu
+for Viterbi E-values. Default is 200.
+Sets the number of sequences in simulation that estimates the location parameter
+mu for Viterbi E-values. Default is 200.
+Sets the sequence length in simulation that estimates the location parameter tau
+for Forward E-values. Default is 100.
+Sets the number of sequences in simulation that estimates the location parameter
+tau for Forward E-values. Default is 200.
+Sets the tail mass fraction to fit in the simulation that estimates the location param-
+eter tau for Forward evalues. Default is 0.04.
+  <token name="@FORMAT_SELECTOR_HELP@"><![CDATA[
+Options for Specifying the Alphabet
+The alphabet type (amino, DNA, or RNA) is autodetected by default, by looking
+at the composition of the msafile. Autodetection is normally quite reliable,
+but occasionally alphabet type may be ambiguous and autodetection can fail (for
+instance, on tiny toy alignments of just a few residues). To avoid this, or to
+increase robustness in automated analysis pipelines, you may specify the
+alphabet type of msafile with these options.
+  <token name="@HSSI_HELP@"><![CDATA[
+Options Controlling Single Sequence Scoring (first Iteration)
+By default, the first iteration uses a search model constructed from a single
+query sequence. This model is constructed using a standard 20x20 substitution
+matrix for residue probabilities, and two additional pa- rameters for
+position-independent gap open and gap extend probabilities. These options allow
+the default single-sequence scoring parameters to be changed.
+**Gap Open (--popen)**
+Set the gap open probability for a single sequence query model to <x>
+**Gap Extend (--pextend)**
+Set the gap extend probability for a single sequence query model to <x>.
+These options are not currently supported
+  <token name="@LENGTHS_HELP@"><![CDATA[
+Tail Mass Options
+**Window length tail mass (--w_beta)**
+The upper bound, W, on the length at which nhmmer expects to find an instance
+of the model is set such that the fraction of all sequences generated by the
+model with length >= W is less than <x>. The default is 1e-7.
+**Model instance length upper bound (--w length)**
+Override the model instance length upper bound, W, which is otherwise
+controlled by --w beta. It should be larger than the model length. The value of
+W is used deep in the acceleration pipeline, and modest changes are not
+expected to impact results (though larger values of W do lead to longer run
+  <token name="@MCSS_HELP@"><![CDATA[
+**Options Controlling Profile Construction**
+These options control how consensus columns are defined in an alignment.
+Define consensus columns as those that have a fraction >= symfrac of residues
+as opposed to gaps. (See below for the --symfrac option.) This is the default.
+Define consensus columns in next profile using reference annotation to the multiple
+alignment. This allows you to define any consensus columns you like.
+Define the residue fraction threshold necessary to define a consensus column
+when using the --fast option. The default is 0.5. The symbol fraction in each
+column is calculated after taking relative sequence weighting into account, and
+ignoring gap characters corresponding to ends of sequence fragments (as opposed
+to internal insertions/deletions). Setting this to 0.0 means that every
+alignment column will be assigned as consensus, which may be useful in some
+cases. Setting it to 1.0 means that only columns that include 0 gaps (internal
+insertions/deletions) will be assigned as consensus.
+We only want to count terminal gaps as deletions if the aligned sequence is
+known to be full-length, not if it is a fragment (for instance, because only
+part of it was sequenced). HMMER uses a simple rule to infer fragments: if the
+sequence length L is less than or equal to a fraction <x> times the alignment
+length in columns, then the sequence is handled as a fragment. The default is
+0.5. Setting --fragthresh0 will define no (nonempty) sequence as a fragment;
+you might want to do this if you know you’ve got a carefully curated alignment
+of full-length sequences. Setting --fragthresh1 will define all sequences as
+fragments; you might want to do this if you know your alignment is entirely
+composed of fragments, such as translated short reads in metagenomic shotgun
+  <token name="@OFORMAT_WITH_OPTS_HELP@"><![CDATA[
+Options for Controlling Output
+**Table of hits**
+Save a simple tabular (space-delimited) file summarizing the per-target output, with
+one data line per homologous target model found.
+**Table of per-domain hits**
+Save a simple tabular (space-delimited) file summarizing the per-domain output,
+with one data line per homologous domain detected in a query sequence for each
+homologous model.
+**Table of hits and domains in Pfam Format**
+Save an especially succinct tabular (space-delimited) file summarizing the
+per-target output, with one data line per homologous target model found.
+Options for Controlling Output
+**Table of hits**
+Save a simple tabular (space-delimited) file summarizing the per-target output, with
+one data line per homologous target model found.
+**Table of per-domain hits**
+Save a simple tabular (space-delimited) file summarizing the per-domain output,
+with one data line per homologous domain detected in a query sequence for each
+homologous model.
+  <token name="@OFORMAT_WITH_OPTS_N_HELP@"><![CDATA[
+Options for Controlling Output
+**Table of hits**
+Save a simple tabular (space-delimited) file summarizing the per-target output, with
+one data line per homologous target model found.
+**Table of hits (dfam)**
+Save a tabular (space-delimited) file summarizing the per-hit output, similar
+to --tblout but more succinct.
+**List of per-position scores for each hit (--aliscoreout)**
+Save to file a list of per-position scores for each hit. This is useful, for
+example, in identifying regions of high score density for use in resolving
+overlapping hits from different models.
+  <token name="@PRIOR_HELP@"><![CDATA[
+Options Controlling Priors
+By default, weighted counts are converted to mean posterior probability
+parameter estimates using mixture Dirichlet priors. Default mixture Dirichlet
+prior parameters for protein models and for nucleic acid (RNA and DNA) models
+are built in. The following options allow you to override the default priors.
+**No priors (--pnone)**
+Don’t use any priors. Probability parameters will simply be the observed
+frequencies, after relative sequence weighting.
+**Laplace +1 prior**
+Use a Laplace +1 prior in place of the default mixture Dirichlet prior.
+  <token name="@SEED_HELP@"><![CDATA[
+Random Seeding
+Seed the random number generator with <n>, an integer >= 0. If <n> is nonzero,
+any stochastic simulations will be reproducible; the same command will give the
+same results. If <n> is 0, the random number generator is seeded arbitrarily,
+and stochastic simulations will vary from run to run of the same command.
+  <token name="@THRESHOLDS_HELP@"><![CDATA[
+Options for Reporting Thresholds
+Reporting thresholds control which hits are reported in output files (the main
+output, --tblout, and --domtblout).
+**E-value (-E)**
+In the per-target output, report target profiles with an E-value of <= <x>. The
+default is 10.0, meaning that on average, about 10 false positives will be
+reported per query, so you can see the top of the noise and decide for yourself
+if it’s really noise.
+**Bit score (-T)**
+Instead of thresholding per-profile output on E-value, instead report target profiles
+with a bit score of >= <x>.
+**domain E-value (--domE)**
+In the per-domain output, for target profiles that have already satisfied the
+per-profile reporting threshold, report individual domains with a conditional
+E-value of <= <x>. The default is 10.0. A conditional E-value means the
+expected number of additional false positive domains in the smaller search
+space of those comparisons that already satisfied the per-profile reporting
+threshold (and thus must have at least one homologous domain already).
+**domain Bit scores (--domT)**
+Instead of thresholding per-domain output on E-value, instead report domains
+with a bit score of >= <x>.
+Options for Inclusion Thresholds
+Inclusion thresholds are stricter than reporting thresholds. Inclusion
+thresholds control which hits are considered to be reliable enough to be
+included in an output alignment or a subsequent search round. In hmmscan, which
+does not have any alignment output (like hmmsearch or phmmer) nor any iterative
+search steps (like jackhmmer), inclusion thresholds have little effect. They
+only affect what domains get marked as significant (!) or questionable (?) in
+domain output.
+**E-value of per target inclusion threshold**
+Use an E-value of <= <x> as the per-target inclusion threshold. The default is
+0.01, meaning that on average, about 1 false positive would be expected in
+every 100 searches with different query sequences.
+**Bit score of per target inclusion threshold**
+Instead of using E-values for setting the inclusion threshold, instead use a
+bit score of >= <x> as the per-target inclusion threshold. It would be unusual
+to use bit score thresholds with hmmscan, because you don’t expect a single
+score threshold to work for different profiles; different profiles have
+slightly different expected score distributions.
+**domain E-value per target inclusion treshold**
+Use a conditional E-value of <= <x> as the per-domain inclusion threshold, in
+targets that have already satisfied the overall per-target inclusion threshold.
+**domain Bit score per target inclusion treshold**
+Instead of using E-values, instead use a bit score of >= <x> as the per-domain
+inclusion threshold. As with --incT above, it would be unusual to use a single
+bit score threshold in hmmscan.
+  <token name="@THRESHOLDS_NODOM_HELP@"><![CDATA[
+Options for Reporting Thresholds
+Reporting thresholds control which hits are reported in output files (the main
+output, --tblout, and --domtblout).
+**E-value (-E)**
+In the per-target output, report target profiles with an E-value of <= <x>. The
+default is 10.0, meaning that on average, about 10 false positives will be
+reported per query, so you can see the top of the noise and decide for yourself
+if it’s really noise.
+**Bit score (-T)**
+Instead of thresholding per-profile output on E-value, instead report target profiles
+with a bit score of >= <x>.
+Options for Inclusion Thresholds
+Inclusion thresholds are stricter than reporting thresholds. Inclusion
+thresholds control which hits are considered to be reliable enough to be
+included in an output alignment or a subsequent search round. In hmmscan, which
+does not have any alignment output (like hmmsearch or phmmer) nor any iterative
+search steps (like jackhmmer), inclusion thresholds have little effect. They
+only affect what domains get marked as significant (!) or questionable (?) in
+domain output.
+**E-value of per target inclusion threshold**
+Use an E-value of <= <x> as the per-target inclusion threshold. The default is
+0.01, meaning that on average, about 1 false positive would be expected in
+every 100 searches with different query sequences.
+**Bit score of per target inclusion threshold**
+Instead of using E-values for setting the inclusion threshold, instead use a
+bit score of >= <x> as the per-target inclusion threshold. It would be unusual
+to use bit score thresholds with hmmscan, because you don’t expect a single
+score threshold to work for different profiles; different profiles have
+slightly different expected score distributions.
+  <token name="@ATTRIBUTION@"><![CDATA[
+This Galaxy tool relies on HMMER3_ from
+Internally the software is cited as:
+    # hmmscan :: search sequence(s) against a profile database
+    # HMMER 3.1 (February 2013);
+    # Copyright (C) 2011 Howard Hughes Medical Institute.
+    # Freely distributed under the GNU General Public License (GPLv3).
+    # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+The wrappers were written by Eric Rasche and is licensed under Apache2_. The
+documentation is copied from the HMMER3 documentation.
+.. _Apache2:
+.. _HMMER3:
+  ]]></token>
+  <token name="@HELP_PRE@"><![CDATA[
+What it does
+  ]]></token>
+  <token name="@HELP_PRE_OTH@"><![CDATA[
+  ]]></token>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/nhmmer.xml	Sat Jun 25 15:07:17 2016 -0400
@@ -0,0 +1,90 @@
+<?xml version="1.0"?>
+<tool id="hmmer_nhmmer" name="nhmmer" version="@WRAPPER_VERSION@.0">
+  <description>search a DNA model or alignment against a DNA database (BLASTN-like)</description>
+  <macros>
+    <import>macros.xml</import>
+  </macros>
+  <expand macro="requirements"/>
+  <expand macro="stdio"/>
+  <command><![CDATA[
+> $output
+      ]]></command>
+  <inputs>
+    <expand macro="input_hmm" />
+    <param name="seqfile" type="data" format="fasta" label="Target sequence file"/>
+    <expand macro="oformat_with_opts_n"/>
+    <expand macro="hssi"/>
+    <expand macro="thresholds_nodom"/>
+    <expand macro="cut" />
+    <expand macro="accel_heur_xml"/>
+    <expand macro="format_selector_noprot"/>
+    <expand macro="adv_opts"/>
+    <expand macro="lengths"/>
+    <!-- TODO: block_length toponly bottomonly -->
+    <expand macro="seed"/>
+  </inputs>
+  <outputs>
+    <data format="txt" name="output" label="NHMMER search of $ in $"/>
+    <data format="txt" name="tblout" label="Table of per-sequence hits from HMM matches of $ in $">
+      <filter>'tblout' in str(oformat)</filter>
+    </data>
+    <data format="txt" name="dfamtblout" label="Table of per-sequence/per-domain hits from HMM matches of $ in $">
+      <filter>'pfamtblout' in str(oformat)</filter>
+    </data>
+    <data format="txt" name="aliscoresout" label="Scores for positional matches of $ in $">
+      <filter>'aliscoresout' in str(oformat)</filter>
+    </data>
+  </outputs>
+  <tests>
+    <test>
+      <param name="hmmfile" value="MADE1.hmm"/>
+      <param name="seqfile" value="dna_target.fa"/>
+      <expand macro="oformat_test" />
+      <expand macro="seed_test" />
+      <output name="output" file="nhmmer.out" lines_diff="32"/>
+    </test>
+  </tests>
+  <help><![CDATA[
+nhmmer is used to search one or more nucleotide queries against a nucleotide
+sequence database. For each query in <queryfile>, use that query to search the
+target database of sequences in <seqdb>, and output a ranked list of the hits
+with the most significant matches to the query. A query may be either a profile
+model built using hmmbuild, a sequence alignment, or a single sequence.
+Sequence based queries can be in a number of formats (see --qformat), and can
+typically be autodetected. Note that only Stockholm format supports the use of
+multiple sequence-based queries.
+  <expand macro="citation"/>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/readme.rst	Sat Jun 25 15:07:17 2016 -0400
@@ -0,0 +1,54 @@
+Galaxy wrapper for HMMER3
+This wrapper is copyright 2015 by Eric Rasche
+HMMER is used for searching sequence databases for homologs of protein
+sequences, and for making protein sequence alignments. It implements methods
+using probabilistic models called profile hidden Markov models (profile HMMs).
+Compared to BLAST, FASTA, and other sequence alignment and database search
+tools based on older scoring methodology, HMMER aims to be significantly more
+accurate and more able to detect remote homologs because of the strength of its
+underlying mathematical models. In the past, this strength came at significant
+computational expense, but in the new HMMER3 project, HMMER is now essentially
+as fast as BLAST.
+The recommended installation is by means of the toolshed_.
+.. _toolshed:
+* v0.1      - Initial public release
+Licence (MIT)
+Permission is hereby granted, free of charge, to any person obtaining a copy
+of this software and associated documentation files (the "Software"), to deal
+in the Software without restriction, including without limitation the rights
+to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
+copies of the Software, and to permit persons to whom the Software is
+furnished to do so, subject to the following conditions:
+The above copyright notice and this permission notice shall be included in
+all copies or substantial portions of the Software.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/MADE1.hmm	Sat Jun 25 15:07:17 2016 -0400
@@ -0,0 +1,265 @@
+HMMER3/f [3.1b2 | February 2015]
+ACC   DF0000629.2
+DESC  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+LENG  80
+MAXL  425
+RF    yes
+MM    no
+CONS  yes
+CS    no
+MAP   yes
+DATE  Sat Jun 25 17:24:24 2016
+NSEQ  1997
+EFFN  3.911818
+CKSUM 3015610723
+STATS LOCAL MSV       -8.5408  0.71858
+STATS LOCAL VITERBI   -9.6224  0.71858
+STATS LOCAL FORWARD   -3.4150  0.71858
+HMM          A        C        G        T   
+            m->m     m->i     m->d     i->m     i->i     d->m     d->d
+  COMPO   1.24533  1.59094  1.62722  1.16493
+          1.38629  1.38629  1.38629  1.38629
+          0.21058  4.11281  1.75146  1.46634  0.26236  0.00000        *
+      1   2.69765  2.44396  2.81521  0.24089      1 t x - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03960  3.94183  3.94183  1.46634  0.26236  1.10301  0.40327
+      2   2.72939  2.37873  2.85832  0.24244      2 t x - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03725  4.00179  4.00179  1.46634  0.26236  1.21367  0.35255
+      3   0.16099  3.16370  2.87328  2.99734      3 a x - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03604  4.03416  4.03416  1.46634  0.26236  1.32877  0.30762
+      4   1.98862  2.42132  0.42649  2.10770      4 g x - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03539  4.05203  4.05203  1.46634  0.26236  1.35213  0.29933
+      5   1.96369  2.69532  0.36534  2.32099      5 g x - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03764  4.06427  3.92372  1.46634  0.26236  1.00259  0.45717
+      6   2.56994  2.11239  2.71946  0.30571      6 t x - -
+          1.37159  1.41129  1.39124  1.37159
+          0.03806  3.89715  4.07214  1.50442  0.25122  1.12269  0.39364
+      7   2.58388  2.10353  2.64646  0.31253     12 t x - -
+          1.38764  1.38524  1.38764  1.38465
+          0.03494  4.03864  4.09125  1.40070  0.28293  1.44046  0.27026
+      8   2.18552  2.70201  0.28821  2.64645     14 g x - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03628  4.09157  3.96779  1.46634  0.26236  1.26997  0.32967
+      9   2.16916  2.82142  0.28427  2.60854     15 g x - -
+          1.38091  1.39033  1.38365  1.39033
+          0.03566  4.00237  4.08886  1.38021  0.28972  1.26961  0.32981
+     10   2.45517  2.15232  2.42886  0.34277     18 t x - -
+          1.39065  1.39065  1.39065  1.37335
+          0.03536  4.01212  4.09576  1.39554  0.28462  1.25024  0.33748
+     11   2.10260  2.95484  0.28160  2.64222     21 g x - -
+          1.36740  1.40555  1.40555  1.36740
+          0.03843  3.92069  4.02468  1.44733  0.26814  1.15789  0.37709
+     12   2.54740  0.30185  2.61355  2.21647     26 c x - -
+          1.38748  1.38276  1.38748  1.38748
+          0.03457  4.05446  4.09623  1.40847  0.28040  1.17686  0.36852
+     13   0.28443  2.72003  2.32214  2.48149     28 a x - -
+          1.38740  1.38740  1.38298  1.38740
+          0.03441  4.05976  4.10001  1.41198  0.27926  0.97690  0.47237
+     14   0.29412  2.55413  2.49679  2.35701     30 a x - -
+          1.38194  1.39067  1.38194  1.39067
+          0.03505  4.02482  4.10005  1.39522  0.28473  1.16906  0.37202
+     15   0.18837  2.99710  2.82270  2.77556     33 a x - -
+          1.39015  1.39472  1.37503  1.38539
+          0.03725  3.97815  4.02618  1.37955  0.28994  1.16870  0.37218
+     16   0.50816  2.05151  2.22111  1.82407     37 a x - -
+          1.36727  1.38730  1.39683  1.39405
+          0.04830  3.89881  3.61610  1.29026  0.32186  1.08301  0.41336
+     17   2.11260  2.73141  0.29747  2.64152     41 g x - -
+          1.36913  1.40376  1.40376  1.36913
+          0.03705  3.93681  4.08299  1.44872  0.26771  1.09472  0.40742
+     18   2.24459  1.90539  2.34054  0.43234     46 t x - -
+          1.33632  1.42493  1.39937  1.38665
+          0.04427  3.64574  4.06297  1.70501  0.20061  1.19872  0.35894
+     19   0.44322  2.17202  2.18055  2.03175     57 a x - -
+          1.41047  1.41471  1.36338  1.35797
+          0.03970  3.81957  4.07540  1.65588  0.21186  1.24390  0.34004
+     20   0.33340  2.42691  2.40824  2.25160     66 a x - -
+          1.29389  1.44615  1.37917  1.43324
+          0.04223  3.70146  4.09459  1.55158  0.23815  1.01872  0.44794
+     21   2.50563  1.98543  2.69600  0.33746     74 t x - -
+          1.39462  1.39462  1.42862  1.32990
+          0.04184  3.80216  3.98177  1.80466  0.17976  1.00279  0.45705
+     22   2.54484  1.97505  2.66483  0.33806     84 t x - -
+          1.39134  1.39489  1.38662  1.37246
+          0.03877  3.97504  3.95038  1.37620  0.29107  1.13932  0.38572
+     23   2.10159  2.83856  0.29282  2.61635     88 g x - -
+          1.39682  1.39682  1.35536  1.39682
+          0.05046  3.75402  3.65808  1.08330  0.41321  1.13019  0.39004
+     24   2.25298  0.61854  2.50691  1.29221     90 c x - -
+          1.35803  1.49605  1.46737  1.24379
+          0.06091  3.28322  3.83564  1.89752  0.16245  1.28788  0.32276
+     25   1.27819  2.23285  0.76242  1.91259    106 g x - -
+          1.29024  1.67349  1.68279  1.04597
+          0.05752  3.44263  3.73311  2.58671  0.07825  1.26818  0.33037
+     26   1.86925  2.58352  0.39466  2.33986    131 g x - -
+          1.31084  1.49412  1.46666  1.29002
+          0.04698  3.54257  4.07715  2.25245  0.11109  0.86163  0.54900
+     27   2.38297  1.93394  2.39162  0.39800    151 t x - -
+          1.33582  1.47359  1.44163  1.30411
+          0.04951  3.48445  4.03783  2.15951  0.12260  1.21681  0.35122
+     28   2.41717  2.17810  2.62774  0.32113    170 t x - -
+          1.36805  1.48060  1.37439  1.32840
+          0.04849  3.50958  4.05014  2.58370  0.07850  1.22399  0.34822
+     29   2.57764  2.35132  2.56552  0.28512    194 t x - -
+          1.43829  1.43458  1.24787  1.43829
+          0.04667  3.56670  4.05428  2.49706  0.08591  1.23744  0.34267
+     30   2.47248  2.07688  2.62257  0.33172    215 t x - -
+          1.25120  1.52623  1.70635  1.15531
+          0.08932  3.31524  3.01336  2.81842  0.06156  1.22909  0.34610
+     31   2.25937  2.13157  2.02027  0.43957    248 t x - -
+          1.18172  1.43522  1.72841  1.28150
+          0.07936  2.93117  3.77395  2.46269  0.08906  0.60457  0.79034
+     32   2.04508  2.84981  0.30490  2.58263    280 g x - -
+          1.17665  1.66785  1.66218  1.16056
+          0.05998  3.23615  3.96853  2.83684  0.06040  1.01952  0.44749
+     33   2.45103  0.38098  2.56776  1.87147    317 c x - -
+          1.24153  1.52524  1.60663  1.22783
+          0.05538  3.39046  3.90294  2.73920  0.06680  1.18729  0.36391
+     34   2.22082  0.36258  2.75077  2.02704    347 c x - -
+          1.15008  1.62014  1.86511  1.10673
+          0.06086  3.18178  4.04341  2.94504  0.05403  1.25991  0.33363
+     35   0.27033  2.66664  2.52541  2.43767    388 a x - -
+          1.24951  1.47565  1.41392  1.42074
+          0.07123  3.00373  3.95552  3.13655  0.04440  1.28173  0.32512
+     36   2.83107  2.41670  2.97197  0.22235    439 t x - -
+          1.37071  1.57683  1.38637  1.23972
+          0.05293  3.45216  3.91807  2.54402  0.08181  1.14651  0.38235
+     37   2.52322  2.25084  2.45909  0.31611    465 t x - -
+          1.26335  1.55077  1.59008  1.19965
+          0.07504  3.13329  3.55006  3.08962  0.04659  1.13108  0.38962
+     38   0.45807  2.30687  1.98940  2.03143    512 a x - -
+          1.15472  1.67511  1.53797  1.26320
+          0.09820  3.13076  2.99876  2.79197  0.06326  1.39915  0.28343
+     39   2.37471  0.42180  2.44763  1.80427    550 c x - -
+          1.23785  1.49058  1.48364  1.35502
+          0.06081  3.19472  4.01643  2.41851  0.09327  0.94671  0.49105
+     40   2.32826  1.95481  2.36781  0.40458    578 t x - -
+          1.36586  1.46001  1.43000  1.29720
+          0.05257  3.39673  4.03256  1.84862  0.17133  1.40979  0.27997
+     41   2.68669  2.13935  2.81520  0.28200    592 t x - -
+          1.34965  1.42793  1.45781  1.31633
+          0.04735  3.57826  3.99988  2.09424  0.13144  1.22129  0.34934
+     42   2.55904  2.16444  2.70859  0.29952    609 t x - -
+          1.12072  1.61936  1.63578  1.26895
+          0.07346  3.25910  3.42962  2.85641  0.05919  1.38363  0.28857
+     43   1.99923  1.61027  2.26343  0.57851    646 t x - -
+          1.32290  1.58747  1.61095  1.11018
+          0.06656  3.08568  3.97944  2.44774  0.09046  0.75593  0.63407
+     44   0.23887  2.79899  2.55209  2.60783    675 a x - -
+          1.18557  1.50323  1.59070  1.31590
+          0.05597  3.38637  3.88222  2.46900  0.08847  1.27945  0.32599
+     45   0.29593  2.53488  2.53903  2.32335    701 a x - -
+          1.08710  1.54222  1.59276  1.40430
+          0.07539  2.94521  3.91062  1.91623  0.15918  1.22327  0.34852
+     46   2.58352  2.40524  2.76700  0.25955    725 t x - -
+          1.19685  1.58503  1.74852  1.14293
+          0.06124  3.18279  4.02089  2.82961  0.06085  1.05474  0.42814
+     47   2.13251  2.88788  0.29508  2.50964    764 g x - -
+          1.20891  1.55463  1.68206  1.19000
+          0.06526  3.12574  3.94910  2.41448  0.09367  1.10396  0.40280
+     48   2.23841  2.99164  0.25118  2.72900    792 g x - -
+          1.26330  1.55339  1.52606  1.24355
+          0.05464  3.34968  4.01313  2.78872  0.06347  1.15133  0.38012
+     49   2.57533  0.32900  2.64632  2.01501    824 c x - -
+          1.35118  1.39828  1.40141  1.39516
+          0.04340  3.79297  3.91506  1.59549  0.22666  1.20075  0.35806
+     50   0.46433  2.04127  2.23437  2.00605    833 a x - -
+          1.23062  1.36903  1.62282  1.36182
+          0.05764  3.31530  3.92762  2.28791  0.10700  1.07910  0.41536
+     51   0.27513  2.77017  2.28518  2.57549    853 a x - -
+          1.27958  1.58726  1.46109  1.25394
+          0.05750  3.30072  3.96214  2.60776  0.07656  1.25708  0.33475
+     52   0.20149  2.86434  2.84551  2.69770    883 a x - -
+          1.23645  1.62259  1.71174  1.10368
+          0.05756  3.26729  4.02702  2.54508  0.08172  1.27391  0.32814
+     53   0.26982  2.65833  2.50477  2.46835    911 a x - -
+          1.36005  1.50358  1.48100  1.22550
+          0.06921  3.37553  3.42118  2.36646  0.09851  1.27560  0.32748
+     54   0.40022  2.19284  2.22687  2.20396    934 a x - -
+          1.12070  1.60472  1.53213  1.35895
+          0.05523  3.36752  3.94966  2.42917  0.09224  0.84774  0.55928
+     55   2.11356  0.46400  2.46442  1.79955    960 c x - -
+          1.23932  1.35913  1.50478  1.46331
+          0.05187  3.47055  3.94022  2.35854  0.09933  1.12102  0.39445
+     56   1.85868  0.79440  2.22069  1.25971    983 c x - -
+          1.21951  1.50212  1.51138  1.34185
+          0.06404  3.29054  3.69705  1.75742  0.18933  1.18410  0.36532
+     57   1.33272  2.32720  0.71452  1.90215    999 g x - -
+          1.12229  1.49343  1.56653  1.42255
+          0.04920  3.46654  4.08749  2.17995  0.11996  1.31769  0.31164
+     58   2.48337  0.43652  2.46331  1.68683   1017 c x - -
+          1.34704  1.55461  1.38112  1.28222
+          0.04823  3.61532  3.90311  2.20911  0.11631  1.00864  0.45368
+     59   0.41659  2.44509  1.93972  2.20507   1034 a x - -
+          1.38198  1.38198  1.39194  1.38932
+          0.03641  3.98130  4.06929  1.35873  0.29704  1.31330  0.31325
+     60   0.41612  2.39160  1.97116  2.21075   1037 a x - -
+          1.03649  1.46430  1.57421  1.57557
+          0.04787  3.52599  4.05584  2.32461  0.10294  0.84329  0.56263
+     61   2.66264  2.12302  2.82746  0.28581   1056 t x - -
+          1.36925  1.39635  1.38930  1.39048
+          0.04103  3.97406  3.84419  1.39433  0.28502  1.12555  0.39227
+     62   2.26510  2.13196  2.42551  0.37231   1060 t x - -
+          1.37965  1.39147  1.39147  1.38264
+          0.04136  3.91664  3.88204  1.24613  0.33914  0.95630  0.48501
+     63   0.41244  2.25761  2.16787  2.12907   1062 a x - -
+          1.34515  1.41203  1.41203  1.37753
+          0.04086  3.77867  4.06371  1.30483  0.31638  1.13245  0.38897
+     64   2.51464  0.37905  2.62296  1.82008   1068 c x - -
+          1.39543  1.38753  1.39233  1.37008
+          0.03884  3.90614  4.01884  1.36573  0.29463  1.15716  0.37743
+     65   2.16380  2.11332  2.18714  0.42765   1073 t x - -
+          1.38764  1.38471  1.38519  1.38764
+          0.03603  4.05405  4.01529  1.40080  0.28289  1.06383  0.42332
+     66   2.79349  2.39141  2.87271  0.23478   1075 t x - -
+          1.37227  1.39101  1.39101  1.39101
+          0.03884  4.01734  3.90722  1.39017  0.28639  1.09574  0.40690
+     67   2.82488  2.47749  2.93179  0.21887   1078 t x - -
+          1.38141  1.39112  1.38915  1.38353
+          0.03675  3.99492  4.03549  1.35958  0.29675  1.21867  0.35044
+     68   2.77679  2.30433  2.90694  0.24425   1081 t x - -
+          1.37593  1.38989  1.45520  1.32825
+          0.04566  3.68855  3.93098  1.76176  0.18843  1.07133  0.41939
+     69   2.47698  3.17398  0.19595  2.95437   1093 g x - -
+          1.38264  1.38264  1.39734  1.38264
+          0.05482  3.96677  3.36946  1.40348  0.28202  1.13963  0.38557
+     70   2.84327  0.27906  2.97336  2.00890   1097 c x - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03475  4.08873  4.05197  1.46634  0.26236  0.79234  0.60291
+     71   0.21870  2.83638  2.69251  2.65798   1098 a x - -
+          1.37446  1.37942  1.39640  1.39509
+          0.04066  3.94379  3.88865  1.41905  0.27700  1.24551  0.33939
+     72   2.35233  0.46085  2.23804  1.78715   1103 c x - -
+          1.38536  1.38781  1.38781  1.38421
+          0.03885  4.04214  3.88532  1.39310  0.28542  1.30851  0.31501
+     73   2.57111  0.32543  2.74124  1.98892   1105 c x - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03403  4.09710  4.08422  1.46634  0.26236  1.37004  0.29316
+     74   0.27014  2.61416  2.53262  2.47636   1106 a x - -
+          1.38629  1.38629  1.38629  1.38629
+          0.03889  4.09695  3.83874  1.46634  0.26236  1.37489  0.29151
+     75   0.52873  2.16549  1.91736  1.90409   1107 a x - -
+          1.38629  1.38629  1.38629  1.38629
+          0.04237  4.09207  3.69758  1.46634  0.26236  1.41112  0.27954
+     76   2.33134  0.38082  2.65861  1.90055   1108 c x - -
+          1.38629  1.38629  1.38629  1.38629
+          0.04659  4.08459  3.55121  1.46634  0.26236  1.54765  0.23921
+     77   2.20588  0.45134  2.35553  1.84373   1109 c x - -
+          1.38629  1.38629  1.38629  1.38629
+          0.05904  4.07266  3.21140  1.46634  0.26236  1.68734  0.20458
+     78   2.69018  2.22054  2.82311  0.26898   1110 t x - -
+          1.38629  1.38629  1.38629  1.38629
+          0.08061  4.04912  2.81320  1.46634  0.26236  1.91269  0.15980
+     79   0.16248  3.15867  2.86159  2.98963   1111 a x - -
+          1.38629  1.38629  1.38629  1.38629
+          0.12592  4.00561  2.30158  1.46634  0.26236  2.22059  0.11490
+     80   0.17484  3.04770  2.86638  2.88183   1112 a x - -
+          1.38629  1.38629  1.38629  1.38629
+          0.02045  3.90014        *  1.46634  0.26236  0.00000        *
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/MADE1.out	Sat Jun 25 15:07:17 2016 -0400
@@ -0,0 +1,87 @@
+# hmmscan :: search sequence(s) against a profile database
+# HMMER 3.1b2 (February 2015);
+# Copyright (C) 2015 Howard Hughes Medical Institute.
+# Freely distributed under the GNU General Public License (GPLv3).
+# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+# query sequence file:             /tmp/tmpYWzicI/files/000/dataset_20.dat
+# target HMM database:             /tmp/tmpYWzicI/files/000/dataset_19.dat
+# per-seq hits tabular output:     /tmp/tmpYWzicI/files/000/dataset_22.dat
+# per-dom hits tabular output:     /tmp/tmpYWzicI/files/000/dataset_23.dat
+# pfam-style tabular hit output:   /tmp/tmpYWzicI/files/000/dataset_24.dat
+# max ASCII text line length:      unlimited
+# Vit filter P threshold:       <= 0.001
+# Fwd filter P threshold:       <= 1e-05
+# random number seed set to:       4
+# number of worker threads:        1
+# - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
+Query:       humanchr1/239220001-239550000  [L=330000]
+Scores for complete sequence (score includes all domains):
+   --- full sequence ---   --- best 1 domain ---    -#dom-
+    E-value  score  bias    E-value  score  bias    exp  N  Model    Description
+    ------- ------ -----    ------- ------ -----   ---- --  -------- -----------
+      1e-17   51.0  28.5    2.7e-12   33.7   0.7    9.6  5  MADE1     MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+Domain annotation for each model (and alignments):
+>> MADE1  MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+   #    score  bias  c-Evalue  i-Evalue hmmfrom  hmm to    alifrom  ali to    envfrom  env to     acc
+ ---   ------ ----- --------- --------- ------- -------    ------- -------    ------- -------    ----
+   1 ?   -4.2   0.1         1         1      30      54 ..   80044   80068 ..   80030   80073 .. 0.80
+   2 ?   -6.6   3.3         1         1      13      71 ..  154012  154072 ..  154011  154076 .. 0.75
+   3 !   27.4   0.7   2.4e-10   2.4e-10       1      44 [.  174456  174514 ..  174456  174577 .. 0.62
+   4 !   33.7   0.7   2.7e-12   2.7e-12       2      80 .]  302388  302466 ..  302387  302466 .. 0.86
+   5 ?    2.9   0.7     0.011     0.011      27      75 ..  304060  304107 ..  304021  304109 .. 0.61
+  Alignments for each domain:
+  == domain 1  score: -4.2 bits;  conditional E-value: 1
+                                      xxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1    30 ttgccattacttttaatggcaaaaa 54
+                                      t g catt  ttt aatggcaaa a
+  humanchr1/239220001-239550000 80044 TAGTCATTCATTTCAATGGCAAATA 80068
+                                      45789****************9966 PP
+  == domain 2  score: -6.6 bits;  conditional E-value: 1
+                                       xxxxxxxxxxxxxxxxxxxxxxxxx......xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1     13 aaaagtaattgcggtttttgccatt......acttttaatggcaaaaaccgcaattacttttgca 71
+                                       aaaagta tt +   ttttgc att      a  tttaa  gcaaa a +    tta  tttgca
+  humanchr1/239220001-239550000 154012 AAAAGTAGTTTTCAATTTTGCAATTtgaccaATATTTAAATGCAAATATT----TTATATTTGCA 154072
+                                       78999999999999999999999984444444457777777899998876....77777888876 PP
+  == domain 3  score: 27.4 bits;  conditional E-value: 2.4e-10
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx...............x RF
+                          MADE1      1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt...............a 44
+                                       ttaggtt gtgcaaaagtaattg+ggtttttg cattactttt               a
+  humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTTctgcatgctagaagtA 174514
+                                       79***************************************964443333333333330 PP
+  == domain 4  score: 33.7 bits;  conditional E-value: 2.7e-12
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1      2 taggttggtgcaaaagtaattgcggtttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaacctaa 80
+                                       t ggt ggtgcaaaa  aattg+ggtttttgccatt cttttaat gc    a  +  a t ctttt caccaa ctaa
+                                       56899******************************************963333233345578**************996 PP
+  == domain 5  score: 2.9 bits;  conditional E-value: 0.011
+                                       xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
+                          MADE1     27 tttttgccattacttttaatggcaaaaaccgcaattacttttgcaccaa 75
+                                       tttt g c  ta  tt a tgg aaaaa ++ca tta ttttgca  aa
+  humanchr1/239220001-239550000 304060 TTTTAGACTATA-GTTAAGTGGGAAAAAATACACTTATTTTTGCATTAA 304107
+                                       222222222222.3455779************************98765 PP
+Internal pipeline statistics summary:
+Query sequence(s):                         1  (330000 residues searched)
+Target model(s):                           1  (80 nodes)
+Passed MSV filter:                         1  (1); expected 0.0 (0.02)
+Passed bias filter:                        1  (1); expected 0.0 (0.02)
+Passed Vit filter:                         1  (1); expected 0.0 (0.001)
+Passed Fwd filter:                         1  (1); expected 0.0 (1e-05)
+Initial search space (Z):                  1  [actual number of targets]
+Domain search space  (domZ):               1  [number of targets reported over threshold]
+# CPU time: 0.15u 0.00s 00:00:00.15 Elapsed: 00:00:00.16
+# Mc/sec: 165.00
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/MADE1.out.domtblout	Sat Jun 25 15:07:17 2016 -0400
@@ -0,0 +1,18 @@
+#                                                                                      --- full sequence --- -------------- this domain -------------   hmm coord   ali coord   env coord
+# target name        accession    tlen query name                    accession   qlen   E-value  score  bias   #  of  c-Evalue  i-Evalue  score  bias  from    to  from    to  from    to  acc description of target
+#-------------------  ---------- -----          -------------------- ---------- ----- --------- ------ ----- --- --- --------- --------- ------ ----- ----- ----- ----- ----- ----- ----- ---- ---------------------
+MADE1                DF0000629.2    80 humanchr1/239220001-239550000 -          330000     1e-17   51.0  28.5   1   5         1         1   -4.2   0.1    30    54 80044 80068 80030 80073 0.80 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                DF0000629.2    80 humanchr1/239220001-239550000 -          330000     1e-17   51.0  28.5   2   5         1         1   -6.6   3.3    13    71 154012 154072 154011 154076 0.75 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                DF0000629.2    80 humanchr1/239220001-239550000 -          330000     1e-17   51.0  28.5   3   5   2.4e-10   2.4e-10   27.4   0.7     1    44 174456 174514 174456 174577 0.62 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                DF0000629.2    80 humanchr1/239220001-239550000 -          330000     1e-17   51.0  28.5   4   5   2.7e-12   2.7e-12   33.7   0.7     2    80 302388 302466 302387 302466 0.86 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                DF0000629.2    80 humanchr1/239220001-239550000 -          330000     1e-17   51.0  28.5   5   5     0.011     0.011    2.9   0.7    27    75 304060 304107 304021 304109 0.61 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+# Program:         hmmscan
+# Version:         3.1b2 (February 2015)
+# Pipeline mode:   SCAN
+# Query file:      /tmp/tmpYWzicI/files/000/dataset_2.dat
+# Target file:     /tmp/tmpYWzicI/files/000/dataset_1.dat
+# Option settings: hmmscan --tblout /tmp/tmpYWzicI/files/000/dataset_4.dat --domtblout /tmp/tmpYWzicI/files/000/dataset_5.dat --pfamtblout /tmp/tmpYWzicI/files/000/dataset_6.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --cpu 1 /tmp/tmpYWzicI/files/000/dataset_1.dat /tmp/tmpYWzicI/files/000/dataset_2.dat 
+# Current dir:     /tmp/tmpYWzicI/job_working_directory/000/3
+# Date:            Sat Jun 25 19:05:15 2016
+# [ok]
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/MADE1.out.pfamtblout	Sat Jun 25 15:07:17 2016 -0400
@@ -0,0 +1,27 @@
+# Sequence scores
+# ---------------
+# name                  bits   E-value   n   exp  bias    description
+# ------------------- ------ --------- --- ----- -----    ---------------------
+MADE1                   51.0     1e-17   5   9.6  28.5    MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+# Domain scores
+# -------------
+#  name                 bits   E-value   hit  bias env-st env-en ali-st ali-en hmm-st hmm-en     description
+# ------------------- ------ --------- ----- ----- ------ ------ ------ ------ ------ ------      ---------------------
+MADE1                   33.7   2.7e-12     4   0.7 302387 302466 302388 302466      2     80     MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                   27.4   2.4e-10     3   0.7 174456 174577 174456 174514      1     44     MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                    2.9     0.011     5   0.7 304021 304109 304060 304107     27     75     MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                   -4.2         1     1   0.1  80030  80073  80044  80068     30     54     MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+MADE1                   -6.6         1     2   3.3 154011 154076 154012 154072     13     71     MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+# Program:         hmmscan
+# Version:         3.1b2 (February 2015)
+# Pipeline mode:   SEARCH
+# Query file:      /tmp/tmpYWzicI/files/000/dataset_2.dat
+# Target file:     /tmp/tmpYWzicI/files/000/dataset_1.dat
+# Option settings: hmmscan --tblout /tmp/tmpYWzicI/files/000/dataset_4.dat --domtblout /tmp/tmpYWzicI/files/000/dataset_5.dat --pfamtblout /tmp/tmpYWzicI/files/000/dataset_6.dat --notextw -E 10.0 --domE 10.0 --F1 0.02 --F2 0.001 --F3 1e-05 --seed 4 --cpu 1 /tmp/tmpYWzicI/files/000/dataset_1.dat /tmp/tmpYWzicI/files/000/dataset_2.dat 
+# Current dir:     /tmp/tmpYWzicI/job_working_directory/000/3
+# Date:            Sat Jun 25 19:05:15 2016
+# [ok]
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/MADE1.out.tblout	Sat Jun 25 15:07:17 2016 -0400
@@ -0,0 +1,14 @@
+#                                                                         --- full sequence ---- --- best 1 domain ---- --- domain number estimation ----
+# target name        accession   query name                    accession    E-value  score  bias   E-value  score  bias   exp reg clu  ov env dom rep inc description of target
+#-------------------  ----------          -------------------- ---------- --------- ------ ----- --------- ------ -----   --- --- --- --- --- --- --- --- ---------------------
+MADE1                DF0000629.2 humanchr1/239220001-239550000 -            7.1e-18   51.5  28.5     2e-12   34.0   0.7   9.6   5   0   0   5   5   5   2 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+# Program:         hmmscan
+# Version:         3.1b1 (May 2013)
+# Pipeline mode:   SCAN
+# Query file:      test-data/dna_target.fa
+# Target file:     test-data/MADE1.hmm
+# Option settings: hmmscan --tblout tblout --domtblout domtblout --pfamtblout pfamtblout test-data/MADE1.hmm test-data/dna_target.fa 
+# Current dir:     /home/users/cpt/cpt/esr/Projects/galaxy/tools-iuc/tools/hmmer
+# Date:            Tue Feb 10 14:40:35 2015
+# [ok]
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/MADE1.sto	Sat Jun 25 15:07:17 2016 -0400
@@ -0,0 +1,4021 @@
+#=GF ID   MADE1
+#=GF AC   DF0000629.2
+#=GF DE   MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
+#=GF AU   Finn RD, Hubley R, Jones T, Jurka J, Smit A, Wheeler T
+#=GF SE   Repbase
+#=GF GA   15.98;
+#=GF TC   32.00;
+#=GF NC   15.90;
+#=GF BM   hmmbuild --hand --maxinsertlen 10 HMM.ann SEED.ann
+#=GF SM   nhmmer -Z 3102 --dfamtblout DFAMOUT -E 100  --noali HMM.ann
+#=GF SM   dfamseq
+#=GF CT   Type; DNA Transposon;
+#=GF CT   Class; Cut and Paste;
+#=GF CT   Superfamily; TcMar-Mariner;
+#=GF MS   TaxId:9606 TaxName:Homo sapiens
+#=GF RN   [1]
+#=GF RM   8643651
+#=GF RT   Tiggers and DNA transposon fossils in the human genome.
+#=GF RA   Smit AF, Riggs AD;
+#=GF RL   Proc Natl Acad Sci U S A 1996;93:1443-1448
+#=GF DR   Repbase; MADE1;
+#=GF CC   Resembles an internal deletion product of Mariner1; has 37 bp
+#=GF CC   TIRs and a TA target site.
+#=GF SQ   1997
+#=GS H.sapiens_13.1/49567006-49566901     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_8.1/107923792-107923714    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_6.1/35544547-35544476      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_8.1/33053357-33053450      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_7.1/137095299-137095226    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_19.1/19100550-19100497     DE 19 dna:chromosome chromosome:GRCh37:19:1:59128983:1
+#=GS H.sapiens_1.1/164701792-164701870    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_3.1/68038940-68038866      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_Y.1/16255032-16255111      DE Y dna:chromosome chromosome:GRCh37:Y:1:10000:1
+#=GS H.sapiens_11.1/78684849-78684770     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_9.1/102803629-102803549    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_7.1/70331740-70331819      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_12.1/65806432-65806356     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_4.1/140063757-140063828    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_2.1/145673253-145673319    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_8.1/75316483-75316561      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_10.1/58241727-58241653     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_10.1/9215317-9215239       DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_3.1/5959133-5959195        DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_5.1/123101247-123101157    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_X.1/35165291-35165214      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_1.1/178351842-178351911    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_5.1/109325838-109325779    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_3.1/108039241-108039320    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_3.1/11149279-11149387      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_9.1/76348944-76348881      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_4.1/13679946-13679866      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_3.1/50865115-50865038      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_3.1/142708263-142708322    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_14.1/99520157-99520073     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_8.1/49894414-49894352      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_22.1/33739050-33738973     DE 22 dna:chromosome chromosome:GRCh37:22:1:51304566:1
+#=GS H.sapiens_10.1/28741187-28741252     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_18.1/71734515-71734437     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_7.1/96920909-96920830      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_6.1/140981762-140981839    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_9.1/73732275-73732334      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_1.1/111001521-111001446    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_18.1/33907333-33907408     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_10.1/109566953-109566884   DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_1.1/179679390-179679469    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_5.1/157390677-157390755    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_2.1/211802792-211802859    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_20.1/8603541-8603488       DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_9.1/93793923-93793841      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_11.1/76241565-76241634     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_X.1/133793823-133793745    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_4.1/159458164-159458225    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_X.1/129332388-129332309    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_5.1/66760434-66760355      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_1.1/62116231-62116153      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_20.1/9534057-9533996       DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_3.1/94020912-94020991      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_1.1/168717118-168717039    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_21.1/34963270-34963347     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_11.1/130743555-130743492   DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_4.1/103112987-103113055    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_4.1/16530066-16530000      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_1.1/199584406-199584328    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_12.1/112277369-112277443   DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_2.1/5239389-5239312        DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_10.1/15469390-15469317     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_8.1/97258936-97258995      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_11.1/67700789-67700711     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_X.1/120466487-120466408    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_2.1/183325541-183325620    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_X.1/113826669-113826741    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_9.1/14878575-14878655      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_X.1/24671328-24671251      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_9.1/18507503-18507562      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_5.1/85696277-85696354      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_2.1/227603020-227602944    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_6.1/145097997-145097895    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_12.1/16556446-16556522     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_12.1/43712804-43712881     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_9.1/7783782-7783704        DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_4.1/67467756-67467826      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_2.1/7944476-7944565        DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_13.1/105870337-105870416   DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_12.1/93112104-93112186     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_11.1/87185547-87185458     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_6.1/51926423-51926502      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_13.1/93064224-93064137     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_4.1/184034469-184034531    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_12.1/45513677-45513583     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_9.1/104650141-104650062    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_3.1/68266302-68266393      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_2.1/201450273-201450196    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_X.1/94318145-94318222      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_10.1/28599864-28599787     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_6.1/132825302-132825242    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_6.1/75668274-75668326      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_17.1/65467610-65467689     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_2.1/40084937-40085016      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_13.1/21149898-21149966     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_7.1/39334003-39333910      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_X.1/93468166-93468090      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_11.1/113239604-113239525   DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_10.1/118343486-118343564   DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_4.1/113390680-113390769    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_8.1/36863111-36863193      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_7.1/18445901-18445981      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_2.1/10018988-10018929      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_8.1/119639026-119639108    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_6.1/8450038-8450117        DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_5.1/57168871-57168769      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_6.1/142166360-142166436    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_17.1/19300760-19300695     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_8.1/4383131-4383205        DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_9.1/75906141-75906041      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_18.1/49446508-49446584     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_5.1/27986390-27986288      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_6.1/63278417-63278355      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_10.1/29070427-29070485     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_12.1/33194672-33194751     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_2.1/35696549-35696474      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_4.1/111050175-111050123    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_6.1/106323847-106323770    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_2.1/198518364-198518435    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_1.1/73380886-73380810      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_3.1/77834126-77834062      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_2.1/31315697-31315776      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_21.1/34559248-34559333     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_6.1/153177803-153177876    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_X.1/8946935-8946859        DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_11.1/70880041-70880120     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_9.1/114950996-114950924    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_3.1/180685010-180684936    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_4.1/96906805-96906869      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_19.1/37871674-37871616     DE 19 dna:chromosome chromosome:GRCh37:19:1:59128983:1
+#=GS H.sapiens_5.1/78202463-78202524      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_22.1/22242843-22242781     DE 22 dna:chromosome chromosome:GRCh37:22:1:51304566:1
+#=GS H.sapiens_1.1/18916588-18916699      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_9.1/37068668-37068747      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_3.1/19206718-19206772      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_19.1/56355102-56355179     DE 19 dna:chromosome chromosome:GRCh37:19:1:59128983:1
+#=GS H.sapiens_8.1/62548174-62548122      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_10.1/93465898-93465957     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_20.1/37145281-37145200     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_8.1/39613629-39613705      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_9.1/113535321-113535241    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_8.1/120739328-120739250    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_16.1/18530220-18530296     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_5.1/151604386-151604469    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_15.1/94126227-94126316     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_14.1/98798076-98798014     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_22.1/34855547-34855625     DE 22 dna:chromosome chromosome:GRCh37:22:1:51304566:1
+#=GS H.sapiens_X.1/16091228-16091289      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_13.1/88383262-88383184     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_6.1/136299032-136298955    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_19.1/38544602-38544525     DE 19 dna:chromosome chromosome:GRCh37:19:1:59128983:1
+#=GS H.sapiens_7.1/104212624-104212699    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_5.1/18862138-18862066      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_20.1/37774282-37774352     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_17.1/65596860-65596926     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_6.1/37770434-37770356      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_8.1/7946507-7946585        DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_1.1/242637446-242637514    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_X.1/136584670-136584591    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_7.1/96169277-96169197      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_20.1/55035410-55035334     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_1.1/58940108-58940022      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_7.1/135737563-135737641    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_2.1/8028613-8028545        DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_21.1/22973756-22973829     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_9.1/101475094-101475017    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_X.1/6437632-6437699        DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_3.1/174693253-174693326    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_13.1/108288464-108288387   DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_X.1/134620705-134620633    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_17.1/13403574-13403646     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_2.1/19846337-19846267      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_2.1/51170432-51170511      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_8.1/139967180-139967082    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_16.1/86639093-86639151     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_9.1/46742299-46742222      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_8.1/72382788-72382709      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_13.1/106517268-106517187   DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_10.1/31940286-31940360     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_2.1/115629064-115628966    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_17.1/63353454-63353530     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_3.1/101876312-101876231    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_6.1/147222821-147222751    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_8.1/121937526-121937447    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_5.1/3913164-3913092        DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_3.1/197750756-197750681    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_10.1/59575566-59575489     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_10.1/120312913-120312835   DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_5.1/166290303-166290225    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_11.1/3428118-3428051       DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_7.1/71595564-71595486      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_14.1/63143275-63143196     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_8.1/51726349-51726414      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_10.1/59930276-59930395     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_4.1/176670402-176670321    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_2.1/13108636-13108715      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_8.1/36515990-36515911      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_4.1/172004049-172003971    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_17.1/51614882-51614960     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_3.1/38064467-38064372      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_X.1/149435154-149435247    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_6.1/112590909-112590830    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_3.1/4821494-4821562        DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_1.1/194474471-194474416    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_5.1/109197177-109197099    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_7.1/118083993-118083934    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_10.1/10057471-10057541     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_4.1/9169954-9170021        DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_8.1/40243672-40243770      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_2.1/177723149-177723225    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_5.1/54148689-54148766      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_1.1/103229254-103229326    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_6.1/133586397-133586470    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_11.1/32135553-32135678     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_13.1/21187976-21187915     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_8.1/12038264-12038197      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_4.1/78886479-78886539      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_6.1/56002911-56002844      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_3.1/189745381-189745467    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_14.1/29896119-29896195     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_2.1/148224279-148224200    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_15.1/61110381-61110460     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_5.1/19446772-19446835      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_3.1/53365959-53366028      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_6.1/149554886-149554960    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_16.1/19689499-19689435     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_8.1/15379468-15379395      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_5.1/176701407-176701483    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_17.1/51948186-51948107     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_4.1/129325867-129325947    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_NC.49/74886-74808          DE GL000219.1 dna:supercontig supercontig:GRCh37:GL000219.1:1:179198:1
+#=GS H.sapiens_1.1/204622312-204622234    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_20.1/38188414-38188335     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_2.1/165484586-165484523    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_3.1/4493184-4493106        DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_2.1/213291075-213290996    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_8.1/120259931-120259856    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_X.1/121002722-121002800    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_10.1/13888230-13888295     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_18.1/64024969-64025049     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_10.1/14482909-14482844     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_3.1/133915829-133915925    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_20.1/41663327-41663252     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_20.1/12766828-12766762     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_8.1/112498156-112498234    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_21.1/14719716-14719638     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_15.1/53610103-53610161     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_10.1/117898738-117898685   DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_X.1/98454339-98454418      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_9.1/32764378-32764299      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_12.1/10267456-10267542     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_6.1/69203333-69203409      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_7.1/110288509-110288611    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_4.1/189625704-189625625    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_12.1/277674-277732         DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_21.1/45866831-45866894     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_X.1/71012024-71012090      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_15.1/50893962-50894040     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_4.1/128419287-128419192    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_14.1/102137305-102137368   DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_17.1/71311939-71312019     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_20.1/5875896-5875826       DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_9.1/126347736-126347665    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_2.1/117850350-117850430    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_1.1/175956513-175956575    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_19.1/11334803-11334869     DE 19 dna:chromosome chromosome:GRCh37:19:1:59128983:1
+#=GS H.sapiens_20.1/21244871-21244795     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_9.1/109847472-109847361    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_2.1/194855781-194855861    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_X.1/42116085-42116157      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_1.1/245220579-245220649    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_2.1/180339058-180339122    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_6.1/113226309-113226246    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_11.1/71587679-71587601     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_14.1/37289002-37289101     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_3.1/77975857-77975936      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_5.1/164716164-164716216    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_9.1/120012883-120012962    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_12.1/5709840-5709903       DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_17.1/2978366-2978434       DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_8.1/25003980-25003900      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_14.1/39009284-39009358     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_4.1/25213610-25213663      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_4.1/18799421-18799496      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_1.1/23596786-23596700      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_6.1/104956076-104956156    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_7.1/19686900-19686976      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_8.1/68965658-68965595      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_4.1/4086165-4086087        DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_11.1/78322095-78322174     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_6.1/6507148-6507069        DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_1.1/113494968-113494886    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_1.1/241404677-241404602    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_4.1/101051187-101051108    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_2.1/78644185-78644112      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_10.1/118383099-118383022   DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_12.1/91518510-91518608     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_2.1/77268987-77268908      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_8.1/99722206-99722120      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_5.1/68186046-68185968      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_1.1/26983185-26983108      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_1.1/168537191-168537107    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_10.1/3888274-3888339       DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_11.1/106009729-106009802   DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_4.1/34906820-34906888      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_8.1/105496681-105496602    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_1.1/81508747-81508668      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_X.1/78413612-78413530      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_2.1/209957275-209957351    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_X.1/55277736-55277842      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_18.1/62552228-62552164     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_12.1/68094346-68094238     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_17.1/40551104-40551033     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_13.1/74885117-74885193     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_7.1/39724692-39724614      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_17.1/68403991-68404056     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_8.1/4238642-4238588        DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_8.1/37487215-37487147      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_4.1/127232307-127232244    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_2.1/216143949-216143870    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_9.1/28332263-28332334      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_12.1/127880334-127880401   DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_22.1/33306690-33306616     DE 22 dna:chromosome chromosome:GRCh37:22:1:51304566:1
+#=GS H.sapiens_2.1/38390896-38390819      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_7.1/4662512-4662437        DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_5.1/173197377-173197296    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_2.1/17446628-17446574      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_8.1/34267045-34267118      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_4.1/42562918-42562837      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_18.1/66188212-66188293     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_X.1/97378609-97378551      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_8.1/8603107-8603048        DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_4.1/108839427-108839506    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_1.1/45697973-45697896      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_22.1/30340283-30340204     DE 22 dna:chromosome chromosome:GRCh37:22:1:51304566:1
+#=GS H.sapiens_18.1/65215489-65215423     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_16.1/26216053-26215995     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_2.1/157871767-157871689    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_8.1/95360454-95360571      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_2.1/72693874-72693938      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_3.1/149165262-149165186    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_12.1/27695349-27695424     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_4.1/156287676-156287599    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_13.1/36068572-36068650     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_2.1/181481849-181481921    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_2.1/89066926-89066844      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_3.1/87274282-87274227      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_2.1/107766190-107766115    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_16.1/87051050-87051111     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_1.1/79065250-79065168      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_8.1/63346203-63346280      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_6.1/129102991-129103071    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_8.1/114202364-114202288    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_13.1/40187139-40187199     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_1.1/56989207-56989109      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_10.1/12172751-12172823     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_4.1/41626528-41626600      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_9.1/20988479-20988552      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_3.1/178959652-178959571    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_2.1/18400964-18400900      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_15.1/87847042-87846967     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_X.1/105104682-105104752    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_20.1/3487657-3487750       DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_17.1/15773546-15773609     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_10.1/66624224-66624303     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_6.1/128877634-128877709    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_5.1/143750534-143750458    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_18.1/71487277-71487356     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_6.1/69716237-69716306      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_12.1/34180292-34180214     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_8.1/132713950-132713883    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_X.1/148393765-148393844    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_8.1/107811978-107811899    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_15.1/54101900-54101975     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_9.1/110474739-110474665    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_11.1/56958293-56958215     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_11.1/46929892-46929971     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_6.1/48782389-48782325      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_18.1/32433110-32433199     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_4.1/31636737-31636631      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_8.1/21407515-21407593      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_16.1/7524522-7524618       DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_18.1/71574719-71574633     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_6.1/15848908-15848829      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_2.1/48308821-48308732      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_10.1/43063501-43063577     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_8.1/32772680-32772623      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_11.1/62731982-62731905     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_8.1/23145187-23145257      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_5.1/92533642-92533583      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_3.1/1360859-1360937        DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_1.1/5476888-5476966        DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_1.1/96408229-96408152      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_15.1/40119895-40119968     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_17.1/50416994-50417068     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_17.1/63725518-63725578     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_5.1/18013069-18012998      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_16.1/53202547-53202602     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_13.1/55194459-55194385     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_17.1/9974288-9974212       DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_18.1/41402335-41402413     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_9.1/77128286-77128361      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_6.1/158186029-158186103    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_1.1/20534163-20534084      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_X.1/89227706-89227785      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_7.1/41814033-41814098      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_14.1/64561835-64561756     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_10.1/24517340-24517286     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_15.1/78813779-78813856     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_8.1/106145070-106145136    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_6.1/166324652-166324598    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_2.1/194121329-194121259    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_2.1/13969343-13969281      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_7.1/103070347-103070414    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_2.1/188607399-188607320    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_4.1/8220188-8220258        DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_16.1/47708339-47708265     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_X.1/129850144-129850066    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_X.1/99504303-99504227      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_2.1/211391758-211391700    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_16.1/17332259-17332180     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_16.1/20867484-20867571     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_4.1/125525993-125526067    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_2.1/143862029-143862082    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_6.1/100677426-100677507    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_6.1/22397838-22397916      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_7.1/118102566-118102646    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_21.1/27161974-27162053     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_7.1/97535387-97535309      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_13.1/36930013-36929930     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_16.1/80229779-80229858     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_14.1/69218409-69218475     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_5.1/117009721-117009663    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_9.1/21132547-21132478      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_6.1/105229975-105229868    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_16.1/79962036-79962111     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_3.1/135811679-135811756    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_10.1/113763823-113763751   DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_8.1/19172552-19172650      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_10.1/67444468-67444389     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_8.1/76698606-76698678      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_21.1/17061440-17061362     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_13.1/110574309-110574220   DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_12.1/83401940-83401862     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_1.1/160438896-160438975    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_X.1/131791847-131791768    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_X.1/6800285-6800363        DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_2.1/188089235-188089333    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_8.1/7711103-7711024        DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_10.1/122316359-122316434   DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_11.1/74110373-74110279     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_9.1/4904851-4904922        DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_3.1/127383631-127383552    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_X.1/14630060-14629982      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_6.1/54774164-54774242      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_5.1/112663548-112663469    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_3.1/8048243-8048164        DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_15.1/77255789-77255710     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_18.1/65591918-65591854     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_12.1/12129996-12130059     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_X.1/5484236-5484327        DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_9.1/90359820-90359899      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_6.1/113743260-113743339    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_5.1/151469141-151469219    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_1.1/72529196-72529123      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_2.1/218000885-218000960    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_11.1/76438722-76438812     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_17.1/66349355-66349283     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_7.1/142815490-142815413    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_7.1/39927074-39927148      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_9.1/3390966-3390907        DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_Y.1/19095266-19095183      DE Y dna:chromosome chromosome:GRCh37:Y:1:10000:1
+#=GS H.sapiens_3.1/63790430-63790360      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_3.1/85191319-85191249      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_1.1/248841253-248841193    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_5.1/155889779-155889858    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_3.1/54499758-54499691      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_7.1/32510325-32510246      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_10.1/67084128-67084206     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_6.1/109145536-109145470    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_17.1/47748655-47748724     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_10.1/15532794-15532859     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_3.1/132393157-132393233    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_17.1/21481167-21481089     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_1.1/64146281-64146187      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_6.1/91214595-91214531      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_5.1/64591040-64591117      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_2.1/34628741-34628820      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_9.1/3466563-3466509        DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_5.1/121806442-121806512    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_8.1/15265664-15265605      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_1.1/39173489-39173434      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_8.1/49851407-49851486      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_7.1/100957906-100957823    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_9.1/96357111-96357181      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_6.1/109864045-109863972    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_2.1/221226302-221226372    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_1.1/222186349-222186428    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_8.1/26906476-26906379      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_20.1/40591063-40590984     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_10.1/71618974-71619053     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_10.1/13064624-13064509     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_21.1/11051935-11052013     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_4.1/125582331-125582408    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_15.1/57252170-57252245     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_9.1/125222259-125222163    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_1.1/174317409-174317487    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_2.1/80161403-80161457      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_6.1/104800427-104800481    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_3.1/21236840-21236917      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_8.1/138274106-138274208    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_14.1/28202571-28202469     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_4.1/31162745-31162815      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_5.1/105167491-105167428    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_4.1/153822120-153822186    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_9.1/119999427-119999505    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_9.1/120853318-120853387    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_20.1/52993093-52993014     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_12.1/105721763-105721686   DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_13.1/99370320-99370398     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_10.1/56609437-56609514     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_11.1/79549637-79549700     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_2.1/68500324-68500246      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_4.1/13113835-13113898      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_20.1/15539029-15539108     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_10.1/97398228-97398150     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_12.1/39048909-39048995     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_1.1/225788149-225788224    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_16.1/68089697-68089776     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_14.1/86382959-86383016     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_5.1/156505351-156505430    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_10.1/33016626-33016568     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_11.1/114751912-114751835   DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_2.1/220816766-220816691    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_18.1/22603150-22603213     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_4.1/155706672-155706738    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_7.1/70793197-70793269      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_19.1/35322238-35322169     DE 19 dna:chromosome chromosome:GRCh37:19:1:59128983:1
+#=GS H.sapiens_2.1/59548383-59548459      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_9.1/7285042-7284965        DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_5.1/139540215-139540149    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_5.1/73567512-73567588      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_14.1/45389564-45389644     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_13.1/48499132-48499186     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_3.1/19650617-19650513      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_4.1/40558533-40558596      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_16.1/7949418-7949342       DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_20.1/6116874-6116952       DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_18.1/41908798-41908718     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_13.1/47787519-47787444     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_21.1/31173552-31173631     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_7.1/147582151-147582230    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_2.1/208843036-208843115    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_16.1/60803885-60803979     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_4.1/158509384-158509305    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_7.1/21225670-21225748      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_4.1/178465637-178465710    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_2.1/69390129-69390051      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_7.1/70530195-70530116      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_5.1/91741657-91741736      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_16.1/49974605-49974682     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_16.1/56850913-56850843     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_3.1/110809666-110809729    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_13.1/106906220-106906283   DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_9.1/129920586-129920516    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_1.1/177522011-177522089    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_4.1/59655890-59655812      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_14.1/104818353-104818430   DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_1.1/118484101-118484032    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_18.1/33762578-33762651     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_3.1/358124-358057          DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_11.1/97595524-97595603     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_16.1/26747553-26747632     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_2.1/224346362-224346263    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_4.1/163093911-163093986    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_7.1/31833877-31833956      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_18.1/21573817-21573880     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_X.1/31571609-31571528      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_2.1/171890270-171890196    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_18.1/70374568-70374490     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_9.1/77280141-77280218      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_4.1/79109490-79109569      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_7.1/6968540-6968473        DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_2.1/23000564-23000463      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_8.1/108297549-108297628    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_4.1/122323745-122323822    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_5.1/18059725-18059789      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_6.1/107202028-107202122    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_1.1/245120589-245120667    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_5.1/112062811-112062734    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_6.1/68972086-68972163      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_1.1/60414223-60414286      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_5.1/84786073-84785999      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_2.1/5196153-5196253        DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_1.1/96352109-96352182      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_5.1/36270219-36270141      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_12.1/86041099-86041031     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_5.1/98280902-98280820      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_9.1/111121209-111121134    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_5.1/106741944-106742017    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_17.1/7661573-7661641       DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_X.1/88068260-88068343      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_1.1/210814759-210814837    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_20.1/9086968-9086890       DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_2.1/50608803-50608882      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_1.1/42224814-42224893      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_4.1/36703000-36702924      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_11.1/29455850-29455927     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_21.1/28706998-28707077     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_12.1/106624405-106624467   DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_6.1/44569443-44569542      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_13.1/49326224-49326285     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_11.1/39853391-39853340     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_X.1/118944317-118944244    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_2.1/31209529-31209462      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_1.1/14461619-14461542      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_11.1/97756293-97756239     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_X.1/38935837-38935767      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_16.1/26036634-26036555     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_7.1/152559434-152559513    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_1.1/245533638-245533717    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_1.1/79152826-79152747      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_2.1/227989051-227988975    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_11.1/125862222-125862136   DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_7.1/42258014-42258090      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_8.1/134998382-134998452    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_9.1/22137354-22137420      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_3.1/76730903-76730987      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_9.1/16244958-16245037      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_5.1/106346505-106346575    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_2.1/185990470-185990393    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_12.1/127944244-127944160   DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_10.1/8734406-8734471       DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_18.1/6241511-6241589       DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_2.1/78484209-78484130      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_14.1/78073789-78073684     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_5.1/109021283-109021383    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_5.1/153149273-153149195    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_3.1/118049498-118049573    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_8.1/95039903-95039831      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_3.1/41559419-41559347      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_7.1/71995269-71995191      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_6.1/124294874-124294796    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_9.1/6411203-6411128        DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_X.1/16928941-16929012      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_15.1/48243932-48244010     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_20.1/36968064-36968126     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_3.1/102071243-102071163    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_7.1/70971896-70971827      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_2.1/224072770-224072852    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_10.1/25965273-25965334     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_5.1/59302063-59302134      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_12.1/105345538-105345617   DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_6.1/146948266-146948327    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_12.1/17429662-17429589     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_1.1/97287656-97287583      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_12.1/41039694-41039762     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_10.1/10905540-10905620     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_12.1/110419693-110419634   DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_X.1/16645137-16645211      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_10.1/85595277-85595359     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_8.1/29127495-29127571      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_7.1/25610297-25610376      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_7.1/145396476-145396549    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_4.1/80080840-80080762      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_2.1/223657898-223657820    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_1.1/225755430-225755505    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_4.1/188212849-188212779    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_1.1/57431955-57432033      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_8.1/138404039-138404116    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_10.1/95368438-95368359     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_X.1/6296647-6296710        DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_4.1/163663823-163663745    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_6.1/67859409-67859487      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_8.1/27005307-27005233      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_9.1/109847419-109847472    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_13.1/75134387-75134316     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_13.1/48293509-48293433     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_2.1/72976645-72976726      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_9.1/87425085-87425017      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_22.1/40971754-40971827     DE 22 dna:chromosome chromosome:GRCh37:22:1:51304566:1
+#=GS H.sapiens_10.1/57759742-57759820     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_4.1/164631446-164631523    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_7.1/14733245-14733171      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_5.1/88263549-88263627      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_4.1/179298666-179298590    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_19.1/46481684-46481605     DE 19 dna:chromosome chromosome:GRCh37:19:1:59128983:1
+#=GS H.sapiens_18.1/1840046-1840135       DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_20.1/47041975-47041913     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_1.1/225994330-225994256    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_1.1/82174941-82174864      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_16.1/56136874-56136796     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_6.1/81922123-81922069      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_16.1/20045159-20045214     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_3.1/152002389-152002318    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_21.1/23672831-23672760     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_4.1/23464725-23464644      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_6.1/45648683-45648605      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_5.1/56297624-56297550      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_19.1/48554684-48554762     DE 19 dna:chromosome chromosome:GRCh37:19:1:59128983:1
+#=GS H.sapiens_10.1/76738829-76738752     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_6.1/80495090-80495169      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_11.1/95724177-95724098     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_11.1/100813868-100813944   DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_4.1/5314809-5314869        DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_2.1/154759890-154759963    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_X.1/28819774-28819851      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_1.1/94856814-94856883      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_7.1/26027301-26027363      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_14.1/20742927-20742867     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_11.1/12432752-12432827     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_7.1/37771842-37771920      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_19.1/45080528-45080476     DE 19 dna:chromosome chromosome:GRCh37:19:1:59128983:1
+#=GS H.sapiens_14.1/52033393-52033458     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_2.1/48978933-48978863      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_5.1/159162421-159162344    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_X.1/123881420-123881343    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_12.1/103320376-103320301   DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_NC.42/149737-149801        DE GL000213.1 dna:supercontig supercontig:GRCh37:GL000213.1:1:164239:1
+#=GS H.sapiens_3.1/153502332-153502392    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_21.1/21022597-21022524     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_1.1/219837762-219837708    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_13.1/105661523-105661463   DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_1.1/95918741-95918818      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_1.1/62448536-62448615      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_11.1/34386938-34386863     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_9.1/24843023-24842962      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_14.1/85652014-85651936     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_NC.14/11916-11978          DE GL000249.1 dna:supercontig supercontig:GRCh37:GL000249.1:1:38502:1
+#=GS H.sapiens_4.1/155140063-155140142    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_4.1/70804142-70804068      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_11.1/68273119-68273042     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_1.1/162915868-162915947    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_20.1/57710843-57710916     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_X.1/129718852-129718930    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_6.1/82370047-82369968      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_16.1/83110543-83110473     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_5.1/120156697-120156752    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_4.1/102387184-102387241    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_14.1/26333554-26333500     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_12.1/103897780-103897858   DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_11.1/76589281-76589360     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_6.1/112230886-112230966    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_8.1/80409949-80410027      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_21.1/22666397-22666473     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_12.1/74414103-74414024     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_4.1/162109047-162109121    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_18.1/70520624-70520548     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_8.1/103479223-103479302    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_13.1/96223231-96223309     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_22.1/27182499-27182574     DE 22 dna:chromosome chromosome:GRCh37:22:1:51304566:1
+#=GS H.sapiens_7.1/135929198-135929277    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_16.1/47244915-47244839     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_20.1/8590881-8590802       DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_10.1/33387562-33387465     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_13.1/26984453-26984377     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_2.1/174358684-174358607    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_8.1/31812716-31812604      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_1.1/207614033-207613963    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_8.1/34174926-34175003      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_3.1/190884499-190884598    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_16.1/18932884-18932947     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_5.1/154404355-154404278    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_13.1/108259382-108259455   DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_1.1/90582580-90582661      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_12.1/105479216-105479143   DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_7.1/91255094-91255171      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_2.1/224304169-224304093    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_8.1/126636390-126636475    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_3.1/150123038-150123116    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_20.1/19570829-19570750     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_X.1/70401392-70401469      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_X.1/14189197-14189289      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_2.1/147892111-147892030    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_2.1/165280041-165280111    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_12.1/102388864-102388948   DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_1.1/105698986-105699046    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_6.1/52019826-52019885      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_2.1/96656055-96656137      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_18.1/69457152-69457227     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_5.1/64895271-64895349      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_11.1/67420919-67420998     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_4.1/120526048-120525978    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_2.1/105185281-105185360    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_X.1/45434291-45434221      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_4.1/125023442-125023506    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_12.1/40308468-40308389     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_12.1/33545982-33545885     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_5.1/25355129-25355205      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_5.1/142285343-142285272    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_2.1/232309326-232309265    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_14.1/65295227-65295306     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_7.1/119822590-119822653    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_19.1/54049423-54049493     DE 19 dna:chromosome chromosome:GRCh37:19:1:59128983:1
+#=GS H.sapiens_18.1/18642425-18642349     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_X.1/105073880-105073953    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_X.1/96073378-96073316      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_6.1/51948523-51948599      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_10.1/82363192-82363255     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_1.1/47090585-47090657      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_10.1/110463603-110463683   DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_20.1/7870408-7870336       DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_11.1/58035774-58035848     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_X.1/45778921-45778982      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_8.1/56954935-56955015      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_12.1/84966786-84966850     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_7.1/84295322-84295243      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_20.1/38683104-38683183     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_2.1/162163041-162162982    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_4.1/67925061-67925128      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_2.1/23684812-23684895      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_2.1/228184690-228184622    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_15.1/97634497-97634577     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_7.1/128546911-128546832    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_7.1/31356698-31356619      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_6.1/138621752-138621824    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_X.1/3984161-3984107        DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_8.1/93457596-93457521      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_X.1/116884136-116884222    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_X.1/38929724-38929648      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_13.1/95193834-95193902     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_1.1/89256060-89256138      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_20.1/37131639-37131697     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_5.1/84538808-84538727      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_3.1/72118116-72118182      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_2.1/202705931-202705854    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_10.1/133509057-133508980   DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_8.1/49996512-49996452      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_6.1/18572101-18572027      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_1.1/40173535-40173599      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_17.1/70710587-70710532     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_7.1/40569430-40569352      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_1.1/65557223-65557295      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_1.1/216056486-216056556    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_3.1/160440256-160440333    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_5.1/55296472-55296541      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_3.1/166398219-166398288    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_2.1/125231522-125231601    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_4.1/170496118-170496187    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_12.1/39307122-39307043     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_5.1/139554007-139553926    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_18.1/26776411-26776490     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_16.1/7124427-7124335       DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_2.1/70682752-70682673      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_1.1/35919689-35919631      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_1.1/189861575-189861652    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_3.1/8812962-8812883        DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_9.1/102303329-102303416    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_1.1/210838610-210838533    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_2.1/98204775-98204857      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_9.1/138420542-138420467    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_3.1/79848075-79848012      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_16.1/10049327-10049407     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_7.1/105607402-105607339    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_18.1/69244861-69244780     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_18.1/54249057-54249126     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_7.1/41343445-41343516      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_5.1/161698034-161697957    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_1.1/62066659-62066572      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_9.1/43582126-43582201      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_2.1/183605600-183605520    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_2.1/44208965-44209038      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_7.1/99177496-99177422      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_7.1/107677296-107677375    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_X.1/118658513-118658441    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_4.1/15233197-15233276      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_16.1/68849322-68849257     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_8.1/118026301-118026376    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_2.1/54806249-54806171      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_2.1/4729219-4729136        DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_17.1/27350637-27350569     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_9.1/30771105-30771183      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_2.1/4479851-4479930        DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_9.1/12345400-12345332      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_8.1/127759903-127759810    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_10.1/33766606-33766676     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_4.1/92503784-92503861      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_15.1/100047174-100047106   DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_8.1/2528001-2527928        DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_1.1/97368344-97368263      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_1.1/183759040-183758962    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_10.1/54684513-54684591     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_1.1/70445566-70445491      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_4.1/105199268-105199348    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_22.1/48118232-48118319     DE 22 dna:chromosome chromosome:GRCh37:22:1:51304566:1
+#=GS H.sapiens_1.1/190217312-190217376    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_16.1/5810783-5810690       DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_4.1/29737695-29737630      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_9.1/24758980-24758911      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_16.1/82139474-82139561     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_16.1/5132949-5132882       DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_X.1/80531863-80531784      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_19.1/45782786-45782840     DE 19 dna:chromosome chromosome:GRCh37:19:1:59128983:1
+#=GS H.sapiens_2.1/235285387-235285321    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_3.1/64415736-64415813      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_8.1/19172608-19172552      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_16.1/5419829-5419906       DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_5.1/124631102-124631180    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_20.1/38404718-38404797     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_16.1/6123280-6123335       DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_8.1/4363744-4363665        DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_12.1/8741921-8741981       DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_4.1/14917642-14917564      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_13.1/66540472-66540551     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_20.1/13936493-13936423     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_4.1/157217794-157217716    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_9.1/12777918-12777992      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_7.1/135482773-135482854    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_2.1/165815509-165815437    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_15.1/63639412-63639484     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_13.1/54560591-54560673     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_X.1/126409417-126409494    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_2.1/176395458-176395384    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_4.1/139732836-139732915    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_10.1/53399505-53399583     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_11.1/116822176-116822254   DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_5.1/96786796-96786869      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_19.1/48401994-48402069     DE 19 dna:chromosome chromosome:GRCh37:19:1:59128983:1
+#=GS H.sapiens_7.1/9083983-9083914        DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_4.1/175136380-175136460    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_11.1/98273629-98273559     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_22.1/44011431-44011358     DE 22 dna:chromosome chromosome:GRCh37:22:1:51304566:1
+#=GS H.sapiens_11.1/123751847-123751776   DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_11.1/85203346-85203274     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_13.1/56543734-56543661     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_2.1/207438700-207438776    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_4.1/134964703-134964622    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_X.1/34059687-34059758      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_12.1/63514194-63514118     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_12.1/117716085-117716163   DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_8.1/29846250-29846175      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_3.1/3688212-3688149        DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_18.1/2482642-2482579       DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_2.1/156961367-156961290    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_2.1/75370871-75370810      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_18.1/42126142-42126063     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_21.1/32167220-32167142     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_12.1/8382433-8382367       DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_9.1/89331920-89331845      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_1.1/150796716-150796636    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_2.1/147966200-147966275    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_15.1/52899857-52899934     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_14.1/87329648-87329724     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_9.1/13141140-13141197      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_3.1/105900385-105900312    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_14.1/53493775-53493698     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_9.1/84420913-84420990      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_9.1/17700833-17700891      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_12.1/63429104-63429042     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_3.1/170552014-170551931    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_22.1/25928770-25928692     DE 22 dna:chromosome chromosome:GRCh37:22:1:51304566:1
+#=GS H.sapiens_2.1/29645313-29645366      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_11.1/92053380-92053304     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_14.1/91628219-91628121     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_3.1/76392761-76392684      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_12.1/65016301-65016380     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_6.1/72429057-72429133      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_12.1/27000686-27000746     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_2.1/4478240-4478302        DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_12.1/95715155-95715088     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_12.1/8382434-8382367       DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_11.1/70130080-70130158     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_3.1/100701326-100701393    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_X.1/112221465-112221539    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_8.1/82201271-82201351      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_5.1/24529063-24529129      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_1.1/37439844-37439923      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_22.1/27445701-27445777     DE 22 dna:chromosome chromosome:GRCh37:22:1:51304566:1
+#=GS H.sapiens_20.1/39001459-39001536     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_8.1/109661793-109661868    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_2.1/231361319-231361236    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_4.1/170695671-170695599    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_7.1/113651909-113651840    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_2.1/80471827-80471750      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_2.1/59626468-59626391      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_X.1/100400694-100400616    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_6.1/122520182-122520080    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_10.1/3071950-3072003       DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_9.1/113992667-113992729    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_18.1/73955529-73955447     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_1.1/77742418-77742334      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_2.1/88762287-88762366      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_X.1/154558735-154558813    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_7.1/41076215-41076284      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_11.1/31890859-31890800     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_7.1/43269473-43269555      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_12.1/96293902-96293827     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_11.1/104685453-104685376   DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_11.1/95571889-95571824     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_10.1/113718479-113718548   DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_4.1/144533709-144533786    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_6.1/2344394-2344313        DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_6.1/113836283-113836209    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_5.1/160657072-160657147    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_5.1/7543749-7543695        DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_2.1/27075587-27075666      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_3.1/73534351-73534287      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_3.1/146421686-146421752    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_4.1/172899082-172899141    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_3.1/26516858-26516782      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_6.1/79729950-79729848      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_16.1/7961155-7961092       DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_5.1/4675187-4675107        DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_2.1/230147100-230147163    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_13.1/80069602-80069692     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_18.1/61905795-61905691     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_4.1/175668002-175668072    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_6.1/169871304-169871229    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_10.1/80510375-80510449     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_6.1/164512276-164512342    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_X.1/131941078-131941148    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_6.1/164960154-164960232    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_12.1/98298528-98298458     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_20.1/12961408-12961484     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_16.1/21940172-21940235     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_3.1/132295674-132295570    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_7.1/50412723-50412644      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_5.1/153468690-153468619    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_6.1/155202503-155202442    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_9.1/129299948-129299869    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_5.1/13174880-13174956      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_14.1/27396957-27396869     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_4.1/111313257-111313197    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_6.1/103276761-103276839    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_2.1/123490557-123490671    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_3.1/21179759-21179833      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_1.1/85088691-85088612      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_X.1/38058222-38058297      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_7.1/118041890-118041954    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_6.1/117514850-117514926    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_11.1/7126961-7127037       DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_7.1/106804565-106804652    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_8.1/84350905-84350967      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_12.1/65102517-65102574     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_6.1/64825848-64825778      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_6.1/64059999-64060052      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_15.1/47274148-47274224     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_1.1/98839022-98838945      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_16.1/20456060-20456139     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_3.1/70276804-70276750      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_4.1/158331622-158331723    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_11.1/37299878-37299957     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_4.1/185033152-185033090    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_11.1/59943514-59943579     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_X.1/78522359-78522433      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_6.1/102356213-102356129    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_2.1/214165743-214165820    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_7.1/110536228-110536155    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_3.1/175213266-175213319    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_4.1/81857217-81857290      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_9.1/134197575-134197650    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_10.1/53054298-53054400     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_X.1/131130876-131130955    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_2.1/158035384-158035463    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_14.1/38856140-38856064     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_21.1/26895661-26895567     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_1.1/101138934-101139013    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_5.1/262905-262984          DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_5.1/83269700-83269622      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_11.1/19260445-19260366     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_6.1/133839557-133839617    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_11.1/94666352-94666420     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_3.1/70100635-70100558      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_1.1/113691700-113691638    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_2.1/25787813-25787736      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_10.1/57823516-57823607     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_1.1/186554203-186554280    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_2.1/235601180-235601248    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_3.1/127230072-127230007    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_3.1/180498392-180498316    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_5.1/50357385-50357307      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_13.1/63404663-63404740     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_7.1/131703394-131703316    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_9.1/113478446-113478506    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_13.1/65052640-65052576     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_1.1/7922473-7922550        DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_7.1/119378793-119378867    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_4.1/127479204-127479287    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_1.1/219563082-219563161    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_10.1/79797865-79797925     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_10.1/110301210-110301271   DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_7.1/67018133-67018214      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_2.1/4194225-4194280        DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_13.1/59511496-59511422     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_5.1/55992120-55992043      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_5.1/35034267-35034346      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_4.1/157527437-157527510    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_16.1/26692675-26692751     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_5.1/55872316-55872237      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_5.1/165401855-165401780    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_5.1/174623371-174623450    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_5.1/101615082-101615005    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_6.1/15813673-15813752      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_12.1/54922243-54922316     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_5.1/180347208-180347129    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_7.1/122850520-122850444    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_4.1/176959236-176959337    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_12.1/10123432-10123491     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_1.1/177759296-177759218    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_12.1/21955968-21956025     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_3.1/141469018-141468952    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_X.1/123405050-123404979    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_5.1/1569627-1569548        DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_2.1/34011203-34011107      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_11.1/28600570-28600641     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_7.1/70775525-70775449      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_1.1/235107603-235107531    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_7.1/110288611-110288545    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_3.1/148359612-148359683    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_4.1/41552076-41551979      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_4.1/107336942-107336865    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_10.1/68389229-68389161     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_22.1/32575838-32575759     DE 22 dna:chromosome chromosome:GRCh37:22:1:51304566:1
+#=GS H.sapiens_X.1/40417654-40417568      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_12.1/92641154-92641228     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_14.1/26641375-26641454     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_10.1/52957648-52957569     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_2.1/9630811-9630868        DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_16.1/25875770-25875690     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_3.1/147798625-147798704    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_18.1/25443558-25443638     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_1.1/113691766-113691703    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_7.1/115039768-115039692    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_17.1/54314087-54314165     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_11.1/87925797-87925717     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_18.1/63545872-63545949     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_2.1/201540662-201540584    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_15.1/91608384-91608458     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_X.1/21581279-21581200      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_13.1/30780828-30780753     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_17.1/44995944-44995868     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_4.1/103080116-103080198    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_2.1/139928863-139928790    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_X.1/12633968-12633889      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_4.1/5951764-5951852        DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_6.1/126675583-126675686    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_2.1/62974922-62974846      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_4.1/113318566-113318643    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_1.1/243061249-243061174    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_2.1/216743640-216743561    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_21.1/23146979-23146903     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_10.1/2043680-2043605       DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_11.1/100232855-100232928   DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_5.1/25535256-25535333      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_6.1/38630545-38630466      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_1.1/90391878-90391811      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_2.1/183747965-183747892    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_5.1/62652633-62652555      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_3.1/72311479-72311558      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_X.1/23139022-23138954      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_9.1/2485331-2485266        DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_19.1/8755450-8755372       DE 19 dna:chromosome chromosome:GRCh37:19:1:59128983:1
+#=GS H.sapiens_1.1/216033802-216033879    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_16.1/5724614-5724678       DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_3.1/78897424-78897492      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_5.1/120648785-120648706    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_18.1/55569536-55569457     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_17.1/66383129-66383208     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_12.1/73133053-73133121     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_3.1/163234273-163234194    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_1.1/194058636-194058563    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_2.1/54930978-54931060      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_16.1/62754738-62754808     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_10.1/36482808-36482883     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_3.1/65504826-65504886      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_15.1/27262467-27262412     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_8.1/120566954-120567034    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_5.1/40235899-40235977      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_20.1/53765378-53765270     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_1.1/20111783-20111710      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_14.1/99390241-99390311     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_1.1/56843087-56843008      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_17.1/12307494-12307564     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_3.1/15175933-15176011      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_18.1/54454196-54454119     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_2.1/180857928-180857858    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_9.1/7754615-7754510        DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_4.1/20326491-20326551      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_7.1/47736101-47736025      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_8.1/27082460-27082522      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_1.1/24606264-24606342      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_1.1/174181505-174181439    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_13.1/34327660-34327578     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_6.1/2445257-2445173        DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_14.1/25150452-25150398     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_8.1/40954427-40954494      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_6.1/167521001-167521080    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_10.1/98282920-98282869     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_X.1/28550067-28549993      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_X.1/38107290-38107215      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_11.1/57591372-57591308     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_21.1/30853542-30853454     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_5.1/100794442-100794517    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_X.1/113877687-113877748    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_14.1/75238145-75238217     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_2.1/222384289-222384372    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_20.1/58712669-58712594     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_2.1/137402759-137402682    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_11.1/23121540-23121459     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_X.1/93595270-93595339      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_7.1/89235178-89235097      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_5.1/4302973-4302894        DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_2.1/216494602-216494680    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_6.1/166435094-166435171    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_16.1/5429107-5429028       DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_8.1/2979502-2979581        DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_18.1/22880589-22880668     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_X.1/46928469-46928399      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_2.1/113917625-113917704    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_13.1/50937289-50937368     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_1.1/222916234-222916312    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_5.1/100624433-100624509    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_X.1/101845792-101845882    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_X.1/83480838-83480761      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_19.1/32968257-32968189     DE 19 dna:chromosome chromosome:GRCh37:19:1:59128983:1
+#=GS H.sapiens_4.1/93823280-93823207      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_X.1/12963823-12963747      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_3.1/113485622-113485696    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_10.1/119117947-119117869   DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_8.1/108266637-108266716    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_2.1/8305864-8305932        DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_13.1/99743483-99743555     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_18.1/1347015-1347079       DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_6.1/151872109-151872192    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_11.1/89207254-89207326     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_5.1/155634661-155634589    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_X.1/40313410-40313464      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_10.1/14008427-14008346     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_12.1/52850720-52850774     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_X.1/8410766-8410695        DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_21.1/19264031-19264109     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_18.1/71811338-71811416     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_2.1/44979454-44979372      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_2.1/48724698-48724782      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_16.1/5313273-5313346       DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_14.1/45487261-45487329     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_X.1/47436740-47436664      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_5.1/59776411-59776481      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_5.1/122698177-122698234    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_2.1/45605000-45605104      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_4.1/61529667-61529745      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_15.1/58281793-58281853     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_10.1/38577056-38577129     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_9.1/116309906-116309828    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_6.1/152117767-152117827    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_7.1/36527187-36527083      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_4.1/72574848-72574915      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_8.1/6973465-6973543        DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_12.1/128049055-128048977   DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_4.1/188345043-188344964    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_15.1/63534234-63534301     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_10.1/2495334-2495411       DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_8.1/129981682-129981762    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_4.1/12604218-12604280      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_19.1/39776702-39776781     DE 19 dna:chromosome chromosome:GRCh37:19:1:59128983:1
+#=GS H.sapiens_4.1/21596586-21596519      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_2.1/136935272-136935352    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_2.1/65717562-65717483      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_14.1/43173654-43173725     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_X.1/8199998-8199940        DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_16.1/2944104-2944028       DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_20.1/55293943-55294022     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_15.1/47534472-47534409     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_16.1/74114363-74114293     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_8.1/27082383-27082437      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_4.1/38192870-38192939      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_7.1/53246599-53246679      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_3.1/84545733-84545812      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_7.1/155664673-155664594    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_18.1/71583292-71583345     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_10.1/69791304-69791230     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_10.1/62938894-62938970     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_18.1/30106130-30106184     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_X.1/20207790-20207726      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_2.1/86358874-86358937      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_X.1/111502795-111502713    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_14.1/27917223-27917293     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_8.1/135225738-135225815    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_6.1/104656477-104656544    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_20.1/11878095-11878031     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_12.1/60420556-60420630     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_12.1/82658726-82658819     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_20.1/46718951-46718877     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_20.1/41702211-41702288     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_4.1/82313673-82313595      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_12.1/104953725-104953645   DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_9.1/117075571-117075651    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_11.1/102979287-102979352   DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_1.1/105450150-105450081    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_1.1/203425712-203425793    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_4.1/166594814-166594741    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_8.1/135557944-135557816    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_4.1/175164733-175164654    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_8.1/31673335-31673276      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_8.1/12435617-12435539      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_2.1/208832427-208832347    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_13.1/72903905-72903828     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_16.1/61773457-61773535     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_7.1/83027704-83027627      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_15.1/86585370-86585293     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_Y.1/16070499-16070578      DE Y dna:chromosome chromosome:GRCh37:Y:1:10000:1
+#=GS H.sapiens_10.1/120765377-120765304   DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_1.1/38293461-38293530      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_1.1/239094640-239094578    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_3.1/147629198-147629277    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_1.1/213783080-213783159    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_X.1/94148589-94148511      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_8.1/131591302-131591366    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_X.1/4026467-4026537        DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_16.1/56207291-56207209     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_20.1/32506331-32506416     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_1.1/57336018-57335941      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_2.1/208082472-208082542    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_11.1/116345567-116345645   DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_16.1/82152539-82152603     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_7.1/43095689-43095612      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_4.1/94772077-94771998      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_16.1/29601794-29601857     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_9.1/9425554-9425481        DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_2.1/98913409-98913485      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_11.1/105519515-105519606   DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_5.1/42180701-42180779      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_12.1/66484958-66485034     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_2.1/224266055-224266123    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_16.1/9652830-9652761       DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_5.1/127429468-127429393    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_X.1/139876059-139875975    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_5.1/39167150-39167224      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_19.1/52873708-52873760     DE 19 dna:chromosome chromosome:GRCh37:19:1:59128983:1
+#=GS H.sapiens_4.1/109201767-109201691    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_3.1/125650207-125650273    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_13.1/90401274-90401350     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_7.1/138895907-138895986    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_11.1/24203541-24203466     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_13.1/80577717-80577649     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_2.1/162300659-162300567    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_15.1/27083322-27083249     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_X.1/70266711-70266778      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_4.1/9707323-9707390        DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_8.1/93764288-93764218      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_12.1/109256517-109256592   DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_2.1/210428117-210428042    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_15.1/48454006-48454099     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_X.1/17833840-17833918      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_3.1/143870911-143870993    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_12.1/23382981-23382924     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_5.1/124462988-124463065    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_14.1/20501826-20501916     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_4.1/104343346-104343261    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_13.1/30145325-30145256     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_6.1/62688790-62688878      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_6.1/112646303-112646379    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_13.1/95117558-95117637     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_7.1/95307606-95307552      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_2.1/202979896-202979973    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_1.1/163703592-163703667    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_3.1/150635569-150635490    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_18.1/11457724-11457639     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_5.1/129080672-129080742    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_5.1/67263351-67263275      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_2.1/165699318-165699228    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_8.1/24045921-24045846      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_7.1/20056700-20056646      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_9.1/119360835-119360756    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_4.1/18941920-18942007      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_9.1/37296020-37296099      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_6.1/78570940-78571024      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_6.1/156400253-156400175    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_5.1/27317247-27317321      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_20.1/22337493-22337558     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_15.1/48941381-48941302     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_4.1/176607396-176607468    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_16.1/30341943-30341881     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_7.1/63291664-63291577      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_Y.1/28557293-28557211      DE Y dna:chromosome chromosome:GRCh37:Y:1:10000:1
+#=GS H.sapiens_3.1/21871245-21871321      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_1.1/117102730-117102650    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_5.1/162094190-162094261    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_3.1/23013429-23013356      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_20.1/38683575-38683510     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_2.1/176195191-176195112    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_9.1/91079239-91079155      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_6.1/122874493-122874416    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_X.1/84397048-84396970      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_16.1/63042857-63042932     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_2.1/4759036-4759095        DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_16.1/63580045-63580123     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_1.1/34641548-34641470      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_21.1/33581874-33581798     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_8.1/121057223-121057148    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_11.1/56231415-56231493     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_8.1/131517356-131517436    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_4.1/60990439-60990515      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_8.1/128003326-128003270    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_4.1/64135466-64135523      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_6.1/63692992-63693070      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_2.1/138632609-138632686    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_17.1/56315722-56315669     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_7.1/81919395-81919474      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_7.1/43693364-43693287      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_4.1/100361087-100361153    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_16.1/61045093-61045172     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_12.1/101936665-101936566   DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_8.1/31858350-31858276      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_10.1/61100543-61100617     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_3.1/151347401-151347322    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_14.1/86329950-86329873     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_5.1/86527668-86527745      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_11.1/68273555-68273634     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_12.1/95441756-95441695     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_X.1/37662567-37662491      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_18.1/46592470-46592539     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_3.1/19457182-19457257      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_1.1/211384422-211384333    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_10.1/98977194-98977129     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_8.1/90587180-90587111      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_8.1/65271554-65271461      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_3.1/29410833-29410912      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_1.1/35884918-35884994      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_8.1/15218105-15218031      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_X.1/134727824-134727902    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_4.1/11537713-11537636      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_1.1/51286666-51286742      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_4.1/75453406-75453313      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_3.1/150953738-150953817    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_3.1/94806797-94806899      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_X.1/124796968-124796905    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_1.1/204847543-204847475    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_1.1/154501995-154501923    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_7.1/30032774-30032855      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_X.1/149657882-149657804    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_1.1/83125770-83125716      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_3.1/63167723-63167647      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_5.1/150179621-150179689    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_17.1/63909033-63909124     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_2.1/157788764-157788685    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_17.1/43077811-43077882     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_14.1/89584456-89584534     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_6.1/76841301-76841365      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_16.1/30657997-30658075     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_4.1/12798789-12798711      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_6.1/131901619-131901684    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_13.1/34486212-34486137     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_3.1/121641025-121640947    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_11.1/26859015-26858955     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_16.1/83434220-83434151     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_2.1/59327633-59327710      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_18.1/58075106-58075028     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_Y.1/13908423-13908368      DE Y dna:chromosome chromosome:GRCh37:Y:1:10000:1
+#=GS H.sapiens_15.1/72006399-72006474     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_X.1/5368393-5368446        DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_4.1/9444428-9444350        DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_X.1/139129799-139129866    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_11.1/17114420-17114341     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_2.1/218297020-218297100    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_5.1/150512435-150512516    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_1.1/184749196-184749292    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_11.1/35571890-35571797     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_2.1/80021399-80021488      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_6.1/76603407-76603341      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_X.1/8056327-8056393        DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_6.1/147766637-147766714    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_18.1/30904023-30903967     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_15.1/100292005-100291926   DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_13.1/76498706-76498642     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_9.1/33042125-33042193      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_2.1/207271364-207271278    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_1.1/82916463-82916396      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_5.1/112494493-112494435    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_7.1/83548921-83548998      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_20.1/34497144-34497218     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_18.1/76893388-76893305     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_5.1/144760945-144761025    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_6.1/20086814-20086754      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_1.1/159210329-159210393    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_8.1/56589807-56589883      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_7.1/37599412-37599487      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_21.1/25841912-25841991     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_8.1/48628152-48628073      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_4.1/6226339-6226245        DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_16.1/8359655-8359551       DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_13.1/75502274-75502353     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_14.1/33669375-33669452     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_1.1/234153497-234153566    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_15.1/70261159-70261092     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_9.1/87291708-87291654      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_10.1/63875977-63876056     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_7.1/135736380-135736300    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_1.1/87071956-87072034      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_6.1/148228548-148228628    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_5.1/60853193-60853129      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_22.1/27527734-27527797     DE 22 dna:chromosome chromosome:GRCh37:22:1:51304566:1
+#=GS H.sapiens_14.1/78910246-78910326     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_8.1/122888481-122888583    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_6.1/113352197-113352138    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_8.1/29786202-29786123      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_6.1/92816528-92816449      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_X.1/13910501-13910565      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_4.1/139027152-139027049    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_12.1/33565546-33565469     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_X.1/100373611-100373547    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_1.1/88388477-88388555      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_18.1/34758056-34757975     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_21.1/28111057-28110953     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_11.1/35321885-35321824     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_X.1/10184659-10184738      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_21.1/19047256-19047327     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_7.1/70771678-70771598      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_5.1/63619847-63619783      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_9.1/14746108-14746159      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_9.1/7624269-7624348        DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_2.1/211370041-211369963    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_12.1/115283519-115283438   DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_14.1/31362337-31362291     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_12.1/74411632-74411555     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_2.1/60413402-60413471      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_5.1/40378656-40378587      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_5.1/14910746-14910667      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_X.1/70215485-70215378      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_2.1/64273260-64273326      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_14.1/37941576-37941521     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_1.1/185622187-185622262    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_2.1/144629726-144629805    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_11.1/88534548-88534492     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_6.1/149497845-149497924    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_11.1/70171391-70171333     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_14.1/49209634-49209559     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_12.1/85949729-85949651     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_18.1/36997573-36997501     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_4.1/31757539-31757612      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_4.1/70443259-70443188      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_2.1/169760589-169760668    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_2.1/82584821-82584739      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_1.1/188116606-188116539    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_6.1/132825201-132825302    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_10.1/103690202-103690150   DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_2.1/173806986-173806903    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_8.1/68742211-68742143      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_11.1/59678824-59678737     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_3.1/170259613-170259546    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_6.1/66475132-66475193      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_8.1/116213300-116213225    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_3.1/103242962-103242874    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_10.1/33719330-33719253     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_4.1/35784002-35784089      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_12.1/64275921-64275845     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_7.1/68388485-68388406      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_X.1/134029867-134029789    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_12.1/114558175-114558094   DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_X.1/100145471-100145393    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_10.1/59114347-59114411     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_11.1/74663350-74663271     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_12.1/79176613-79176692     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_1.1/98752473-98752397      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_18.1/22542742-22542689     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_5.1/175362215-175362293    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_7.1/34980372-34980447      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_4.1/45887264-45887344      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_2.1/54376044-54376098      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_7.1/68944906-68944985      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_14.1/88575215-88575298     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_14.1/22387695-22387616     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_6.1/47988206-47988282      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_3.1/55614167-55614101      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_13.1/49158528-49158603     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_X.1/91159263-91159178      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_11.1/28717029-28717106     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_11.1/94199668-94199744     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_10.1/6591539-6591478       DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_11.1/69539941-69539862     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_13.1/28776971-28777045     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_21.1/27842576-27842498     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_6.1/128476780-128476702    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_5.1/164373145-164373049    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_16.1/10147660-10147597     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_15.1/86762511-86762584     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_5.1/83638197-83638140      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_1.1/143876901-143876980    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_10.1/108477513-108477448   DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_4.1/92565001-92565078      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_13.1/77953342-77953421     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_5.1/126740132-126740054    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_3.1/60486763-60486686      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_11.1/5409264-5409192       DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_12.1/44377275-44377350     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_11.1/129206525-129206449   DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_11.1/61038001-61037936     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_18.1/57416909-57416986     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_6.1/135683561-135683481    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_21.1/47179981-47179920     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_19.1/43177742-43177820     DE 19 dna:chromosome chromosome:GRCh37:19:1:59128983:1
+#=GS H.sapiens_3.1/67691923-67691867      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_1.1/164644580-164644657    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_13.1/46387781-46387702     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_5.1/122112130-122112210    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_1.1/18286298-18286360      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_1.1/96829845-96829735      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_3.1/186452459-186452389    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_7.1/136257240-136257174    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_7.1/112155268-112155343    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_3.1/8520040-8520108        DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_6.1/54464787-54464719      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_1.1/180782963-180783027    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_2.1/201251908-201251982    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_9.1/73662990-73663074      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_3.1/76467049-76467126      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_13.1/49747123-49747050     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_18.1/69168395-69168302     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_7.1/48597400-48597309      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_5.1/6154559-6154483        DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_16.1/48274650-48274595     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_15.1/51788201-51788148     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_7.1/105597411-105597347    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_2.1/113601986-113601892    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_4.1/153822224-153822120    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_17.1/3132363-3132288       DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_9.1/122929191-122929103    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_17.1/33874342-33874392     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_8.1/119385054-119384974    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_7.1/86867018-86866954      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_1.1/239608018-239607954    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_12.1/115964914-115964846   DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_11.1/133616395-133616325   DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_11.1/13999584-13999500     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_3.1/70927845-70927923      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_3.1/2743556-2743476        DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_4.1/164444444-164444536    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_13.1/29825589-29825527     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_6.1/156083959-156084034    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_1.1/218877972-218878048    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_11.1/71513630-71513696     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_21.1/17092286-17092355     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_3.1/9068276-9068196        DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_18.1/23836850-23836931     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_6.1/57254931-57255009      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_11.1/19667259-19667350     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_4.1/110979907-110979829    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_22.1/23478815-23478892     DE 22 dna:chromosome chromosome:GRCh37:22:1:51304566:1
+#=GS H.sapiens_1.1/246507265-246507313    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_5.1/138499433-138499486    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_X.1/125507426-125507504    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_8.1/89985858-89985783      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_11.1/79026921-79027029     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_16.1/24024682-24024566     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_7.1/33926486-33926409      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_18.1/72008609-72008542     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_5.1/35002132-35002053      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_3.1/129618452-129618538    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_1.1/212725464-212725548    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_15.1/68142177-68142100     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_2.1/28934491-28934423      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_11.1/31457019-31457102     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_8.1/138555225-138555313    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_18.1/10073376-10073456     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_3.1/20133396-20133320      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_6.1/63475959-63475850      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_4.1/124325062-124325137    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_15.1/54847899-54847843     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_7.1/133682032-133681970    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_5.1/23561239-23561311      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_2.1/138587081-138587160    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_5.1/150485436-150485514    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_4.1/179165757-179165830    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_4.1/147043358-147043436    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_4.1/123043626-123043707    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_1.1/103950367-103950450    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_16.1/75588704-75588783     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_3.1/122645886-122645965    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_18.1/59723336-59723251     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_19.1/44167332-44167411     DE 19 dna:chromosome chromosome:GRCh37:19:1:59128983:1
+#=GS H.sapiens_10.1/16843934-16843987     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_3.1/70489798-70489905      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_7.1/107312772-107312853    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_12.1/19974279-19974201     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_7.1/92585257-92585328      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_18.1/21474083-21474162     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_3.1/184609265-184609186    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_8.1/69039514-69039433      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_3.1/196501743-196501812    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_6.1/45592106-45592182      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_9.1/93353854-93353782      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_10.1/108247237-108247294   DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_X.1/92253332-92253254      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_11.1/101623913-101623988   DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_1.1/193313137-193313190    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_3.1/104826596-104826518    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_8.1/127879238-127879159    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_X.1/129657649-129657591    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_17.1/37453664-37453740     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_8.1/75201037-75200958      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_16.1/13137332-13137431     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_16.1/54905604-54905540     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_4.1/34388456-34388379      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_17.1/71424659-71424738     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_X.1/25224572-25224491      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_8.1/34144917-34144856      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_16.1/61280584-61280529     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_9.1/84511355-84511277      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_7.1/137335849-137335913    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_X.1/7779679-7779602        DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_8.1/103745942-103745863    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_X.1/105883125-105883046    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_10.1/34841789-34841850     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_5.1/65905918-65905847      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_9.1/82003754-82003831      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_4.1/77775119-77775208      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_21.1/29522993-29522925     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_18.1/44074706-44074768     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_2.1/140179820-140179903    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_7.1/34352574-34352651      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_10.1/25168652-25168730     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_9.1/72975697-72975634      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_20.1/18312570-18312645     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_7.1/70402832-70402772      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_X.1/116112499-116112421    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_11.1/19114099-19114027     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_7.1/67441665-67441729      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_15.1/72064951-72065023     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_20.1/11980221-11980145     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_11.1/60047705-60047629     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_9.1/3752099-3752177        DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_4.1/118751825-118751749    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_10.1/9346720-9346794       DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_7.1/69167976-69168062      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_16.1/10147878-10147815     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_6.1/49735571-49735493      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_6.1/82693206-82693266      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_12.1/86409031-86408982     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_9.1/103732818-103732758    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_13.1/33615495-33615576     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_21.1/26827153-26827064     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_6.1/85546984-85547043      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_11.1/60104786-60104708     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_6.1/168264634-168264559    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_2.1/138658537-138658459    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_22.1/43947245-43947312     DE 22 dna:chromosome chromosome:GRCh37:22:1:51304566:1
+#=GS H.sapiens_12.1/5305886-5305956       DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_3.1/15661144-15661077      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_5.1/56938732-56938811      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_1.1/209519466-209519530    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_12.1/70195789-70195711     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_2.1/207401122-207401045    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_3.1/170247910-170247843    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_3.1/170134695-170134756    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_4.1/56773687-56773617      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_9.1/87623259-87623333      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_7.1/26099962-26100051      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_7.1/147075126-147075200    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_3.1/109194926-109194997    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_10.1/60262343-60262263     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_11.1/106398691-106398768   DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_16.1/52289380-52289459     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_2.1/147156981-147157037    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_8.1/119044326-119044401    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_3.1/100578227-100578149    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_8.1/96732041-96731983      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_11.1/108340277-108340184   DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_1.1/177155581-177155501    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_3.1/158779242-158779174    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_10.1/31577439-31577364     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_8.1/88412442-88412508      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_8.1/55667215-55667140      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_2.1/137858044-137857967    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_7.1/137753370-137753295    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_9.1/83011814-83011878      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_1.1/220610895-220610817    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_4.1/133208942-133208880    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_8.1/32028338-32028409      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_3.1/23648822-23648885      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_13.1/74154605-74154673     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_3.1/3050435-3050514        DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_8.1/121633849-121633783    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_3.1/165611693-165611633    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_13.1/107716057-107716130   DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_18.1/14397266-14397342     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_X.1/122151754-122151679    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_10.1/20671534-20671597     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_17.1/51705971-51705913     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_5.1/34677939-34678010      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_2.1/8129275-8129221        DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_5.1/84930229-84930292      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_11.1/37137928-37137874     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_4.1/56138542-56138447      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_12.1/16541116-16541041     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_10.1/121883731-121883653   DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_20.1/29636682-29636759     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_1.1/83025863-83025932      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_2.1/154484176-154484098    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_X.1/70909244-70909178      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_1.1/204353695-204353616    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_X.1/73720915-73720838      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_4.1/22580764-22580682      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_5.1/110891595-110891674    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_13.1/42547256-42547174     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_6.1/69924701-69924624      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_7.1/34796880-34796950      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_1.1/198803501-198803582    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_16.1/78659914-78659837     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_6.1/6473282-6473370        DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_16.1/31518339-31518430     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_7.1/84852577-84852649      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_10.1/26757613-26757534     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_13.1/36515300-36515380     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_7.1/158560769-158560699    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_5.1/101444379-101444461    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_11.1/107539666-107539589   DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_6.1/87087702-87087624      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_16.1/52845319-52845407     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_8.1/122199038-122199110    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_10.1/58040083-58040005     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_16.1/11400381-11400302     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_4.1/16623657-16623586      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_6.1/120694554-120694484    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_14.1/57290936-57291010     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_7.1/69884124-69884071      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_8.1/106904986-106904923    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_16.1/62780334-62780406     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_7.1/49069658-49069580      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_21.1/41711795-41711728     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_19.1/10330422-10330353     DE 19 dna:chromosome chromosome:GRCh37:19:1:59128983:1
+#=GS H.sapiens_4.1/94472933-94472854      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_17.1/61268649-61268739     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_13.1/81982697-81982645     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_7.1/132782727-132782785    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_4.1/117022965-117022883    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_3.1/25312392-25312299      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_10.1/107790156-107790236   DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_2.1/124941513-124941439    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_15.1/65924041-65924126     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_X.1/89630109-89630040      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_1.1/17476683-17476605      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_18.1/14553610-14553674     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_12.1/29043607-29043542     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_1.1/99256240-99256297      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_17.1/39212973-39213050     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_1.1/211670946-211670882    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_Y.1/3820039-3819967        DE Y dna:chromosome chromosome:GRCh37:Y:1:10000:1
+#=GS H.sapiens_21.1/32834884-32834806     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_1.1/93788050-93787984      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_7.1/82445056-82445136      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_8.1/3649467-3649389        DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_11.1/17029509-17029434     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_7.1/67870609-67870689      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_17.1/45195953-45195875     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_3.1/93537856-93537930      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_13.1/50911985-50912065     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_8.1/96175092-96175162      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_14.1/78317325-78317395     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_20.1/10036979-10037059     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_1.1/224850778-224850700    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_4.1/178583521-178583586    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_11.1/13070767-13070837     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_5.1/13919980-13919909      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_6.1/135560389-135560309    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_17.1/46496586-46496509     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_1.1/74750157-74750237      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_12.1/69557638-69557716     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_12.1/20780210-20780272     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_10.1/19423359-19423449     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_10.1/119676881-119676939   DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_7.1/110110213-110110275    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_1.1/199761205-199761295    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_6.1/20331447-20331507      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_8.1/72744916-72744839      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_X.1/133475122-133475204    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_10.1/3944916-3945024       DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_21.1/38086340-38086417     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_9.1/112404717-112404797    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_7.1/34941256-34941177      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_13.1/55793236-55793300     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_12.1/91255595-91255654     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_17.1/14662540-14662615     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_14.1/61051911-61051851     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_8.1/53942103-53942029      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_4.1/67353120-67353044      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_3.1/107084124-107084045    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_6.1/154069489-154069568    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_18.1/32399915-32399995     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_3.1/113738517-113738597    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_20.1/31455923-31455850     DE 20 dna:chromosome chromosome:GRCh37:20:1:63025520:1
+#=GS H.sapiens_4.1/165746554-165746645    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_17.1/63096475-63096534     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_X.1/5605692-5605621        DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_13.1/57315669-57315742     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_4.1/152610759-152610835    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_1.1/80492169-80492244      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_2.1/164628491-164628419    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_10.1/2429336-2429408       DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_5.1/173971197-173971118    DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_2.1/59760206-59760128      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_12.1/40220759-40220849     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_2.1/168758543-168758614    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_11.1/80142596-80142676     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_7.1/146677016-146677090    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_X.1/13579009-13578935      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_14.1/85813256-85813331     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_11.1/119893368-119893445   DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_14.1/79084291-79084214     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_10.1/71572531-71572452     DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_15.1/49773472-49773394     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_8.1/88053329-88053250      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_9.1/86329122-86329198      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_4.1/54477852-54477778      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_6.1/114598553-114598632    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_13.1/83433799-83433877     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_21.1/27239296-27239375     DE 21 dna:chromosome chromosome:GRCh37:21:1:48129895:1
+#=GS H.sapiens_1.1/88388790-88388712      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_13.1/77375943-77376017     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_X.1/130538572-130538494    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_14.1/30160898-30160831     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_9.1/119155870-119155949    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_4.1/175848458-175848540    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_8.1/30927630-30927706      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_4.1/59829622-59829692      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_5.1/37888361-37888447      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_9.1/122274034-122273972    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_13.1/71475361-71475283     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_4.1/157123932-157123862    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_7.1/130359684-130359758    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_2.1/125458425-125458504    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_18.1/40809759-40809838     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_3.1/130075405-130075321    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_4.1/154663083-154663008    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_7.1/78190882-78190821      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_7.1/9133744-9133822        DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_5.1/39586044-39585947      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_13.1/62527198-62527120     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_17.1/68496982-68497098     DE 17 dna:chromosome chromosome:GRCh37:17:1:81195210:1
+#=GS H.sapiens_X.1/32760115-32760035      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_4.1/155645381-155645459    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_5.1/77444586-77444517      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_5.1/97689122-97689201      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_NC.25/12079-12001          DE GL000241.1 dna:supercontig supercontig:GRCh37:GL000241.1:1:42152:1
+#=GS H.sapiens_6.1/114131774-114131698    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_2.1/54931034-54931107      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_9.1/73524759-73524689      DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_4.1/146839194-146839273    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_22.1/35207468-35207533     DE 22 dna:chromosome chromosome:GRCh37:22:1:51304566:1
+#=GS H.sapiens_1.1/86574594-86574669      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_7.1/141076460-141076531    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_18.1/37996631-37996554     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_2.1/86813268-86813347      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_3.1/159540407-159540484    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_8.1/128145986-128145927    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_10.1/120779955-120780029   DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_14.1/30174608-30174508     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_2.1/237795498-237795575    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_12.1/42473656-42473579     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_10.1/2277700-2277623       DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_3.1/81690558-81690494      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_4.1/107784265-107784316    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_1.1/39362167-39362245      DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_7.1/62740093-62740152      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_12.1/13740912-13740814     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_9.1/107041055-107040983    DE 9 dna:chromosome chromosome:GRCh37:9:1:141213431:1
+#=GS H.sapiens_1.1/158439462-158439546    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_4.1/82901781-82901701      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_7.1/135033143-135033063    DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_6.1/72248589-72248666      DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_X.1/70845703-70845606      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_3.1/106528817-106528721    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_4.1/62182220-62182142      DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_1.1/159064081-159064001    DE 1 dna:chromosome chromosome:GRCh37:1:1:249250621:1
+#=GS H.sapiens_8.1/118397962-118398040    DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_8.1/31378516-31378591      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_12.1/5522213-5522272       DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_10.1/5667126-5667205       DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_2.1/208278489-208278414    DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_6.1/148845370-148845292    DE 6 dna:chromosome chromosome:GRCh37:6:1:171115067:1
+#=GS H.sapiens_11.1/3578676-3578598       DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_18.1/19275547-19275488     DE 18 dna:chromosome chromosome:GRCh37:18:1:78077248:1
+#=GS H.sapiens_15.1/94624411-94624333     DE 15 dna:chromosome chromosome:GRCh37:15:1:102531392:1
+#=GS H.sapiens_X.1/136379587-136379508    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_X.1/106941750-106941831    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_X.1/142519391-142519447    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_2.1/29726777-29726855      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_10.1/129692170-129692249   DE 10 dna:chromosome chromosome:GRCh37:10:1:135534747:1
+#=GS H.sapiens_4.1/122190685-122190583    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_8.1/84226854-84226931      DE 8 dna:chromosome chromosome:GRCh37:8:1:146364022:1
+#=GS H.sapiens_X.1/13909209-13909294      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_3.1/28692560-28692482      DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_4.1/146459028-146459098    DE 4 dna:chromosome chromosome:GRCh37:4:1:191154276:1
+#=GS H.sapiens_7.1/95359736-95359654      DE 7 dna:chromosome chromosome:GRCh37:7:1:159138663:1
+#=GS H.sapiens_13.1/20839129-20839208     DE 13 dna:chromosome chromosome:GRCh37:13:1:115169878:1
+#=GS H.sapiens_11.1/93818069-93818148     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_12.1/74380524-74380437     DE 12 dna:chromosome chromosome:GRCh37:12:1:133851895:1
+#=GS H.sapiens_14.1/22348688-22348765     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+#=GS H.sapiens_5.1/3719892-3719813        DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_X.1/119589819-119589883    DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_11.1/99413217-99413294     DE 11 dna:chromosome chromosome:GRCh37:11:1:135006516:1
+#=GS H.sapiens_3.1/187953927-187954006    DE 3 dna:chromosome chromosome:GRCh37:3:1:198022430:1
+#=GS H.sapiens_5.1/45808850-45808962      DE 5 dna:chromosome chromosome:GRCh37:5:1:180915260:1
+#=GS H.sapiens_2.1/52168091-52168020      DE 2 dna:chromosome chromosome:GRCh37:2:1:243199373:1
+#=GS H.sapiens_X.1/15982118-15982178      DE X dna:chromosome chromosome:GRCh37:X:1:155270560:1
+#=GS H.sapiens_16.1/26558428-26558349     DE 16 dna:chromosome chromosome:GRCh37:16:1:90354753:1
+#=GS H.sapiens_Y.1/15779845-15779925      DE Y dna:chromosome chromosome:GRCh37:Y:1:10000:1
+#=GS H.sapiens_14.1/99179197-99179121     DE 14 dna:chromosome chromosome:GRCh37:14:1:107349540:1
+H.sapiens_13.1/49567006-49566901     ...GGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................GTACAAATGGTACTTTTAATTGAAAGCAATGGC........A...................A.............................A...........................A......................A.........................C......................C..................................................A..G..................T...T.A.....C....T.T..T..C...........G...CA....C.CAACCTAA
+H.sapiens_8.1/107923792-107923714    TTAGGT.....T.GG..T..A....C.A.A..A...A...G....T..........A........A.......T.........T...A.C...............G........................G...................T..................T.......................C....................T................................T...............................G....................................T.............................C........................................A..................................................T.........................T..............................................T.....................................C...........................T.............T................T....................................T............................A.................................................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_6.1/35544547-35544476      TTAGAT.....T.GG..T..T....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................A....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................A...............G.................C................A..A..................T...T.................T..T...........G...CA....C.CAAC....
+H.sapiens_8.1/33053357-33053450      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................G..................................................T.........................T..............................................A...............................AAAGTAC...........................T.............T................T....................................T............................A.........................A.......................T......................................G.....................TAATTTA...............................C........A.................TTA.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.GAACCTAA
+H.sapiens_7.1/137095299-137095226    .TAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T.....T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................T.............................C........................................A..................................................T.........................T...............................................................................................................................................T....................................C............................A.........................G.......................T......................................G...........................A...............................C........A...................A.............................A...........................A......................C.........................C......................T...............G.................C................A..A..................T...C.A.....T....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_19.1/19100550-19100497     .TAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................G...........................G...............................C........A...................A.............................A...........................A......................C.........................C......................T...............T.................C................A..A..................T...T.A.....C....T.T..T..T...........C...CA....C.CAACCTAA
+H.sapiens_1.1/164701792-164701870    TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.A...............G........................G...................T..................C.......................T....................T................................T....................................................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................G......................A.........................C......................C...............G.................T................A..A..................T...T.A.....C....T.T..T..C...........G...CA....C.CAACCTAA
+H.sapiens_3.1/68038940-68038866      .TAGGT.....C.AG..T..G....C.A.C..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C..................................................................................................................................................................................................A.....................................G...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................A...............................T........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_Y.1/16255032-16255111      TTATGT.....T.GG..T..A....C.A.A..A...G...G....T..........A........C.......T.........T...G.T...............G........................A...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.G..T..T...........A...CA....C.CAACCTAA
+H.sapiens_11.1/78684849-78684770     TTAAGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...A.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................T...........................A.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAGCCTAA
+H.sapiens_9.1/102803629-102803549    .TAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................A...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................C..................................................T.........................T..............................................T.....................................T...........................T.............T................T....................................T...........................TT.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A........................AC......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...TG....C.CAACCTAA
+H.sapiens_7.1/70331740-70331819      TTAGGT.....T.GG..T..G....C.A.A..A...T...G....T..........G........A.......T.........T...G.C...............A........................G...................T..................G.......................T....................T................................T...............................G....................................C.............................A........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....A.T..G..T...........G...CA....G.CAACCTAA
+H.sapiens_12.1/65806432-65806356     .TAGGT.....T.GG..T..G....C.T.A..A...A...G....T..........A........A.......T.........T...G.C...............G............................................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T....................................................................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................C...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_4.1/140063757-140063828    .TATGT.....T.G...T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................................................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................................................T........A...................A.................................................................................................................................T...............G.................C................A..A.................AC...T.A.....C....T.T..T..T...........G...CA....C.AAACCCA.
+H.sapiens_2.1/145673253-145673319    ...GAT.....T.GG..T..G....C.A.A..A.......G....T..........A........A.......T.............G.T...............G........................G...................T..................T.......................T....................T................................T...............................A....................................C.............................T........................................A..................................................T.........................T..............................................A....................................................................................................................................................................................................................T......................................A...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A.....................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_8.1/75316483-75316561      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................G...............................A....................................C.............................T........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A......................AT......................................G...........................G...............................C........A...................A.............................A...........................A................................................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........T...CA....C.CAACCTA.
+H.sapiens_10.1/58241727-58241653     ....GT.....T.GG..T..G....C.A.A..A...A...G....C..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................................................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................T........A...................G.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACTTAA
+H.sapiens_10.1/9215317-9215239       TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...A.C...............A........................G...................T..................T.......................T....................T................................................................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................T...........................T.............G................T....................................C............................A.........................A.......................T......................................G...........................G...............................G........A...................A.............................A...........................A......................G.........................C......................C...............C.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAATCTAA
+H.sapiens_3.1/5959133-5959195        TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................T.............................C........................................A..................................................T.........................C..............................................A.....................................C...........................G.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........G...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A..................................................
+H.sapiens_5.1/123101247-123101157    TTAGAT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............T........................G...................G..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A..........................ATTTTAATTACT...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................T......................A...............G.................T................A..A..................T...T.A.....C....T.T..T..T...........G...CA....A.CAACCTAA
+H.sapiens_X.1/35165291-35165214      TTAGGT.....T.GG..T..G....C.A.A..A...A........T..........C........A.......T.........T...G.C...............A........................G...................A..................T.......................T....................T................................................................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................A...............G.................T................G..A..................T...T.A.....C....T.T..T..T...........A...CA....C.CAACCTAA
+H.sapiens_1.1/178351842-178351911    ..AGGT.....T.GG..C..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................C.....................................................................................................A.............................C........................................A..................................................T.........................T................................................................................................................T.............T................T....................................T............................A.........................A......................GT......................................T...........................G...............................C........A...................A.............................A...........................A......................G.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAA.....
+H.sapiens_5.1/109325838-109325779    TTAGTT.....T.GG..T..G....C.A.A..A...G...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................A........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A...........................................................................
+H.sapiens_3.1/108039241-108039320    TTAAGT.....T.GG..T..G....C.A.A..A...A...G....C..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................T.............................C........................................A..................................................T.........................G..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................G......................A.........................C......................C...............A.................C................G..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_3.1/11149279-11149387      TTAGGT.....T.CG..T..G....C.A.A..A...T...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................GCGGCAGTTAACCATTAACCATTAACCCATTAA....................................C.............................C........................................A..................................................T.........................T..............................................A.................................................................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAATCTA.
+H.sapiens_9.1/76348944-76348881      ...GGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................G..................T.......................T....................T................................T...............................A..........................................................................................................................................................................................................................................................................................................................................................................................................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCT..
+H.sapiens_4.1/13679946-13679866      TTAGAT.....T.GG..T..A....C.A.A..A...A...G....T..........A........A.......C.........T...G.C...............G........................G...................T..................T.......................T....................T................................T..............................TG....................................C.............................C........................................A..................................................G.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................A...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................T................G..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_3.1/50865115-50865038      .TAGGT.....T.GA..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.G...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................C....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A................................................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CATTCTAA
+H.sapiens_3.1/142708263-142708322    ...........................A.A..A...A...G....T..........G........A.......T.........T...G.C...............C........................G...................T..................T.......................T....................T................................................................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G........................................G...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...C.A.....C....A.T..C..T...........G...CA....C.CA......
+H.sapiens_14.1/99520157-99520073     TTAGGT.....T.GG..A..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T...............GGTT.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................C..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C...................TGCC...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........A...CA....T.CAATCCA.
+H.sapiens_8.1/49894414-49894352      TTAGGT.....T.GG..G..G....C.A.A..A...G...G....T..........A........G.......T.........T...C.C...............G........................G...................T..................T.......................T....................T................................C...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A..................................................
+H.sapiens_22.1/33739050-33738973     TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................A........................................A..................................................T.........................T..............................................................................................................................T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........G...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................G...T.A.....C....T.T..T..T..........TG...TA....C.CAAACTAA
+H.sapiens_10.1/28741187-28741252     .TAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G.......................................................................................................................................................................................................................C........................................A..................................................T..............................................................................................................................................................................................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAATATAA
+H.sapiens_18.1/71734515-71734437     TTAGGT.....T.GT..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................................................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........G...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..A..T...........G...CA....C.GAACTTAA
+H.sapiens_7.1/96920909-96920830      TTAGGT.....T.GG..T..A....C.A.A..A...A...G....T..........A........A.......T.........T...C.C...............G........................G...................C..................T.......................T....................T................................T...............................A....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................G.........................C......................C...............G.................C................A..G..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_6.1/140981762-140981839    TTAGGT.....T.GG..T..G....T.A.G..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C...........................................................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.................................................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_9.1/73732275-73732334      TTAGGT.....G.GG..T..G....A.A.A..A...T...G....T..........A........A.......T.........C...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A....................................................................................................................................................................................................................................................................................................................................................A.............................A...........................A......................A.........................C......................C.........................................................................................T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_1.1/111001521-111001446    .TAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T.....................................................................................................C.............................C........................................A..................................................C.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A................................................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CACCCTAA
+H.sapiens_18.1/33907333-33907408     TTAGCT.....T.GG..T..G....C.A.A..A...T...G....T.........................................G.C...............G........................G...................C..................T.......................T....................T................................T...............................G....................................C.............................C........................................G..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................A......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CCATCTAA
+H.sapiens_10.1/109566953-109566884   ...........................A.A..A...A...C....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T.............................TTA....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................T...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAAACTAA
+H.sapiens_1.1/179679390-179679469    TTATGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................T........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................A...............................C........A...................A.............................A...........................A......................A.........................C......................C...............T.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAGCCTAA
+H.sapiens_5.1/157390677-157390755    TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................A......................................G...........................G...............................C........A..................CA.............................A...........................A......................A.........................C......................C.................................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....T.CAACCTA.
+H.sapiens_2.1/211802792-211802859    ..AGAT.....T.GG..T..G....C.A.A..A...A...A....T..........A........A.......T.........T...G.A...............A........................G...................T..................T.......................T....................T................................T...............................G....................................A.....................................................................................................................................................................................................................................................................................................................................................................A.........................A.......................T......................................A...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_20.1/8603541-8603488       TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................G...........................G...............................C............................A.............................A...........................A......................A.........................C......................C...............C.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAATCTAA
+H.sapiens_9.1/93793923-93793841      TTAGGT.....T.GG..T..G....T.A.A..A...A...G....T..........A........A.......T.........C...G.C...............G........................G...................T..................T.............................................................................G...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T......................TAAAAAA.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A.....................T...T.A.....C....T.T..T..T...........G...TA....C.CAACCTAA
+H.sapiens_11.1/76241565-76241634     TTAGGT.....T.GG..T..G....C.A.A..A...A...G....C..........A........G.......T.........T...G.C................................................................................................................................................................................................................................................................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A................................................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_X.1/133793823-133793745    TTAGGT.....T.GG..T..G....G.A.A..A...A........T..........G........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................C.........................T..............................................A.....................................A...........................T.............T................T....................................C............................A.........................A.......................C......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....T.CAACCTAA
+H.sapiens_4.1/159458164-159458225    TTAGGT.....TTGG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................A...............................C........A...................A.................................................................................................................................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_X.1/129332388-129332309    TTAGGT.....T.AG..T..G....C.C.A..A...A...G....T..........A........A.......T.........C...A.C...............G........................G...................T..................T.......................T....................T................................T...............................C....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAATCTAA
+H.sapiens_5.1/66760434-66760355      TTAGGT.....T.GG..T..G....C.A.A..A...G...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................C.............T................T....................................C............................G.........................A.......................T......................................A...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................G...T.A.....C....C.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_1.1/62116231-62116153      TTAACT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.A...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................A...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A................................................C......................T...............G.................C................G..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_20.1/9534057-9533996       .TAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C................................................................................................................................................................................................................................................................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................G.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...G.A.....C....T.T..T..T...........G...CA....C.........
+H.sapiens_3.1/94020912-94020991      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........T........A.......T.........T...G.G...............G........................G...................T..................T.......................T....................T................................T...............................A....................................C.............................C........................................G..................................................T.........................T..............................................A.....................................C...........................A.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.G..T..T...........G...CA....C.CAACATAA
+H.sapiens_1.1/168717118-168717039    TTAAGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................T.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................C......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...G.A.....C....T.T..T..T...........T...CA....C.CAACCTAA
+H.sapiens_21.1/34963270-34963347     ..AGAT.....C.AG..T..G....C.A.A..A...A...G....T..........A........A.......A.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....T....G.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_11.1/130743555-130743492   .TGGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.................G........................A...................G..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T...............................................................................................................................................T....................................T............................A.........................A.......................T......................................G............................................................................................................................................................................................................................................................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAATCTAA
+H.sapiens_4.1/103112987-103113055    TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..............................................................................................................................................................................................................................................................................................................................................................................................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_4.1/16530066-16530000      TTAGGT.....T.GG..T..G....C.A.A..A...A...A....T..........G........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................G.....................................C...........................C.............T................T....................................T............................A.........................A.......................T......................................G...........................A...............................C........A...................A.............................A...........................A......................A.........................C......................C...............T.................C................A..A..................T...T.A.....C....C.T..T..................................
+H.sapiens_1.1/199584406-199584328    TTACGA.....T.AG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................................................G....................................C.............................C........................................A..................................................T.........................T..............................................T.....................................T...........................T.............T................T....................................T............................A.........................A.......................A......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_12.1/112277369-112277443   .TAGGT.....T.AG..T..G....C.A.A..A...A...A....T..........G........A.......C.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................T...........................T.............T................T....................................T............................A.........................A......................AT......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.GAA.....
+H.sapiens_2.1/5239389-5239312        TTAGAT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........C...A.T...............G........................G...................A..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A............................................................................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_10.1/15469390-15469317     .....T.....T.GG..T..G....C.A.G..A...A...G....T..........G........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................T.............................C........................................A..................................................T.........................T..............................................A.....................................T...........................T.............T................T....................................C............................A.........................A.......................A......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.TAGCCTA.
+H.sapiens_8.1/97258936-97258995      .............................................T..........A........G.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................A...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................................A.................T................G..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCT..
+H.sapiens_11.1/67700789-67700711     .TAGGC.....T.GG..T..A....C.A.A..A...A...A....T..........A........A.......T.........T...G.C...............T........................A...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................T.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_X.1/120466487-120466408    TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................T........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................T........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....T.CAACCTAA
+H.sapiens_2.1/183325541-183325620    TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............A........................G...................T..................T.......................T....................T................................T...............................G....................................T.............................T........................................A..................................................T.........................T..............................................G.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...G.A.....C....T.T..T..T...........G...TA....C.CAACCTAA
+H.sapiens_X.1/113826669-113826741    TTAGGT.....T.GG..T..T....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............A........................G...................T..................T.......................T....................T................................C...............................A....................................C.............................C........................................A..................................................T.........................T..............................................G.....................................T........................GGTT.............T................T....................................C............................A............................................................................................................................................................................................................................................................................................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_9.1/14878575-14878655      TTAGGT.....T.GT..T..G....C.A.A..C...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................C...............................A....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A........................AC......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...TA....C.CAACCTAA
+H.sapiens_X.1/24671328-24671251      TTAGGT.....T.GG..C..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................................................G....................................T.............................C........................................A..................................................T.........................T..............................................A.....................................T...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..T..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTA.
+H.sapiens_9.1/18507503-18507562      ....GT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................T........................................A..................................................T.........................T..............................................A.....................................C...........................C.............T................T....................................C............................A.........................A.......................T..................................................................T...............................C........A...................C.............................C...........................A......................A.........................C......................C.................................C................A..A......................T.A.....C....T.T..T..................................
+H.sapiens_5.1/85696277-85696354      ...GGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........G...G.T...............A........................A...................T..................T.......................T....................T................................T..............................TG....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................T........A...................A.............................A...........................A......................G.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_2.1/227603020-227602944    ..AGGT.....T.GG..T..C....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................A........................................A..................................................T.........................T..............................................T.....................................A...........................T.............T................T....................................T......................................................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.G.....C....T.T..T..T...........G...CT....C.CACCCTAA
+H.sapiens_6.1/145097997-145097895    TTAAGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.A...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...AAATACCCTAACTTACTTTTAACGG...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....T....T.T..T..T...........G...CA....T.CAACCTA.
+H.sapiens_12.1/16556446-16556522     TTAGAT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............T........................G...................T..................T.......................T....................T................................C...............................A....................................C.............................C........................................A..................................................T.........................T................................................................................................................T.............T................T....................................T............................A.........................A.......................T......................................G...........................T...............................C........A...................A.............................A...........................A................................................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAGCCTAA
+H.sapiens_12.1/43712804-43712881     TTAGGT.....T.AG..T..G....C.A.A..A...A...G....C..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................G.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....G....T.T..T..T...........G...CA....C.CAGCCT..
+H.sapiens_9.1/7783782-7783704        TTAGAT.....T.GG..T..G....T.G.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................................................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................G.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................G.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..G..T...........G...CA....C.CAACCTAA
+H.sapiens_4.1/67467756-67467826      .................T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................T...................G..................T.......................T....................T................................T...............................G....................................C.............................A........................................A..................................................T.........................T..............................................G.....................................T...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................A...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_2.1/7944476-7944565        TTAGGT.....T.AG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T............................TTTG....................................T.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A................AAAAACAT......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................T................G..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CATTCTAA
+H.sapiens_13.1/105870337-105870416   TTAGGT.....T.GG..T..G....C.A.A..A...A...A....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................A....................................T.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................T.............................A...........................A......................A.........................C......................A...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CGACCTAA
+H.sapiens_12.1/93112104-93112186     TTAGGC.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...A.C...............G........................G...................G..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................T...........................G...............................C.....GTCA...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....A.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_11.1/87185547-87185458     TTAGGT.....T.GG..T..G....C.A.A..A...T...G....T..........A........A.......C.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T............................TATTTTTAATG...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................G..A..................T...T.A.....A....G.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_6.1/51926423-51926502      TTAGAT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................C.............T................T....................................C............................A.........................A.......................C......................................G...........................G...............................T........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_13.1/93064224-93064137     TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................A...................T..................C.......................T....................T................................................................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T.............................ACGTTTAATG...........................A...............................C........T...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_4.1/184034469-184034531    TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C.......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................T.............T................T....................................C............................A.........................A.......................T..................................................................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTA.
+H.sapiens_12.1/45513677-45513583     TTAAGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......C.........T...G.C...............A........................G...................G..................T.......................T....................T................................T...............................G....................................C.............................A........................................A..................................................T.........................T..............................................A.....................................C...........................T.GGTGTACAGTAAT................T....................................T.........................GCCA.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................C......................C.........................C......................T...............G.................C................A..G..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_9.1/104650141-104650062    TTAGGT.....T.GG..T..G....C.A.A..A...T...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................A.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............G................T....................................T............................A.........................A.......................T......................................T...........................G...............................C........A...................A.............................A...........................A......................T.........................C......................T...............G.................C................A..A..................T...T.A.....C....G.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_3.1/68266302-68266393      .........................C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................C...............................A....................................C.............................C........................................A..................................................T.........................T..............................................A..............TTCTTAATGTAATTTATTAATTAC...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.T.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_2.1/201450273-201450196    ..AGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................A....................................C.............................C........................................A..................................................T.........................C..............................................A.....................................C...........................T.............T................C....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................C...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....A....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_X.1/94318145-94318222      TTAGGT.....T.GG..T..G....C.A.A..A...G...G....T..........A........T.......T.........T...G.T...............G........................G...................C..................T.......................T....................T................................T...............................G....................................C......................................................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T.................................................................A.........................A.......................T......................................G...........................A...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................A...T.A.....C....C.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_10.1/28599864-28599787     TTAGGT.....T.GA..T..G....C.A.A..A...A...T....T..........A........A.......T.........T...A.A...............G........................G...................G..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A......................AT......................................G...........................G...............................C........A...................A.............................A...........................A......................C.........................C......................C...............G.................C................A..A..................T...T.G.....C....T.T..T..T...........G...CA....C.CAACC...
+H.sapiens_6.1/132825302-132825242    ..AGGT.....T.GG..T..A....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............C........................A...................T..................T.......................T....................T................................T...............................A....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A..................................................
+H.sapiens_6.1/75668274-75668326      .TAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C................................................................................................................................................................................................................................................................C........................................A..................................................T........................CT..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................A......................C...............A.................T................G..A..................T...T....................................................
+H.sapiens_17.1/65467610-65467689     TTAGGT.....T.GG..T..G....C.A.A..A...A...G....A..........A........A.......C.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_2.1/40084937-40085016      TTAGAT.....T.GG..T..G....C.A.A..A.......C....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................................................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.......................AAA......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CTACCTAA
+H.sapiens_13.1/21149898-21149966     ...........T.GG..T..G....C.A.A..A...A...G....T..........A........A.......C.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T...............................................................................................................................................T....................................T............................A.........................A.......................T......................................T...........................G...............................C........A...................A.............................A...........................A................................................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..G...........G...CG....C.CAACCTAA
+H.sapiens_7.1/39334003-39333910      TTAGGT.....T.GG..C..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................C..............................................G.....................................C...........................T.............T................T....................................T..............TGCCATCACTTTTTG.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CG....C.CAACCTAA
+H.sapiens_X.1/93468166-93468090      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A.................................................................................................................................................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................T.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCCAA
+H.sapiens_11.1/113239604-113239525   TTAGGT.....T.AG..T..G....C.A.A..A...A...G....A..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................T.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....G....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_10.1/118343486-118343564   TTAGGT.....T.GG..T..G....C.A.A..A...A...A....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................C...............................A....................................T.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A..............................................................G...........................G...............................C........C...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CGACCTAA
+H.sapiens_4.1/113390680-113390769    TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......A.........T...G.C...............A........................G...................T..................T.......................A....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T............................TACTCTTAATG...........................G...............................C........A...................A.............................A...........................A......................C.........................C......................T...............G.................C................A..A..................T...T.A.....T....T.T..T..T...........G...CA....C.CATCCTAA
+H.sapiens_8.1/36863111-36863193      TTAAGT.....T.GG..T..G....C.A.A..A...T...G....T..........A........A.......T.........TTTGG.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................T.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................G.........................C......................T...............G.................C................A..A..................T...T.A.....C....A.T..T..T...........G...CA....G.CAACCTAA
+H.sapiens_7.1/18445901-18445981      TTAGGT.....T.GG..T..G....T.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T..............................TG....................................C.............................A........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................A................A..A..................T...T.A.....T....G.T..T..T...........G...TA....C.CAACCCAA
+H.sapiens_2.1/10018988-10018929      ..AGGT.....T.AG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................................................................................................................................................................................................................................................................................................................................................................................................................A.........................C......................T...............G.................C................A..A..................T...G.A.....C....C.T..T..T...........G...CA....C.CAACC...
+H.sapiens_8.1/119639026-119639108    TTAGGT.....T.GG..T..G....T.A.A..A...A...A....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................T.....................................T...........................T.............T................T....................................T.........................TTTA.........................A.......................T......................................G...........................G...............................T........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................C..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_6.1/8450038-8450117        TTAGGT.....T.GG..G..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................G...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................G...........................T.............T................T....................................C............................C.........................A.......................T......................................G...........................G...............................G........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....G.AAACCTAA
+H.sapiens_5.1/57168871-57168769      TTATAT.....T.GC..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................A...................T..................T.......................T....................T................................T...............................G.............TCATTACTTTTATTAGCATTTTGC.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................T......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_6.1/142166360-142166436    TTAGGT.....T.GG..T..A....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............C................T....................................C............................A.........................A.......................A......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CACCC...
+H.sapiens_17.1/19300760-19300695     TCAGGT.....T.GA..T..G....C.A.A..A...A...G....T..........A........A.......G.........T...G..............................................................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A............................................................................................................................................................................................A.......................T......................................G...........................G...............................C........A...................A.............................A..................................................G.........................T......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAAC....
+H.sapiens_8.1/4383131-4383205        .....T.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........A...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................T.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................A......................................T...........................G...............................C........C...................A.............................C...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_9.1/75906141-75906041      TTAGGT.....T.GG..C..A....C.A.A..A...A...G....T..........A........A.......T.........C...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T.........................GCTTTTAGTTACTTCTACATTA.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.G.....C....T.T..T..T...........G...CA....C.CAGCCTAA
+H.sapiens_18.1/49446508-49446584     .TAGGT.....T.GG..T..G....C.A.A..A...A........T..........A........A.................T...G.T...............G........................G...................T..................T.......................T....................C................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................A...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................A...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................C...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_5.1/27986390-27986288      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C..........................AC.............T................C....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................CATTACACTCTCGTGGCAAAAACC...............A.................C................G..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_6.1/63278417-63278355      .TAGGT.....T.GG..T..G....C.A.A..A...A...G....G..........T........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A............................................................................................................................................................................................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A............................................................................................................................................................C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_10.1/29070427-29070485     ..AGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................................................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................A........G...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T....................................................
+H.sapiens_12.1/33194672-33194751     TTAGGG.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................T........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................C.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CC....C.CAACCTAA
+H.sapiens_2.1/35696549-35696474      TTAGAT.....T.GG..T..G....C.A.A..A...A...G....T..........C........A.......T.........T...G.T...............C........................G...................T..................T.......................T....................T................................C...............................G....................................C.............................C........................................A................................................AGT.........................T..............................................A.....................................C...........................T.............T................T......................................................................................................................................................................................................................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_4.1/111050175-111050123    .TAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................G...........................G...............................C............................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...A.A.....C....T.T..T..T...........G...CA....C.CCACCTAA
+H.sapiens_6.1/106323847-106323770    TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C.............ACA........................G...................C..................C.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................G............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A................................................C......................T...............G.................C................A..A..................T...T.A.....A....T.T..T..T...........G...CA....C.CAACC...
+H.sapiens_2.1/198518364-198518435    TTGGGT.....T.GG..T..G....C.A.A..A...A...A....T..........A........A.......T.........T...A.T...............G........................G...................T..................G.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................G.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...................................................................................................................G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....A.TAAC....
+H.sapiens_1.1/73380886-73380810      .TAGGT.....T.GA..T..G....C.A.A..A...A...G....T..........G........A.......T.........T...A.T...............G........................G...................G..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................T........A...................A.............................A...........................A......................A.........................C......................................A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.AAACCTA.
+H.sapiens_3.1/77834126-77834062      TTAGTT.....T.GG..T..G....C.A.A..A...A...A....T..........A........A.......T.........T...G.T...............G........................A...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................................................................................................................................................................................................................................................................................................................................................................................................................A.........................T......................C...............A.................C................A..A..................C...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_2.1/31315697-31315776      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................G................................G...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................T......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....T.CAACCTAA
+H.sapiens_21.1/34559248-34559333     TTATGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......C.........T...G.T...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C.....................ATTTTTT.............T................T....................................A............................A.........................A.......................T......................................G...........................A...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....G....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_6.1/153177803-153177876    TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................C...............................A....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.....................................................................................................................................................................................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_X.1/8946935-8946859        TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........A...G.T...............G........................G...................A..................G.......................T....................T................................C...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A................................................C......................T...............G.................C................G..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCT..
+H.sapiens_11.1/70880041-70880120     TTCGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................G..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................T.....................................C...........................T.............T................T....................................A............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....G.CAACCTAA
+H.sapiens_9.1/114950996-114950924    TTAGGC.....T.GG..T..G....C.A.A..A...A...G....C..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................................................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................G.........................A.......................T......................................A...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................T................G..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CA......
+H.sapiens_3.1/180685010-180684936    ...........................A.A..A...A...G....T..........A........A.......C.........T...A.C...........TTTTA........................C...................T..................T.......................T....................T................................T...............................G....................................C.............................T.....................................TTTC..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_4.1/96906805-96906869      ....................................A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................A...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACATAA
+H.sapiens_19.1/37871674-37871616     .....T.....T.GG..T..G....C.A.A..A...G...G....T..........A........A.......T.........T...G.C...............G........................T...................T..................T.......................T....................T................................T...............................G....................................G.............................C........................................A..............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....T....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_5.1/78202463-78202524      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................C...............................G............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................A.............................A...........................A......................A.........................C......................C...............T.................C................A..A..................T...T.A.....C....T.T..T..A...........G...CA....C.CAACCTAA
+H.sapiens_22.1/22242843-22242781     .TAGGT.....A.GG..T..G....G.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_1.1/18916588-18916699      TTAGGT.....T.GG..C..G....C.A.A..A...A...G....T..........A........A.......T.........C...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....AAAGTAATTTGCCATTAAAAGTAATGTCATTAC...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................G..A..................T...T.A.....C....T.T..T..T...........G...CA....T.CAAACTAA
+H.sapiens_9.1/37068668-37068747      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......C.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................T.............................C........................................A........................................AAACTTTTAAT.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A..........................................................................................................................................................................................................C...T.A.....C......T..T..T...........G...CG....C.CAACTTAA
+H.sapiens_3.1/19206718-19206772      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................A...............G.................C................A..A..................T...T.A.....C....T.T..T..C...........A...CA....C.GAACCTAA
+H.sapiens_19.1/56355102-56355179     TTAGGT.....T.GG..T..A....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C......................................................................A..................................................T.........................T....................................................................................T...........................T.............T................T....................................T............................C.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_8.1/62548174-62548122      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................A...........................G...............................C........A...................A.............................A...........................A......................C.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCT..
+H.sapiens_10.1/93465898-93465957     TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.A...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................G.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................A......................C...............G.................C................A..A...........................................................................
+H.sapiens_20.1/37145281-37145200     TTAGGT.....G.GG..T..G....C.A.A..A...A...G....T..........A........A.......C.........T...G.C...............A........................G...................T..................T.......................T....................T................................G...............................G....................................C.............................C......................................GCA..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAATCTAA
+H.sapiens_8.1/39613629-39613705      ..AGGT.....T.GG..T..G....C.A.A..A...A...C....T..........A........A.......T.........A...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................C.........................T....................................................................................T...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................G.........................C......................C...............G.................C................A..A..................T...C.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_9.1/113535321-113535241    TTAGGT.....T.GG..G..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................C....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................A........A...................A.............................A...........................A......................A........................AA......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...TA....C.CAACCTAA
+H.sapiens_8.1/120739328-120739250    TTAGGT.....T.GG..T..G....C.A.A..A...C...A....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C......................................................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................A...T.A.....C....A.T..T..T...........G...TA....C.CAACCTAA
+H.sapiens_16.1/18530220-18530296     ..AGGT.....T.GG..T..G....C.A.A..A...A...G....T..........G........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................C................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................T...........................T.............C................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...C.A.....C....T.T..T..T...........G...CA....C.CAACCTA.
+H.sapiens_5.1/151604386-151604469    TTAGGT.....T.GG..T..T....C.A.A..A...A...G....T..........A........A.......T.........T...G.A...............A........................G...................T..................T.......................T....................T................................T.............................TAG....................................T.............................C........................................A..................................................T.........................T..............................................A............................AAAGTAATAC...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G..............................................................................................................................................................................................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAATGTAA
+H.sapiens_15.1/94126227-94126316     TTAGGT.....T.GG..T..G....C.A.A..A...A...G....C..........A........A.......C.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T............................TACTTTTAATG...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..G..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_14.1/98798076-98798014     TTAGGT.....T.TG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.G...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................G.........................A.......................T......................................G...........................G...............................C........T...................A.............................A...........................A......................G.........................C......................C...............A.................C................A..A..................T...T.A..................................................
+H.sapiens_22.1/34855547-34855625     .TAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................A...................A..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................G.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...GA....C.CAACCTAA
+H.sapiens_X.1/16091228-16091289      .............................................T..........A........A.......T.........T...G.A...............G........................G...................T..................T.......................T....................T................................T...............................G....................................T.............................G........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTA.
+H.sapiens_13.1/88383262-88383184     TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................C.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTA.
+H.sapiens_6.1/136299032-136298955    TTAGGC.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................................................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.................................................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CC....C.CCACCTAA
+H.sapiens_19.1/38544602-38544525     TTTGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................G.....................................C...........................T.............T................T....................................C............................G.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCT..
+H.sapiens_7.1/104212624-104212699    ....GT.....T.GG..T..G....C.A.A..A...A...G....T..........T........A.......T.........T...G.C...............G........................A...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................G.....................................C...........................G.............T................G....................................T............................A.........................G.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..G..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_5.1/18862138-18862066      ....GT.....T.GG..T..G....C.T.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................A...................T..................T.......................T....................T................................T...............................G....................................T.............................C........................................A..................................................C.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A..................GA.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........C...CA....T.CTAC....
+H.sapiens_20.1/37774282-37774352     TTGGAT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T................AAT.......................T....................T................................T...............................G....................................C........................................................................................................................................................................................................................................................................................................................................A............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................C.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCT..
+H.sapiens_17.1/65596860-65596926     TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................A...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................G...........................T.............T................T....................................T............................A.........................A.......................T......................................G............................................................................................................................................................................................................................................................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACC...
+H.sapiens_6.1/37770434-37770356      TTAGGT.....C.AG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................T...........................A.............T................G....................................C............................A.........................A.......................T......................................G...........................T...............................C........A...................A.............................A...........................A................................................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_8.1/7946507-7946585        .TAGGC.....T.GG..T..A....C.A.A..A...A...A....T..........A........A.......T.........T...G.C...............T........................A...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................T.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.AAACCTAA
+H.sapiens_1.1/242637446-242637514    ....................G....C.A.A..A...A...G....T..........A........A.......C.........T...G.C...............G........................G...................T..................G.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................G....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A................................................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....A.CAACCTAA
+H.sapiens_X.1/136584670-136584591    TTAGTT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................................................G....................................C.............................C........................................A..................................................T.........................C..............................................A.....................................C...........................T.............T................T....................................T............................A........................CA.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................A......................T...............G.................C................A..A..................T...T.A.....T....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_7.1/96169277-96169197      TTAGGT.....T.GA..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................G..................T.......................T....................T................................T...............................G....................................C.............................T........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A........................TA.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................T................A..A..................A...T.A.....C....T.T..T..T...........G...CA....C.CAGCCTAA
+H.sapiens_20.1/55035410-55035334     TTAGGG.....T.GG..T..G....C.A.A..A...A...G....C..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............G................T....................................C............................T.........................A.......................C......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACC...
+H.sapiens_1.1/58940108-58940022      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........G.......T.........T...G.C...............T........................T...................T..................T.......................T....................T................................T.............................TTT....................................T.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A......................AT......................................G...........................G...............................C........A...................A.............................A......................TTTTAA......................A.........................A......................G...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.AAACCTA.
+H.sapiens_7.1/135737563-135737641    TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........C.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................A........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A................................................C......................C...............A.................C................A..A..................C...T.A.....T....C.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_2.1/8028613-8028545        TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........G........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T........................................................................................................................................................................................................................................................................................................A.....................................C...........................C.............T................T...................................................................................................................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A..........T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_21.1/22973756-22973829     .TAGGT.....T.GA..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................................................G....................................T.............................C........................................A..................................................C.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAAC....
+H.sapiens_9.1/101475094-101475017    TTAGTT.....T.GG..T..A....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................A....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCT..
+H.sapiens_X.1/6437632-6437699        TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...A.T...............G........................G...................G..................T.......................T....................T................................C...............................G....................................C.............................C........................................A..................................................A.........................T..............................................A.....................................C...........................T.............T................T..........................................................................................................................................................G...........................G...............................T..............................................................................................................................................................................G.................C................A..A..................T.....A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_3.1/174693253-174693326    .TAGGT.....T.GA..T..G....C.A.A..A...A...A....T..........A........A.......T.........T.....................................................................................T.......................T....................T................................T...............................T....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................T...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................A...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_13.1/108288464-108288387   ..AGGC.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........C...A.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................C....................................T............................A.........................G.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................G.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_X.1/134620705-134620633    TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........G........A.......T.........T..................................................................................................................................T................................T...............................G....................................C.............................T........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................T................G..A..................T...C.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_17.1/13403574-13403646     TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................C..................T.......................T....................T................................T...............................G....................................C.............................A........................................A..................................................T.........................T..............................................A.....................................T...........................T.........................................................................................................................................................................................G...........................G...............................C........A...................A.............................A...........................A................................................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....T.CAACCTAA
+H.sapiens_2.1/19846337-19846267      ..AGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.A...............G........................A...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A....................................................................................................................................................................................................................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................T......................C...............T.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_2.1/51170432-51170511      TTAGGC.....T.AG..T..A....C.A.A..A...A...G....T..........A........A.......T.........G...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................A........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................C.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_8.1/139967180-139967082    TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................C...............................A....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................TTATTTAATTTAACCTGAGAGATTGTTTTA.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................T......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...TA..............
+H.sapiens_16.1/86639093-86639151     TTAGGT.....T.GA..T..G....C.A.A..A...C...C....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T....................................................................................................................................................................................................................................................................................................................................................................................................................................G.................C................A..T..................T...T.A.....C....G.T..T..T...........G...CA....C.CAA.....
+H.sapiens_9.1/46742299-46742222      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............A........................G...................T..................T.......................T....................T................................................................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.................................................T......................................G...........................A...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................T................A..A..................T...T.A.....C....C.T..T..T...........G...CA....C.CAAACTAA
+H.sapiens_8.1/72382788-72382709      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....C..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................A....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................G......................C...............T.................C................G..A..................C...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_13.1/106517268-106517187   TTAGTT.....T.GG..T..G....C.A.A..A...G...G....C..........A........A.......C.........T...G.C...............G........................G...................T..................T.......................T....................T................................T..............................TG....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A......................AT......................................A...........................G...............................C........C...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.G..T..T...........G...CA....C.CAACCTAA
+H.sapiens_10.1/31940286-31940360     TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................C....................T................................T...............................A....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................C..A..................T...T.A.....C....T.T..T..T...........G...CT....C.CAA.....
+H.sapiens_2.1/115629064-115628966    TTAGGT.....T.GG..T..T....C.A.C..A...A...G....T..........A........A.......T.........T...A.C...............A........................G...................T..................T.......................T....................T................................T...............................G.................TAACGGCAAATTACTTGTAT.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..G..T...........G...CA....C.CAACCTAA
+H.sapiens_17.1/63353454-63353530     TTAGGT.....T.GG..T..G....C.T.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................C..................T.......................T....................T................................................................G....................................C.............................A........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A................................................C......................C...............G.................C................A..A..................T...T.G.....C....T.T..T..T...............CA....C.CAATCTAA
+H.sapiens_3.1/101876312-101876231    TTGGGT.....T.GG..T..G....C.A.A..A...T...G....T..........A........A.......T.........T...G.T...............G........................A.................ATT..................T.......................T....................T................................T...............................T....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................T......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_6.1/147222821-147222751    TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........C...A.T...............G........................G...................T..................T.....................................................................................................................................................................................................................................................................................................................................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................T................G..A..................T...T.A.....C....T.T..T..T...........G...CA....T.CAACTTAA
+H.sapiens_8.1/121937526-121937447    TTAGGT.....T.GG..T..G....C.C.A..A...A...G....T..........A........A.......T.........T...A.C...............G........................A...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................C.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..G...........G...CA....C.CAGCCTAA
+H.sapiens_5.1/3913164-3913092        TTAGGT.....T.AG..T..G....A.A.A..A...C...A....C..........A........A.......C.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................C..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.....................................................................................................................................................................................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..C...........G...CA....C.CAACCTA.
+H.sapiens_3.1/197750756-197750681    TTAGGC.....T.GG..T..G....C.A.G..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................C...............................G....................................C......................................................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T.................................................................A.........................A.......................C......................................G...........................G...............................C........A...................A.............................A...........................A................................................C......................C...............A.................C................A..A..................T...T.A.....C....T.C..T..T...........C...CA....C.CAACCTA.
+H.sapiens_10.1/59575566-59575489     .TAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........C...A.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C......................................................................A..................................................T.........................T..............................................A.....................................C...........................C.............T................T....................................C............................A.........................A.......................T......................................G...........................A...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....T.CAGCCTAA
+H.sapiens_10.1/120312913-120312835   TTAGGT.....T.GA..T..G....C.A.A..A...G...G....T..........A........A.......T.........T...G.C...............G........................G...................G..................T.......................T....................T................................T...............................G....................................T.............................C........................................A..................................................T.........................T..............................................A.....................................G...........................T.............T................T..........................................................................................................................................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................T......................T...............G.................T................A..A..................TAATT.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_5.1/166290303-166290225    TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T....................................................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................G.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_11.1/3428118-3428051       TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C................................................................................................................................................................................................................................................................C........................................A..................................................T.........................C..............................................................................................................................T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................T................G..A..................T...T.A.....C....T.T..T..T...........G...TA....T.CAACCTAA
+H.sapiens_7.1/71595564-71595486      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....C..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................G...............................T....................................C.............................C........................................A..................................................T........................................................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_14.1/63143275-63143196     .TAGGT.....T.GG..T..G....C.A.G..A...A...G....T..........A........A.......T.........T...G.C...............T........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A......................AT......................................G...........................G...............................C........A...................A.............................A...........................A......................C.........................C......................C...............A.................C................A..A..................T...T.A.....T....A.T..C..T...........G...TA....C.CAACCTAA
+H.sapiens_8.1/51726349-51726414      TTAGGT.....T.CG..T..G....C.A.A..A.......G....T..........A........A.......T.........T...G.T...............G........................G...................C..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A...................................................................................................................................................................................................................................................................................................................................C.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTA.
+H.sapiens_10.1/59930276-59930395     TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............T........................A...................T..................T.......................T....................T................................T...............................G....................................C.............................CCACTATTAAAGTTTAATATTAATTAAATTTCATATATCCAA..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CATCCTAA
+H.sapiens_4.1/176670402-176670321    TTAGGT.....T.AA..T..G....C.A.A..A...A...G....T..........T........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C.........................CTT.............T................T....................................T............................T.........................T.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAATCTAA
+H.sapiens_2.1/13108636-13108715      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................T...................T..................T.......................T....................T................................T..............................TG....................................T.............................C........................................A..................................................T.........................T....................................................................................T...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAATGTAA
+H.sapiens_8.1/36515990-36515911      TTAGGT.....T.GG..T..G....C.A.A..A...A...A....T..........C........A.......T.........T...G.T...............G........................T...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................A......................................G...........................G...............................C........A...................A.............................G...........................A......................A.........................C......................C...............G.................C................A..A..................T...G.A.....C....T.T..T..T...........G...CA....T.CAACCTAA
+H.sapiens_4.1/172004049-172003971    .TAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................G..................T.......................T....................T................................T...............................G....................................T.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................A......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....G.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_17.1/51614882-51614960     TTAGTT.....T.GG..T..G....C.A.A..A...A...A....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................................................A....................................T.............................C........................................A..................................................T.........................T..............................................G.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_3.1/38064467-38064372      TTAGAT.....T.GA..T..G....C.A.A..A...A...G....T..........A........A.......TCACAGTTTTT...G.C........TATTGAAA........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................T........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................A...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................T................G..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAAACTAA
+H.sapiens_X.1/149435154-149435247    TTAGGA.....T.GG..T..G....C.A.A..A...A...G....T..........C........A.......T.........T...G.T...............G........................A...................T..................C.......................T....................T................................T...............................G....................................C.............................A........................................G..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................A............................A.........................A.........AAAAAAAAAAAAAAT......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_6.1/112590909-112590830    TTAGGT.....T.GG..T..G....C.A.A..A...C...G....T..........A........A.......C.........T...G.C...............A........................G...................C..................T.......................T....................T................................T...............................G....................................C.............................C........................................G..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................A...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_3.1/4821494-4821562        TTTGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........C...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................T........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A................................................C......................C...............A.................C................T..A..................T...T.A.....C....T.T..T..T...........G...C...............
+H.sapiens_1.1/194474471-194474416    TTAAGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_5.1/109197177-109197099    TTAAGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............A........................G...................C..................T.......................T....................T................................................................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................A...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...TA....C.CAACCTAA
+H.sapiens_7.1/118083993-118083934    TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.G...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................A..A..................T...T.A.....C....T.A..T..T...........G...CA....C.CAACCTAA
+H.sapiens_10.1/10057471-10057541     TTATGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C................................................................................................................................................................................................................................................................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................A...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....T....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_4.1/9169954-9170021        TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........T........A.......T.........T...G.C................................................................................................................................................................................................................................................................C........................................A..................................................T.........................T..............................................................................................................................T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................T................G..A..................T...T.A.....C....T.T..T..T...........G...TA....C.CAACCTAA
+H.sapiens_8.1/40243672-40243770      ..AGGT.....T.GG..T..G....C.A.A..A...A...G....C..........A........A..AGGAAT.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................A....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................T........A...................A.............................A...........................A...........TTGCGGTTTTTA.........................C......................C...............A..........TTACTTTC................A..A..................T.....G.....C....T.T..T..T...........G...CA....C.CAACCTA.
+H.sapiens_2.1/177723149-177723225    TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.G...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A............................................................................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTA.
+H.sapiens_5.1/54148689-54148766      TTATGT.....T.GG..T..G....C.C.A..A...A...G....T..........G........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................T...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................A...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..G...........G...CA....C.CAACCT..
+H.sapiens_1.1/103229254-103229326    .TAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......A.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................T.............................C........................................A..................................................C.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A.......................................................................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....T.CAAC....
+H.sapiens_6.1/133586397-133586470    ...........T.GG..T..G....C.A.A..A...A...A....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................T........................................G..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................G.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.G.....T....T.T..T..T...........G...CA....C.AAACCTAA
+H.sapiens_11.1/32135553-32135678     TTAGGT.....T.GG..T..G....C.G.T..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................TGCTTTTAATTCACATGGAAGCTGGGCTCATCAGCTCATCATACATTA.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................G......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_13.1/21187976-21187915     ...GGT.....T.GG..T..G....C.A.A..A...A...G....C..........A........A.......T.........T...G.C...............A.....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................T................T....................................C............................A.........................A.......................T......................................G...........................G...............................G........A...................A.............................A...........................A......................A.........................T......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_8.1/12038264-12038197      TTGGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...T..............................................................................................................................................................................................................................................................................................................................................................T.........................C..............................................A.....................................G...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................T................G..A..................T...T.A.....C....T.T..T..T...........G...TA....C.CAACCTAA
+H.sapiens_4.1/78886479-78886539      ..AGGT.....T.GG..T..A....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............T........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A....................................................................................................................................................................................................................................................................................................................................................A.............................A...........................A......................A.........................C......................A...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...TA....C.CAA.....
+H.sapiens_6.1/56002911-56002844      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................A...................T..................T.......................T....................T................................T...............................G....................................A.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.T.....C....C.T..T..T...............................
+H.sapiens_3.1/189745381-189745467    .TAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................A....................................C.............................C........................................T..................................................T.........................T..............................................T.....................................T...........................T.............T................T....................................T..................TTTTTTAAGCA.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCT..
+H.sapiens_14.1/29896119-29896195     TTAGGT.....T.GA..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............C................T....................................C............................A.........................G.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............T.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACC...
+H.sapiens_2.1/148224279-148224200    TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................T........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................G........A...................A.............................A...........................A......................A.........................G......................C...............G.................C................A..A..................T...G.A.....C....T.T..T..T...........G...CA....C.CAACCCAA
+H.sapiens_15.1/61110381-61110460     TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........T........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................T........................................A..................................................T.........................T..............................................A.....................................C...........................C.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...TG....C.CAACCTAA
+H.sapiens_5.1/19446772-19446835      .................T..G....C.A.A..A...A...G....T..........A........A.......T.........T...T.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................G.....................................C...........................T.............T................T....................................T.................................................................................................................................................G...............................C........A..............................................................................................................................C......................C...............A.................C..............CTA..A..................T...T.A.....T....T.T..T..T...........G...CA....C.CA.CCTAA
+H.sapiens_3.1/53365959-53366028      ...GGT.....T.GG..T..G....C.A.A..A...A........T..........A........T.......T.........T...G.T...............G........................T...................T..................T.......................C....................T................................T...............................G....................................A.............................C........................................A..................................................T.........................T..............................................A.....................................A...........................T.............T.......................................................................................................................................................................................................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_6.1/149554886-149554960    .....T.....T.GG..T..G....C.A.A..A...A...G....T..........G........A.......T.........T...G.T...............T........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................A........................................A..................................................C.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................G...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..C..T...........G...CA....C.CAACCTAA
+H.sapiens_16.1/19689499-19689435     TTAGGT.....T.GG..T..G....T.A.G..A...A...G....T..........A........A.......T.........T...........................................................................................................................................................................................................................................................................................................................................................................................................................................A.....................................T...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................C.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAATCTAA
+H.sapiens_8.1/15379468-15379395      .....T.....T.GC..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................T........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T.................................................................A.........................A.......................T......................................T...........................G...............................C........A...................G.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...A.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_5.1/176701407-176701483    TTATGT.....T.GT..T..G....C.T.A..A...A...A....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................................................A....................................T.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A............................................................................C......................C...............T.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_17.1/51948186-51948107     .TAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.A...............A........................G...................G..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T...........................TA.........................A.......................T......................................G...........................G...............................T........A...................A.............................A...........................G......................A.........................C......................A...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........T...CA....C.CAACCCAA
+H.sapiens_4.1/129325867-129325947    TTAAGT.....G.GG..T..G....C.A.A..A...C...A....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................T........................................A..................................................G.........................T..............................................A.....................................C...........................T.............T................T....................................T...........................TA.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....A.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_NC.49/74886-74808          TTAGGG.....T.GG..T..A....C.A.A..A...A..AG....T..........A........A.......T.........T...G.C...............G........................G...................G..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................C......................C.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.C..T..T...........G...CA....C.CAACCT..
+H.sapiens_1.1/204622312-204622234    TTAGGC.....T.AG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................T........................................G..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................T......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CA.TCTAA
+H.sapiens_20.1/38188414-38188335     TTAGGT.....T.GG..T..G....C.A.A..A...T...G....T..........A........G.......T.........T...G.T...............G........................G...................C..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.G.....T....G.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_2.1/165484586-165484523    TTAGGC.....T.GG..T..G....C.A.A..A...A...G....T..........A........C.......T.........T...G.T...............G........................G...................T...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................A.........................A.......................T......................................T...........................G...............................A........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_3.1/4493184-4493106        .TAAGT.....T.GG..T..A....C.A.A..A...A...G....T..........A........A.......T.........T...A.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................T.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................G......................A.........................C......................C...............G.................C................G..A..................T...T.A.....C....T.T..T..T...........G...CA....G.CAACCTAA
+H.sapiens_2.1/213291075-213290996    TTAGGT.....T.GG..T..G....C.G.A..A...C...A....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................A....................................T.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................T................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_8.1/120259931-120259856    .TAGGT.....T.GG..T..G....C.A.A..A...A...G....G..........A........A.......T.........T...G.C...............A........................G...................C..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................A.............T................T....................................C............................A.........................A.......................T......................................A...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...AA....C.CAACC...
+H.sapiens_X.1/121002722-121002800    TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........C........G.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................A........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACATA.
+H.sapiens_10.1/13888230-13888295     TTAGGT.....T.GG..T..G....C.C.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G............................................................................................................................................................................................................................................................C................A..A..................T...T.A.....C....T.T..T..C...........G...CA....C.CAAC....
+H.sapiens_18.1/64024969-64025049     .TAGGT.....T.GG..T..G....A.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................A........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T..............AAA....................................A............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....T.AAACGTAA
+H.sapiens_10.1/14482909-14482844     TTAGGT.....T.GG..T..G....C.A.A..A...G...G....T.........................................................................................................................................................................................................................................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................C.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................G.........................T......................C...............G.................C................A..A..................T...T.A.....C....C.T..T..T...........G...CA....T.CAACCTA.
+H.sapiens_3.1/133915829-133915925    TTAGAT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C........AAATTGCA........................G...................T..................T.......................T....................T................................T...............................G....................................T.............................C........................................A..................................................T.........................T..............................................G.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G............CTATTGCTTTTAATGA...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T...................G...CA....C.CAACCT..
+H.sapiens_20.1/41663327-41663252     TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................T........................................G..................................................T.........................T................................................................................................................T.............T................T...........................................................................................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAGCCTAA
+H.sapiens_20.1/12766828-12766762     TTAGGT.....T.GG..T..G....................................................................T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................T...........................A...............................C........A...................A.............................A...........................A................................................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CC....C.CAACCTAA
+H.sapiens_8.1/112498156-112498234    TTAGGT.....T.GG..T..G....C.A.AGAA...A...A....T..........G........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T..............................TG....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................C.............T................T..........................................................................................................................................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................A...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAATGTAA
+H.sapiens_21.1/14719716-14719638     TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................C..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.................................................T......................................G...........................A...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................T................A..A..................T...T.A.....C....C.T..T..T...........G...CA....C.CAAACTAA
+H.sapiens_15.1/53610103-53610161     TTAGGT.....T.GC..T..G....C.A.A..A...G...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................G...............................G....................................C.............................T........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T..................................................................................................................................................................................................................................................................................................................................................................................................................................................................T.A.....C....T.T..T..T...........G...CA....C.CAACTT..
+H.sapiens_10.1/117898738-117898685   TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................G...T.A.....C....T.T..T..T...........G...CA....C.CATCCTA.
+H.sapiens_X.1/98454339-98454418      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....C..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................A.............A................T....................................C............................A.........................A.......................T......................................G...........................A...............................T........A...................A.............................A...........................A......................A.........................C......................C...............A.................T................A..A..................T...T.A.....C....T.T..T..T...........G...CA....G.CAACCTAA
+H.sapiens_9.1/32764378-32764299      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................A...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................G..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_12.1/10267456-10267542     ....GC.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A..........TCCTATATACTTTCAA.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.................T..T...........G...CA....C.CAACCTAA
+H.sapiens_6.1/69203333-69203409      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............T........................A...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................A...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....T.CCACC...
+H.sapiens_7.1/110288509-110288611    TTAGGT.....T.GG..T..A....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................C..................T.......................T....................T................................................................G....................................C.............................A........................................A..................................................T.........................T..............................................A........................AAAGTAATTGCAGC...........................T.............T................T.........................GCAATTAAAAGT............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................T......................C...............T.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAAACTAA
+H.sapiens_4.1/189625704-189625625    TTAGGT.....T.GG..T..G....C.A.A..A...G...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................................................G....................................T.............................C........................................A..................................................G.........................T..............................................A.....................................C...........................T.............T................C....................................T............................A.........................A......................AT......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................C...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_12.1/277674-277732         ..AGGT.....T.GG..T..G....C.T.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C.................................................................................................................................................G...............................C........A...................C.............................A...........................A......................A.........................C......................C...............T.................T................A..A..................T.....A.....C....T.T.....................................
+H.sapiens_21.1/45866831-45866894     TTAGGT.....T.GG..T..G....C.A.A..A...A...A....T..........A........A.......T.........T...G.C.......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................T.............T................C....................................T............................A.........................A.......................T......................................T...........................G...............................C........A...................A.............................A...........................C......................A.........................C......................C...............G.................C................A..G..................T...T.A.....C....TCT..T..T...........T...CA....C.CAACTT..
+H.sapiens_X.1/71012024-71012090      ....GT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................T.............................C........................................G..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................A...........................G...............................C........A...................A.............................A...........................A......................A.........................C................................................................................................................T.T..C..T...........G...CA....C.CAACCCAA
+H.sapiens_15.1/50893962-50894040     TTAGGT.....T.GA..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................A........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.TAGCCTA.
+H.sapiens_4.1/128419287-128419192    .TAGAT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................T...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T......TTAAAAAATTAAAAATTAAAAAA.........................A.......................G......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.C..T..T...........G...CA....A.CAA.....
+H.sapiens_14.1/102137305-102137368   TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............T.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_17.1/71311939-71312019     TTAGGT.....A.GA..T..G....C.A.A..A...A...G....T..........T........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T.........TTG...CA....C.CAACATA.
+H.sapiens_20.1/5875896-5875826       TTAGGT.....T.GG..T..G....C.A.A..A...A...C....C..........A........A.......T.........T...G.C................................................................................................................................................................................................................................................................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................C...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.G.....G....T.T..T..T...........G...CG....C.CAACCTAA
+H.sapiens_9.1/126347736-126347665    TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A................................C...............A........................T...................T..................C.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T..........................................................................................................................................................G...........................G...............................T........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.TAACCTAA
+H.sapiens_2.1/117850350-117850430    TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........C...A.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................T........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A........................AC......................C...............G.................T................G..A..................T...A.A.....T....T.T..T..T...........G...CA....C.CAACTCAA
+H.sapiens_1.1/175956513-175956575    ..AGGT.....T.GG..T..A....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................G..................T.......................T....................T................................T...............................G....................................T.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T..............................................................................................................................................................................................................................................................................................................................................T.A.....C....T.T..T..T...........G...CA....C.CAGCCTAA
+H.sapiens_19.1/11334803-11334869     TTAAAT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................................................G....................................C.............................A........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................T................A..A..................T...T.A.....C....T.T..T..T...............................
+H.sapiens_20.1/21244871-21244795     TTAGGT.....T.GG..A..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................................................................................................T................T....................................T............................A.........................T.......................T......................................G...........................C...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........A...CA....T.TAACCTAA
+H.sapiens_9.1/109847472-109847361    ....GT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................A...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................AAAAGTGGCAAAATTACTTTTTGCCAGTGCAGTAATTAC...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................T......................C...............A.................C................T..A..................T...T.A.....C....T.T..T..T...........G...TA....C.CAACCCA.
+H.sapiens_2.1/194855781-194855861    TTAGTT.....T.GG..T..G....C.A.A..A...A...G....T..........C........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A........................AC......................A...............G.................C................A..A..................T...G.A.....C....T.T..T..T...........G...CA....C.CAAACTAA
+H.sapiens_X.1/42116085-42116157      TTAGGT.....T.GC..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A.................................................................................................................................................................................................................................................................A............................A.........................A.......................T......................................G...........................G...............................C........A...................G.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.G.....C....T.T..T..T...........G...AA....G.CAACCTAA
+H.sapiens_1.1/245220579-245220649    .TAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C..........................................................................................................................................................................................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................C.........................C......................C...............A.................C................A..A..................T...T.................T..T...........G...CA....C.GAGCCTAA
+H.sapiens_2.1/180339058-180339122    ...GGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.A...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................T......................T...............A.................C..........................................T.A.....T....C.T..T..T...........A...CA..............
+H.sapiens_6.1/113226309-113226246    TTAGAT.....T.GG..C..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................................................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................................................................................................................................................................................................................................................................................................................................................................................................................A.........................C......................A...............G.................C................A..A..................C...T.A.....C....T.T..T..T...........G...CA....C.CAATTTAA
+H.sapiens_11.1/71587679-71587601     .TAGGC.....T.GG..T..G....T.A.A..A...T...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................T......................C...............G.................C................A..A..................T...T.A.....T....G.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_14.1/37289002-37289101     .....T.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........C...G.T...............G........................G...................T..................T.......................T....................T................................G...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G......TGCCTAACACCCAATCTTTTAATGGC........C...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..C..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_3.1/77975857-77975936      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....G..........T........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...A.C.....C....T.T..T..T...........G...CA....C.CAGCCTAA
+H.sapiens_5.1/164716164-164716216    TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................C......................................G...........................G...............................C........A...................C.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.G.....T....T.T..T..T...........G...CA....C.CAACTT..
+H.sapiens_9.1/120012883-120012962    TTAGGT.....T.GG..T..A....C.A.A..A...A...G....T..........A........A.......T.........C...A.T...............G........................G...................C..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................G..............................................A.....................................C...........................T.............T................T.................................................................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A........................AC......................A...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_12.1/5709840-5709903       ........................................................A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................A........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T...........................TA.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T.AA...........G...CA....G.CAACCTAA
+H.sapiens_17.1/2978366-2978434       TTAGGT.....T.G...................................................A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................G.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...C.A.....C....A.T..T..T...........G...CC....C.CAACCTAA
+H.sapiens_8.1/25003980-25003900      TTAGGT.....T.GG..T..G....C.A.A..A...A...A....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C..............TG.................C................G..A..................T...T.A.....C....T.T..T..T...........C...CA....T.CAACCTAA
+H.sapiens_14.1/39009284-39009358     TTAGGT.....T.GA..T..A....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................C....................................C.............................C........................................A..................................................T.........................T..............................................T.....................................C...........................T.............T................T.................................................................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...................................................................................................................G.................C................A..A..................T...T.A.....C....A.T..T..T...........G...TA....C.CAACCTAA
+H.sapiens_4.1/25213610-25213663      .TAGGT.....T.GG..T..G....T.A.A..A...A...G....T..........A........A.......C.........T...G.A...............G........................G...................C..................T.......................T....................T................................T...............................G....................................C............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_4.1/18799421-18799496      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................C..................T.......................T....................T................................T...............................G....................................T.............................C........................................A..................................................C.........................T..............................................A.....................................................................................................................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................A...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_1.1/23596786-23596700      .TAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...T.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................C..........................................CTCCCCCTT.........................T..............................................A.....................................T...........................T.............T................T....................................T............................A.........................A.......................T......................................T...........................G...............................C........A...................G.............................A...........................A......................A.........................T......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_6.1/104956076-104956156    TTAGGG.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................T........................................A..................................................T.........................T..............................................C.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................A...........................G...............................T........G...................A.............................A...........................A......................A.........................C......................C..............CG.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_7.1/19686900-19686976      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........T.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............C................G....................................C............................A....................................................................................................................G...............................A........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_8.1/68965658-68965595      TTAGGT.....T.GG..T..G....G.A.G..A...A...G....T..........A........A.......T.........T...G.C.......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................T.............T................T....................................C............................A.........................A.......................T......................................G...........................T...............................C............................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...A.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_4.1/4086165-4086087        .TAGGC.....T.GG..T..A....C.A.A..A...A...A....T..........A........A.......T.........T...G.C...............T........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................G..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................T.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_11.1/78322095-78322174     TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................A...............................A....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............C................T....................................T............................A.........................A.......................C......................................A...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................A...............G.................C................A..G..................T...T.A.....C....T.T..T..T...........G...CA....T.CAACCTAA
+H.sapiens_6.1/6507148-6507069        TTAGGT.....T.GA..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................................................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............G................T....................................C............................A.........................A.......................T......................................A...........................G...............................C........A...................A.............................A...........................A......................A........................AC......................A...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAATCTAA
+H.sapiens_1.1/113494968-113494886    ..AGGT.....T.GG..T..G....C.A.A..A...T...G....T..........C........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A........................TTGAAA...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....T....G.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_1.1/241404677-241404602    ....GT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................T.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................C.........................A.......................T......................................T...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....A.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_4.1/101051187-101051108    TTAGGC.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................T.............................T........................................G..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAAGTTAA
+H.sapiens_2.1/78644185-78644112      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......C.........T...G..........................................G...................T..................T.......................T....................T.....................................................................................................G.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................A...........................G...............................C........A...................A.............................A...........................A......................C.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..C..T...........G...CA....C.CAACCT..
+H.sapiens_10.1/118383099-118383022   .TAGGT.....T.GG..T..G....C.A.A..A...A........T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................T........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..G..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_12.1/91518510-91518608     TTGGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................T...................T..................T.......................T....................T................................T...............................G....................................T.............................C........................................A..................................................T.........................T..............................................T.....................................C........AATGGAGGTTTTTTTGTCGT.............T................T....................................C............................A.........................A.......................T......................................G...........................A...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....T.CAACCCAA
+H.sapiens_2.1/77268987-77268908      TTAGGT.....C.AG..T..G....C.A.A..A...A...G....T..........C........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................A......................................A...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...G.A.....T....T.T..T..T...........G...CA....C.CGACCTAA
+H.sapiens_8.1/99722206-99722120      TTAGGC.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...T.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T.............................AAAAAAAA............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................G..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_5.1/68186046-68185968      TTAGAT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................T........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A................................................C......................T...............G.................T................A..A..................T...T.A.....C....T.T..T..T...........G...CA....T.CAACCTAA
+H.sapiens_1.1/26983185-26983108      TTAGGT.....T.GG..T..G....C.A.A..A...A...A....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................C.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...C.G.....C....T.T..T..T...........G...CA....C.CAACCT..
+H.sapiens_1.1/168537191-168537107    .TAGGT.....T.GT..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A...........................................CTGGTAAT.........................T..............................................A.....................................A...........................T.............T................C....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....G.T..T..T...........G...CA....T.CAACCTA.
+H.sapiens_10.1/3888274-3888339       .TAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................C...............................A....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................A........G...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..................................
+H.sapiens_11.1/106009729-106009802   TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................C..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................G.....................................T...........................T.............T................T......................................................................................................................................................................................................................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.G.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_4.1/34906820-34906888      ..AGGT.....T.GC..T..G....C.A.G..A...A...G....T..........A........A.......T.........T...G.T...............G........................T...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................G.......................T......................................G...........................A...............................C........A...................A..........................................................................................................................................................................................................T...T.A.....C....T.T..T..T...........G...AA....C.CAACCTAA
+H.sapiens_8.1/105496681-105496602    TTAGGT.....C.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................A...................G..................T.......................T....................T................................T...............................A....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................C.........................T......................G...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACGTAA
+H.sapiens_1.1/81508747-81508668      TTGGGT.....T.GG..T..G....C.A.A..A...A...A....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................G...............................G....................................C.............................A........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A......................AT......................................G...........................G...............................C........A...................A.............................A...........................A................................................C......................T...............G.................C................A..G..................T...T.A.....C....T.T..T..T...........A...CA....C.CAACCTAA
+H.sapiens_X.1/78413612-78413530      TTAGTT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................C.....................................C...........................C.............T.............ATAT....................................T............................A.........................A.......................C......................................T...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....T.CAAACTAA
+H.sapiens_2.1/209957275-209957351    ..AGGT.....G.TG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C..............CG........................G...................T..................T.......................T.....................................................................................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....C.T..T..T...........G...CC....C.TGACCTAA
+H.sapiens_X.1/55277736-55277842      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........G........A.......T.........T...G.C...............T........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................G..............................................A.....................................C...........................G.............T................T....................................T.TGCCATTAAGGCTTTTGTTTGCCATTAA.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................A...............G.................C................A..A..................T...T.G.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_18.1/62552228-62552164     TTACAT.....T.GG..T..G....C.A.A..A...A...G....T..........G........A.......T.........T...........................................................................................................................................................................................................................................................................................................................................................................................................................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....A.CAACCTAA
+H.sapiens_12.1/68094346-68094238     TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................T.............................C........................................A..................................................T.........................T..............................................A.................AAGTAATGTGTGCAGGAAAAC...........................T....GCACATTACT................T....................................T............................A.........................A.......................T......................................G...........................G...............................T........A...................A.............................A...........................T......................G.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...GA....C.CAACCTAA
+H.sapiens_17.1/40551104-40551033     TTAGGT.....T.GT..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................G..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T..........................................................................................................................................................G...........................A...............................C........A...................A.............................A...........................A......................A.........................C......................G...............A.................C................A..A..................T...T.A.....C....C.T..T..T...........G...CA....C.GAAC....
+H.sapiens_13.1/74885117-74885193     ...GGT.....T.GG..T..G....T.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................A...........................T.............T................T....................................T............................A.........................A.......................T......................................T...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................T................G..G..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_7.1/39724692-39724614      TTAGGT.....T.GG..C..G....C.C.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................G...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A................................................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACTTAA
+H.sapiens_17.1/68403991-68404056     .............................A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................A........................................A..................................................T........................................................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................T...........................G...............................C........A...................A.............................A...........................A......................A.........................A......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...AA....C.CAACCTAA
+H.sapiens_8.1/4238642-4238588        TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................G...........................G...............................C........T...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...AA....C.CAACCTAA
+H.sapiens_8.1/37487215-37487147      TTAGGT.....T.GG..C..A....C.A.A..A...T...G....T..........C........A.......T.........T...G.A...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T...........................................................................................A.......................T......................................G...........................................................C........A...................A.............................A............................................................................................................................................................................T...T.A.....C....A.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_4.1/127232307-127232244    ........................................................A........A.......C.........T...G.C...............A........................G...................T..................T.....................ACT....................T................................T...............................G....................................G.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............T.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_2.1/216143949-216143870    TTATGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................G................................T...............................G....................................C.............................C........................................A..................................................T.........................A..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................G......................................G...........................T...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....G.CAACCTAA
+H.sapiens_9.1/28332263-28332334      TTAGGT.....T.GA..T..G....T.C.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................C.......................T....................T................................................................G....................................C.............................C........................................G..................................................T.........................C..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.................................................................................................................................................................................................................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....T.CAACCTAA
+H.sapiens_12.1/127880334-127880401   TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...................................................................................................................................................................T...............................G....................................C.............................A........................................A..................................................T.........................T..............................................A.....................................C...........................C.............T................G....................................T............................A.........................A.......................T......................................A...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CCAC....
+H.sapiens_22.1/33306690-33306616     ....GT.....T.GG..T..G....C.A.A..A...C...A....T..........A........A.......T.........T...G.T...............G........................A...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................G.........................C......................................G.................C................A..A..................T...T.A.....C....G.T..T..T...........G...CA....C.CAACCGAA
+H.sapiens_2.1/38390896-38390819      ..AGGT.....T.TG..T..G....C.A.A..A...T...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................A...............................C........A...................A.............................A...........................A......................A.........................C......................A...............G.................C................A..A..................T...T.G.....C....A.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_7.1/4662512-4662437        TTAGGT.....T.GG..T..A....C.A.G..A...A...G....T.........................................G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................A....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................T..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_5.1/173197377-173197296    TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........G...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T.........................TAAA.........................A.......................T......................................G...........................G...............................C........T...................A.............................A...........................A......................A.........................C......................C...............G.................C................C..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CGTCCTA.
+H.sapiens_2.1/17446628-17446574      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................T.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................A...............G.................C................A..A..................T...T.A.....C....C.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_8.1/34267045-34267118      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................................................A....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A................................................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G....A....C.CAACC...
+H.sapiens_4.1/42562918-42562837      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................A........................................A..................................................T.........................T..............................................G.....................................T...........................T.............T................T....................................T...........................TA.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................T......................C...............T.................C................A..A.................AT...T.A.....C....T.T..T..T...........G...CA....C.CAATCTAA
+H.sapiens_18.1/66188212-66188293     TTAGTT.....T.GG..T..G....C.A.A..C...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................C.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G.........................CGG...............................G........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...A.A.....C....T.A..T..T...........G...CA....C.CAACCTAA
+H.sapiens_X.1/97378609-97378551      TTAGGT.....T.GG..G..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C................................................................................................................................................................................................................................................................C........................................A..................................................T.........................T..............................................A....................................................................................................................................................................................................................................................................................................................................................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_8.1/8603107-8603048        TTAGGT.....T.GG..T..G....C.A.A..T...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................C...............................A....................................C.............................A........................................A..................................................T.........................T...............................................................................................................................................T....................................T............................A.........................A.......................T......................................G...........................A...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C............................................
+H.sapiens_4.1/108839427-108839506    TTAAGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................G.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................T...........................T...............................C........A...................A.............................A...........................A......................A.........................A......................C...............A.................C................G..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAATCTAA
+H.sapiens_1.1/45697973-45697896      TTAGTT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G....................................................................A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CT....C.CAATCTAA
+H.sapiens_22.1/30340283-30340204     TTAGAT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...A.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................C..............................................A.....................................T...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAATCTAA
+H.sapiens_18.1/65215489-65215423     ...........................A.A..A...A...G....T..........A........A.......T.........T...G.A...............G........................G...................T..................T.......................T....................T................................T...............................G....................................A.............................T........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................T........A...................A.............................A...........................A................................................T......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_16.1/26216053-26215995     .TAAGT.....T.GG..T..G....C.A.A.........................................................................................................................................................................................................................T...............................G....................................C.............................C..........................................................................................................................................................................................................C...........................T.............T................T....................................A............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................G................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.TAACCTAA
+H.sapiens_2.1/157871767-157871689    TTAGCT.....T.GG..T..G....C.A.A..A...A...G....T..........G........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................A..............................................A.....................................C...........................T.............T................T....................................C............................A.........................G.......................T......................................A...........................G...............................C........A...................A.............................A...........................A................................................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAGCCCAA
+H.sapiens_8.1/95360454-95360571      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................G....................T................................T...............................ATTCTTCAAAAGAATTGTTATTCTTCAAAAAGAATAAC.............................A........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.....................AAT......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_2.1/72693874-72693938      .TAAGT.....T.GG.AT..G....C.A.A..A...A...G....A..........A........A.......C.........T...G.C.......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_3.1/149165262-149165186    TTAGGT.....T.GG..C..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................T...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................G.....................................C...........................T.............T................T..........................................................................................................................................................G...........................G...............................C........A...................A.............................A...........................A......................A........................AA......................C...............G.................C................A..A..................T...T.A.....C....C.T..T..T...........G...CT....C.CAACCTAA
+H.sapiens_12.1/27695349-27695424     ..AGAT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................G....................................C............................A.........................A.......................T......................................G...........................C...............................C........A...................A.............................A...........................A................................................C......................A...............G.................C................A..A..................T...T.A.....A....T.T..T..T...........G...CG....C.CCACCTA.
+H.sapiens_4.1/156287676-156287599    .TATGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................G...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................A...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...C.A..........T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_13.1/36068572-36068650     TTAGGT.....T.GG..T..G....C.A.A..A...A...G...............A........A.......T.........C...G.T...............G........................G...................T..................T.......................T....................T................................T...............................C....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................C.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....T.CAACCTAA
+H.sapiens_2.1/181481849-181481921    ...GGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................A................A..A..................T...T.A.....C....T.T..T..T...........G...CG....C.CAAC....
+H.sapiens_2.1/89066926-89066844      TTAGAT.....T.GG..T..G....C.A.A..A...A...G....C..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................C.....................................C...........................T.............T................G....................................T............................A.........................A.......................T...................................TGTG...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.G.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_3.1/87274282-87274227      TTAGGT.....T.GG..T..A....C.A.A..A...A...G....T..........A........A.......T.........T...G...............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................G...............................C........G...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..G..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_2.1/107766190-107766115    TTAGAT.....T.AG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................T........................................A..................................................T.........................T...............................................................................................................................................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................G.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAATCTAA
+H.sapiens_16.1/87051050-87051111     TTAGGT.......GA..T..G....C.A.A..A...A...G....T..........C........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................A...........................C.............T................G....................................C............................A.........................G.......................T......................................G...........................G...............................C.............................................................................................................................................................................................................................................................T..T...........G...TA....C.CAACCTAA
+H.sapiens_1.1/79065250-79065168      .TAGCT.....T.GG..T..G....C.A.A..A...C...A....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................C................................C...............................G....................................C.............................A........................................A..................................................T.........................T..............................................A.....................................T...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C..........AAACCG.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTA.
+H.sapiens_8.1/63346203-63346280      .TAGGT.....T.GA..T..G....C.A.A..G...A...G....T..........A........A.......T.........T...G.A...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................G..................................................T.........................T..............................................G.....................................C...........................T.............T................T....................................T............................A.........................A.......................C......................................A...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....A....T.T..T..............G...CA....C.CAACCTAA
+H.sapiens_6.1/129102991-129103071    TTAGAT.....T.GG..T..A....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................T.............................C........................................A..................................................T.........................T..............................................A.....................................G...........................G.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................G.............................A...........................A......................A.........................C......................C...............G.................T................A..A..................T...T.A.....T....T.T..T..T..........TG...CA....C.CAACCTAA
+H.sapiens_8.1/114202364-114202288    ...GGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................T...................T..................T.......................T....................T................................T...............................G....................................C.............................T........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................T...............................C........A...................G.............................A...........................A......................A.........................G......................T...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_13.1/40187139-40187199     TTAGGT.....T.GG..T..G....C.A.A..A...A...G....C..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................C......................................G...........................G...............................C........A...................G.............................A...........................A.....................TA.........................C......................C...............A.................T................A..A...........................................................................
+H.sapiens_1.1/56989207-56989109      TTAGGT.....T.GG..T..G....C.A.A..G...A...G....T..........A........A.......T.........T...G.A...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................G..................................................T.........................T..............................................A.....................................C......AAAAACCCCTGGACTACATTAC.............T................T....................................A............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C......................................T...T.A.....C....T.C..T..T...........G...CA....C.CACCCTAA
+H.sapiens_10.1/12172751-12172823     TTAGGT.....T.GC..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T.....................................................................................................C.............................A........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................C....................................T.................................................................................................................................................................................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..G..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_4.1/41626528-41626600      TTAGGG.....C.GG..T..G....C.A.C..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................................................G....................................C.............................C........................................A..................................................T.........................T..............................................................................................................................T................T....................................T............................A.........................A.......................A......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..G..T...........G...CA....C.CGACC...
+H.sapiens_9.1/20988479-20988552      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................................................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................A...........................T.............T...........................................................................................................................................................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_3.1/178959652-178959571    TTAGGC.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...C.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................T........................................G..................................................T.........................T..............................................A....................................AC...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C.......GA...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....T....T.T..T..T...........G...CA....T.CAACCTAA
+H.sapiens_2.1/18400964-18400900      TCAGGT.....T.GG..A..G....C.A.A..A...T...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................A...................AAAT...............G.................C................A..A..................T...T.A.....C....A.T..T..T...........G...CA....C.CAACC...
+H.sapiens_15.1/87847042-87846967     .....T.....T.GG..T..G....C.A.A..A...A...A....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................T...........................T.............T................T....................................T............................A.........................A......................AT......................................A...........................A...............................C........A...................A.............................A...........................A......................A.........................C......................C...............T.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAGCCTAA
+H.sapiens_X.1/105104682-105104752    TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C................................................................................................................................................................................................................................................................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................T.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_20.1/3487657-3487750       .TAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......A.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................G...................................GGAGGTTTTGTTTTTT.........................T..............................................T.....................................T...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_17.1/15773546-15773609     TTAGGT.....T.GG..T..G....T.A.A..A.......G....T..........A........A.......T.........T...G.C...............G........................T...................T..................T.......................T....................T................................T...............................C....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................................................................................................................................................................................................................................................................................................................................................................................................................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_10.1/66624224-66624303     TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........C...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................C......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................A................A..A..................T...T.A.....C....T.T..T..T...........G...CA....A.CAACCTAA
+H.sapiens_6.1/128877634-128877709    ..AGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.G...............G........................G...................T..................T.......................T....................T................................................................G....................................T.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....G.CAACCTA.
+H.sapiens_5.1/143750534-143750458    .TAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.............G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T.................................................................A.........................A.......................T......................................G...........................G...............................T........A...................A.............................A...........................A......................A.........................C......................G...............G.................C................A..A..................T...A.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_18.1/71487277-71487356     TTAGGC.....T.GG..T..G....T.A.A..A...A...G....T..........A........A.......C.........T...G.C...............A........................G...................T..................T.......................T....................T................................C...............................A....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..T..................T...T.A.....C....G.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_6.1/69716237-69716306      TTAGGT.....T.GA..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T..........................................................................................................................................................................................................................................................................................................................................................................................................................................A.........................A.......................T......................................G...........................G...............................A........A...................A.............................A...........................A......................A......................AACC......................C...............G.................C................A..T..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTA.
+H.sapiens_12.1/34180292-34180214     TTAGGT.....T.GG..T..A....A.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................................................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.TAACCTAA
+H.sapiens_8.1/132713950-132713883    TTAAGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................................................G....................................C.............................C........................................A..................................................T.........................T..............................................A....................................................................................................................................................................................................................T......................................A...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...G.A.....C....T.T..T..T...........G...CT....C.CAAC....
+H.sapiens_X.1/148393765-148393844    TTAGGT.....A.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................A........................................A..................................................A.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_8.1/107811978-107811899    TTAGGT.....T.GT..T..G....C.A.A..A...A...A....T..........A........A.......T.........T...G.T...............G........................T...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................T.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................C...T.C.....C....T.T..T..T...........G...CA....A.CAACCTAA
+H.sapiens_15.1/54101900-54101975     ..AGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................................................A....................................C.............................C........................................A..................................................G.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A................................................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...TA....C.CAACCTAA
+H.sapiens_9.1/110474739-110474665    TTAGAT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......G.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................C.....................................A...........................T.............T................T..........................................................................................................................................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAATTTA.
+H.sapiens_11.1/56958293-56958215     TTAGAT.....T.GA..C..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.G...............G........................A...................T..................T.......................T....................T................................T...............................G....................................C.............................T........................................A..................................................T.........................C..............................................A.....................................T...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTA.
+H.sapiens_11.1/46929892-46929971     TTAGTT.....T.GA..T..G....C.A.A..A...A...G....C..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................A...............................C........A...................A.............................A...........................A......................A.........................T......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CG....C.CAACCTAA
+H.sapiens_6.1/48782389-48782325      TTAAGT.....T.GG..T..G....C.A.A..A...G...G....T..........A........A.......T.........T...................................................................................................................................................................T...............................G....................................C..................................................................................................................................................................................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CGACC...
+H.sapiens_18.1/32433110-32433199     .TAGGT.....C.GG..T..G....C.A.A..A...T...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A...........................TTTTTAATTAC...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A........................AA......................C...............G.................C................A..A..................T...T.A.....C....G.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_4.1/31636737-31636631      TTAGGT.....T.GG..T..A....C.A.A..A...A...G....G..........A........A.......T.........T...G.C...............A........................A...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................CGTAATGGCAAAAAGTAACTGCCATTACT.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................C.........................C......................C...............A.................C................A..A..................T...C.C.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_8.1/21407515-21407593      TTAGGT.....T.GA..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...A.C...............A........................G...................T..................T.......................T....................T................................................................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................T........A...................A.............................A...........................A......................A.........................C......................A...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCCAA
+H.sapiens_16.1/7524522-7524618       TTAGGT.....T.GG..T..G....C.A.A..A...A...G....C..........A........A.......T.........T...A.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C......................................TTT..................................................T.........................T..............................................A.....................................T...........................T.............T................T....................................T............................A.........................A.....................AAT......................................G...........................G...............................C........A...................A.............................A...........................A.........TTAAAGTGGCAGGA.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAAGCTAA
+H.sapiens_18.1/71574719-71574633     .TAGGT.....G.GA..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.A...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T............................................TTA.....................................C...........................T.............T................T....................................T............................A...................TTAACAA.......................T......................................T...........................G...............................C........A...................A.............................A...........................A......................C.........................C......................C...............A.................C................A..A..................T...T.A.....G....T.T..T..T...........G...TA....C.CAACCTAA
+H.sapiens_6.1/15848908-15848829      TTAGGT.....T.GG..T..G....A.A.A..A...A...G....A..........A........A.......T.........C...G.C...............A........................G...................G..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................T.........................T......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...TA....C.CAACCTAA
+H.sapiens_2.1/48308821-48308732      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.A...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................T........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................T........................TTTG...............................C........T...................A.............................T....................TACTTTTA......................A.........................C......................C...............T.................G................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACTTAA
+H.sapiens_10.1/43063501-43063577     TTAGGT.....T.GG..T..G....C.A.C..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C............C...........G...CA....C.CAACCTAA
+H.sapiens_8.1/32772680-32772623      TTAGGT.....T.GG..T..G....C.A.A..A...A...T....T..........A........A.......T.........T...G.T...............G........................G..................................................................................................................................................................................................................................................................................................................................................................................................................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A..........................................................................................................................................................................................................T...T.A.....C....T.T..T..T...........G...CA....C.CAACATA.
+H.sapiens_11.1/62731982-62731905     TTAGGT.....T.GA..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................T.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................C.............T................T....................................T............................A.........................A.......................T......................................T...........................G...............................C........A...................A.............................A...........................A......................C.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACTT..
+H.sapiens_8.1/23145187-23145257      TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T........................................................................................................................................................................................................................T..............................................A.....................................C...........................T.............T..................................................................................A.........................T.......................T......................................A...........................G...............................C........A...................A.............................A...........................A................................................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..............G...CA....C.CAACCTAA
+H.sapiens_5.1/92533642-92533583      TTAGGT.....T.GG..T..G....C.A.A.....................................................T...G........................................................................................................................................................................................................................................................................................................................................................................................T..............................................A.....................................C...........................T.............T................T....................................A............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_3.1/1360859-1360937        TTAGGT.....T.TG..T..G....C.A.A..A...A...G....T..........A........A.......T.........C.....C...............T........................A...................C..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................G..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................G.........................C......................C...............G.................C................G..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_1.1/5476888-5476966        .TAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............A........................G...................T..................T.......................A....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................T...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................A...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_1.1/96408229-96408152      ..AGGT.....T.GC..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................G........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...TA....C.CAAACTAA
+H.sapiens_15.1/40119895-40119968     TTAGAT.....T.GG..T..G....C.A.A...........................................T.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................T.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................A........A...................A.............................A...........................A......................A.........................A......................C...............A.................C................A..A..................T...C.A.....C....T.T..T..T...........G...CA....C.CAATCTAA
+H.sapiens_17.1/50416994-50417068     TTAAAT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............T........................G...................T..................T.......................T....................T................................................................G....................................C.............................C........................................A..................................................T.........................C..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A..............................................................................................................................................................................................................................T...C.A.....C....T.T..T..C.....AGTCAGG...CA....C.CAACCTAA
+H.sapiens_17.1/63725518-63725578     ..AGGC.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C................................................................................................................................................................................................................................................................................................................................................................................................................................................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CA.TCTAA
+H.sapiens_5.1/18013069-18012998      TTAGGT.....T.GG..T..G....C.A.A..A...T...G....T..........A........A.......T.........T...G.C...............A........................A...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................A.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................T................A..A..................T...T.A.....C....................................CAACCTAA
+H.sapiens_16.1/53202547-53202602     TTAGGT.....T.GG..T..G....C.A.A..A...A................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................C...........................T.............T................T....................................C............................A.........................G.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................T......................T...............G.................C................A..A..................T...T.A..........T.T..T..T...........G...CA....C.CAACCTA.
+H.sapiens_13.1/55194459-55194385     TTAGGT.....T.GG..T..G....C.A.A..A...C...A....T..........A........A......CT.........T...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................A........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................G.............................A...........................A......................A.........................T......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..............G...CA....C.CAA.....
+H.sapiens_17.1/9974288-9974212       TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............T........................A...................T..................T.......................T....................T................................G...............................T....................................C.............................C........................................A..................................................T.........................T..............................................................................................................................T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................A......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_18.1/41402335-41402413     ...GGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.T...............T........................G...................T..................T.......................T....................C................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................C......................................G...........................G.............................TGC........A...................G..........................TTGA...........................A......................A.........................C......................T...............G.................C................A..A..................T...G.A.....A....T.T..T..T...........G...CA....C.CAACC...
+H.sapiens_9.1/77128286-77128361      TTAGGT.....T.GA..T..G....G.A.A..A...A...G....T..........T........A.......T.........T...G.C...............A........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................G.............T................C..........................................................................................................................................................A...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...A.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_6.1/158186029-158186103    .....T.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......C.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................A....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................G......................A.........................T......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...TG....C.CAACCTAA
+H.sapiens_1.1/20534163-20534084      .TAGGT.....T.GG..T..C....C.A.A..A...A...G....T..........A........A.......T.........C...G.T...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A......................AT......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................G..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTGA
+H.sapiens_X.1/89227706-89227785      TTAGGT.....T.GG..C..T....C.A.A..A...A...G....T..........A........A.......C.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................T........................................G..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................C............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...TG....C.CAATCTAA
+H.sapiens_7.1/41814033-41814098      TTAGGT.....T.GG..T..A....C.A.A..A...A...G....T..........A.................................................................................................................................................................................................................................................................................................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................T......................C...............A.................C................A..A..................T...A.A.....C....T.T..T..C...........G...CA....C.CAATCTAA
+H.sapiens_14.1/64561835-64561756     TTAGGT.....G.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........C...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................T.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................T........A...................A.............................A...........................A......................A.........................C......................T...............G.................G................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.TGACCTAA
+H.sapiens_10.1/24517340-24517286     TTAGGT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_15.1/78813779-78813856     TTCGAT.....T.GG..T..G....C.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................G..................T.......................T....................T................................................................G....................................C.............................C........................................A..................................................T.........................T..............................................A.....................................C...........................T.............T................T....................................T............................A.........................A.......................T......................................T...........................G...............................C........A...................A.........................................................C......................A.........................C......................T...............G.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAACCTAA
+H.sapiens_8.1/106145070-106145136    .TAGGC.....T.GG..T..G....A.A.A..A...A...G....T..........A........A.......T.........T...G.C...............G........................G...................T..................T.......................T....................T................................T...............................G....................................C.............................T........................................A..................................................T.........................T....................................................................................T...........................T.............T................T....................................T............................A.........................A.......................T......................................G...........................G...............................C.......................................................................................................................................C......................C...............A.................C................A..A..................T...T.A.....C....T.T..T..T...........G...CA....T.CA......
+H.sapiens_6.1/166324652-166324598    TTAGGT.....T.GG..T..A....C.A.A..A...A...G....T..........A........A.......T.................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................G...........................G...............................C........A...................A.............................A...........................A......................A.........................C......................C...............G.................C................C..A..................T...T.A.....C....T.T..T..T...........G...CA....C.CAAACTAA
+H.sapiens_2.1/194121329-194121259    TTAGGT.....T.GG..T..G....G.A.A..A...A...G....T..........A........A.......T.........T...G....................................................................................................................................................................................................................................T.............................C........................................A..................................................T.........................T..............................................G.....................................C...........................T.............T................T....................................C............................A.........................G.....................