changeset 0:8ed686bd4229 draft

planemo upload for repository https://github.com/ASaiM/galaxytools/tree/master/tools/humann2/ commit b46aa969c01b7e5f4f133192899fa4da286ecf89-dirty
author iuc
date Mon, 13 Mar 2017 12:37:33 -0400
parents
children ace84aac38ce
files README.rst generate_test_data humann2_macros.xml humann2_split_table.xml repository_dependencies.xml test-data/cpm_community_renormalized_pathway_abundance.tsv test-data/demo_Abundance.tsv test-data/demo_Coverage.tsv test-data/demo_genefamilies.tsv test-data/demo_pathabundance.tsv test-data/demo_pathcoverage.tsv test-data/g__Bacteroides.s__Bacteroides_stercoris.centroids.v0.1.1.ffn.gz test-data/g__Bacteroides.s__Bacteroides_thetaiotaomicron.centroids.v0.1.1.ffn.gz test-data/input_sequences.fasta test-data/joined_pathway_coverage_abundance.tsv test-data/marker_metadata.json test-data/marker_sequences.fasta test-data/max_reduced_gene_family_abundance.tsv test-data/reduced_uniref50.fasta test-data/regrouped_gene_families_to_infogo1000.tsv test-data/regrouped_gene_families_to_ko.tsv test-data/regrouped_gene_families_to_rxn.tsv test-data/relab_levelwise_renormalized_pathway_abundance.tsv test-data/taxonomic_profile.tabular tool-data/humann2_nucleotide_database.loc.sample tool-data/humann2_protein_database.loc.sample tool-data/metaphlan2_database.loc.sample tool_data_table_conf.xml.sample transform_json_to_pkl.py
diffstat 29 files changed, 30312 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/README.rst	Mon Mar 13 12:37:33 2017 -0400
@@ -0,0 +1,12 @@
+Galaxy wrappers for HUMAnN2
+===========================
+
+Galaxy should be able to automatically install the dependencies, i.e. the
+HUMAnN2 binaries and its dependencies.
+
+After installation, you must tell Galaxy about the default databases for MetaPhlAn2 and HUMAnN2. 
+You need to use the data managers for that and installing:
+
+- MetaPhlAn2 database
+- HUMAnN2 nucleotide database
+- HUMAnN2 protein database
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/generate_test_data	Mon Mar 13 12:37:33 2017 -0400
@@ -0,0 +1,124 @@
+#/usr/bin/env bash
+
+# humann2
+humann2 \
+    --input 'test-data/input_sequences.fasta' \
+    -o 'humann2_output' \
+    --annotation-gene-index 8 \
+    --taxonomic-profile 'test-data/taxonomic_profile.tabular' \
+    --metaphlan-options="-t rel_ab" \
+    --nucleotide-database 'test-data/' \
+    --protein-database 'test-data/' \
+    --evalue '1' \
+    --search-mode 'uniref50' \
+    --prescreen-threshold '0.01' \
+    --identity-threshold '50' \
+    --translated-subject-coverage-threshold '50' \
+    --translated-query-coverage-threshold '50' \
+    --translated-alignment 'diamond' \
+    --xipe 'off' \
+    --minpath 'on' \
+    --pick-frames 'on' \
+    --gap-fill 'off' \
+    --output-format 'tsv' \
+    --output-max-decimals '10' \
+    --output-basename 'humann2' \
+    --pathways 'metacyc'
+
+humann2 \
+    --input 'test-data/input_sequences.fasta' \
+    -o 'humann2_output' \
+    --annotation-gene-index 8 \
+    --metaphlan-options="-t rel_ab" \
+    --nucleotide-database 'test-data/' \
+    --protein-database 'test-data/' \
+    --evalue '1' \
+    --search-mode 'uniref90' \
+    --prescreen-threshold '0.01' \
+    --identity-threshold '50' \
+    --translated-subject-coverage-threshold '50' \
+    --translated-query-coverage-threshold '50' \
+    --translated-alignment 'rapsearch' \
+    --xipe 'off' \
+    --minpath 'on' \
+    --pick-frames 'on' \
+    --gap-fill 'off' \
+    --output-format 'tsv' \
+    --output-max-decimals '10' \
+    --output-basename 'humann2' \
+    --pathways 'unipathway'
+
+# humann2_regroup_table
+humann2_regroup_table \
+    --input 'test-data/demo_genefamilies.tsv' \
+    -o 'test-data/regrouped_gene_families_to_infogo1000.tsv' \
+    --function 'sum' \
+    --groups 'uniref90_infogo1000' \
+    --ungrouped 'Y' \
+    --protected 'Y'
+
+humann2_regroup_table \
+    --input 'test-data/demo_genefamilies.tsv' \
+    -o 'test-data/regrouped_gene_families_to_ko.tsv' \
+    --function 'mean' \
+    --groups 'uniref90_ko' \
+    --ungrouped 'Y' \
+    --protected 'Y'
+
+humann2_regroup_table \
+    --input 'test-data/demo_genefamilies.tsv' \
+    -o 'test-data/regrouped_gene_families_to_rxn.tsv' \
+    --function 'sum' \
+    --groups 'uniref90_rxn' \
+    --ungrouped 'Y' \
+    --protected 'Y'
+
+# humann2_renorm_table
+humann2_renorm_table \
+    --input 'test-data/demo_pathabundance.tsv' \
+    -o 'test-data/cpm_community_renormalized_pathway_abundance.tsv' \
+    --units 'cpm' \
+    --mode 'community' \
+    --special 'n'
+
+humann2_renorm_table \
+    --input 'test-data/demo_pathabundance.tsv' \
+    -o 'test-data/relab_levelwise_renormalized_pathway_abundance.tsv' \
+    --units 'relab' \
+    --mode 'levelwise' \
+    --special 'y'
+
+# humann2_join_tables
+mkdir join_table_tmp_dir
+cp 'test-data/demo_pathabundance.tsv' join_table_tmp_dir
+cp 'test-data/demo_pathcoverage.tsv' join_table_tmp_dir
+humann2_join_tables \
+    -i 'join_table_tmp_dir' \
+    -o 'test-data/joined_pathway_coverage_abundance.tsv'
+
+# humann2_merge_abundance_tables
+humann2_merge_abundance_tables \
+    --input-genes 'test-data/demo_genefamilies.tsv' \
+    --input-pathways 'test-data/demo_pathabundance.tsv' \
+    -o 'test-data/merged_gene_families_pathways_abundances.tsv' 
+
+# humann2_reduce_table
+humann2_reduce_table \
+    --input 'test-data/demo_genefamilies.tsv' \
+    -o 'test-data/max_reduced_gene_family_abundance.tsv' \
+    --function 'max' \
+    --sort-by 'name'
+
+# humann2_rename_table
+humann2_rename_table \
+    --input 'test-data/demo_genefamilies.tsv' \
+    -o 'test-data/renamed_genefamilies.tsv' \
+    --names 'metacyc-pwy'
+
+# humann2_split_table
+mkdir split_table_tmp_dir
+humann2_split_table \
+    --input 'test-data/joined_pathway_coverage_abundance.tsv' \
+    -o 'split_table_tmp_dir'
+cp 'split_table_tmp_dir/demo_Abundance.tsv' 'test-data/'
+cp 'split_table_tmp_dir/demo_Coverage.tsv' 'test-data/'
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/humann2_macros.xml	Mon Mar 13 12:37:33 2017 -0400
@@ -0,0 +1,25 @@
+<?xml version="1.0"?>
+<macros>
+    <token name="@WRAPPER_VERSION@">0.9.9</token>
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package" version="@WRAPPER_VERSION@">humann2</requirement>
+            <yield/>
+        </requirements>
+    </xml>
+    <xml name="version">
+        <version_command>humann2 --version</version_command>
+    </xml>
+    <token name="@HELP_HEADER@">
+**What it does**
+
+HUMAnN is a pipeline for efficiently and accuretly profiling the presence/absence and abundance of microbial pathways in a community from metagenomic or metatranscriptomic sequencing data. 
+
+Read more about the tool: http://huttenhower.sph.harvard.edu/humann2/manual.
+    </token>
+    <xml name="citations">
+        <citations>
+            <citation type="doi">10.1371/journal.pcbi.1002358</citation>
+        </citations>
+    </xml>
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/humann2_split_table.xml	Mon Mar 13 12:37:33 2017 -0400
@@ -0,0 +1,52 @@
+<tool id="humann2_split_table" name="Split" version="@WRAPPER_VERSION@.0">
+    <description> a HUMAnN2 generated table</description>
+    <macros>
+        <import>humann2_macros.xml</import>
+    </macros>
+    <expand macro="requirements"/>
+    <expand macro="version"/>
+    <command detect_errors="exit_code"><![CDATA[
+        humann2_split_table
+            --input '$input'
+            -o 'output'
+            #if $taxonomy_index
+                --taxonomy_index '$taxonomy_index'
+            #end if
+            #if $taxonomy_level
+                --taxonomy_level '$taxonomy_level'
+            #end if
+    ]]></command>
+    <inputs>
+        <param argument="--input" type="data" format="tsv,tabular,biom1" label="Gene table to split"/>
+        <param argument="--taxonomy_index" type="text" label="Index of the gene in the taxonomy data" optional="true"/>
+        <param argument="--taxonomy_level" type="select" label="Level of taxonomy for the output" optional="true" help="if input is from picrust metagenome_contributions.py">
+            <option value="Kingdom">Kingdom</option>
+            <option value="Phylum">Phylum</option>
+            <option value="Class">Class</option>
+            <option value="Order">Order</option>
+            <option value="Family">Family</option>
+            <option value="Genus">Genus</option>
+            <option value="Species">Species</option>
+        </param>
+    </inputs>
+    <outputs>
+        <collection type="list" name="split_tables" label="${tool.name} on ${on_string}: Split tables">
+            <discover_datasets pattern="__designation_and_ext__" directory="output"/>
+        </collection>
+    </outputs>
+    <tests>
+        <test>
+            <param name="input" value="joined_pathway_coverage_abundance.tsv"/>
+            <output_collection name="split_tables" type="list" >
+                <element name="demo_Coverage" file="demo_Coverage.tsv" />
+                <element name="demo_Abundance" file="demo_Abundance.tsv" />
+            </output_collection>
+        </test>
+    </tests>
+    <help><![CDATA[
+@HELP_HEADER@
+
+Split HUMAnN2 table is a tool to split a gene table with multiple columns. This file can have been generated with the join table tool.
+    ]]></help>
+    <expand macro="citations"/>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/repository_dependencies.xml	Mon Mar 13 12:37:33 2017 -0400
@@ -0,0 +1,5 @@
+<?xml version="1.0"?>
+<repositories description="This requires the HUMAnN2 data manager definition to install all required databases.">
+    <repository changeset_revision="9c4ad82be5bd" name="data_manager_metaphlan2_database_downloader" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" />
+    <repository changeset_revision="1316375a8cbb" name="data_manager_humann2_database_downloader" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" />
+</repositories>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cpm_community_renormalized_pathway_abundance.tsv	Mon Mar 13 12:37:33 2017 -0400
@@ -0,0 +1,24 @@
+# Pathway	demo_Abundance
+PWY-5423: oleoresin monoterpene volatiles biosynthesis	180020
+PWY-5423: oleoresin monoterpene volatiles biosynthesis|unclassified	180020
+PWY-6305: putrescine biosynthesis IV	161410
+PWY-6305: putrescine biosynthesis IV|unclassified	161410
+PWY490-3: nitrate reduction VI (assimilatory)	143637
+PWY490-3: nitrate reduction VI (assimilatory)|unclassified	143637
+PWY-1269: CMP-3-deoxy-D-manno-octulosonate biosynthesis I	139077
+PWY-1269: CMP-3-deoxy-D-manno-octulosonate biosynthesis I|unclassified	117223
+COA-PWY-1: coenzyme A biosynthesis II (mammalian)	83200
+COA-PWY-1: coenzyme A biosynthesis II (mammalian)|g__Bacteroides.s__Bacteroides_vulgatus	62649.4
+PWY-6700: queuosine biosynthesis	72792.1
+PWY-6700: queuosine biosynthesis|g__Bacteroides.s__Bacteroides_dorei	44461.5
+PWY-6700: queuosine biosynthesis|g__Bacteroides.s__Bacteroides_vulgatus	18957.3
+PWY-7111: pyruvate fermentation to isobutanol (engineered)	41366.2
+PWY-7111: pyruvate fermentation to isobutanol (engineered)|g__Bacteroides.s__Bacteroides_vulgatus	30998.5
+VALSYN-PWY: L-valine biosynthesis	41366.2
+VALSYN-PWY: L-valine biosynthesis|g__Bacteroides.s__Bacteroides_vulgatus	30998.5
+PWY-5695: urate biosynthesis/inosine 5'-phosphate degradation	37515.4
+PWY-5097: L-lysine biosynthesis VI	34829.8
+PWY-2942: L-lysine biosynthesis III	33055.4
+PWY-2942: L-lysine biosynthesis III|g__Bacteroides.s__Bacteroides_dorei	23325.7
+PWY-7219: adenosine ribonucleotides de novo biosynthesis	31729.7
+PWY-7219: adenosine ribonucleotides de novo biosynthesis|g__Bacteroides.s__Bacteroides_dorei	16294.6
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/demo_Abundance.tsv	Mon Mar 13 12:37:33 2017 -0400
@@ -0,0 +1,29 @@
+# Pathway	demo_Abundance
+COA-PWY-1: coenzyme A biosynthesis II (mammalian)	6.3694267516
+PWY-7219: adenosine ribonucleotides de novo biosynthesis	2.4290890774
+PWY-6305: putrescine biosynthesis IV	12.3568523173
+PWY-2942: L-lysine biosynthesis III|g__Bacteroides.s__Bacteroides_dorei	1.7857142857
+PWY-5423: oleoresin monoterpene volatiles biosynthesis|unclassified	13.7815543238
+UNINTEGRATED|g__Bacteroides.s__Bacteroides_dorei	1957.0469180460
+PWY-7111: pyruvate fermentation to isobutanol (engineered)	3.1668118122
+PWY-1269: CMP-3-deoxy-D-manno-octulosonate biosynthesis I|unclassified	8.9740635174
+PWY-7219: adenosine ribonucleotides de novo biosynthesis|g__Bacteroides.s__Bacteroides_dorei	1.2474418751
+PWY-6700: queuosine biosynthesis|g__Bacteroides.s__Bacteroides_vulgatus	1.4512868417
+PWY-2942: L-lysine biosynthesis III	2.5305778153
+PWY-6305: putrescine biosynthesis IV|unclassified	12.3568523173
+PWY-5097: L-lysine biosynthesis VI	2.6664127226
+UNINTEGRATED|unclassified	46.5907339353
+UNINTEGRATED	6378.3363291102
+VALSYN-PWY: L-valine biosynthesis	3.1668118122
+VALSYN-PWY: L-valine biosynthesis|g__Bacteroides.s__Bacteroides_vulgatus	2.3731126339
+COA-PWY-1: coenzyme A biosynthesis II (mammalian)|g__Bacteroides.s__Bacteroides_vulgatus	4.7961630695
+PWY-7111: pyruvate fermentation to isobutanol (engineered)|g__Bacteroides.s__Bacteroides_vulgatus	2.3731126339
+UNINTEGRATED|g__Bacteroides.s__Bacteroides_vulgatus	2909.3950875399
+PWY-5423: oleoresin monoterpene volatiles biosynthesis	13.7815543238
+PWY-6700: queuosine biosynthesis|g__Bacteroides.s__Bacteroides_dorei	3.4037771853
+PWY-5695: urate biosynthesis/inosine 5'-phosphate degradation	2.8720157961
+PWY490-3: nitrate reduction VI (assimilatory)|unclassified	10.9962495261
+PWY-6700: queuosine biosynthesis	5.5726434156
+PWY490-3: nitrate reduction VI (assimilatory)	10.9962495261
+PWY-1269: CMP-3-deoxy-D-manno-octulosonate biosynthesis I	10.6471569863
+UNMAPPED	1548.1865983490
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/demo_Coverage.tsv	Mon Mar 13 12:37:33 2017 -0400
@@ -0,0 +1,29 @@
+# Pathway	demo_Coverage
+COA-PWY-1: coenzyme A biosynthesis II (mammalian)	0.7609346153
+PWY-7219: adenosine ribonucleotides de novo biosynthesis	0.2181895299
+PWY-6305: putrescine biosynthesis IV	0.9518375285
+PWY-2942: L-lysine biosynthesis III|g__Bacteroides.s__Bacteroides_dorei	0.4389950257
+PWY-5423: oleoresin monoterpene volatiles biosynthesis|unclassified	0.8805252394
+UNINTEGRATED|g__Bacteroides.s__Bacteroides_dorei	1.0000000000
+PWY-7111: pyruvate fermentation to isobutanol (engineered)	0.3826032161
+PWY-1269: CMP-3-deoxy-D-manno-octulosonate biosynthesis I|unclassified	0.5431316496
+PWY-7219: adenosine ribonucleotides de novo biosynthesis|g__Bacteroides.s__Bacteroides_dorei	0.3040136356
+PWY-6700: queuosine biosynthesis|g__Bacteroides.s__Bacteroides_vulgatus	0.3826190602
+PWY-2942: L-lysine biosynthesis III	0.2651956314
+PWY-6305: putrescine biosynthesis IV|unclassified	0.7234100116
+PWY-5097: L-lysine biosynthesis VI	0.2856160532
+UNINTEGRATED|unclassified	1.0000000000
+UNINTEGRATED	1.0000000000
+VALSYN-PWY: L-valine biosynthesis	0.3826032161
+VALSYN-PWY: L-valine biosynthesis|g__Bacteroides.s__Bacteroides_vulgatus	0.5877696572
+COA-PWY-1: coenzyme A biosynthesis II (mammalian)|g__Bacteroides.s__Bacteroides_vulgatus	0.8557878872
+PWY-7111: pyruvate fermentation to isobutanol (engineered)|g__Bacteroides.s__Bacteroides_vulgatus	0.5877696572
+UNINTEGRATED|g__Bacteroides.s__Bacteroides_vulgatus	1.0000000000
+PWY-5423: oleoresin monoterpene volatiles biosynthesis	0.9874950891
+PWY-6700: queuosine biosynthesis|g__Bacteroides.s__Bacteroides_dorei	0.7183078347
+PWY-5695: urate biosynthesis/inosine 5'-phosphate degradation	0.3368670323
+PWY490-3: nitrate reduction VI (assimilatory)|unclassified	0.7290147297
+PWY-6700: queuosine biosynthesis	0.6918160989
+PWY490-3: nitrate reduction VI (assimilatory)	0.9568614047
+PWY-1269: CMP-3-deoxy-D-manno-octulosonate biosynthesis I	0.9392767343
+UNMAPPED	1.0000000000
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/demo_genefamilies.tsv	Mon Mar 13 12:37:33 2017 -0400
@@ -0,0 +1,8420 @@
+# Gene Family	demo_Abundance-RPKs
+UNMAPPED	4531.0000000000
+UniRef90_unknown	1635.4482975639
+UniRef90_unknown|g__Bacteroides.s__Bacteroides_dorei	883.2117957343
+UniRef90_unknown|g__Bacteroides.s__Bacteroides_vulgatus	752.2365018295
+UniRef90_R6HHA8	333.3333333333
+UniRef90_R6HHA8|g__Bacteroides.s__Bacteroides_dorei	333.3333333333
+UniRef90_R7NYS9	166.6666666667
+UniRef90_R7NYS9|g__Bacteroides.s__Bacteroides_vulgatus	166.6666666667
+UniRef90_D1K9F5	66.6666666667
+UniRef90_D1K9F5|g__Bacteroides.s__Bacteroides_dorei	66.6666666667
+UniRef90_G1UMF5	66.6666666667
+UniRef90_G1UMF5|g__Bacteroides.s__Bacteroides_vulgatus	66.6666666667
+UniRef90_R7NVD8	56.3492063492
+UniRef90_R7NVD8|g__Bacteroides.s__Bacteroides_vulgatus	56.3492063492
+UniRef90_R7P3A5	55.5555555556
+UniRef90_R7P3A5|g__Bacteroides.s__Bacteroides_dorei	55.5555555556
+UniRef90_D1K046	47.6190476190
+UniRef90_D1K046|g__Bacteroides.s__Bacteroides_dorei	47.6190476190
+UniRef90_D4VBJ0	47.6190476190
+UniRef90_D4VBJ0|g__Bacteroides.s__Bacteroides_vulgatus	47.6190476190
+UniRef90_R6HVY6	47.6190476190
+UniRef90_R6HVY6|g__Bacteroides.s__Bacteroides_dorei	47.6190476190
+UniRef90_R6I0Z3	47.6190476190
+UniRef90_R6I0Z3|g__Bacteroides.s__Bacteroides_vulgatus	47.6190476190
+UniRef90_C3R7K2	45.7650273224
+UniRef90_C3R7K2|g__Bacteroides.s__Bacteroides_dorei	45.7650273224
+UniRef90_B6VX47	41.6666666667
+UniRef90_B6VX47|g__Bacteroides.s__Bacteroides_dorei	41.6666666667
+UniRef90_R9HIC6	41.6666666667
+UniRef90_R9HIC6|g__Bacteroides.s__Bacteroides_vulgatus	41.6666666667
+UniRef90_A7AE97	37.0370370370
+UniRef90_A7AE97|g__Bacteroides.s__Bacteroides_dorei	37.0370370370
+UniRef90_I9GA88	35.3063343718
+UniRef90_I9GA88|g__Bacteroides.s__Bacteroides_vulgatus	19.7300103842
+UniRef90_I9GA88|g__Bacteroides.s__Bacteroides_dorei	15.5763239875
+UniRef90_A6KZ97	33.3333333333
+UniRef90_A6KZ97|g__Bacteroides.s__Bacteroides_dorei	33.3333333333
+UniRef90_B6VTL0	33.3333333333
+UniRef90_B6VTL0|g__Bacteroides.s__Bacteroides_dorei	33.3333333333
+UniRef90_B6VXB0	30.3030303030
+UniRef90_B6VXB0|g__Bacteroides.s__Bacteroides_dorei	30.3030303030
+UniRef90_B6VZR2	30.3030303030
+UniRef90_B6VZR2|g__Bacteroides.s__Bacteroides_dorei	30.3030303030
+UniRef90_C3Q4T2	30.3030303030
+UniRef90_C3Q4T2|g__Bacteroides.s__Bacteroides_dorei	30.3030303030
+UniRef90_D1K8B6	30.3030303030
+UniRef90_D1K8B6|g__Bacteroides.s__Bacteroides_dorei	30.3030303030
+UniRef90_R6HMF6	30.3030303030
+UniRef90_R6HMF6|g__Bacteroides.s__Bacteroides_dorei	30.3030303030
+UniRef90_B6VVE6	28.9855072464
+UniRef90_B6VVE6|g__Bacteroides.s__Bacteroides_dorei	28.9855072464
+UniRef90_D1JZ48	27.7777777778
+UniRef90_D1JZ48|g__Bacteroides.s__Bacteroides_dorei	27.7777777778
+UniRef90_D4VC99	27.7777777778
+UniRef90_D4VC99|g__Bacteroides.s__Bacteroides_vulgatus	27.7777777778
+UniRef90_G1ULF8	27.7777777778
+UniRef90_G1ULF8|g__Bacteroides.s__Bacteroides_dorei	27.7777777778
+UniRef90_A6KXM7	26.1437908497
+UniRef90_A6KXM7|g__Bacteroides.s__Bacteroides_vulgatus	26.1437908497
+UniRef90_B6W1W2	25.6410256410
+UniRef90_B6W1W2|g__Bacteroides.s__Bacteroides_dorei	25.6410256410
+UniRef90_A6KXY0	23.8095238095
+UniRef90_A6KXY0|g__Bacteroides.s__Bacteroides_vulgatus	23.8095238095
+UniRef90_D4V534	23.8095238095
+UniRef90_D4V534|g__Bacteroides.s__Bacteroides_vulgatus	23.8095238095
+UniRef90_I0PXX6	23.8095238095
+UniRef90_I0PXX6|g__Bacteroides.s__Bacteroides_dorei	23.8095238095
+UniRef90_D1JXM3	22.9885057471
+UniRef90_D1JXM3|g__Bacteroides.s__Bacteroides_dorei	22.9885057471
+UniRef90_R6HVW3	22.7272727273
+UniRef90_R6HVW3|g__Bacteroides.s__Bacteroides_dorei	22.7272727273
+UniRef90_D1JXH6	22.2222222222
+UniRef90_D1JXH6|g__Bacteroides.s__Bacteroides_dorei	22.2222222222
+UniRef90_D1JXW7	22.2222222222
+UniRef90_D1JXW7|g__Bacteroides.s__Bacteroides_dorei	22.2222222222
+UniRef90_I8VUS4	22.2222222222
+UniRef90_I8VUS4|g__Bacteroides.s__Bacteroides_dorei	22.2222222222
+UniRef90_R6HFI1	22.2222222222
+UniRef90_R6HFI1|g__Bacteroides.s__Bacteroides_dorei	22.2222222222
+UniRef90_R6HVJ4	22.2222222222
+UniRef90_R6HVJ4|g__Bacteroides.s__Bacteroides_dorei	22.2222222222
+UniRef90_R7NUD1	20.8333333333
+UniRef90_R7NUD1|g__Bacteroides.s__Bacteroides_vulgatus	20.8333333333
+UniRef90_B6VUH9	20.8333333333
+UniRef90_B6VUH9|g__Bacteroides.s__Bacteroides_dorei	20.8333333333
+UniRef90_D1KAK7	20.8333333333
+UniRef90_D1KAK7|g__Bacteroides.s__Bacteroides_dorei	20.8333333333
+UniRef90_R6IEY4	20.8333333333
+UniRef90_R6IEY4|g__Bacteroides.s__Bacteroides_dorei	20.8333333333
+UniRef90_R7P0K6	20.8333333333
+UniRef90_R7P0K6|g__Bacteroides.s__Bacteroides_vulgatus	20.8333333333
+UniRef90_R9HL23	20.8333333333
+UniRef90_R9HL23|g__Bacteroides.s__Bacteroides_vulgatus	20.8333333333
+UniRef90_E5UQ50	20.5087014726
+UniRef90_E5UQ50|g__Bacteroides.s__Bacteroides_dorei	16.0642570281
+UniRef90_E5UQ50|g__Bacteroides.s__Bacteroides_vulgatus	4.4444444444
+UniRef90_C3PW36	20.2020202020
+UniRef90_C3PW36|g__Bacteroides.s__Bacteroides_dorei	20.2020202020
+UniRef90_R9HXZ8	20.1149425287
+UniRef90_R9HXZ8|g__Bacteroides.s__Bacteroides_vulgatus	20.1149425287
+UniRef90_I9QT32	19.6078431373
+UniRef90_I9QT32|g__Bacteroides.s__Bacteroides_dorei	19.6078431373
+UniRef90_R9HD97	19.6078431373
+UniRef90_R9HD97|g__Bacteroides.s__Bacteroides_vulgatus	19.6078431373
+UniRef90_A6KXD7	19.3236714976
+UniRef90_A6KXD7|g__Bacteroides.s__Bacteroides_dorei	9.6618357488
+UniRef90_A6KXD7|g__Bacteroides.s__Bacteroides_vulgatus	9.6618357488
+UniRef90_B7AMT3	19.0476190476
+UniRef90_B7AMT3|g__Bacteroides.s__Bacteroides_vulgatus	19.0476190476
+UniRef90_U5C7R6	19.0476190476
+UniRef90_U5C7R6|g__Bacteroides.s__Bacteroides_vulgatus	19.0476190476
+UniRef90_Q650C6	18.9393939394
+UniRef90_Q650C6|g__Bacteroides.s__Bacteroides_vulgatus	15.1515151515
+UniRef90_Q650C6|g__Bacteroides.s__Bacteroides_dorei	3.7878787879
+UniRef90_B6VYA5	18.5185185185
+UniRef90_B6VYA5|g__Bacteroides.s__Bacteroides_dorei	18.5185185185
+UniRef90_I9R6V8	18.5185185185
+UniRef90_I9R6V8|g__Bacteroides.s__Bacteroides_dorei	18.5185185185
+UniRef90_A6KYS7	17.5438596491
+UniRef90_A6KYS7|g__Bacteroides.s__Bacteroides_vulgatus	11.6959064327
+UniRef90_A6KYS7|g__Bacteroides.s__Bacteroides_dorei	5.8479532164
+UniRef90_B6VS18	17.5438596491
+UniRef90_B6VS18|g__Bacteroides.s__Bacteroides_dorei	17.5438596491
+UniRef90_C3Q3W9	17.5438596491
+UniRef90_C3Q3W9|g__Bacteroides.s__Bacteroides_dorei	17.5438596491
+UniRef90_I9PQN8	17.5438596491
+UniRef90_I9PQN8|g__Bacteroides.s__Bacteroides_dorei	17.5438596491
+UniRef90_R6HJR2	17.5438596491
+UniRef90_R6HJR2|g__Bacteroides.s__Bacteroides_dorei	17.5438596491
+UniRef90_R9H8N9	17.5438596491
+UniRef90_R9H8N9|g__Bacteroides.s__Bacteroides_vulgatus	17.5438596491
+UniRef90_R9HG33	17.5438596491
+UniRef90_R9HG33|g__Bacteroides.s__Bacteroides_vulgatus	17.5438596491
+UniRef90_U5FT06	16.7693829744
+UniRef90_U5FT06|unclassified	16.7693829744
+UniRef90_A6KZR7	16.7427701674
+UniRef90_A6KZR7|g__Bacteroides.s__Bacteroides_dorei	10.6544901065
+UniRef90_A6KZR7|g__Bacteroides.s__Bacteroides_vulgatus	6.0882800609
+UniRef90_A6L3X7	16.7001114827
+UniRef90_A6L3X7|g__Bacteroides.s__Bacteroides_dorei	16.7001114827
+UniRef90_A6L5E0	16.6666666667
+UniRef90_A6L5E0|g__Bacteroides.s__Bacteroides_dorei	8.3333333333
+UniRef90_A6L5E0|g__Bacteroides.s__Bacteroides_vulgatus	8.3333333333
+UniRef90_B6W456	16.6666666667
+UniRef90_B6W456|g__Bacteroides.s__Bacteroides_dorei	16.6666666667
+UniRef90_R7NZY6	16.6666666667
+UniRef90_R7NZY6|g__Bacteroides.s__Bacteroides_vulgatus	16.6666666667
+UniRef90_R6HID2	16.5484633570
+UniRef90_R6HID2|g__Bacteroides.s__Bacteroides_dorei	11.8203309693
+UniRef90_R6HID2|g__Bacteroides.s__Bacteroides_vulgatus	4.7281323877
+UniRef90_I8ZG91	16.4609053498
+UniRef90_I8ZG91|g__Bacteroides.s__Bacteroides_vulgatus	16.4609053498
+UniRef90_R6HSV0	16.3934426230
+UniRef90_R6HSV0|g__Bacteroides.s__Bacteroides_dorei	16.3934426230
+UniRef90_R6HKJ4	16.2601626016
+UniRef90_R6HKJ4|g__Bacteroides.s__Bacteroides_dorei	8.1300813008
+UniRef90_R6HKJ4|g__Bacteroides.s__Bacteroides_vulgatus	8.1300813008
+UniRef90_A6L5B2	16.2037037037
+UniRef90_A6L5B2|g__Bacteroides.s__Bacteroides_vulgatus	9.2592592593
+UniRef90_A6L5B2|g__Bacteroides.s__Bacteroides_dorei	6.9444444444
+UniRef90_I9QMD3	16.1290322581
+UniRef90_I9QMD3|g__Bacteroides.s__Bacteroides_dorei	16.1290322581
+UniRef90_A6L303	15.8730158730
+UniRef90_A6L303|g__Bacteroides.s__Bacteroides_dorei	9.0702947846
+UniRef90_A6L303|g__Bacteroides.s__Bacteroides_vulgatus	6.8027210884
+UniRef90_R6IEY0	15.8730158730
+UniRef90_R6IEY0|g__Bacteroides.s__Bacteroides_dorei	15.8730158730
+UniRef90_R9HCS0	15.8730158730
+UniRef90_R9HCS0|g__Bacteroides.s__Bacteroides_vulgatus	15.8730158730
+UniRef90_Q64WL4	15.5038759690
+UniRef90_Q64WL4|g__Bacteroides.s__Bacteroides_dorei	7.7519379845
+UniRef90_Q64WL4|g__Bacteroides.s__Bacteroides_vulgatus	7.7519379845
+UniRef90_Q650D8	15.4320987654
+UniRef90_Q650D8|g__Bacteroides.s__Bacteroides_dorei	9.2592592593
+UniRef90_Q650D8|g__Bacteroides.s__Bacteroides_vulgatus	6.1728395062
+UniRef90_R7NWM3	15.3061224490
+UniRef90_R7NWM3|g__Bacteroides.s__Bacteroides_vulgatus	11.9047619048
+UniRef90_R7NWM3|g__Bacteroides.s__Bacteroides_dorei	3.4013605442
+UniRef90_A6KXY7	15.2505446623
+UniRef90_A6KXY7|g__Bacteroides.s__Bacteroides_dorei	10.8932461874
+UniRef90_A6KXY7|g__Bacteroides.s__Bacteroides_vulgatus	4.3572984749
+UniRef90_F7UWW6	15.1515151515
+UniRef90_F7UWW6|g__Bacteroides.s__Bacteroides_dorei	15.1515151515
+UniRef90_R6HLV0	15.1515151515
+UniRef90_R6HLV0|g__Bacteroides.s__Bacteroides_vulgatus	9.0909090909
+UniRef90_R6HLV0|g__Bacteroides.s__Bacteroides_dorei	6.0606060606
+UniRef90_A6L277	14.9253731343
+UniRef90_A6L277|g__Bacteroides.s__Bacteroides_vulgatus	14.9253731343
+UniRef90_D1K4H6	14.9253731343
+UniRef90_D1K4H6|g__Bacteroides.s__Bacteroides_dorei	14.9253731343
+UniRef90_D1K0Y4	14.8148148148
+UniRef90_D1K0Y4|g__Bacteroides.s__Bacteroides_dorei	7.4074074074
+UniRef90_D1K0Y4|g__Bacteroides.s__Bacteroides_vulgatus	7.4074074074
+UniRef90_R6HM78	14.6520146520
+UniRef90_R6HM78|g__Bacteroides.s__Bacteroides_vulgatus	12.8205128205
+UniRef90_R6HM78|g__Bacteroides.s__Bacteroides_dorei	1.8315018315
+UniRef90_R6HM09	14.6198830409
+UniRef90_R6HM09|g__Bacteroides.s__Bacteroides_dorei	11.6959064327
+UniRef90_R6HM09|g__Bacteroides.s__Bacteroides_vulgatus	2.9239766082
+UniRef90_C6Z3C4	14.4927536232
+UniRef90_C6Z3C4|g__Bacteroides.s__Bacteroides_vulgatus	14.4927536232
+UniRef90_Q650E5	14.4927536232
+UniRef90_Q650E5|g__Bacteroides.s__Bacteroides_dorei	14.4927536232
+UniRef90_R6HMH8	14.4927536232
+UniRef90_R6HMH8|g__Bacteroides.s__Bacteroides_dorei	14.4927536232
+UniRef90_R9HQ76	14.4927536232
+UniRef90_R9HQ76|g__Bacteroides.s__Bacteroides_vulgatus	14.4927536232
+UniRef90_R6CCT5	14.3678160920
+UniRef90_R6CCT5|g__Bacteroides.s__Bacteroides_vulgatus	11.4942528736
+UniRef90_R6CCT5|g__Bacteroides.s__Bacteroides_dorei	2.8735632184
+UniRef90_I9F7R5	14.1843971631
+UniRef90_I9F7R5|g__Bacteroides.s__Bacteroides_dorei	14.1843971631
+UniRef90_A6KWV2	13.8888888889
+UniRef90_A6KWV2|g__Bacteroides.s__Bacteroides_vulgatus	13.8888888889
+UniRef90_A6L756	13.8888888889
+UniRef90_A6L756|g__Bacteroides.s__Bacteroides_vulgatus	13.8888888889
+UniRef90_C3PVL5	13.8888888889
+UniRef90_C3PVL5|g__Bacteroides.s__Bacteroides_dorei	13.8888888889
+UniRef90_R7P0P4	13.8067061144
+UniRef90_R7P0P4|g__Bacteroides.s__Bacteroides_dorei	13.8067061144
+UniRef90_Q9ZUH4	13.7815543238
+UniRef90_Q9ZUH4|unclassified	13.7815543238
+UniRef90_I9QBE7	13.7741046832
+UniRef90_I9QBE7|g__Bacteroides.s__Bacteroides_dorei	13.7741046832
+UniRef90_Q5L8D4	13.7457044674
+UniRef90_Q5L8D4|g__Bacteroides.s__Bacteroides_dorei	10.3092783505
+UniRef90_Q5L8D4|g__Bacteroides.s__Bacteroides_vulgatus	3.4364261168
+UniRef90_Q650G6	13.6054421769
+UniRef90_Q650G6|g__Bacteroides.s__Bacteroides_dorei	13.6054421769
+UniRef90_R6HLL3	13.6054421769
+UniRef90_R6HLL3|g__Bacteroides.s__Bacteroides_dorei	13.6054421769
+UniRef90_R7NS71	13.5135135135
+UniRef90_R7NS71|g__Bacteroides.s__Bacteroides_dorei	9.0090090090
+UniRef90_R7NS71|g__Bacteroides.s__Bacteroides_vulgatus	4.5045045045
+UniRef90_I8VNZ4	13.3730158730
+UniRef90_I8VNZ4|g__Bacteroides.s__Bacteroides_dorei	13.3730158730
+UniRef90_A6KXU6	13.3333333333
+UniRef90_A6KXU6|g__Bacteroides.s__Bacteroides_vulgatus	13.3333333333
+UniRef90_B6W5J0	13.3333333333
+UniRef90_B6W5J0|g__Bacteroides.s__Bacteroides_dorei	13.3333333333
+UniRef90_R7P2W5	13.3333333333
+UniRef90_R7P2W5|g__Bacteroides.s__Bacteroides_dorei	13.3333333333
+UniRef90_A6KZJ9	13.1362889984
+UniRef90_A6KZJ9|g__Bacteroides.s__Bacteroides_dorei	8.2101806240
+UniRef90_A6KZJ9|g__Bacteroides.s__Bacteroides_vulgatus	4.9261083744
+UniRef90_A6L1U6	13.1362889984
+UniRef90_A6L1U6|g__Bacteroides.s__Bacteroides_dorei	6.5681444992
+UniRef90_A6L1U6|g__Bacteroides.s__Bacteroides_vulgatus	6.5681444992
+UniRef90_I9R3T6	13.0718954248
+UniRef90_I9R3T6|g__Bacteroides.s__Bacteroides_dorei	13.0718954248
+UniRef90_A6L706	13.0208333333
+UniRef90_A6L706|g__Bacteroides.s__Bacteroides_vulgatus	10.4166666667
+UniRef90_A6L706|g__Bacteroides.s__Bacteroides_dorei	2.6041666667
+UniRef90_R6HHC0	12.9629629630
+UniRef90_R6HHC0|g__Bacteroides.s__Bacteroides_vulgatus	12.9629629630
+UniRef90_A6L308	12.8205128205
+UniRef90_A6L308|g__Bacteroides.s__Bacteroides_vulgatus	12.8205128205
+UniRef90_D4VA22	12.8205128205
+UniRef90_D4VA22|g__Bacteroides.s__Bacteroides_vulgatus	12.8205128205
+UniRef90_I8UQW6	12.8205128205
+UniRef90_I8UQW6|g__Bacteroides.s__Bacteroides_dorei	12.8205128205
+UniRef90_R5JPA6	12.8205128205
+UniRef90_R5JPA6|g__Bacteroides.s__Bacteroides_vulgatus	8.5470085470
+UniRef90_R5JPA6|g__Bacteroides.s__Bacteroides_dorei	4.2735042735
+UniRef90_R5M126	12.8205128205
+UniRef90_R5M126|g__Bacteroides.s__Bacteroides_vulgatus	8.5470085470
+UniRef90_R5M126|g__Bacteroides.s__Bacteroides_dorei	4.2735042735
+UniRef90_R6IKN1	12.8205128205
+UniRef90_R6IKN1|g__Bacteroides.s__Bacteroides_vulgatus	12.8205128205
+UniRef90_R6ZBZ2	12.8205128205
+UniRef90_R6ZBZ2|g__Bacteroides.s__Bacteroides_dorei	12.8205128205
+UniRef90_Q5LI35	12.8205128205
+UniRef90_Q5LI35|g__Bacteroides.s__Bacteroides_dorei	10.6837606838
+UniRef90_Q5LI35|g__Bacteroides.s__Bacteroides_vulgatus	2.1367521368
+UniRef90_R6HWM4	12.8205128205
+UniRef90_R6HWM4|g__Bacteroides.s__Bacteroides_vulgatus	12.8205128205
+UniRef90_Z9K4C5	12.7438684783
+UniRef90_Z9K4C5|unclassified	12.7438684783
+UniRef90_Q8GT21	12.7217525466
+UniRef90_Q8GT21|unclassified	12.7217525466
+UniRef90_A6L0W0	12.6582278481
+UniRef90_A6L0W0|g__Bacteroides.s__Bacteroides_dorei	8.4388185654
+UniRef90_A6L0W0|g__Bacteroides.s__Bacteroides_vulgatus	4.2194092827
+UniRef90_W8YTG4	12.6386317258
+UniRef90_W8YTG4|unclassified	12.6386317258
+UniRef90_D6CZE7	12.4481327801
+UniRef90_D6CZE7|g__Bacteroides.s__Bacteroides_vulgatus	12.4481327801
+UniRef90_R9HNX0	12.4378109453
+UniRef90_R9HNX0|g__Bacteroides.s__Bacteroides_vulgatus	12.4378109453
+UniRef90_A6KX80	12.3456790123
+UniRef90_A6KX80|g__Bacteroides.s__Bacteroides_vulgatus	12.3456790123
+UniRef90_A6L031	12.3456790123
+UniRef90_A6L031|g__Bacteroides.s__Bacteroides_vulgatus	9.8765432099
+UniRef90_A6L031|g__Bacteroides.s__Bacteroides_dorei	2.4691358025
+UniRef90_A6L0A1	12.3456790123
+UniRef90_A6L0A1|g__Bacteroides.s__Bacteroides_dorei	6.1728395062
+UniRef90_A6L0A1|g__Bacteroides.s__Bacteroides_vulgatus	6.1728395062
+UniRef90_I9QQ57	12.3456790123
+UniRef90_I9QQ57|g__Bacteroides.s__Bacteroides_dorei	12.3456790123
+UniRef90_R6HFJ1	12.3456790123
+UniRef90_R6HFJ1|g__Bacteroides.s__Bacteroides_dorei	12.3456790123
+UniRef90_B6VVK5	12.1951219512
+UniRef90_B6VVK5|g__Bacteroides.s__Bacteroides_dorei	12.1951219512
+UniRef90_W1IYL7	12.1580837819
+UniRef90_W1IYL7|unclassified	12.1580837819
+UniRef90_A6L6X2	12.1212121212
+UniRef90_A6L6X2|g__Bacteroides.s__Bacteroides_dorei	6.0606060606
+UniRef90_A6L6X2|g__Bacteroides.s__Bacteroides_vulgatus	6.0606060606
+UniRef90_B5A7F8	12.0481927711
+UniRef90_B5A7F8|g__Bacteroides.s__Bacteroides_dorei	12.0481927711
+UniRef90_R6HUF6	12.0120120120
+UniRef90_R6HUF6|g__Bacteroides.s__Bacteroides_dorei	12.0120120120
+UniRef90_A6L7J0	11.9904076739
+UniRef90_A6L7J0|g__Bacteroides.s__Bacteroides_dorei	8.7929656275
+UniRef90_A6L7J0|g__Bacteroides.s__Bacteroides_vulgatus	3.1974420464
+UniRef90_Q89YW2	11.9760479042
+UniRef90_Q89YW2|g__Bacteroides.s__Bacteroides_dorei	11.9760479042
+UniRef90_A6L6E0	11.9047619048
+UniRef90_A6L6E0|g__Bacteroides.s__Bacteroides_vulgatus	11.9047619048
+UniRef90_C3Q5G7	11.9047619048
+UniRef90_C3Q5G7|g__Bacteroides.s__Bacteroides_dorei	11.9047619048
+UniRef90_C3Q5W4	11.9047619048
+UniRef90_C3Q5W4|g__Bacteroides.s__Bacteroides_dorei	11.9047619048
+UniRef90_D1K7N4	11.9047619048
+UniRef90_D1K7N4|g__Bacteroides.s__Bacteroides_dorei	11.9047619048
+UniRef90_G1UM66	11.9047619048
+UniRef90_G1UM66|g__Bacteroides.s__Bacteroides_vulgatus	11.9047619048
+UniRef90_R6HXB0	11.9047619048
+UniRef90_R6HXB0|g__Bacteroides.s__Bacteroides_dorei	11.9047619048
+UniRef90_R6II27	11.9047619048
+UniRef90_R6II27|g__Bacteroides.s__Bacteroides_vulgatus	8.9285714286
+UniRef90_R6II27|g__Bacteroides.s__Bacteroides_dorei	2.9761904762
+UniRef90_R6IM51	11.8276187480
+UniRef90_R6IM51|g__Bacteroides.s__Bacteroides_dorei	6.0606060606
+UniRef90_R6IM51|g__Bacteroides.s__Bacteroides_vulgatus	5.7670126874
+UniRef90_I8W9U2	11.7994100295
+UniRef90_I8W9U2|g__Bacteroides.s__Bacteroides_dorei	11.7994100295
+UniRef90_R6IMC3	11.7994100295
+UniRef90_R6IMC3|g__Bacteroides.s__Bacteroides_vulgatus	8.8495575221
+UniRef90_R6IMC3|g__Bacteroides.s__Bacteroides_dorei	2.9498525074
+UniRef90_U3KP22	11.6979338377
+UniRef90_U3KP22|unclassified	11.6979338377
+UniRef90_A6L6W4	11.6959064327
+UniRef90_A6L6W4|g__Bacteroides.s__Bacteroides_vulgatus	11.6959064327
+UniRef90_I9QUZ5	11.6279069767
+UniRef90_I9QUZ5|g__Bacteroides.s__Bacteroides_vulgatus	11.6279069767
+UniRef90_K6B0B3	11.6161616162
+UniRef90_K6B0B3|g__Bacteroides.s__Bacteroides_vulgatus	6.0606060606
+UniRef90_K6B0B3|g__Bacteroides.s__Bacteroides_dorei	5.5555555556
+UniRef90_W7DVV5	11.5904796756
+UniRef90_W7DVV5|unclassified	11.5904796756
+UniRef90_U3KI10	11.5589897710
+UniRef90_U3KI10|unclassified	11.5589897710
+UniRef90_R6HZL4	11.5358987173
+UniRef90_R6HZL4|g__Bacteroides.s__Bacteroides_vulgatus	6.7049808429
+UniRef90_R6HZL4|g__Bacteroides.s__Bacteroides_dorei	4.8309178744
+UniRef90_A0A015V946	11.4942528736
+UniRef90_A0A015V946|g__Bacteroides.s__Bacteroides_dorei	11.4942528736
+UniRef90_B6VWS6	11.4942528736
+UniRef90_B6VWS6|g__Bacteroides.s__Bacteroides_dorei	11.4942528736
+UniRef90_C3Q517	11.4942528736
+UniRef90_C3Q517|g__Bacteroides.s__Bacteroides_dorei	11.4942528736
+UniRef90_C6IUM0	11.4942528736
+UniRef90_C6IUM0|g__Bacteroides.s__Bacteroides_dorei	11.4942528736
+UniRef90_D4VC53	11.4942528736
+UniRef90_D4VC53|g__Bacteroides.s__Bacteroides_vulgatus	11.4942528736
+UniRef90_I9QIW6	11.4942528736
+UniRef90_I9QIW6|g__Bacteroides.s__Bacteroides_dorei	11.4942528736
+UniRef90_Q5L8C8	11.4942528736
+UniRef90_Q5L8C8|g__Bacteroides.s__Bacteroides_vulgatus	8.6206896552
+UniRef90_Q5L8C8|g__Bacteroides.s__Bacteroides_dorei	2.8735632184
+UniRef90_Q64NV0	11.4942528736
+UniRef90_Q64NV0|g__Bacteroides.s__Bacteroides_vulgatus	11.4942528736
+UniRef90_R6HHP1	11.4942528736
+UniRef90_R6HHP1|g__Bacteroides.s__Bacteroides_dorei	6.5681444992
+UniRef90_R6HHP1|g__Bacteroides.s__Bacteroides_vulgatus	4.9261083744
+UniRef90_R7P0I9	11.4503816794
+UniRef90_R7P0I9|g__Bacteroides.s__Bacteroides_vulgatus	6.3613231552
+UniRef90_R7P0I9|g__Bacteroides.s__Bacteroides_dorei	5.0890585242
+UniRef90_R6HJN7	11.4285714286
+UniRef90_R6HJN7|g__Bacteroides.s__Bacteroides_dorei	7.6190476190
+UniRef90_R6HJN7|g__Bacteroides.s__Bacteroides_vulgatus	3.8095238095
+UniRef90_R6HTM7	11.3986002838
+UniRef90_R6HTM7|g__Bacteroides.s__Bacteroides_vulgatus	6.4724919094
+UniRef90_R6HTM7|g__Bacteroides.s__Bacteroides_dorei	4.9261083744
+UniRef90_Z5XKU5	11.3736016532
+UniRef90_Z5XKU5|unclassified	11.3736016532
+UniRef90_R7NXH3	11.3636363636
+UniRef90_R7NXH3|g__Bacteroides.s__Bacteroides_vulgatus	11.3636363636
+UniRef90_D4V956	11.3259948216
+UniRef90_D4V956|g__Bacteroides.s__Bacteroides_vulgatus	7.4349442379
+UniRef90_D4V956|g__Bacteroides.s__Bacteroides_dorei	3.8910505837
+UniRef90_Q650D4	11.2994350282
+UniRef90_Q650D4|g__Bacteroides.s__Bacteroides_vulgatus	11.2994350282
+UniRef90_R6HWC5	11.2676056338
+UniRef90_R6HWC5|g__Bacteroides.s__Bacteroides_dorei	7.5117370892
+UniRef90_R6HWC5|g__Bacteroides.s__Bacteroides_vulgatus	3.7558685446
+UniRef90_R6HRE6	11.2612612613
+UniRef90_R6HRE6|g__Bacteroides.s__Bacteroides_dorei	11.2612612613
+UniRef90_R7P3R1	11.2612612613
+UniRef90_R7P3R1|g__Bacteroides.s__Bacteroides_dorei	9.0090090090
+UniRef90_R7P3R1|g__Bacteroides.s__Bacteroides_vulgatus	2.2522522523
+UniRef90_R9HXR4	11.2359550562
+UniRef90_R9HXR4|g__Bacteroides.s__Bacteroides_vulgatus	11.2359550562
+UniRef90_A6KXL1	11.1111111111
+UniRef90_A6KXL1|g__Bacteroides.s__Bacteroides_dorei	11.1111111111
+UniRef90_A6KYP1	11.1111111111
+UniRef90_A6KYP1|g__Bacteroides.s__Bacteroides_dorei	5.5555555556
+UniRef90_A6KYP1|g__Bacteroides.s__Bacteroides_vulgatus	5.5555555556
+UniRef90_A6L4K2	11.1111111111
+UniRef90_A6L4K2|g__Bacteroides.s__Bacteroides_vulgatus	11.1111111111
+UniRef90_A6L4W3	11.1111111111
+UniRef90_A6L4W3|g__Bacteroides.s__Bacteroides_vulgatus	11.1111111111
+UniRef90_D1K3M7	11.1111111111
+UniRef90_D1K3M7|g__Bacteroides.s__Bacteroides_dorei	11.1111111111
+UniRef90_Q5LCF6	11.1111111111
+UniRef90_Q5LCF6|g__Bacteroides.s__Bacteroides_dorei	11.1111111111
+UniRef90_R6HF18	11.1111111111
+UniRef90_R6HF18|g__Bacteroides.s__Bacteroides_dorei	11.1111111111
+UniRef90_R6HMR6	11.1111111111
+UniRef90_R6HMR6|g__Bacteroides.s__Bacteroides_dorei	11.1111111111
+UniRef90_R7P4Q7	11.1111111111
+UniRef90_R7P4Q7|g__Bacteroides.s__Bacteroides_vulgatus	11.1111111111
+UniRef90_A6L1X4	11.0001447387
+UniRef90_A6L1X4|g__Bacteroides.s__Bacteroides_vulgatus	8.1632653061
+UniRef90_A6L1X4|g__Bacteroides.s__Bacteroides_dorei	2.8368794326
+UniRef90_E1WPT3	10.9890109890
+UniRef90_E1WPT3|g__Bacteroides.s__Bacteroides_dorei	10.9890109890
+UniRef90_I9R3I4	10.9739368999
+UniRef90_I9R3I4|g__Bacteroides.s__Bacteroides_dorei	10.9739368999
+UniRef90_C3Q522	10.9289617486
+UniRef90_C3Q522|g__Bacteroides.s__Bacteroides_dorei	10.9289617486
+UniRef90_I8WK68	10.9289617486
+UniRef90_I8WK68|g__Bacteroides.s__Bacteroides_dorei	10.9289617486
+UniRef90_R6HYY9	10.9289617486
+UniRef90_R6HYY9|g__Bacteroides.s__Bacteroides_dorei	10.9289617486
+UniRef90_E5UV84	10.9090909091
+UniRef90_E5UV84|g__Bacteroides.s__Bacteroides_vulgatus	10.9090909091
+UniRef90_R7P1E6	10.8961873929
+UniRef90_R7P1E6|g__Bacteroides.s__Bacteroides_dorei	7.9745058998
+UniRef90_R7P1E6|g__Bacteroides.s__Bacteroides_vulgatus	2.9216814931
+UniRef90_F7M8U5	10.8225108225
+UniRef90_F7M8U5|g__Bacteroides.s__Bacteroides_dorei	10.8225108225
+UniRef90_A6KYL2	10.7526881720
+UniRef90_A6KYL2|g__Bacteroides.s__Bacteroides_dorei	10.7526881720
+UniRef90_D4V9W1	10.7526881720
+UniRef90_D4V9W1|g__Bacteroides.s__Bacteroides_vulgatus	10.7526881720
+UniRef90_D4VE06	10.7526881720
+UniRef90_D4VE06|g__Bacteroides.s__Bacteroides_vulgatus	10.7526881720
+UniRef90_R5J7Y8	10.7526881720
+UniRef90_R5J7Y8|g__Bacteroides.s__Bacteroides_dorei	10.7526881720
+UniRef90_R6HUH3	10.7526881720
+UniRef90_R6HUH3|g__Bacteroides.s__Bacteroides_dorei	5.3763440860
+UniRef90_R6HUH3|g__Bacteroides.s__Bacteroides_vulgatus	5.3763440860
+UniRef90_R6HH14	10.7212475634
+UniRef90_R6HH14|g__Bacteroides.s__Bacteroides_vulgatus	6.8226120858
+UniRef90_R6HH14|g__Bacteroides.s__Bacteroides_dorei	3.8986354776
+UniRef90_A6L0A6	10.6998366629
+UniRef90_A6L0A6|g__Bacteroides.s__Bacteroides_vulgatus	8.7950747581
+UniRef90_A6L0A6|g__Bacteroides.s__Bacteroides_dorei	1.9047619048
+UniRef90_A6KYM6	10.6666666667
+UniRef90_A6KYM6|g__Bacteroides.s__Bacteroides_dorei	5.3333333333
+UniRef90_A6KYM6|g__Bacteroides.s__Bacteroides_vulgatus	5.3333333333
+UniRef90_Z5XVM9	10.6655343460
+UniRef90_Z5XVM9|unclassified	10.6655343460
+UniRef90_A6L521	10.6589147287
+UniRef90_A6L521|g__Bacteroides.s__Bacteroides_dorei	7.7519379845
+UniRef90_A6L521|g__Bacteroides.s__Bacteroides_vulgatus	2.9069767442
+UniRef90_A6L3N8	10.5820105820
+UniRef90_A6L3N8|g__Bacteroides.s__Bacteroides_vulgatus	8.4656084656
+UniRef90_A6L3N8|g__Bacteroides.s__Bacteroides_dorei	2.1164021164
+UniRef90_A6L3V9	10.5820105820
+UniRef90_A6L3V9|g__Bacteroides.s__Bacteroides_dorei	5.2910052910
+UniRef90_A6L3V9|g__Bacteroides.s__Bacteroides_vulgatus	5.2910052910
+UniRef90_R9HM66	10.5633802817
+UniRef90_R9HM66|g__Bacteroides.s__Bacteroides_vulgatus	10.5633802817
+UniRef90_A6KWX7	10.5263157895
+UniRef90_A6KWX7|g__Bacteroides.s__Bacteroides_dorei	7.0175438596
+UniRef90_A6KWX7|g__Bacteroides.s__Bacteroides_vulgatus	3.5087719298
+UniRef90_A6L1I3	10.5263157895
+UniRef90_A6L1I3|g__Bacteroides.s__Bacteroides_dorei	6.1403508772
+UniRef90_A6L1I3|g__Bacteroides.s__Bacteroides_vulgatus	4.3859649123
+UniRef90_R6IHA4	10.4986876640
+UniRef90_R6IHA4|g__Bacteroides.s__Bacteroides_dorei	10.4986876640
+UniRef90_A6L2J2	10.4712041885
+UniRef90_A6L2J2|g__Bacteroides.s__Bacteroides_dorei	5.2356020942
+UniRef90_A6L2J2|g__Bacteroides.s__Bacteroides_vulgatus	5.2356020942
+UniRef90_A6L0V6	10.4166666667
+UniRef90_A6L0V6|g__Bacteroides.s__Bacteroides_vulgatus	7.8125000000
+UniRef90_A6L0V6|g__Bacteroides.s__Bacteroides_dorei	2.6041666667
+UniRef90_A6L3L0	10.4166666667
+UniRef90_A6L3L0|g__Bacteroides.s__Bacteroides_dorei	10.4166666667
+UniRef90_C3RFC7	10.4166666667
+UniRef90_C3RFC7|g__Bacteroides.s__Bacteroides_dorei	10.4166666667
+UniRef90_I0PXY0	10.4166666667
+UniRef90_I0PXY0|g__Bacteroides.s__Bacteroides_dorei	10.4166666667
+UniRef90_I9R0Z5	10.4166666667
+UniRef90_I9R0Z5|g__Bacteroides.s__Bacteroides_dorei	10.4166666667
+UniRef90_R6HRH5	10.3626943005
+UniRef90_R6HRH5|g__Bacteroides.s__Bacteroides_dorei	10.3626943005
+UniRef90_A6L4N7	10.3519668737
+UniRef90_A6L4N7|g__Bacteroides.s__Bacteroides_vulgatus	8.2815734990
+UniRef90_A6L4N7|g__Bacteroides.s__Bacteroides_dorei	2.0703933747
+UniRef90_A6KYS6	10.3359173127
+UniRef90_A6KYS6|g__Bacteroides.s__Bacteroides_dorei	5.1679586563
+UniRef90_A6KYS6|g__Bacteroides.s__Bacteroides_vulgatus	5.1679586563
+UniRef90_R6HXS7	10.3359173127
+UniRef90_R6HXS7|g__Bacteroides.s__Bacteroides_dorei	10.3359173127
+UniRef90_I9RCY8	10.2880658436
+UniRef90_I9RCY8|g__Bacteroides.s__Bacteroides_dorei	10.2880658436
+UniRef90_A6L425	10.2707749767
+UniRef90_A6L425|g__Bacteroides.s__Bacteroides_vulgatus	5.6022408964
+UniRef90_A6L425|g__Bacteroides.s__Bacteroides_dorei	4.6685340803
+UniRef90_A6KZC2	10.2564102564
+UniRef90_A6KZC2|g__Bacteroides.s__Bacteroides_dorei	6.8376068376
+UniRef90_A6KZC2|g__Bacteroides.s__Bacteroides_vulgatus	3.4188034188
+UniRef90_Q64SI4	10.2564102564
+UniRef90_Q64SI4|g__Bacteroides.s__Bacteroides_dorei	10.2564102564
+UniRef90_I8WPJ5	10.1522842640
+UniRef90_I8WPJ5|g__Bacteroides.s__Bacteroides_dorei	10.1522842640
+UniRef90_R6HQ45	10.1371496720
+UniRef90_R6HQ45|g__Bacteroides.s__Bacteroides_dorei	8.3482409064
+UniRef90_R6HQ45|g__Bacteroides.s__Bacteroides_vulgatus	1.7889087657
+UniRef90_R9HMC0	10.1010101010
+UniRef90_R9HMC0|g__Bacteroides.s__Bacteroides_vulgatus	10.1010101010
+UniRef90_A6L7K6	10.1010101010
+UniRef90_A6L7K6|g__Bacteroides.s__Bacteroides_vulgatus	10.1010101010
+UniRef90_D1K9J0	10.1010101010
+UniRef90_D1K9J0|g__Bacteroides.s__Bacteroides_dorei	10.1010101010
+UniRef90_I8VT24	10.1010101010
+UniRef90_I8VT24|g__Bacteroides.s__Bacteroides_dorei	10.1010101010
+UniRef90_R7P0G1	10.1010101010
+UniRef90_R7P0G1|g__Bacteroides.s__Bacteroides_vulgatus	10.1010101010
+UniRef90_A6KXW4	10.0456621005
+UniRef90_A6KXW4|g__Bacteroides.s__Bacteroides_dorei	7.3059360731
+UniRef90_A6KXW4|g__Bacteroides.s__Bacteroides_vulgatus	2.7397260274
+UniRef90_A6KXG3	9.9502487562
+UniRef90_A6KXG3|g__Bacteroides.s__Bacteroides_dorei	7.4626865672
+UniRef90_A6KXG3|g__Bacteroides.s__Bacteroides_vulgatus	2.4875621891
+UniRef90_Q45122	9.9502487562
+UniRef90_Q45122|g__Bacteroides.s__Bacteroides_dorei	9.9502487562
+UniRef90_R7NX63	9.9502487562
+UniRef90_R7NX63|g__Bacteroides.s__Bacteroides_vulgatus	9.9502487562
+UniRef90_R7NYB6	9.9354197715
+UniRef90_R7NYB6|g__Bacteroides.s__Bacteroides_dorei	6.9547938400
+UniRef90_R7NYB6|g__Bacteroides.s__Bacteroides_vulgatus	2.9806259314
+UniRef90_A6KZJ3	9.9009900990
+UniRef90_A6KZJ3|g__Bacteroides.s__Bacteroides_vulgatus	6.6006600660
+UniRef90_A6KZJ3|g__Bacteroides.s__Bacteroides_dorei	3.3003300330
+UniRef90_A6L1J3	9.8039215686
+UniRef90_A6L1J3|g__Bacteroides.s__Bacteroides_vulgatus	9.8039215686
+UniRef90_I8VHT2	9.8039215686
+UniRef90_I8VHT2|g__Bacteroides.s__Bacteroides_dorei	9.8039215686
+UniRef90_Q64SB7	9.8039215686
+UniRef90_Q64SB7|g__Bacteroides.s__Bacteroides_dorei	9.8039215686
+UniRef90_R7P0L5	9.8039215686
+UniRef90_R7P0L5|g__Bacteroides.s__Bacteroides_vulgatus	9.8039215686
+UniRef90_R9HMC3	9.8039215686
+UniRef90_R9HMC3|g__Bacteroides.s__Bacteroides_vulgatus	9.8039215686
+UniRef90_A6KZD1	9.7465886940
+UniRef90_A6KZD1|g__Bacteroides.s__Bacteroides_vulgatus	7.7972709552
+UniRef90_A6KZD1|g__Bacteroides.s__Bacteroides_dorei	1.9493177388
+UniRef90_A6KWF9	9.7323600973
+UniRef90_A6KWF9|g__Bacteroides.s__Bacteroides_vulgatus	9.7323600973
+UniRef90_A6LIM8	9.7087378641
+UniRef90_A6LIM8|g__Bacteroides.s__Bacteroides_vulgatus	6.4724919094
+UniRef90_A6LIM8|g__Bacteroides.s__Bacteroides_dorei	3.2362459547
+UniRef90_G1ULH7	9.7087378641
+UniRef90_G1ULH7|g__Bacteroides.s__Bacteroides_dorei	9.7087378641
+UniRef90_A6L3L3	9.6969696970
+UniRef90_A6L3L3|g__Bacteroides.s__Bacteroides_vulgatus	6.0606060606
+UniRef90_A6L3L3|g__Bacteroides.s__Bacteroides_dorei	3.6363636364
+UniRef90_I9TW05	9.6618357488
+UniRef90_I9TW05|g__Bacteroides.s__Bacteroides_vulgatus	9.6618357488
+UniRef90_R6E713	9.6618357488
+UniRef90_R6E713|g__Bacteroides.s__Bacteroides_vulgatus	9.6618357488
+UniRef90_R6HMM6	9.6618357488
+UniRef90_R6HMM6|g__Bacteroides.s__Bacteroides_dorei	9.6618357488
+UniRef90_R6IEA8	9.6618357488
+UniRef90_R6IEA8|g__Bacteroides.s__Bacteroides_vulgatus	7.2463768116
+UniRef90_R6IEA8|g__Bacteroides.s__Bacteroides_dorei	2.4154589372
+UniRef90_R9HD03	9.6618357488
+UniRef90_R9HD03|g__Bacteroides.s__Bacteroides_vulgatus	9.6618357488
+UniRef90_I9QPJ8	9.6339113680
+UniRef90_I9QPJ8|g__Bacteroides.s__Bacteroides_dorei	5.7803468208
+UniRef90_I9QPJ8|g__Bacteroides.s__Bacteroides_vulgatus	3.8535645472
+UniRef90_R6HW91	9.6156606102
+UniRef90_R6HW91|g__Bacteroides.s__Bacteroides_dorei	6.8027210884
+UniRef90_R6HW91|g__Bacteroides.s__Bacteroides_vulgatus	2.8129395218
+UniRef90_A6L3F8	9.5238095238
+UniRef90_A6L3F8|g__Bacteroides.s__Bacteroides_vulgatus	6.3492063492
+UniRef90_A6L3F8|g__Bacteroides.s__Bacteroides_dorei	3.1746031746
+UniRef90_A6L4G6	9.5238095238
+UniRef90_A6L4G6|g__Bacteroides.s__Bacteroides_dorei	9.5238095238
+UniRef90_A6L747	9.5238095238
+UniRef90_A6L747|g__Bacteroides.s__Bacteroides_vulgatus	9.5238095238
+UniRef90_A6LIM9	9.5238095238
+UniRef90_A6LIM9|g__Bacteroides.s__Bacteroides_vulgatus	9.5238095238
+UniRef90_D4VEG7	9.5238095238
+UniRef90_D4VEG7|g__Bacteroides.s__Bacteroides_dorei	4.7619047619
+UniRef90_D4VEG7|g__Bacteroides.s__Bacteroides_vulgatus	4.7619047619
+UniRef90_G1UM27	9.5238095238
+UniRef90_G1UM27|g__Bacteroides.s__Bacteroides_vulgatus	9.5238095238
+UniRef90_I9F8Y2	9.5238095238
+UniRef90_I9F8Y2|g__Bacteroides.s__Bacteroides_dorei	9.5238095238
+UniRef90_R6HK63	9.5238095238
+UniRef90_R6HK63|g__Bacteroides.s__Bacteroides_vulgatus	9.5238095238
+UniRef90_R6HUZ0	9.5238095238
+UniRef90_R6HUZ0|g__Bacteroides.s__Bacteroides_dorei	6.3492063492
+UniRef90_R6HUZ0|g__Bacteroides.s__Bacteroides_vulgatus	3.1746031746
+UniRef90_R6HXN6	9.5238095238
+UniRef90_R6HXN6|g__Bacteroides.s__Bacteroides_dorei	9.5238095238
+UniRef90_V3KIQ1	9.5054275569
+UniRef90_V3KIQ1|unclassified	9.5054275569
+UniRef90_A6KXW1	9.4966761633
+UniRef90_A6KXW1|g__Bacteroides.s__Bacteroides_vulgatus	5.6980056980
+UniRef90_A6KXW1|g__Bacteroides.s__Bacteroides_dorei	3.7986704653
+UniRef90_E1WS10	9.4562647754
+UniRef90_E1WS10|g__Bacteroides.s__Bacteroides_vulgatus	7.0921985816
+UniRef90_E1WS10|g__Bacteroides.s__Bacteroides_dorei	2.3640661939
+UniRef90_A6L6C5	9.4228504122
+UniRef90_A6L6C5|g__Bacteroides.s__Bacteroides_vulgatus	9.4228504122
+UniRef90_R6IM61	9.4161958569
+UniRef90_R6IM61|g__Bacteroides.s__Bacteroides_dorei	9.4161958569
+UniRef90_R6HZ88	9.3896713615
+UniRef90_R6HZ88|g__Bacteroides.s__Bacteroides_dorei	4.6948356808
+UniRef90_R6HZ88|g__Bacteroides.s__Bacteroides_vulgatus	4.6948356808
+UniRef90_A6L2U5	9.3776641091
+UniRef90_A6L2U5|g__Bacteroides.s__Bacteroides_vulgatus	5.1150895141
+UniRef90_A6L2U5|g__Bacteroides.s__Bacteroides_dorei	4.2625745951
+UniRef90_A6L011	9.3240093240
+UniRef90_A6L011|g__Bacteroides.s__Bacteroides_dorei	4.6620046620
+UniRef90_A6L011|g__Bacteroides.s__Bacteroides_vulgatus	4.6620046620
+UniRef90_Z9JXD8	9.3092450619
+UniRef90_Z9JXD8|unclassified	9.3092450619
+UniRef90_C3QUC7	9.2592592593
+UniRef90_C3QUC7|g__Bacteroides.s__Bacteroides_dorei	9.2592592593
+UniRef90_A6L426	9.2592592593
+UniRef90_A6L426|g__Bacteroides.s__Bacteroides_vulgatus	5.5555555556
+UniRef90_A6L426|g__Bacteroides.s__Bacteroides_dorei	3.7037037037
+UniRef90_D6D3L1	9.1954022989
+UniRef90_D6D3L1|g__Bacteroides.s__Bacteroides_dorei	4.5977011494
+UniRef90_D6D3L1|g__Bacteroides.s__Bacteroides_vulgatus	4.5977011494
+UniRef90_Z9JRB3	9.1884719908
+UniRef90_Z9JRB3|unclassified	9.1884719908
+UniRef90_R6SGE3	9.1863517060
+UniRef90_R6SGE3|g__Bacteroides.s__Bacteroides_vulgatus	6.5616797900
+UniRef90_R6SGE3|g__Bacteroides.s__Bacteroides_dorei	2.6246719160
+UniRef90_R7NPP0	9.1827364555
+UniRef90_R7NPP0|g__Bacteroides.s__Bacteroides_vulgatus	6.4279155188
+UniRef90_R7NPP0|g__Bacteroides.s__Bacteroides_dorei	2.7548209366
+UniRef90_R7P473	9.1618806096
+UniRef90_R7P473|g__Bacteroides.s__Bacteroides_vulgatus	7.1231446259
+UniRef90_R7P473|g__Bacteroides.s__Bacteroides_dorei	2.0387359837
+UniRef90_A0A015YC48	9.1324200913
+UniRef90_A0A015YC48|g__Bacteroides.s__Bacteroides_dorei	9.1324200913
+UniRef90_A6KXL2	9.1324200913
+UniRef90_A6KXL2|g__Bacteroides.s__Bacteroides_vulgatus	7.6103500761
+UniRef90_A6KXL2|g__Bacteroides.s__Bacteroides_dorei	1.5220700152
+UniRef90_R6HWN9	9.1324200913
+UniRef90_R6HWN9|g__Bacteroides.s__Bacteroides_dorei	9.1324200913
+UniRef90_D1JZ97	9.1185410334
+UniRef90_D1JZ97|g__Bacteroides.s__Bacteroides_vulgatus	8.1053698075
+UniRef90_D1JZ97|g__Bacteroides.s__Bacteroides_dorei	1.0131712259
+UniRef90_A6L3K4	9.0909090909
+UniRef90_A6L3K4|g__Bacteroides.s__Bacteroides_dorei	4.5454545455
+UniRef90_A6L3K4|g__Bacteroides.s__Bacteroides_vulgatus	4.5454545455
+UniRef90_A6L5W8	9.0909090909
+UniRef90_A6L5W8|g__Bacteroides.s__Bacteroides_vulgatus	9.0909090909
+UniRef90_I8VW20	9.0909090909
+UniRef90_I8VW20|g__Bacteroides.s__Bacteroides_dorei	9.0909090909
+UniRef90_X5M7Z0	9.0719420554
+UniRef90_X5M7Z0|unclassified	9.0719420554
+UniRef90_C3R8N2	9.0702947846
+UniRef90_C3R8N2|g__Bacteroides.s__Bacteroides_dorei	9.0702947846
+UniRef90_A6KX76	9.0090090090
+UniRef90_A6KX76|g__Bacteroides.s__Bacteroides_vulgatus	9.0090090090
+UniRef90_C3PZG9	9.0090090090
+UniRef90_C3PZG9|g__Bacteroides.s__Bacteroides_dorei	9.0090090090
+UniRef90_D1K0P7	9.0090090090
+UniRef90_D1K0P7|g__Bacteroides.s__Bacteroides_dorei	9.0090090090
+UniRef90_K9EB06	9.0090090090
+UniRef90_K9EB06|g__Bacteroides.s__Bacteroides_dorei	9.0090090090
+UniRef90_R6HWJ1	9.0090090090
+UniRef90_R6HWJ1|g__Bacteroides.s__Bacteroides_dorei	6.7567567568
+UniRef90_R6HWJ1|g__Bacteroides.s__Bacteroides_vulgatus	2.2522522523
+UniRef90_R7NWZ3	8.9686098655
+UniRef90_R7NWZ3|g__Bacteroides.s__Bacteroides_dorei	7.4738415546
+UniRef90_R7NWZ3|g__Bacteroides.s__Bacteroides_vulgatus	1.4947683109
+UniRef90_R6IKC9	8.9605734767
+UniRef90_R6IKC9|g__Bacteroides.s__Bacteroides_dorei	7.1684587814
+UniRef90_R6IKC9|g__Bacteroides.s__Bacteroides_vulgatus	1.7921146953
+UniRef90_B8RBV1	8.9493644040
+UniRef90_B8RBV1|unclassified	8.9493644040
+UniRef90_V5V2L3	8.8892176814
+UniRef90_V5V2L3|unclassified	8.8892176814
+UniRef90_A6L2T0	8.8888888889
+UniRef90_A6L2T0|g__Bacteroides.s__Bacteroides_dorei	8.8888888889
+UniRef90_R7P164	8.8888888889
+UniRef90_R7P164|g__Bacteroides.s__Bacteroides_vulgatus	8.8888888889
+UniRef90_R7NQB2	8.8719898606
+UniRef90_R7NQB2|g__Bacteroides.s__Bacteroides_vulgatus	6.3371356147
+UniRef90_R7NQB2|g__Bacteroides.s__Bacteroides_dorei	2.5348542459
+UniRef90_R6HVI9	8.8675927990
+UniRef90_R6HVI9|g__Bacteroides.s__Bacteroides_vulgatus	5.7474679940
+UniRef90_R6HVI9|g__Bacteroides.s__Bacteroides_dorei	3.1201248050
+UniRef90_R7NTM2	8.8652482270
+UniRef90_R7NTM2|g__Bacteroides.s__Bacteroides_dorei	5.3191489362
+UniRef90_R7NTM2|g__Bacteroides.s__Bacteroides_vulgatus	3.5460992908
+UniRef90_A6L7N1	8.8495575221
+UniRef90_A6L7N1|g__Bacteroides.s__Bacteroides_dorei	5.8997050147
+UniRef90_A6L7N1|g__Bacteroides.s__Bacteroides_vulgatus	2.9498525074
+UniRef90_R7P217	8.8300220751
+UniRef90_R7P217|g__Bacteroides.s__Bacteroides_vulgatus	8.8300220751
+UniRef90_A6L4F4	8.8259873373
+UniRef90_A6L4F4|g__Bacteroides.s__Bacteroides_dorei	8.1471007114
+UniRef90_A6L4F4|g__Bacteroides.s__Bacteroides_vulgatus	0.6788866259
+UniRef90_R7P0R2	8.8183421517
+UniRef90_R7P0R2|g__Bacteroides.s__Bacteroides_dorei	5.2910052910
+UniRef90_R7P0R2|g__Bacteroides.s__Bacteroides_vulgatus	3.5273368607
+UniRef90_A6KWI9	8.7719298246
+UniRef90_A6KWI9|g__Bacteroides.s__Bacteroides_vulgatus	5.8479532164
+UniRef90_A6KWI9|g__Bacteroides.s__Bacteroides_dorei	2.9239766082
+UniRef90_A6L7J9	8.7719298246
+UniRef90_A6L7J9|g__Bacteroides.s__Bacteroides_dorei	4.3859649123
+UniRef90_A6L7J9|g__Bacteroides.s__Bacteroides_vulgatus	4.3859649123
+UniRef90_A6L7N5	8.7719298246
+UniRef90_A6L7N5|g__Bacteroides.s__Bacteroides_vulgatus	8.7719298246
+UniRef90_I8ZN39	8.7719298246
+UniRef90_I8ZN39|g__Bacteroides.s__Bacteroides_vulgatus	8.7719298246
+UniRef90_R9ICM0	8.7719298246
+UniRef90_R9ICM0|g__Bacteroides.s__Bacteroides_dorei	8.7719298246
+UniRef90_R6CPE5	8.7449318746
+UniRef90_R6CPE5|g__Bacteroides.s__Bacteroides_vulgatus	5.6179775281
+UniRef90_R6CPE5|g__Bacteroides.s__Bacteroides_dorei	3.1269543465
+UniRef90_Y0KIL9	8.7447954250
+UniRef90_Y0KIL9|unclassified	8.7447954250
+UniRef90_A6L071	8.7209302326
+UniRef90_A6L071|g__Bacteroides.s__Bacteroides_dorei	5.8139534884
+UniRef90_A6L071|g__Bacteroides.s__Bacteroides_vulgatus	2.9069767442
+UniRef90_Q8A8Q1	8.7145969499
+UniRef90_Q8A8Q1|g__Bacteroides.s__Bacteroides_dorei	4.3572984749
+UniRef90_Q8A8Q1|g__Bacteroides.s__Bacteroides_vulgatus	4.3572984749
+UniRef90_A6L2T8	8.7032201915
+UniRef90_A6L2T8|g__Bacteroides.s__Bacteroides_vulgatus	6.0922541340
+UniRef90_A6L2T8|g__Bacteroides.s__Bacteroides_dorei	2.6109660574
+UniRef90_Q650E3	8.7032201915
+UniRef90_Q650E3|g__Bacteroides.s__Bacteroides_dorei	5.2219321149
+UniRef90_Q650E3|g__Bacteroides.s__Bacteroides_vulgatus	3.4812880766
+UniRef90_A6L5I7	8.6956521739
+UniRef90_A6L5I7|g__Bacteroides.s__Bacteroides_dorei	4.3478260870
+UniRef90_A6L5I7|g__Bacteroides.s__Bacteroides_vulgatus	4.3478260870
+UniRef90_A6L541	8.6813097307
+UniRef90_A6L541|g__Bacteroides.s__Bacteroides_vulgatus	5.2090875084
+UniRef90_A6L541|g__Bacteroides.s__Bacteroides_dorei	3.4722222222
+UniRef90_R9HKW4	8.6580086580
+UniRef90_R9HKW4|g__Bacteroides.s__Bacteroides_vulgatus	8.6580086580
+UniRef90_X6L320	8.6463137003
+UniRef90_X6L320|unclassified	8.6463137003
+UniRef90_A6KZS6	8.6355785838
+UniRef90_A6KZS6|g__Bacteroides.s__Bacteroides_dorei	4.3177892919
+UniRef90_A6KZS6|g__Bacteroides.s__Bacteroides_vulgatus	4.3177892919
+UniRef90_I8WPF6	8.6206896552
+UniRef90_I8WPF6|g__Bacteroides.s__Bacteroides_dorei	8.6206896552
+UniRef90_R9H4X2	8.6206896552
+UniRef90_R9H4X2|g__Bacteroides.s__Bacteroides_vulgatus	8.6206896552
+UniRef90_A6L552	8.6027741530
+UniRef90_A6L552|g__Bacteroides.s__Bacteroides_dorei	5.8479532164
+UniRef90_A6L552|g__Bacteroides.s__Bacteroides_vulgatus	2.7548209366
+UniRef90_A6KWX4	8.6021505376
+UniRef90_A6KWX4|g__Bacteroides.s__Bacteroides_vulgatus	7.5268817204
+UniRef90_A6KWX4|g__Bacteroides.s__Bacteroides_dorei	1.0752688172
+UniRef90_A6KXL3	8.5606228756
+UniRef90_A6KXL3|g__Bacteroides.s__Bacteroides_dorei	5.2356020942
+UniRef90_A6KXL3|g__Bacteroides.s__Bacteroides_vulgatus	3.3250207814
+UniRef90_A6L3G3	8.5470085470
+UniRef90_A6L3G3|g__Bacteroides.s__Bacteroides_dorei	5.6980056980
+UniRef90_A6L3G3|g__Bacteroides.s__Bacteroides_vulgatus	2.8490028490
+UniRef90_G1ULJ7	8.5470085470
+UniRef90_G1ULJ7|g__Bacteroides.s__Bacteroides_vulgatus	8.5470085470
+UniRef90_I9Q7S0	8.5470085470
+UniRef90_I9Q7S0|g__Bacteroides.s__Bacteroides_dorei	8.5470085470
+UniRef90_R6HF15	8.5470085470
+UniRef90_R6HF15|g__Bacteroides.s__Bacteroides_dorei	8.5470085470
+UniRef90_E5UWP0	8.5034013605
+UniRef90_E5UWP0|g__Bacteroides.s__Bacteroides_dorei	8.5034013605
+UniRef90_C3PZ85	8.4925690021
+UniRef90_C3PZ85|g__Bacteroides.s__Bacteroides_vulgatus	8.4925690021
+UniRef90_Z9JLB1	8.4767761266
+UniRef90_Z9JLB1|unclassified	8.4767761266
+UniRef90_A6L389	8.4745762712
+UniRef90_A6L389|g__Bacteroides.s__Bacteroides_vulgatus	5.6497175141
+UniRef90_A6L389|g__Bacteroides.s__Bacteroides_dorei	2.8248587571
+UniRef90_C3Q1A4	8.4745762712
+UniRef90_C3Q1A4|g__Bacteroides.s__Bacteroides_dorei	4.2372881356
+UniRef90_C3Q1A4|g__Bacteroides.s__Bacteroides_vulgatus	4.2372881356
+UniRef90_A6L1F0	8.4602368866
+UniRef90_A6L1F0|g__Bacteroides.s__Bacteroides_vulgatus	5.0761421320
+UniRef90_A6L1F0|g__Bacteroides.s__Bacteroides_dorei	3.3840947547
+UniRef90_R7P3B2	8.4602368866
+UniRef90_R7P3B2|g__Bacteroides.s__Bacteroides_vulgatus	6.7681895093
+UniRef90_R7P3B2|g__Bacteroides.s__Bacteroides_dorei	1.6920473773
+UniRef90_D4V6Z2	8.4541062802
+UniRef90_D4V6Z2|g__Bacteroides.s__Bacteroides_dorei	7.2463768116
+UniRef90_D4V6Z2|g__Bacteroides.s__Bacteroides_vulgatus	1.2077294686
+UniRef90_R7NQ41	8.4541062802
+UniRef90_R7NQ41|g__Bacteroides.s__Bacteroides_vulgatus	8.4541062802
+UniRef90_R6HXQ6	8.4485407066
+UniRef90_R6HXQ6|g__Bacteroides.s__Bacteroides_dorei	4.6082949309
+UniRef90_R6HXQ6|g__Bacteroides.s__Bacteroides_vulgatus	3.8402457757
+UniRef90_A0A015VSY3	8.4388185654
+UniRef90_A0A015VSY3|g__Bacteroides.s__Bacteroides_dorei	5.6258790436
+UniRef90_A0A015VSY3|g__Bacteroides.s__Bacteroides_vulgatus	2.8129395218
+UniRef90_A6L4R5	8.4388185654
+UniRef90_A6L4R5|g__Bacteroides.s__Bacteroides_dorei	8.4388185654
+UniRef90_C6Z7R9	8.4388185654
+UniRef90_C6Z7R9|g__Bacteroides.s__Bacteroides_dorei	8.4388185654
+UniRef90_F0R7P9	8.4388185654
+UniRef90_F0R7P9|g__Bacteroides.s__Bacteroides_dorei	8.4388185654
+UniRef90_R6L547	8.4388185654
+UniRef90_R6L547|g__Bacteroides.s__Bacteroides_dorei	8.4388185654
+UniRef90_R6HYJ4	8.4306095979
+UniRef90_R6HYJ4|g__Bacteroides.s__Bacteroides_dorei	4.5395590143
+UniRef90_R6HYJ4|g__Bacteroides.s__Bacteroides_vulgatus	3.8910505837
+UniRef90_Q5L8W2	8.4291187739
+UniRef90_Q5L8W2|g__Bacteroides.s__Bacteroides_dorei	6.1302681992
+UniRef90_Q5L8W2|g__Bacteroides.s__Bacteroides_vulgatus	2.2988505747
+UniRef90_R6HKI1	8.4210526316
+UniRef90_R6HKI1|g__Bacteroides.s__Bacteroides_dorei	6.3157894737
+UniRef90_R6HKI1|g__Bacteroides.s__Bacteroides_vulgatus	2.1052631579
+UniRef90_A6L006	8.4175084175
+UniRef90_A6L006|g__Bacteroides.s__Bacteroides_dorei	4.2087542088
+UniRef90_A6L006|g__Bacteroides.s__Bacteroides_vulgatus	4.2087542088
+UniRef90_A6KZ63	8.3857442348
+UniRef90_A6KZ63|g__Bacteroides.s__Bacteroides_dorei	6.2893081761
+UniRef90_A6KZ63|g__Bacteroides.s__Bacteroides_vulgatus	2.0964360587
+UniRef90_A6L3V6	8.3857442348
+UniRef90_A6L3V6|g__Bacteroides.s__Bacteroides_vulgatus	6.2893081761
+UniRef90_A6L3V6|g__Bacteroides.s__Bacteroides_dorei	2.0964360587
+UniRef90_A6L529	8.3798882682
+UniRef90_A6L529|g__Bacteroides.s__Bacteroides_vulgatus	5.5865921788
+UniRef90_A6L529|g__Bacteroides.s__Bacteroides_dorei	2.7932960894
+UniRef90_A6KY23	8.3752093802
+UniRef90_A6KY23|g__Bacteroides.s__Bacteroides_dorei	6.7001675042
+UniRef90_A6KY23|g__Bacteroides.s__Bacteroides_vulgatus	1.6750418760
+UniRef90_S3ZHA6	8.3597446144
+UniRef90_S3ZHA6|g__Bacteroides.s__Bacteroides_vulgatus	5.6497175141
+UniRef90_S3ZHA6|g__Bacteroides.s__Bacteroides_dorei	2.7100271003
+UniRef90_A6KWC1	8.3542188805
+UniRef90_A6KWC1|g__Bacteroides.s__Bacteroides_vulgatus	5.0125313283
+UniRef90_A6KWC1|g__Bacteroides.s__Bacteroides_dorei	3.3416875522
+UniRef90_A6L4L7	8.3507306889
+UniRef90_A6L4L7|g__Bacteroides.s__Bacteroides_dorei	4.1753653445
+UniRef90_A6L4L7|g__Bacteroides.s__Bacteroides_vulgatus	4.1753653445
+UniRef90_D4VKI7	8.3493898523
+UniRef90_D4VKI7|g__Bacteroides.s__Bacteroides_vulgatus	4.4958253051
+UniRef90_D4VKI7|g__Bacteroides.s__Bacteroides_dorei	3.8535645472
+UniRef90_A6KZ79	8.3333333333
+UniRef90_A6KZ79|g__Bacteroides.s__Bacteroides_dorei	4.1666666667
+UniRef90_A6KZ79|g__Bacteroides.s__Bacteroides_vulgatus	4.1666666667
+UniRef90_A6KZY3	8.3333333333
+UniRef90_A6KZY3|g__Bacteroides.s__Bacteroides_vulgatus	8.3333333333
+UniRef90_A6L7N9	8.3333333333
+UniRef90_A6L7N9|g__Bacteroides.s__Bacteroides_vulgatus	6.2500000000
+UniRef90_A6L7N9|g__Bacteroides.s__Bacteroides_dorei	2.0833333333
+UniRef90_D1K2Z4	8.3333333333
+UniRef90_D1K2Z4|g__Bacteroides.s__Bacteroides_dorei	8.3333333333
+UniRef90_R7P1D1	8.3333333333
+UniRef90_R7P1D1|g__Bacteroides.s__Bacteroides_dorei	8.3333333333
+UniRef90_R7P1H7	8.3333333333
+UniRef90_R7P1H7|g__Bacteroides.s__Bacteroides_vulgatus	8.3333333333
+UniRef90_R9H8Y2	8.3333333333
+UniRef90_R9H8Y2|g__Bacteroides.s__Bacteroides_vulgatus	8.3333333333
+UniRef90_C6Z4Y7	8.2987551867
+UniRef90_C6Z4Y7|g__Bacteroides.s__Bacteroides_dorei	8.2987551867
+UniRef90_R6CIY6	8.2987551867
+UniRef90_R6CIY6|g__Bacteroides.s__Bacteroides_dorei	8.2987551867
+UniRef90_A6L1Q1	8.2644628099
+UniRef90_A6L1Q1|g__Bacteroides.s__Bacteroides_vulgatus	8.2644628099
+UniRef90_R9HXI8	8.2644628099
+UniRef90_R9HXI8|g__Bacteroides.s__Bacteroides_vulgatus	8.2644628099
+UniRef90_R7P281	8.2593936950
+UniRef90_R7P281|g__Bacteroides.s__Bacteroides_dorei	6.8226120858
+UniRef90_R7P281|g__Bacteroides.s__Bacteroides_vulgatus	1.4367816092
+UniRef90_R6HWL6	8.2582582583
+UniRef90_R6HWL6|g__Bacteroides.s__Bacteroides_dorei	6.0060060060
+UniRef90_R6HWL6|g__Bacteroides.s__Bacteroides_vulgatus	2.2522522523
+UniRef90_A6L4J4	8.2361380088
+UniRef90_A6L4J4|g__Bacteroides.s__Bacteroides_vulgatus	6.7900064108
+UniRef90_A6L4J4|g__Bacteroides.s__Bacteroides_dorei	1.4461315980
+UniRef90_A6KYK0	8.2304526749
+UniRef90_A6KYK0|g__Bacteroides.s__Bacteroides_dorei	4.1152263374
+UniRef90_A6KYK0|g__Bacteroides.s__Bacteroides_vulgatus	4.1152263374
+UniRef90_C3Q122	8.2304526749
+UniRef90_C3Q122|g__Bacteroides.s__Bacteroides_dorei	8.2304526749
+UniRef90_Q650E8	8.2304526749
+UniRef90_Q650E8|g__Bacteroides.s__Bacteroides_dorei	8.2304526749
+UniRef90_R6HJS6	8.2304526749
+UniRef90_R6HJS6|g__Bacteroides.s__Bacteroides_dorei	8.2304526749
+UniRef90_R6HZG1	8.2304526749
+UniRef90_R6HZG1|g__Bacteroides.s__Bacteroides_dorei	8.2304526749
+UniRef90_R6IKT0	8.2304526749
+UniRef90_R6IKT0|g__Bacteroides.s__Bacteroides_dorei	8.2304526749
+UniRef90_R7NVW6	8.2177709296
+UniRef90_R7NVW6|g__Bacteroides.s__Bacteroides_dorei	6.1633281972
+UniRef90_R7NVW6|g__Bacteroides.s__Bacteroides_vulgatus	2.0544427324
+UniRef90_A6L9X4	8.2101806240
+UniRef90_A6L9X4|g__Bacteroides.s__Bacteroides_dorei	8.2101806240
+UniRef90_A6L1B0	8.2077258875
+UniRef90_A6L1B0|g__Bacteroides.s__Bacteroides_dorei	5.8685446009
+UniRef90_A6L1B0|g__Bacteroides.s__Bacteroides_vulgatus	2.3391812865
+UniRef90_I8WC86	8.1967213115
+UniRef90_I8WC86|g__Bacteroides.s__Bacteroides_dorei	8.1967213115
+UniRef90_K5XYZ0	8.1967213115
+UniRef90_K5XYZ0|g__Bacteroides.s__Bacteroides_vulgatus	6.8306010929
+UniRef90_K5XYZ0|g__Bacteroides.s__Bacteroides_dorei	1.3661202186
+UniRef90_R7NXC6	8.1845238095
+UniRef90_R7NXC6|g__Bacteroides.s__Bacteroides_dorei	5.9523809524
+UniRef90_R7NXC6|g__Bacteroides.s__Bacteroides_vulgatus	2.2321428571
+UniRef90_R6HVJ8	8.1837323217
+UniRef90_R6HVJ8|g__Bacteroides.s__Bacteroides_vulgatus	4.1797283177
+UniRef90_R6HVJ8|g__Bacteroides.s__Bacteroides_dorei	4.0040040040
+UniRef90_A6L168	8.1799591002
+UniRef90_A6L168|g__Bacteroides.s__Bacteroides_dorei	4.0899795501
+UniRef90_A6L168|g__Bacteroides.s__Bacteroides_vulgatus	4.0899795501
+UniRef90_R9HAL3	8.1799591002
+UniRef90_R9HAL3|g__Bacteroides.s__Bacteroides_dorei	8.1799591002
+UniRef90_A6KXG5	8.1743869210
+UniRef90_A6KXG5|g__Bacteroides.s__Bacteroides_vulgatus	5.4495912807
+UniRef90_A6KXG5|g__Bacteroides.s__Bacteroides_dorei	2.7247956403
+UniRef90_R7NZW0	8.1632653061
+UniRef90_R7NZW0|g__Bacteroides.s__Bacteroides_vulgatus	5.4421768707
+UniRef90_R7NZW0|g__Bacteroides.s__Bacteroides_dorei	2.7210884354
+UniRef90_A6L5K0	8.1300813008
+UniRef90_A6L5K0|g__Bacteroides.s__Bacteroides_dorei	8.1300813008
+UniRef90_C3RBC8	8.1300813008
+UniRef90_C3RBC8|g__Bacteroides.s__Bacteroides_vulgatus	8.1300813008
+UniRef90_D1K6A6	8.1300813008
+UniRef90_D1K6A6|g__Bacteroides.s__Bacteroides_dorei	8.1300813008
+UniRef90_I8WIA2	8.1300813008
+UniRef90_I8WIA2|g__Bacteroides.s__Bacteroides_dorei	8.1300813008
+UniRef90_Q650H0	8.1300813008
+UniRef90_Q650H0|g__Bacteroides.s__Bacteroides_vulgatus	8.1300813008
+UniRef90_R5J2D6	8.1300813008
+UniRef90_R5J2D6|g__Bacteroides.s__Bacteroides_dorei	8.1300813008
+UniRef90_R9HLN7	8.1300813008
+UniRef90_R9HLN7|g__Bacteroides.s__Bacteroides_vulgatus	8.1300813008
+UniRef90_A6KY30	8.1136236464
+UniRef90_A6KY30|g__Bacteroides.s__Bacteroides_dorei	4.0650406504
+UniRef90_A6KY30|g__Bacteroides.s__Bacteroides_vulgatus	4.0485829960
+UniRef90_R6HLJ0	8.0945519256
+UniRef90_R6HLJ0|g__Bacteroides.s__Bacteroides_vulgatus	6.4724919094
+UniRef90_R6HLJ0|g__Bacteroides.s__Bacteroides_dorei	1.6220600162
+UniRef90_R6IL92	8.0917645573
+UniRef90_R6IL92|g__Bacteroides.s__Bacteroides_dorei	4.8076923077
+UniRef90_R6IL92|g__Bacteroides.s__Bacteroides_vulgatus	3.2840722496
+UniRef90_A6L6D0	8.0384322679
+UniRef90_A6L6D0|g__Bacteroides.s__Bacteroides_dorei	4.0588533739
+UniRef90_A6L6D0|g__Bacteroides.s__Bacteroides_vulgatus	3.9795788940
+UniRef90_A6L575	8.0321285141
+UniRef90_A6L575|g__Bacteroides.s__Bacteroides_dorei	4.0160642570
+UniRef90_A6L575|g__Bacteroides.s__Bacteroides_vulgatus	4.0160642570
+UniRef90_A6L7L7	8.0321285141
+UniRef90_A6L7L7|g__Bacteroides.s__Bacteroides_dorei	6.6934404284
+UniRef90_A6L7L7|g__Bacteroides.s__Bacteroides_vulgatus	1.3386880857
+UniRef90_C6ZAZ9	8.0321285141
+UniRef90_C6ZAZ9|g__Bacteroides.s__Bacteroides_dorei	8.0321285141
+UniRef90_R6IFB1	8.0321285141
+UniRef90_R6IFB1|g__Bacteroides.s__Bacteroides_dorei	8.0321285141
+UniRef90_R7NZN5	8.0321285141
+UniRef90_R7NZN5|g__Bacteroides.s__Bacteroides_dorei	8.0321285141
+UniRef90_R9HF30	8.0321285141
+UniRef90_R9HF30|g__Bacteroides.s__Bacteroides_vulgatus	8.0321285141
+UniRef90_A6L4M8	8.0238688373
+UniRef90_A6L4M8|g__Bacteroides.s__Bacteroides_dorei	4.0650406504
+UniRef90_A6L4M8|g__Bacteroides.s__Bacteroides_vulgatus	3.9588281869
+UniRef90_R6HQ62	8.0128205128
+UniRef90_R6HQ62|g__Bacteroides.s__Bacteroides_vulgatus	4.8076923077
+UniRef90_R6HQ62|g__Bacteroides.s__Bacteroides_dorei	3.2051282051
+UniRef90_A6L5C5	8.0128205128
+UniRef90_A6L5C5|g__Bacteroides.s__Bacteroides_dorei	6.4102564103
+UniRef90_A6L5C5|g__Bacteroides.s__Bacteroides_vulgatus	1.6025641026
+UniRef90_I8UQG2	8.0128205128
+UniRef90_I8UQG2|g__Bacteroides.s__Bacteroides_dorei	8.0128205128
+UniRef90_R6HM00	8.0128205128
+UniRef90_R6HM00|g__Bacteroides.s__Bacteroides_dorei	4.8076923077
+UniRef90_R6HM00|g__Bacteroides.s__Bacteroides_vulgatus	3.2051282051
+UniRef90_K0XFW7	8.0000000000
+UniRef90_K0XFW7|g__Bacteroides.s__Bacteroides_dorei	8.0000000000
+UniRef90_A6KWP6	7.9840319361
+UniRef90_A6KWP6|g__Bacteroides.s__Bacteroides_vulgatus	5.3226879574
+UniRef90_A6KWP6|g__Bacteroides.s__Bacteroides_dorei	2.6613439787
+UniRef90_A6L0Y8	7.9840319361
+UniRef90_A6L0Y8|g__Bacteroides.s__Bacteroides_dorei	4.9900199601
+UniRef90_A6L0Y8|g__Bacteroides.s__Bacteroides_vulgatus	2.9940119760
+UniRef90_A6L2V6	7.9681274900
+UniRef90_A6L2V6|g__Bacteroides.s__Bacteroides_dorei	3.9840637450
+UniRef90_A6L2V6|g__Bacteroides.s__Bacteroides_vulgatus	3.9840637450
+UniRef90_A6KXM8	7.9365079365
+UniRef90_A6KXM8|g__Bacteroides.s__Bacteroides_vulgatus	7.9365079365
+UniRef90_C3R7K6	7.9365079365
+UniRef90_C3R7K6|g__Bacteroides.s__Bacteroides_dorei	7.9365079365
+UniRef90_C3RCK4	7.9365079365
+UniRef90_C3RCK4|g__Bacteroides.s__Bacteroides_dorei	5.9523809524
+UniRef90_C3RCK4|g__Bacteroides.s__Bacteroides_vulgatus	1.9841269841
+UniRef90_D4VC29	7.9365079365
+UniRef90_D4VC29|g__Bacteroides.s__Bacteroides_vulgatus	7.9365079365
+UniRef90_E1WRY2	7.9365079365
+UniRef90_E1WRY2|g__Bacteroides.s__Bacteroides_dorei	7.9365079365
+UniRef90_Q5LEQ3	7.9365079365
+UniRef90_Q5LEQ3|g__Bacteroides.s__Bacteroides_dorei	7.9365079365
+UniRef90_R7P030	7.9365079365
+UniRef90_R7P030|g__Bacteroides.s__Bacteroides_vulgatus	7.9365079365
+UniRef90_R9H4S7	7.9365079365
+UniRef90_R9H4S7|g__Bacteroides.s__Bacteroides_vulgatus	7.9365079365
+UniRef90_R7NZG7	7.9365079365
+UniRef90_R7NZG7|g__Bacteroides.s__Bacteroides_dorei	7.9365079365
+UniRef90_A6KY00	7.9051383399
+UniRef90_A6KY00|g__Bacteroides.s__Bacteroides_dorei	5.2700922266
+UniRef90_A6KY00|g__Bacteroides.s__Bacteroides_vulgatus	2.6350461133
+UniRef90_D4V427	7.9051383399
+UniRef90_D4V427|g__Bacteroides.s__Bacteroides_vulgatus	5.2700922266
+UniRef90_D4V427|g__Bacteroides.s__Bacteroides_dorei	2.6350461133
+UniRef90_D1K6P7	7.9051383399
+UniRef90_D1K6P7|g__Bacteroides.s__Bacteroides_dorei	7.9051383399
+UniRef90_I9RLN2	7.8895463511
+UniRef90_I9RLN2|g__Bacteroides.s__Bacteroides_dorei	7.8895463511
+UniRef90_R6HF02	7.8740157480
+UniRef90_R6HF02|g__Bacteroides.s__Bacteroides_dorei	4.3744531934
+UniRef90_R6HF02|g__Bacteroides.s__Bacteroides_vulgatus	3.4995625547
+UniRef90_A6KWL0	7.8662733530
+UniRef90_A6KWL0|g__Bacteroides.s__Bacteroides_vulgatus	5.8997050147
+UniRef90_A6KWL0|g__Bacteroides.s__Bacteroides_dorei	1.9665683382
+UniRef90_R7P3T4	7.8431372549
+UniRef90_R7P3T4|g__Bacteroides.s__Bacteroides_vulgatus	6.8627450980
+UniRef90_R7P3T4|g__Bacteroides.s__Bacteroides_dorei	0.9803921569
+UniRef90_R7P1B0	7.8237124532
+UniRef90_R7P1B0|g__Bacteroides.s__Bacteroides_vulgatus	5.5248618785
+UniRef90_R7P1B0|g__Bacteroides.s__Bacteroides_dorei	2.2988505747
+UniRef90_A6KZF7	7.7972709552
+UniRef90_A6KZF7|g__Bacteroides.s__Bacteroides_vulgatus	7.7972709552
+UniRef90_A6L4M5	7.7821011673
+UniRef90_A6L4M5|g__Bacteroides.s__Bacteroides_dorei	5.1880674449
+UniRef90_A6L4M5|g__Bacteroides.s__Bacteroides_vulgatus	2.5940337224
+UniRef90_R7NX80	7.7630121816
+UniRef90_R7NX80|g__Bacteroides.s__Bacteroides_dorei	4.4296788483
+UniRef90_R7NX80|g__Bacteroides.s__Bacteroides_vulgatus	3.3333333333
+UniRef90_A0A015UU70	7.7519379845
+UniRef90_A0A015UU70|g__Bacteroides.s__Bacteroides_dorei	7.7519379845
+UniRef90_A6KXG9	7.7519379845
+UniRef90_A6KXG9|g__Bacteroides.s__Bacteroides_dorei	5.8139534884
+UniRef90_A6KXG9|g__Bacteroides.s__Bacteroides_vulgatus	1.9379844961
+UniRef90_A6L7K7	7.7519379845
+UniRef90_A6L7K7|g__Bacteroides.s__Bacteroides_dorei	7.7519379845
+UniRef90_C3QU73	7.7519379845
+UniRef90_C3QU73|g__Bacteroides.s__Bacteroides_dorei	7.7519379845
+UniRef90_E5UNJ3	7.7519379845
+UniRef90_E5UNJ3|g__Bacteroides.s__Bacteroides_vulgatus	7.7519379845
+UniRef90_G1UM25	7.7519379845
+UniRef90_G1UM25|g__Bacteroides.s__Bacteroides_dorei	7.7519379845
+UniRef90_R7NYN1	7.7519379845
+UniRef90_R7NYN1|g__Bacteroides.s__Bacteroides_vulgatus	7.7519379845
+UniRef90_A6KWR6	7.7390823659
+UniRef90_A6KWR6|g__Bacteroides.s__Bacteroides_vulgatus	7.7390823659
+UniRef90_A6L3D7	7.7262693157
+UniRef90_A6L3D7|g__Bacteroides.s__Bacteroides_dorei	5.5187637969
+UniRef90_A6L3D7|g__Bacteroides.s__Bacteroides_vulgatus	2.2075055188
+UniRef90_I9F753	7.7160493827
+UniRef90_I9F753|g__Bacteroides.s__Bacteroides_dorei	7.7160493827
+UniRef90_B5A7G1	7.7121077121
+UniRef90_B5A7G1|g__Bacteroides.s__Bacteroides_vulgatus	5.1480051480
+UniRef90_B5A7G1|g__Bacteroides.s__Bacteroides_dorei	2.5641025641
+UniRef90_R7NQL1	7.7120822622
+UniRef90_R7NQL1|g__Bacteroides.s__Bacteroides_vulgatus	4.2844901457
+UniRef90_R7NQL1|g__Bacteroides.s__Bacteroides_dorei	3.4275921165
+UniRef90_R6HW47	7.7071290944
+UniRef90_R6HW47|g__Bacteroides.s__Bacteroides_vulgatus	7.7071290944
+UniRef90_Q8A8R2	7.6804915515
+UniRef90_Q8A8R2|g__Bacteroides.s__Bacteroides_dorei	6.1443932412
+UniRef90_Q8A8R2|g__Bacteroides.s__Bacteroides_vulgatus	1.5360983103
+UniRef90_R7P1A4	7.6726342711
+UniRef90_R7P1A4|g__Bacteroides.s__Bacteroides_dorei	7.6726342711
+UniRef90_A6KYL1	7.6628352490
+UniRef90_A6KYL1|g__Bacteroides.s__Bacteroides_dorei	7.6628352490
+UniRef90_A6L2I5	7.6502732240
+UniRef90_A6L2I5|g__Bacteroides.s__Bacteroides_dorei	5.4644808743
+UniRef90_A6L2I5|g__Bacteroides.s__Bacteroides_vulgatus	2.1857923497
+UniRef90_I9EFG1	7.6190476190
+UniRef90_I9EFG1|g__Bacteroides.s__Bacteroides_dorei	7.6190476190
+UniRef90_I8XXP3	7.6103500761
+UniRef90_I8XXP3|g__Bacteroides.s__Bacteroides_dorei	7.6103500761
+UniRef90_Q64RB2	7.6045627376
+UniRef90_Q64RB2|g__Bacteroides.s__Bacteroides_dorei	5.0697084918
+UniRef90_Q64RB2|g__Bacteroides.s__Bacteroides_vulgatus	2.5348542459
+UniRef90_Q8A1A1	7.6016145022
+UniRef90_Q8A1A1|g__Bacteroides.s__Bacteroides_vulgatus	4.3442855120
+UniRef90_Q8A1A1|g__Bacteroides.s__Bacteroides_dorei	3.2573289902
+UniRef90_R7P2Z3	7.5949610170
+UniRef90_R7P2Z3|g__Bacteroides.s__Bacteroides_dorei	5.0697084918
+UniRef90_R7P2Z3|g__Bacteroides.s__Bacteroides_vulgatus	2.5252525253
+UniRef90_R7NYR4	7.5757575758
+UniRef90_R7NYR4|g__Bacteroides.s__Bacteroides_dorei	4.2087542088
+UniRef90_R7NYR4|g__Bacteroides.s__Bacteroides_vulgatus	3.3670033670
+UniRef90_A6L9Y2	7.5757575758
+UniRef90_A6L9Y2|g__Bacteroides.s__Bacteroides_dorei	7.5757575758
+UniRef90_D4VBR9	7.5757575758
+UniRef90_D4VBR9|g__Bacteroides.s__Bacteroides_vulgatus	7.5757575758
+UniRef90_E4W393	7.5757575758
+UniRef90_E4W393|g__Bacteroides.s__Bacteroides_dorei	7.5757575758
+UniRef90_I9F7Q5	7.5757575758
+UniRef90_I9F7Q5|g__Bacteroides.s__Bacteroides_dorei	7.5757575758
+UniRef90_I9FX09	7.5757575758
+UniRef90_I9FX09|g__Bacteroides.s__Bacteroides_dorei	7.5757575758
+UniRef90_R6HKR1	7.5757575758
+UniRef90_R6HKR1|g__Bacteroides.s__Bacteroides_dorei	7.5757575758
+UniRef90_R6MNH0	7.5757575758
+UniRef90_R6MNH0|g__Bacteroides.s__Bacteroides_dorei	5.4112554113
+UniRef90_R6MNH0|g__Bacteroides.s__Bacteroides_vulgatus	2.1645021645
+UniRef90_R9HMC4	7.5757575758
+UniRef90_R9HMC4|g__Bacteroides.s__Bacteroides_vulgatus	7.5757575758
+UniRef90_R9HNK6	7.5757575758
+UniRef90_R9HNK6|g__Bacteroides.s__Bacteroides_vulgatus	7.5757575758
+UniRef90_R9HVL1	7.5757575758
+UniRef90_R9HVL1|g__Bacteroides.s__Bacteroides_vulgatus	7.5757575758
+UniRef90_A6L239	7.5187969925
+UniRef90_A6L239|g__Bacteroides.s__Bacteroides_dorei	4.1771094403
+UniRef90_A6L239|g__Bacteroides.s__Bacteroides_vulgatus	3.3416875522
+UniRef90_C3Q269	7.5187969925
+UniRef90_C3Q269|g__Bacteroides.s__Bacteroides_dorei	7.5187969925
+UniRef90_R7NZX1	7.5187969925
+UniRef90_R7NZX1|g__Bacteroides.s__Bacteroides_vulgatus	7.5187969925
+UniRef90_R9HCG2	7.5187969925
+UniRef90_R9HCG2|g__Bacteroides.s__Bacteroides_vulgatus	7.5187969925
+UniRef90_I9J606	7.5075075075
+UniRef90_I9J606|g__Bacteroides.s__Bacteroides_vulgatus	7.5075075075
+UniRef90_R6HWB3	7.4938021185
+UniRef90_R6HWB3|g__Bacteroides.s__Bacteroides_dorei	6.5359477124
+UniRef90_R6HWB3|g__Bacteroides.s__Bacteroides_vulgatus	0.9578544061
+UniRef90_R7P463	7.4906367041
+UniRef90_R7P463|g__Bacteroides.s__Bacteroides_dorei	7.4906367041
+UniRef90_R9HY32	7.4906367041
+UniRef90_R9HY32|g__Bacteroides.s__Bacteroides_vulgatus	7.4906367041
+UniRef90_I9FBU4	7.4906367041
+UniRef90_I9FBU4|g__Bacteroides.s__Bacteroides_dorei	7.4906367041
+UniRef90_I9PII1	7.4906367041
+UniRef90_I9PII1|g__Bacteroides.s__Bacteroides_vulgatus	7.4906367041
+UniRef90_A6KWP0	7.4805596144
+UniRef90_A6KWP0|g__Bacteroides.s__Bacteroides_dorei	4.4910229926
+UniRef90_A6KWP0|g__Bacteroides.s__Bacteroides_vulgatus	2.9895366218
+UniRef90_A6KWL5	7.4738415546
+UniRef90_A6KWL5|g__Bacteroides.s__Bacteroides_dorei	4.4843049327
+UniRef90_A6KWL5|g__Bacteroides.s__Bacteroides_vulgatus	2.9895366218
+UniRef90_Z5XTI9	7.4649158985
+UniRef90_Z5XTI9|unclassified	7.4649158985
+UniRef90_A6L0G4	7.4626865672
+UniRef90_A6L0G4|g__Bacteroides.s__Bacteroides_vulgatus	4.9751243781
+UniRef90_A6L0G4|g__Bacteroides.s__Bacteroides_dorei	2.4875621891
+UniRef90_A6L4M2	7.4626865672
+UniRef90_A6L4M2|g__Bacteroides.s__Bacteroides_vulgatus	7.4626865672
+UniRef90_A6LAD7	7.4487895717
+UniRef90_A6LAD7|g__Bacteroides.s__Bacteroides_dorei	7.4487895717
+UniRef90_R6HVK4	7.4371916048
+UniRef90_R6HVK4|g__Bacteroides.s__Bacteroides_dorei	4.4543429844
+UniRef90_R6HVK4|g__Bacteroides.s__Bacteroides_vulgatus	2.9828486204
+UniRef90_A6L445	7.4309978769
+UniRef90_A6L445|g__Bacteroides.s__Bacteroides_dorei	7.4309978769
+UniRef90_A6L211	7.4074074074
+UniRef90_A6L211|g__Bacteroides.s__Bacteroides_dorei	7.4074074074
+UniRef90_A6L748	7.4074074074
+UniRef90_A6L748|g__Bacteroides.s__Bacteroides_dorei	7.4074074074
+UniRef90_D4VD91	7.4074074074
+UniRef90_D4VD91|g__Bacteroides.s__Bacteroides_vulgatus	7.4074074074
+UniRef90_F0QZ60	7.4074074074
+UniRef90_F0QZ60|g__Bacteroides.s__Bacteroides_dorei	7.4074074074
+UniRef90_R6HHI9	7.4074074074
+UniRef90_R6HHI9|g__Bacteroides.s__Bacteroides_dorei	7.4074074074
+UniRef90_A6KWT2	7.3868882733
+UniRef90_A6KWT2|g__Bacteroides.s__Bacteroides_vulgatus	7.3868882733
+UniRef90_R6HQU8	7.3839662447
+UniRef90_R6HQU8|g__Bacteroides.s__Bacteroides_vulgatus	4.2194092827
+UniRef90_R6HQU8|g__Bacteroides.s__Bacteroides_dorei	3.1645569620
+UniRef90_A6L173	7.3746312684
+UniRef90_A6L173|g__Bacteroides.s__Bacteroides_vulgatus	4.4247787611
+UniRef90_A6L173|g__Bacteroides.s__Bacteroides_dorei	2.9498525074
+UniRef90_R6HWR2	7.3668571569
+UniRef90_R6HWR2|g__Bacteroides.s__Bacteroides_vulgatus	4.7961630695
+UniRef90_R6HWR2|g__Bacteroides.s__Bacteroides_dorei	2.5706940874
+UniRef90_A6L3I9	7.3606729758
+UniRef90_A6L3I9|g__Bacteroides.s__Bacteroides_vulgatus	5.2576235542
+UniRef90_A6L3I9|g__Bacteroides.s__Bacteroides_dorei	2.1030494217
+UniRef90_R6D9R8	7.3529411765
+UniRef90_R6D9R8|g__Bacteroides.s__Bacteroides_vulgatus	4.0849673203
+UniRef90_R6D9R8|g__Bacteroides.s__Bacteroides_dorei	3.2679738562
+UniRef90_R6I0W8	7.3260073260
+UniRef90_R6I0W8|g__Bacteroides.s__Bacteroides_dorei	6.4102564103
+UniRef90_R6I0W8|g__Bacteroides.s__Bacteroides_vulgatus	0.9157509158
+UniRef90_Q64S75	7.3260073260
+UniRef90_Q64S75|g__Bacteroides.s__Bacteroides_dorei	7.3260073260
+UniRef90_Q8A8P0	7.3260073260
+UniRef90_Q8A8P0|g__Bacteroides.s__Bacteroides_dorei	3.6630036630
+UniRef90_Q8A8P0|g__Bacteroides.s__Bacteroides_vulgatus	3.6630036630
+UniRef90_R6HY46	7.3260073260
+UniRef90_R6HY46|g__Bacteroides.s__Bacteroides_dorei	3.6630036630
+UniRef90_R6HY46|g__Bacteroides.s__Bacteroides_vulgatus	3.6630036630
+UniRef90_X7F2P9	7.3126169751
+UniRef90_X7F2P9|unclassified	7.3126169751
+UniRef90_R6HM85	7.3041168659
+UniRef90_R6HM85|g__Bacteroides.s__Bacteroides_dorei	4.6480743692
+UniRef90_R6HM85|g__Bacteroides.s__Bacteroides_vulgatus	2.6560424967
+UniRef90_Q8A4S9	7.2992700730
+UniRef90_Q8A4S9|g__Bacteroides.s__Bacteroides_vulgatus	7.2992700730
+UniRef90_I9PJ79	7.2859744991
+UniRef90_I9PJ79|g__Bacteroides.s__Bacteroides_dorei	7.2859744991
+UniRef90_R6HI26	7.2662826761
+UniRef90_R6HI26|g__Bacteroides.s__Bacteroides_dorei	7.2662826761
+UniRef90_A6L3J7	7.2661217075
+UniRef90_A6L3J7|g__Bacteroides.s__Bacteroides_dorei	3.6330608538
+UniRef90_A6L3J7|g__Bacteroides.s__Bacteroides_vulgatus	3.6330608538
+UniRef90_A6L3W8	7.2463768116
+UniRef90_A6L3W8|g__Bacteroides.s__Bacteroides_vulgatus	4.0257648953
+UniRef90_A6L3W8|g__Bacteroides.s__Bacteroides_dorei	3.2206119163
+UniRef90_R6HY02	7.2463768116
+UniRef90_R6HY02|g__Bacteroides.s__Bacteroides_dorei	4.8309178744
+UniRef90_R6HY02|g__Bacteroides.s__Bacteroides_vulgatus	2.4154589372
+UniRef90_R9HQP6	7.2463768116
+UniRef90_R9HQP6|g__Bacteroides.s__Bacteroides_vulgatus	7.2463768116
+UniRef90_C3RD71	7.2463768116
+UniRef90_C3RD71|g__Bacteroides.s__Bacteroides_vulgatus	7.2463768116
+UniRef90_I9F9A4	7.2463768116
+UniRef90_I9F9A4|g__Bacteroides.s__Bacteroides_dorei	7.2463768116
+UniRef90_R6IK81	7.2463768116
+UniRef90_R6IK81|g__Bacteroides.s__Bacteroides_dorei	7.2463768116
+UniRef90_R7P1X6	7.2463768116
+UniRef90_R7P1X6|g__Bacteroides.s__Bacteroides_vulgatus	7.2463768116
+UniRef90_R9H1R7	7.2463768116
+UniRef90_R9H1R7|g__Bacteroides.s__Bacteroides_vulgatus	7.2463768116
+UniRef90_R9HNE3	7.2463768116
+UniRef90_R9HNE3|g__Bacteroides.s__Bacteroides_vulgatus	7.2463768116
+UniRef90_A6L432	7.2289156627
+UniRef90_A6L432|g__Bacteroides.s__Bacteroides_vulgatus	5.6224899598
+UniRef90_A6L432|g__Bacteroides.s__Bacteroides_dorei	1.6064257028
+UniRef90_A6L7R9	7.2202166065
+UniRef90_A6L7R9|g__Bacteroides.s__Bacteroides_vulgatus	7.2202166065
+UniRef90_A6KX02	7.1877807727
+UniRef90_A6KX02|g__Bacteroides.s__Bacteroides_dorei	3.5938903863
+UniRef90_A6KX02|g__Bacteroides.s__Bacteroides_vulgatus	3.5938903863
+UniRef90_F0R8Z6	7.1770334928
+UniRef90_F0R8Z6|g__Bacteroides.s__Bacteroides_vulgatus	3.9872408293
+UniRef90_F0R8Z6|g__Bacteroides.s__Bacteroides_dorei	3.1897926635
+UniRef90_A6L4G2	7.1684587814
+UniRef90_A6L4G2|g__Bacteroides.s__Bacteroides_vulgatus	7.1684587814
+UniRef90_R6IEL1	7.1684587814
+UniRef90_R6IEL1|g__Bacteroides.s__Bacteroides_vulgatus	7.1684587814
+UniRef90_R7ECL2	7.1684587814
+UniRef90_R7ECL2|g__Bacteroides.s__Bacteroides_dorei	7.1684587814
+UniRef90_C3Q1B3	7.1492403932
+UniRef90_C3Q1B3|g__Bacteroides.s__Bacteroides_dorei	5.3619302949
+UniRef90_C3Q1B3|g__Bacteroides.s__Bacteroides_vulgatus	1.7873100983
+UniRef90_U2CVX4	7.1377587438
+UniRef90_U2CVX4|g__Bacteroides.s__Bacteroides_dorei	7.1377587438
+UniRef90_R6HUC6	7.1297684491
+UniRef90_R6HUC6|g__Bacteroides.s__Bacteroides_dorei	4.8309178744
+UniRef90_R6HUC6|g__Bacteroides.s__Bacteroides_vulgatus	2.2988505747
+UniRef90_R6IK75	7.1185800604
+UniRef90_R6IK75|g__Bacteroides.s__Bacteroides_vulgatus	5.0352467271
+UniRef90_R6IK75|g__Bacteroides.s__Bacteroides_dorei	2.0833333333
+UniRef90_C3Q007	7.0921985816
+UniRef90_C3Q007|g__Bacteroides.s__Bacteroides_dorei	7.0921985816
+UniRef90_C3R6S7	7.0921985816
+UniRef90_C3R6S7|g__Bacteroides.s__Bacteroides_dorei	7.0921985816
+UniRef90_C6ZAZ8	7.0921985816
+UniRef90_C6ZAZ8|g__Bacteroides.s__Bacteroides_dorei	7.0921985816
+UniRef90_D1JXI7	7.0921985816
+UniRef90_D1JXI7|g__Bacteroides.s__Bacteroides_dorei	7.0921985816
+UniRef90_I9UIP8	7.0921985816
+UniRef90_I9UIP8|g__Bacteroides.s__Bacteroides_vulgatus	7.0921985816
+UniRef90_Q64S87	7.0921985816
+UniRef90_Q64S87|g__Bacteroides.s__Bacteroides_dorei	7.0921985816
+UniRef90_R6HIA6	7.0921985816
+UniRef90_R6HIA6|g__Bacteroides.s__Bacteroides_vulgatus	7.0921985816
+UniRef90_R7P0C0	7.0733863837
+UniRef90_R7P0C0|g__Bacteroides.s__Bacteroides_vulgatus	6.1892130858
+UniRef90_R7P0C0|g__Bacteroides.s__Bacteroides_dorei	0.8841732980
+UniRef90_A6L7A5	7.0671378092
+UniRef90_A6L7A5|g__Bacteroides.s__Bacteroides_dorei	5.8892815077
+UniRef90_A6L7A5|g__Bacteroides.s__Bacteroides_vulgatus	1.1778563015
+UniRef90_E1WT36	7.0621468927
+UniRef90_E1WT36|g__Bacteroides.s__Bacteroides_vulgatus	7.0621468927
+UniRef90_E6SQG4	7.0546737213
+UniRef90_E6SQG4|g__Bacteroides.s__Bacteroides_dorei	3.5273368607
+UniRef90_E6SQG4|g__Bacteroides.s__Bacteroides_vulgatus	3.5273368607
+UniRef90_R6HL00	7.0546737213
+UniRef90_R6HL00|g__Bacteroides.s__Bacteroides_dorei	7.0546737213
+UniRef90_A6L729	7.0340751762
+UniRef90_A6L729|g__Bacteroides.s__Bacteroides_vulgatus	4.6783625731
+UniRef90_A6L729|g__Bacteroides.s__Bacteroides_dorei	2.3557126031
+UniRef90_A6KX40	7.0175438596
+UniRef90_A6KX40|g__Bacteroides.s__Bacteroides_dorei	7.0175438596
+UniRef90_A6L005	7.0175438596
+UniRef90_A6L005|g__Bacteroides.s__Bacteroides_dorei	7.0175438596
+UniRef90_A6L6W9	7.0175438596
+UniRef90_A6L6W9|g__Bacteroides.s__Bacteroides_dorei	3.5087719298
+UniRef90_A6L6W9|g__Bacteroides.s__Bacteroides_vulgatus	3.5087719298
+UniRef90_A6L707	7.0175438596
+UniRef90_A6L707|g__Bacteroides.s__Bacteroides_vulgatus	7.0175438596
+UniRef90_F3PGZ6	7.0175438596
+UniRef90_F3PGZ6|g__Bacteroides.s__Bacteroides_dorei	7.0175438596
+UniRef90_Q8ABW1	7.0175438596
+UniRef90_Q8ABW1|g__Bacteroides.s__Bacteroides_vulgatus	7.0175438596
+UniRef90_R6HTM4	7.0175438596
+UniRef90_R6HTM4|g__Bacteroides.s__Bacteroides_dorei	7.0175438596
+UniRef90_A6L5F2	7.0070070070
+UniRef90_A6L5F2|g__Bacteroides.s__Bacteroides_dorei	4.0040040040
+UniRef90_A6L5F2|g__Bacteroides.s__Bacteroides_vulgatus	3.0030030030
+UniRef90_A6L3K1	6.9930069930
+UniRef90_A6L3K1|g__Bacteroides.s__Bacteroides_vulgatus	4.6620046620
+UniRef90_A6L3K1|g__Bacteroides.s__Bacteroides_dorei	2.3310023310
+UniRef90_R9HL06	6.9808027923
+UniRef90_R9HL06|g__Bacteroides.s__Bacteroides_vulgatus	6.9808027923
+UniRef90_R6HM03	6.9808027923
+UniRef90_R6HM03|g__Bacteroides.s__Bacteroides_dorei	4.0721349622
+UniRef90_R6HM03|g__Bacteroides.s__Bacteroides_vulgatus	2.9086678301
+UniRef90_A6KY25	6.9735006974
+UniRef90_A6KY25|g__Bacteroides.s__Bacteroides_vulgatus	6.9735006974
+UniRef90_R6HXD0	6.9686411150
+UniRef90_R6HXD0|g__Bacteroides.s__Bacteroides_dorei	6.9686411150
+UniRef90_A6L1A7	6.9606319606
+UniRef90_A6L1A7|g__Bacteroides.s__Bacteroides_vulgatus	5.7951307951
+UniRef90_A6L1A7|g__Bacteroides.s__Bacteroides_dorei	1.1655011655
+UniRef90_R6HHG6	6.9457855886
+UniRef90_R6HHG6|g__Bacteroides.s__Bacteroides_vulgatus	4.6296296296
+UniRef90_R6HHG6|g__Bacteroides.s__Bacteroides_dorei	2.3161559590
+UniRef90_A6KXJ4	6.9444444444
+UniRef90_A6KXJ4|g__Bacteroides.s__Bacteroides_dorei	3.4722222222
+UniRef90_A6KXJ4|g__Bacteroides.s__Bacteroides_vulgatus	3.4722222222
+UniRef90_A6L4I4	6.9444444444
+UniRef90_A6L4I4|g__Bacteroides.s__Bacteroides_vulgatus	6.9444444444
+UniRef90_A6L516	6.9444444444
+UniRef90_A6L516|g__Bacteroides.s__Bacteroides_dorei	4.6296296296
+UniRef90_A6L516|g__Bacteroides.s__Bacteroides_vulgatus	2.3148148148
+UniRef90_A6L5F7	6.9444444444
+UniRef90_A6L5F7|g__Bacteroides.s__Bacteroides_dorei	5.5555555556
+UniRef90_A6L5F7|g__Bacteroides.s__Bacteroides_vulgatus	1.3888888889
+UniRef90_C3QQT9	6.9444444444
+UniRef90_C3QQT9|g__Bacteroides.s__Bacteroides_dorei	6.9444444444
+UniRef90_C6ZBQ4	6.9444444444
+UniRef90_C6ZBQ4|g__Bacteroides.s__Bacteroides_dorei	6.9444444444
+UniRef90_I8VKH1	6.9444444444
+UniRef90_I8VKH1|g__Bacteroides.s__Bacteroides_vulgatus	6.9444444444
+UniRef90_I8VW04	6.9444444444
+UniRef90_I8VW04|g__Bacteroides.s__Bacteroides_dorei	6.9444444444
+UniRef90_I9ITD1	6.9444444444
+UniRef90_I9ITD1|g__Bacteroides.s__Bacteroides_vulgatus	6.9444444444
+UniRef90_I9QI28	6.9444444444
+UniRef90_I9QI28|g__Bacteroides.s__Bacteroides_dorei	6.9444444444
+UniRef90_R5U8C1	6.9444444444
+UniRef90_R5U8C1|g__Bacteroides.s__Bacteroides_dorei	6.9444444444
+UniRef90_R6HY29	6.9444444444
+UniRef90_R6HY29|g__Bacteroides.s__Bacteroides_dorei	4.6296296296
+UniRef90_R6HY29|g__Bacteroides.s__Bacteroides_vulgatus	2.3148148148
+UniRef90_R6HZ68	6.9444444444
+UniRef90_R6HZ68|g__Bacteroides.s__Bacteroides_vulgatus	6.9444444444
+UniRef90_R6IJC8	6.9444444444
+UniRef90_R6IJC8|g__Bacteroides.s__Bacteroides_vulgatus	4.6296296296
+UniRef90_R6IJC8|g__Bacteroides.s__Bacteroides_dorei	2.3148148148
+UniRef90_R7P0S1	6.9444444444
+UniRef90_R7P0S1|g__Bacteroides.s__Bacteroides_vulgatus	6.9444444444
+UniRef90_R6HN63	6.9358178054
+UniRef90_R6HN63|g__Bacteroides.s__Bacteroides_dorei	5.5555555556
+UniRef90_R6HN63|g__Bacteroides.s__Bacteroides_vulgatus	1.3802622498
+UniRef90_R6HUW6	6.9300069300
+UniRef90_R6HUW6|g__Bacteroides.s__Bacteroides_dorei	6.9300069300
+UniRef90_R7P2C2	6.9178481041
+UniRef90_R7P2C2|g__Bacteroides.s__Bacteroides_vulgatus	5.0813008130
+UniRef90_R7P2C2|g__Bacteroides.s__Bacteroides_dorei	1.8365472911
+UniRef90_A6KZ30	6.9112174375
+UniRef90_A6KZ30|g__Bacteroides.s__Bacteroides_vulgatus	3.7214247741
+UniRef90_A6KZ30|g__Bacteroides.s__Bacteroides_dorei	3.1897926635
+UniRef90_A6L2J9	6.9084628670
+UniRef90_A6L2J9|g__Bacteroides.s__Bacteroides_dorei	6.9084628670
+UniRef90_R6HT64	6.8988032338
+UniRef90_R6HT64|g__Bacteroides.s__Bacteroides_dorei	4.1152263374
+UniRef90_R6HT64|g__Bacteroides.s__Bacteroides_vulgatus	2.7835768963
+UniRef90_R6HJW0	6.8965517241
+UniRef90_R6HJW0|g__Bacteroides.s__Bacteroides_dorei	6.8965517241
+UniRef90_A6L6Y7	6.8906575503
+UniRef90_A6L6Y7|g__Bacteroides.s__Bacteroides_dorei	3.4542314335
+UniRef90_A6L6Y7|g__Bacteroides.s__Bacteroides_vulgatus	3.4364261168
+UniRef90_R6HW28	6.8829891839
+UniRef90_R6HW28|g__Bacteroides.s__Bacteroides_vulgatus	4.9164208456
+UniRef90_R6HW28|g__Bacteroides.s__Bacteroides_dorei	1.9665683382
+UniRef90_A6L188	6.8728522337
+UniRef90_A6L188|g__Bacteroides.s__Bacteroides_dorei	3.4364261168
+UniRef90_A6L188|g__Bacteroides.s__Bacteroides_vulgatus	3.4364261168
+UniRef90_R7NW86	6.8535825545
+UniRef90_R7NW86|g__Bacteroides.s__Bacteroides_dorei	3.7383177570
+UniRef90_R7NW86|g__Bacteroides.s__Bacteroides_vulgatus	3.1152647975
+UniRef90_A6KWC4	6.8493150685
+UniRef90_A6KWC4|g__Bacteroides.s__Bacteroides_vulgatus	4.5662100457
+UniRef90_A6KWC4|g__Bacteroides.s__Bacteroides_dorei	2.2831050228
+UniRef90_A6L618	6.8493150685
+UniRef90_A6L618|g__Bacteroides.s__Bacteroides_vulgatus	4.5662100457
+UniRef90_A6L618|g__Bacteroides.s__Bacteroides_dorei	2.2831050228
+UniRef90_R7NX56	6.8376068376
+UniRef90_R7NX56|g__Bacteroides.s__Bacteroides_dorei	3.4188034188
+UniRef90_R7NX56|g__Bacteroides.s__Bacteroides_vulgatus	3.4188034188
+UniRef90_A6L628	6.8327799130
+UniRef90_A6L628|g__Bacteroides.s__Bacteroides_dorei	3.6429872495
+UniRef90_A6L628|g__Bacteroides.s__Bacteroides_vulgatus	3.1897926635
+UniRef90_I9RE62	6.8306010929
+UniRef90_I9RE62|g__Bacteroides.s__Bacteroides_dorei	6.8306010929
+UniRef90_R6IK29	6.8306010929
+UniRef90_R6IK29|g__Bacteroides.s__Bacteroides_dorei	6.8306010929
+UniRef90_R6IL62	6.8259385666
+UniRef90_R6IL62|g__Bacteroides.s__Bacteroides_dorei	6.8259385666
+UniRef90_A6L5Y0	6.8027210884
+UniRef90_A6L5Y0|g__Bacteroides.s__Bacteroides_dorei	6.8027210884
+UniRef90_B6W0A3	6.8027210884
+UniRef90_B6W0A3|g__Bacteroides.s__Bacteroides_dorei	6.8027210884
+UniRef90_I9F993	6.8027210884
+UniRef90_I9F993|g__Bacteroides.s__Bacteroides_dorei	6.8027210884
+UniRef90_I9FWX5	6.8027210884
+UniRef90_I9FWX5|g__Bacteroides.s__Bacteroides_dorei	6.8027210884
+UniRef90_R6HH54	6.8027210884
+UniRef90_R6HH54|g__Bacteroides.s__Bacteroides_dorei	3.4013605442
+UniRef90_R6HH54|g__Bacteroides.s__Bacteroides_vulgatus	3.4013605442
+UniRef90_R6HTQ9	6.8027210884
+UniRef90_R6HTQ9|g__Bacteroides.s__Bacteroides_dorei	6.8027210884
+UniRef90_R6VFN8	6.8027210884
+UniRef90_R6VFN8|g__Bacteroides.s__Bacteroides_vulgatus	6.8027210884
+UniRef90_R7P4I7	6.8027210884
+UniRef90_R7P4I7|g__Bacteroides.s__Bacteroides_dorei	6.8027210884
+UniRef90_R9HLL9	6.8027210884
+UniRef90_R9HLL9|g__Bacteroides.s__Bacteroides_vulgatus	6.8027210884
+UniRef90_A6L330	6.7750677507
+UniRef90_A6L330|g__Bacteroides.s__Bacteroides_vulgatus	6.7750677507
+UniRef90_J9H9I5	6.7567567568
+UniRef90_J9H9I5|g__Bacteroides.s__Bacteroides_vulgatus	6.7567567568
+UniRef90_R9HJ01	6.7567567568
+UniRef90_R9HJ01|g__Bacteroides.s__Bacteroides_vulgatus	6.7567567568
+UniRef90_R9HNI7	6.7567567568
+UniRef90_R9HNI7|g__Bacteroides.s__Bacteroides_vulgatus	6.7567567568
+UniRef90_A6L676	6.7415730337
+UniRef90_A6L676|g__Bacteroides.s__Bacteroides_dorei	4.4943820225
+UniRef90_A6L676|g__Bacteroides.s__Bacteroides_vulgatus	2.2471910112
+UniRef90_C3QUB6	6.7340067340
+UniRef90_C3QUB6|g__Bacteroides.s__Bacteroides_dorei	6.7340067340
+UniRef90_D4KV24	6.7340067340
+UniRef90_D4KV24|g__Bacteroides.s__Bacteroides_dorei	6.7340067340
+UniRef90_I8WRK2	6.7340067340
+UniRef90_I8WRK2|g__Bacteroides.s__Bacteroides_dorei	6.7340067340
+UniRef90_R6IFE8	6.7340067340
+UniRef90_R6IFE8|g__Bacteroides.s__Bacteroides_vulgatus	6.7340067340
+UniRef90_R6IHX2	6.7340067340
+UniRef90_R6IHX2|g__Bacteroides.s__Bacteroides_vulgatus	5.0505050505
+UniRef90_R6IHX2|g__Bacteroides.s__Bacteroides_dorei	1.6835016835
+UniRef90_R6I0C9	6.7340067340
+UniRef90_R6I0C9|g__Bacteroides.s__Bacteroides_dorei	4.4893378227
+UniRef90_R6I0C9|g__Bacteroides.s__Bacteroides_vulgatus	2.2446689113
+UniRef90_R7NZN7	6.7340067340
+UniRef90_R7NZN7|g__Bacteroides.s__Bacteroides_dorei	4.0404040404
+UniRef90_R7NZN7|g__Bacteroides.s__Bacteroides_vulgatus	2.6936026936
+UniRef90_A6L790	6.7243035543
+UniRef90_A6L790|g__Bacteroides.s__Bacteroides_dorei	4.8030739673
+UniRef90_A6L790|g__Bacteroides.s__Bacteroides_vulgatus	1.9212295869
+UniRef90_R6HLM2	6.7204301075
+UniRef90_R6HLM2|g__Bacteroides.s__Bacteroides_vulgatus	6.7204301075
+UniRef90_R6HGY5	6.6998260491
+UniRef90_R6HGY5|g__Bacteroides.s__Bacteroides_vulgatus	5.7077625571
+UniRef90_R6HGY5|g__Bacteroides.s__Bacteroides_dorei	0.9920634921
+UniRef90_A6L2N4	6.6934404284
+UniRef90_A6L2N4|g__Bacteroides.s__Bacteroides_dorei	4.0160642570
+UniRef90_A6L2N4|g__Bacteroides.s__Bacteroides_vulgatus	2.6773761714
+UniRef90_R6HEY9	6.6934404284
+UniRef90_R6HEY9|g__Bacteroides.s__Bacteroides_dorei	4.0160642570
+UniRef90_R6HEY9|g__Bacteroides.s__Bacteroides_vulgatus	2.6773761714
+UniRef90_A6KZW6	6.6815144766
+UniRef90_A6KZW6|g__Bacteroides.s__Bacteroides_dorei	3.7119524870
+UniRef90_A6KZW6|g__Bacteroides.s__Bacteroides_vulgatus	2.9695619896
+UniRef90_A6KXR2	6.6666666667
+UniRef90_A6KXR2|g__Bacteroides.s__Bacteroides_dorei	4.1666666667
+UniRef90_A6KXR2|g__Bacteroides.s__Bacteroides_vulgatus	2.5000000000
+UniRef90_A6KZW0	6.6666666667
+UniRef90_A6KZW0|g__Bacteroides.s__Bacteroides_vulgatus	6.6666666667
+UniRef90_A6L025	6.6666666667
+UniRef90_A6L025|g__Bacteroides.s__Bacteroides_dorei	6.6666666667
+UniRef90_A6L3C7	6.6666666667
+UniRef90_A6L3C7|g__Bacteroides.s__Bacteroides_dorei	6.6666666667
+UniRef90_A6L3M5	6.6666666667
+UniRef90_A6L3M5|g__Bacteroides.s__Bacteroides_vulgatus	6.6666666667
+UniRef90_A6L3M7	6.6666666667
+UniRef90_A6L3M7|g__Bacteroides.s__Bacteroides_vulgatus	6.6666666667
+UniRef90_D4V4W8	6.6666666667
+UniRef90_D4V4W8|g__Bacteroides.s__Bacteroides_dorei	4.4444444444
+UniRef90_D4V4W8|g__Bacteroides.s__Bacteroides_vulgatus	2.2222222222
+UniRef90_I9QIA7	6.6666666667
+UniRef90_I9QIA7|g__Bacteroides.s__Bacteroides_dorei	6.6666666667
+UniRef90_R6HYQ2	6.6666666667
+UniRef90_R6HYQ2|g__Bacteroides.s__Bacteroides_dorei	6.6666666667
+UniRef90_R6HZ61	6.6666666667
+UniRef90_R6HZ61|g__Bacteroides.s__Bacteroides_vulgatus	6.6666666667
+UniRef90_R6IKF8	6.6666666667
+UniRef90_R6IKF8|g__Bacteroides.s__Bacteroides_dorei	6.6666666667
+UniRef90_R6HTJ3	6.6612777678
+UniRef90_R6HTJ3|g__Bacteroides.s__Bacteroides_dorei	4.3859649123
+UniRef90_R6HTJ3|g__Bacteroides.s__Bacteroides_vulgatus	2.2753128555
+UniRef90_R6HHI3	6.6555740433
+UniRef90_R6HHI3|g__Bacteroides.s__Bacteroides_dorei	4.9916805324
+UniRef90_R6HHI3|g__Bacteroides.s__Bacteroides_vulgatus	1.6638935108
+UniRef90_A6L1K2	6.6401062417
+UniRef90_A6L1K2|g__Bacteroides.s__Bacteroides_dorei	5.3120849934
+UniRef90_A6L1K2|g__Bacteroides.s__Bacteroides_vulgatus	1.3280212483
+UniRef90_R6HSY9	6.6401062417
+UniRef90_R6HSY9|g__Bacteroides.s__Bacteroides_dorei	3.9840637450
+UniRef90_R6HSY9|g__Bacteroides.s__Bacteroides_vulgatus	2.6560424967
+UniRef90_A6L3H6	6.6334991708
+UniRef90_A6L3H6|g__Bacteroides.s__Bacteroides_dorei	3.3167495854
+UniRef90_A6L3H6|g__Bacteroides.s__Bacteroides_vulgatus	3.3167495854
+UniRef90_A6L4P9	6.6334991708
+UniRef90_A6L4P9|g__Bacteroides.s__Bacteroides_dorei	3.3167495854
+UniRef90_A6L4P9|g__Bacteroides.s__Bacteroides_vulgatus	3.3167495854
+UniRef90_A6L679	6.6334991708
+UniRef90_A6L679|g__Bacteroides.s__Bacteroides_vulgatus	6.6334991708
+UniRef90_E1WRZ5	6.6334991708
+UniRef90_E1WRZ5|g__Bacteroides.s__Bacteroides_dorei	6.6334991708
+UniRef90_I9FWZ5	6.6287878788
+UniRef90_I9FWZ5|g__Bacteroides.s__Bacteroides_dorei	6.6287878788
+UniRef90_Q8A8P5	6.6287878788
+UniRef90_Q8A8P5|g__Bacteroides.s__Bacteroides_dorei	6.6287878788
+UniRef90_A6L0Z4	6.6225165563
+UniRef90_A6L0Z4|g__Bacteroides.s__Bacteroides_vulgatus	4.4150110375
+UniRef90_A6L0Z4|g__Bacteroides.s__Bacteroides_dorei	2.2075055188
+UniRef90_A6L7H8	6.6225165563
+UniRef90_A6L7H8|g__Bacteroides.s__Bacteroides_dorei	3.3112582781
+UniRef90_A6L7H8|g__Bacteroides.s__Bacteroides_vulgatus	3.3112582781
+UniRef90_R6IKG3	6.6225165563
+UniRef90_R6IKG3|g__Bacteroides.s__Bacteroides_dorei	4.4150110375
+UniRef90_R6IKG3|g__Bacteroides.s__Bacteroides_vulgatus	2.2075055188
+UniRef90_R6IFN5	6.6137566138
+UniRef90_R6IFN5|g__Bacteroides.s__Bacteroides_vulgatus	3.9682539683
+UniRef90_R6IFN5|g__Bacteroides.s__Bacteroides_dorei	2.6455026455
+UniRef90_J9CCP1	6.5789473684
+UniRef90_J9CCP1|g__Bacteroides.s__Bacteroides_dorei	6.5789473684
+UniRef90_R7NKA0	6.5789473684
+UniRef90_R7NKA0|g__Bacteroides.s__Bacteroides_vulgatus	6.5789473684
+UniRef90_A6L641	6.5727699531
+UniRef90_A6L641|g__Bacteroides.s__Bacteroides_vulgatus	4.6948356808
+UniRef90_A6L641|g__Bacteroides.s__Bacteroides_dorei	1.8779342723
+UniRef90_R6HYK5	6.5727699531
+UniRef90_R6HYK5|g__Bacteroides.s__Bacteroides_vulgatus	6.5727699531
+UniRef90_R6HWT5	6.5681444992
+UniRef90_R6HWT5|g__Bacteroides.s__Bacteroides_dorei	3.2840722496
+UniRef90_R6HWT5|g__Bacteroides.s__Bacteroides_vulgatus	3.2840722496
+UniRef90_I9QKD2	6.5616797900
+UniRef90_I9QKD2|g__Bacteroides.s__Bacteroides_dorei	6.5616797900
+UniRef90_R7NX92	6.5616797900
+UniRef90_R7NX92|g__Bacteroides.s__Bacteroides_dorei	6.5616797900
+UniRef90_D4V8I2	6.5573770492
+UniRef90_D4V8I2|g__Bacteroides.s__Bacteroides_vulgatus	6.5573770492
+UniRef90_A6KYS0	6.5359477124
+UniRef90_A6KYS0|g__Bacteroides.s__Bacteroides_dorei	5.4466230937
+UniRef90_A6KYS0|g__Bacteroides.s__Bacteroides_vulgatus	1.0893246187
+UniRef90_B3JMD4	6.5359477124
+UniRef90_B3JMD4|g__Bacteroides.s__Bacteroides_dorei	6.5359477124
+UniRef90_D4V972	6.5359477124
+UniRef90_D4V972|g__Bacteroides.s__Bacteroides_vulgatus	6.5359477124
+UniRef90_I9QGG3	6.5359477124
+UniRef90_I9QGG3|g__Bacteroides.s__Bacteroides_dorei	6.5359477124
+UniRef90_Q5L8C1	6.5359477124
+UniRef90_Q5L8C1|g__Bacteroides.s__Bacteroides_vulgatus	6.5359477124
+UniRef90_Q8ABW0	6.5359477124
+UniRef90_Q8ABW0|g__Bacteroides.s__Bacteroides_dorei	5.4466230937
+UniRef90_Q8ABW0|g__Bacteroides.s__Bacteroides_vulgatus	1.0893246187
+UniRef90_R6HFP2	6.5359477124
+UniRef90_R6HFP2|g__Bacteroides.s__Bacteroides_dorei	6.5359477124
+UniRef90_R6HQC2	6.5359477124
+UniRef90_R6HQC2|g__Bacteroides.s__Bacteroides_vulgatus	4.0849673203
+UniRef90_R6HQC2|g__Bacteroides.s__Bacteroides_dorei	2.4509803922
+UniRef90_A6L1I5	6.5199674002
+UniRef90_A6L1I5|g__Bacteroides.s__Bacteroides_vulgatus	4.8899755501
+UniRef90_A6L1I5|g__Bacteroides.s__Bacteroides_dorei	1.6299918500
+UniRef90_I8UPQ2	6.5104166667
+UniRef90_I8UPQ2|g__Bacteroides.s__Bacteroides_vulgatus	6.5104166667
+UniRef90_R6IEN0	6.5005417118
+UniRef90_R6IEN0|g__Bacteroides.s__Bacteroides_dorei	3.6114120621
+UniRef90_R6IEN0|g__Bacteroides.s__Bacteroides_vulgatus	2.8891296497
+UniRef90_R6HRB8	6.4977257960
+UniRef90_R6HRB8|g__Bacteroides.s__Bacteroides_dorei	3.8986354776
+UniRef90_R6HRB8|g__Bacteroides.s__Bacteroides_vulgatus	2.5990903184
+UniRef90_C3REU1	6.4935064935
+UniRef90_C3REU1|g__Bacteroides.s__Bacteroides_vulgatus	6.4935064935
+UniRef90_R6HK07	6.4935064935
+UniRef90_R6HK07|g__Bacteroides.s__Bacteroides_dorei	6.4935064935
+UniRef90_R6HUX4	6.4935064935
+UniRef90_R6HUX4|g__Bacteroides.s__Bacteroides_dorei	6.4935064935
+UniRef90_F0QZ62	6.4882400649
+UniRef90_F0QZ62|g__Bacteroides.s__Bacteroides_dorei	4.8661800487
+UniRef90_F0QZ62|g__Bacteroides.s__Bacteroides_vulgatus	1.6220600162
+UniRef90_F0R092	6.4724919094
+UniRef90_F0R092|g__Bacteroides.s__Bacteroides_vulgatus	4.0453074434
+UniRef90_F0R092|g__Bacteroides.s__Bacteroides_dorei	2.4271844660
+UniRef90_R6IFH0	6.4724919094
+UniRef90_R6IFH0|g__Bacteroides.s__Bacteroides_vulgatus	6.4724919094
+UniRef90_R7NY57	6.4724919094
+UniRef90_R7NY57|g__Bacteroides.s__Bacteroides_dorei	6.4724919094
+UniRef90_R7P1V8	6.4724919094
+UniRef90_R7P1V8|g__Bacteroides.s__Bacteroides_vulgatus	6.4724919094
+UniRef90_I8W181	6.4724919094
+UniRef90_I8W181|g__Bacteroides.s__Bacteroides_dorei	6.4724919094
+UniRef90_C6IR31	6.4412238325
+UniRef90_C6IR31|g__Bacteroides.s__Bacteroides_vulgatus	6.4412238325
+UniRef90_I8W3S8	6.4412238325
+UniRef90_I8W3S8|g__Bacteroides.s__Bacteroides_dorei	6.4412238325
+UniRef90_R6HIA1	6.4308681672
+UniRef90_R6HIA1|g__Bacteroides.s__Bacteroides_dorei	4.2872454448
+UniRef90_R6HIA1|g__Bacteroides.s__Bacteroides_vulgatus	2.1436227224
+UniRef90_R7EL07	6.4214827788
+UniRef90_R7EL07|g__Bacteroides.s__Bacteroides_dorei	6.4214827788
+UniRef90_A6L0Y7	6.4102564103
+UniRef90_A6L0Y7|g__Bacteroides.s__Bacteroides_vulgatus	6.4102564103
+UniRef90_A6L4L8	6.4102564103
+UniRef90_A6L4L8|g__Bacteroides.s__Bacteroides_dorei	6.4102564103
+UniRef90_A6L4M1	6.4102564103
+UniRef90_A6L4M1|g__Bacteroides.s__Bacteroides_vulgatus	6.4102564103
+UniRef90_A6L533	6.4102564103
+UniRef90_A6L533|g__Bacteroides.s__Bacteroides_dorei	4.2735042735
+UniRef90_A6L533|g__Bacteroides.s__Bacteroides_vulgatus	2.1367521368
+UniRef90_I9QJZ0	6.4102564103
+UniRef90_I9QJZ0|g__Bacteroides.s__Bacteroides_dorei	6.4102564103
+UniRef90_J9GSU8	6.4102564103
+UniRef90_J9GSU8|g__Bacteroides.s__Bacteroides_dorei	3.6630036630
+UniRef90_J9GSU8|g__Bacteroides.s__Bacteroides_vulgatus	2.7472527473
+UniRef90_Q8A8S0	6.4102564103
+UniRef90_Q8A8S0|g__Bacteroides.s__Bacteroides_dorei	6.4102564103
+UniRef90_R6HKQ0	6.4102564103
+UniRef90_R6HKQ0|g__Bacteroides.s__Bacteroides_dorei	6.4102564103
+UniRef90_R9HMA0	6.4102564103
+UniRef90_R9HMA0|g__Bacteroides.s__Bacteroides_vulgatus	6.4102564103
+UniRef90_R9HXN9	6.4102564103
+UniRef90_R9HXN9|g__Bacteroides.s__Bacteroides_vulgatus	6.4102564103
+UniRef90_A6L7R1	6.4102564103
+UniRef90_A6L7R1|g__Bacteroides.s__Bacteroides_vulgatus	6.4102564103
+UniRef90_R7NQP2	6.4102564103
+UniRef90_R7NQP2|g__Bacteroides.s__Bacteroides_dorei	3.8461538462
+UniRef90_R7NQP2|g__Bacteroides.s__Bacteroides_vulgatus	2.5641025641
+UniRef90_Q64SI0	6.3795853270
+UniRef90_Q64SI0|g__Bacteroides.s__Bacteroides_dorei	6.3795853270
+UniRef90_R7NZZ1	6.3795853270
+UniRef90_R7NZZ1|g__Bacteroides.s__Bacteroides_vulgatus	6.3795853270
+UniRef90_A6L731	6.3752276867
+UniRef90_A6L731|g__Bacteroides.s__Bacteroides_dorei	3.6429872495
+UniRef90_A6L731|g__Bacteroides.s__Bacteroides_vulgatus	2.7322404372
+UniRef90_A6L0D6	6.3694267516
+UniRef90_A6L0D6|g__Bacteroides.s__Bacteroides_vulgatus	5.6617126681
+UniRef90_A6L0D6|g__Bacteroides.s__Bacteroides_dorei	0.7077140835
+UniRef90_A6L789	6.3694267516
+UniRef90_A6L789|g__Bacteroides.s__Bacteroides_dorei	6.3694267516
+UniRef90_R7P3E1	6.3568552130
+UniRef90_R7P3E1|g__Bacteroides.s__Bacteroides_dorei	3.1897926635
+UniRef90_R7P3E1|g__Bacteroides.s__Bacteroides_vulgatus	3.1670625495
+UniRef90_C3QTI7	6.3492063492
+UniRef90_C3QTI7|g__Bacteroides.s__Bacteroides_dorei	6.3492063492
+UniRef90_F7LXA0	6.3492063492
+UniRef90_F7LXA0|g__Bacteroides.s__Bacteroides_dorei	6.3492063492
+UniRef90_I9IJP9	6.3492063492
+UniRef90_I9IJP9|g__Bacteroides.s__Bacteroides_vulgatus	6.3492063492
+UniRef90_R6HH04	6.3492063492
+UniRef90_R6HH04|g__Bacteroides.s__Bacteroides_vulgatus	6.3492063492
+UniRef90_R7P2E9	6.3492063492
+UniRef90_R7P2E9|g__Bacteroides.s__Bacteroides_dorei	6.3492063492
+UniRef90_I8WEH1	6.3424947146
+UniRef90_I8WEH1|g__Bacteroides.s__Bacteroides_dorei	5.6377730796
+UniRef90_I8WEH1|g__Bacteroides.s__Bacteroides_vulgatus	0.7047216350
+UniRef90_A6L309	6.3419731228
+UniRef90_A6L309|g__Bacteroides.s__Bacteroides_dorei	5.0697084918
+UniRef90_A6L309|g__Bacteroides.s__Bacteroides_vulgatus	1.2722646310
+UniRef90_A6KWJ7	6.3291139241
+UniRef90_A6KWJ7|g__Bacteroides.s__Bacteroides_vulgatus	6.3291139241
+UniRef90_A6L403	6.3291139241
+UniRef90_A6L403|g__Bacteroides.s__Bacteroides_vulgatus	4.2194092827
+UniRef90_A6L403|g__Bacteroides.s__Bacteroides_dorei	2.1097046414
+UniRef90_R7P393	6.3291139241
+UniRef90_R7P393|g__Bacteroides.s__Bacteroides_vulgatus	6.3291139241
+UniRef90_A6L3X3	6.3157894737
+UniRef90_A6L3X3|g__Bacteroides.s__Bacteroides_dorei	4.2105263158
+UniRef90_A6L3X3|g__Bacteroides.s__Bacteroides_vulgatus	2.1052631579
+UniRef90_R5LY84	6.3091482650
+UniRef90_R5LY84|g__Bacteroides.s__Bacteroides_dorei	4.2060988433
+UniRef90_R5LY84|g__Bacteroides.s__Bacteroides_vulgatus	2.1030494217
+UniRef90_A6L3U5	6.3076176613
+UniRef90_A6L3U5|g__Bacteroides.s__Bacteroides_dorei	4.8520135856
+UniRef90_A6L3U5|g__Bacteroides.s__Bacteroides_vulgatus	1.4556040757
+UniRef90_A6L3E5	6.3034188034
+UniRef90_A6L3E5|g__Bacteroides.s__Bacteroides_vulgatus	4.1666666667
+UniRef90_A6L3E5|g__Bacteroides.s__Bacteroides_dorei	2.1367521368
+UniRef90_A6L9Y6	6.2893081761
+UniRef90_A6L9Y6|g__Bacteroides.s__Bacteroides_vulgatus	6.2893081761
+UniRef90_I9H725	6.2893081761
+UniRef90_I9H725|g__Bacteroides.s__Bacteroides_dorei	6.2893081761
+UniRef90_I9QK08	6.2893081761
+UniRef90_I9QK08|g__Bacteroides.s__Bacteroides_dorei	6.2893081761
+UniRef90_R6HKS7	6.2893081761
+UniRef90_R6HKS7|g__Bacteroides.s__Bacteroides_dorei	6.2893081761
+UniRef90_R7NZ64	6.2893081761
+UniRef90_R7NZ64|g__Bacteroides.s__Bacteroides_dorei	6.2893081761
+UniRef90_R9IAI3	6.2695924765
+UniRef90_R9IAI3|g__Bacteroides.s__Bacteroides_vulgatus	4.1797283177
+UniRef90_R9IAI3|g__Bacteroides.s__Bacteroides_dorei	2.0898641588
+UniRef90_R6HHQ2	6.2656641604
+UniRef90_R6HHQ2|g__Bacteroides.s__Bacteroides_dorei	3.7593984962
+UniRef90_R6HHQ2|g__Bacteroides.s__Bacteroides_vulgatus	2.5062656642
+UniRef90_R9H0E8	6.2608569018
+UniRef90_R9H0E8|g__Bacteroides.s__Bacteroides_dorei	3.7278657968
+UniRef90_R9H0E8|g__Bacteroides.s__Bacteroides_vulgatus	2.5329911050
+UniRef90_A6L3D5	6.2597809077
+UniRef90_A6L3D5|g__Bacteroides.s__Bacteroides_dorei	4.6948356808
+UniRef90_A6L3D5|g__Bacteroides.s__Bacteroides_vulgatus	1.5649452269
+UniRef90_Q64SG6	6.2597809077
+UniRef90_Q64SG6|g__Bacteroides.s__Bacteroides_dorei	6.2597809077
+UniRef90_R7P3X5	6.2597809077
+UniRef90_R7P3X5|g__Bacteroides.s__Bacteroides_dorei	6.2597809077
+UniRef90_D4IMY3	6.2555853441
+UniRef90_D4IMY3|g__Bacteroides.s__Bacteroides_dorei	6.2555853441
+UniRef90_A6L076	6.2439961575
+UniRef90_A6L076|g__Bacteroides.s__Bacteroides_vulgatus	4.8030739673
+UniRef90_A6L076|g__Bacteroides.s__Bacteroides_dorei	1.4409221902
+UniRef90_A6KZ93	6.2421972534
+UniRef90_A6KZ93|g__Bacteroides.s__Bacteroides_vulgatus	4.9937578027
+UniRef90_A6KZ93|g__Bacteroides.s__Bacteroides_dorei	1.2484394507
+UniRef90_R6IHF5	6.2305295950
+UniRef90_R6IHF5|g__Bacteroides.s__Bacteroides_dorei	6.2305295950
+UniRef90_R9HMA4	6.2305295950
+UniRef90_R9HMA4|g__Bacteroides.s__Bacteroides_vulgatus	6.2305295950
+UniRef90_I9G3Q3	6.2222222222
+UniRef90_I9G3Q3|g__Bacteroides.s__Bacteroides_dorei	6.2222222222
+UniRef90_A6L2L9	6.2111801242
+UniRef90_A6L2L9|g__Bacteroides.s__Bacteroides_dorei	4.1407867495
+UniRef90_A6L2L9|g__Bacteroides.s__Bacteroides_vulgatus	2.0703933747
+UniRef90_R6HJF8	6.2111801242
+UniRef90_R6HJF8|g__Bacteroides.s__Bacteroides_dorei	6.2111801242
+UniRef90_R7P405	6.2111801242
+UniRef90_R7P405|g__Bacteroides.s__Bacteroides_vulgatus	6.2111801242
+UniRef90_A6L0D8	6.2111439950
+UniRef90_A6L0D8|g__Bacteroides.s__Bacteroides_vulgatus	4.8096022991
+UniRef90_A6L0D8|g__Bacteroides.s__Bacteroides_dorei	1.4015416959
+UniRef90_R6IFH9	6.2073246431
+UniRef90_R6IFH9|g__Bacteroides.s__Bacteroides_dorei	6.2073246431
+UniRef90_A6KZK9	6.2015503876
+UniRef90_A6KZK9|g__Bacteroides.s__Bacteroides_vulgatus	4.6511627907
+UniRef90_A6KZK9|g__Bacteroides.s__Bacteroides_dorei	1.5503875969
+UniRef90_R6HP45	6.1986191847
+UniRef90_R6HP45|g__Bacteroides.s__Bacteroides_dorei	3.5460992908
+UniRef90_R6HP45|g__Bacteroides.s__Bacteroides_vulgatus	2.6525198939
+UniRef90_R6HVW0	6.1919504644
+UniRef90_R6HVW0|g__Bacteroides.s__Bacteroides_vulgatus	4.1279669763
+UniRef90_R6HVW0|g__Bacteroides.s__Bacteroides_dorei	2.0639834881
+UniRef90_D6D2V9	6.1892130858
+UniRef90_D6D2V9|g__Bacteroides.s__Bacteroides_dorei	6.1892130858
+UniRef90_R7NWK6	6.1871616396
+UniRef90_R7NWK6|g__Bacteroides.s__Bacteroides_dorei	4.6403712297
+UniRef90_R7NWK6|g__Bacteroides.s__Bacteroides_vulgatus	1.5467904099
+UniRef90_R7P5P6	6.1832490163
+UniRef90_R7P5P6|g__Bacteroides.s__Bacteroides_dorei	6.1832490163
+UniRef90_A6KXD9	6.1728395062
+UniRef90_A6KXD9|g__Bacteroides.s__Bacteroides_dorei	3.0864197531
+UniRef90_A6KXD9|g__Bacteroides.s__Bacteroides_vulgatus	3.0864197531
+UniRef90_A6KY32	6.1728395062
+UniRef90_A6KY32|g__Bacteroides.s__Bacteroides_dorei	4.1152263374
+UniRef90_A6KY32|g__Bacteroides.s__Bacteroides_vulgatus	2.0576131687
+UniRef90_A6L5D8	6.1728395062
+UniRef90_A6L5D8|g__Bacteroides.s__Bacteroides_dorei	6.1728395062
+UniRef90_A6L5E4	6.1728395062
+UniRef90_A6L5E4|g__Bacteroides.s__Bacteroides_dorei	6.1728395062
+UniRef90_A6L7R6	6.1728395062
+UniRef90_A6L7R6|g__Bacteroides.s__Bacteroides_vulgatus	6.1728395062
+UniRef90_B3CD12	6.1728395062
+UniRef90_B3CD12|g__Bacteroides.s__Bacteroides_vulgatus	6.1728395062
+UniRef90_C6Z5M6	6.1728395062
+UniRef90_C6Z5M6|g__Bacteroides.s__Bacteroides_vulgatus	6.1728395062
+UniRef90_E1WRZ1	6.1728395062
+UniRef90_E1WRZ1|g__Bacteroides.s__Bacteroides_dorei	6.1728395062
+UniRef90_E5X0E9	6.1728395062
+UniRef90_E5X0E9|g__Bacteroides.s__Bacteroides_dorei	6.1728395062
+UniRef90_F0R4U7	6.1728395062
+UniRef90_F0R4U7|g__Bacteroides.s__Bacteroides_vulgatus	6.1728395062
+UniRef90_I8UUS4	6.1728395062
+UniRef90_I8UUS4|g__Bacteroides.s__Bacteroides_dorei	6.1728395062
+UniRef90_I8WDQ5	6.1728395062
+UniRef90_I8WDQ5|g__Bacteroides.s__Bacteroides_dorei	6.1728395062
+UniRef90_N2B1P6	6.1728395062
+UniRef90_N2B1P6|g__Bacteroides.s__Bacteroides_vulgatus	6.1728395062
+UniRef90_R6HTV5	6.1728395062
+UniRef90_R6HTV5|g__Bacteroides.s__Bacteroides_dorei	6.1728395062
+UniRef90_R9HC83	6.1728395062
+UniRef90_R9HC83|g__Bacteroides.s__Bacteroides_vulgatus	6.1728395062
+UniRef90_R7NZA3	6.1443932412
+UniRef90_R7NZA3|g__Bacteroides.s__Bacteroides_dorei	3.0721966206
+UniRef90_R7NZA3|g__Bacteroides.s__Bacteroides_vulgatus	3.0721966206
+UniRef90_A6KXM9	6.1349693252
+UniRef90_A6KXM9|g__Bacteroides.s__Bacteroides_vulgatus	6.1349693252
+UniRef90_A6KX34	6.1349693252
+UniRef90_A6KX34|g__Bacteroides.s__Bacteroides_dorei	4.0899795501
+UniRef90_A6KX34|g__Bacteroides.s__Bacteroides_vulgatus	2.0449897751
+UniRef90_A6L3D0	6.1349693252
+UniRef90_A6L3D0|g__Bacteroides.s__Bacteroides_vulgatus	6.1349693252
+UniRef90_R6HTF7	6.1349693252
+UniRef90_R6HTF7|g__Bacteroides.s__Bacteroides_vulgatus	4.0899795501
+UniRef90_R6HTF7|g__Bacteroides.s__Bacteroides_dorei	2.0449897751
+UniRef90_R6I1F5	6.1349693252
+UniRef90_R6I1F5|g__Bacteroides.s__Bacteroides_vulgatus	4.0899795501
+UniRef90_R6I1F5|g__Bacteroides.s__Bacteroides_dorei	2.0449897751
+UniRef90_R9HBM2	6.1349693252
+UniRef90_R9HBM2|g__Bacteroides.s__Bacteroides_vulgatus	6.1349693252
+UniRef90_R7NUV4	6.1318424295
+UniRef90_R7NUV4|g__Bacteroides.s__Bacteroides_vulgatus	5.1124744376
+UniRef90_R7NUV4|g__Bacteroides.s__Bacteroides_dorei	1.0193679918
+UniRef90_R6HWS8	6.1315496098
+UniRef90_R6HWS8|g__Bacteroides.s__Bacteroides_vulgatus	3.9018952062
+UniRef90_R6HWS8|g__Bacteroides.s__Bacteroides_dorei	2.2296544036
+UniRef90_A6KZ92	6.1162079511
+UniRef90_A6KZ92|g__Bacteroides.s__Bacteroides_dorei	4.5871559633
+UniRef90_A6KZ92|g__Bacteroides.s__Bacteroides_vulgatus	1.5290519878
+UniRef90_R7P2E0	6.1162079511
+UniRef90_R7P2E0|g__Bacteroides.s__Bacteroides_dorei	4.0774719674
+UniRef90_R7P2E0|g__Bacteroides.s__Bacteroides_vulgatus	2.0387359837
+UniRef90_A6L587	6.0975609756
+UniRef90_A6L587|g__Bacteroides.s__Bacteroides_vulgatus	4.0650406504
+UniRef90_A6L587|g__Bacteroides.s__Bacteroides_dorei	2.0325203252
+UniRef90_A6L3B2	6.0882800609
+UniRef90_A6L3B2|g__Bacteroides.s__Bacteroides_dorei	3.0441400304
+UniRef90_A6L3B2|g__Bacteroides.s__Bacteroides_vulgatus	3.0441400304
+UniRef90_R7P2N7	6.0882800609
+UniRef90_R7P2N7|g__Bacteroides.s__Bacteroides_dorei	6.0882800609
+UniRef90_A6KZZ0	6.0790273556
+UniRef90_A6KZZ0|g__Bacteroides.s__Bacteroides_dorei	5.0658561297
+UniRef90_A6KZZ0|g__Bacteroides.s__Bacteroides_vulgatus	1.0131712259
+UniRef90_A6L6X5	6.0790273556
+UniRef90_A6L6X5|g__Bacteroides.s__Bacteroides_vulgatus	4.0526849037
+UniRef90_A6L6X5|g__Bacteroides.s__Bacteroides_dorei	2.0263424519
+UniRef90_A6L7U2	6.0790273556
+UniRef90_A6L7U2|g__Bacteroides.s__Bacteroides_dorei	3.0395136778
+UniRef90_A6L7U2|g__Bacteroides.s__Bacteroides_vulgatus	3.0395136778
+UniRef90_R7NZX2	6.0744115414
+UniRef90_R7NZX2|g__Bacteroides.s__Bacteroides_dorei	4.5558086560
+UniRef90_R7NZX2|g__Bacteroides.s__Bacteroides_vulgatus	1.5186028853
+UniRef90_R6HUT0	6.0706401766
+UniRef90_R6HUT0|g__Bacteroides.s__Bacteroides_dorei	4.4150110375
+UniRef90_R6HUT0|g__Bacteroides.s__Bacteroides_vulgatus	1.6556291391
+UniRef90_A6L3T4	6.0664112388
+UniRef90_A6L3T4|g__Bacteroides.s__Bacteroides_dorei	3.5121328225
+UniRef90_A6L3T4|g__Bacteroides.s__Bacteroides_vulgatus	2.5542784163
+UniRef90_A6L4N0	6.0606060606
+UniRef90_A6L4N0|g__Bacteroides.s__Bacteroides_vulgatus	6.0606060606
+UniRef90_R9H4F6	6.0606060606
+UniRef90_R9H4F6|g__Bacteroides.s__Bacteroides_vulgatus	6.0606060606
+UniRef90_A6KWK7	6.0606060606
+UniRef90_A6KWK7|g__Bacteroides.s__Bacteroides_vulgatus	6.0606060606
+UniRef90_A6L543	6.0606060606
+UniRef90_A6L543|g__Bacteroides.s__Bacteroides_dorei	3.6363636364
+UniRef90_A6L543|g__Bacteroides.s__Bacteroides_vulgatus	2.4242424242
+UniRef90_A6L5J0	6.0606060606
+UniRef90_A6L5J0|g__Bacteroides.s__Bacteroides_dorei	4.5454545455
+UniRef90_A6L5J0|g__Bacteroides.s__Bacteroides_vulgatus	1.5151515152
+UniRef90_C6ZB21	6.0606060606
+UniRef90_C6ZB21|g__Bacteroides.s__Bacteroides_dorei	6.0606060606
+UniRef90_I9FS75	6.0606060606
+UniRef90_I9FS75|g__Bacteroides.s__Bacteroides_dorei	6.0606060606
+UniRef90_R7NUH5	6.0606060606
+UniRef90_R7NUH5|g__Bacteroides.s__Bacteroides_dorei	3.4632034632
+UniRef90_R7NUH5|g__Bacteroides.s__Bacteroides_vulgatus	2.5974025974
+UniRef90_R9HN23	6.0606060606
+UniRef90_R9HN23|g__Bacteroides.s__Bacteroides_vulgatus	6.0606060606
+UniRef90_A6KZ32	6.0562015504
+UniRef90_A6KZ32|g__Bacteroides.s__Bacteroides_dorei	3.3914728682
+UniRef90_A6KZ32|g__Bacteroides.s__Bacteroides_vulgatus	2.6647286822
+UniRef90_R7NYD6	6.0468631897
+UniRef90_R7NYD6|g__Bacteroides.s__Bacteroides_vulgatus	3.7792894936
+UniRef90_R7NYD6|g__Bacteroides.s__Bacteroides_dorei	2.2675736961
+UniRef90_R9HQV7	6.0468631897
+UniRef90_R9HQV7|g__Bacteroides.s__Bacteroides_vulgatus	6.0468631897
+UniRef90_A6KY02	6.0461608702
+UniRef90_A6KY02|g__Bacteroides.s__Bacteroides_vulgatus	3.6452004860
+UniRef90_A6KY02|g__Bacteroides.s__Bacteroides_dorei	2.4009603842
+UniRef90_R7P0N5	6.0422960725
+UniRef90_R7P0N5|g__Bacteroides.s__Bacteroides_dorei	4.0281973817
+UniRef90_R7P0N5|g__Bacteroides.s__Bacteroides_vulgatus	2.0140986908
+UniRef90_R6HU97	6.0386473430
+UniRef90_R6HU97|g__Bacteroides.s__Bacteroides_dorei	6.0386473430
+UniRef90_A6L1K6	6.0331825038
+UniRef90_A6L1K6|g__Bacteroides.s__Bacteroides_dorei	4.5248868778
+UniRef90_A6L1K6|g__Bacteroides.s__Bacteroides_vulgatus	1.5082956259
+UniRef90_R6HXC5	6.0240963855
+UniRef90_R6HXC5|g__Bacteroides.s__Bacteroides_dorei	6.0240963855
+UniRef90_A6L1V9	6.0240963855
+UniRef90_A6L1V9|g__Bacteroides.s__Bacteroides_vulgatus	4.0160642570
+UniRef90_A6L1V9|g__Bacteroides.s__Bacteroides_dorei	2.0080321285
+UniRef90_R7P1L8	6.0240963855
+UniRef90_R7P1L8|g__Bacteroides.s__Bacteroides_vulgatus	4.0160642570
+UniRef90_R7P1L8|g__Bacteroides.s__Bacteroides_dorei	2.0080321285
+UniRef90_I9R852	6.0060060060
+UniRef90_I9R852|g__Bacteroides.s__Bacteroides_dorei	6.0060060060
+UniRef90_R6HXL2	6.0060060060
+UniRef90_R6HXL2|g__Bacteroides.s__Bacteroides_dorei	6.0060060060
+UniRef90_R6HH17	5.9952038369
+UniRef90_R6HH17|g__Bacteroides.s__Bacteroides_dorei	3.5971223022
+UniRef90_R6HH17|g__Bacteroides.s__Bacteroides_vulgatus	2.3980815348
+UniRef90_R7NX76	5.9883252818
+UniRef90_R7NX76|g__Bacteroides.s__Bacteroides_dorei	4.8309178744
+UniRef90_R7NX76|g__Bacteroides.s__Bacteroides_vulgatus	1.1574074074
+UniRef90_A6L3J1	5.9880239521
+UniRef90_A6L3J1|g__Bacteroides.s__Bacteroides_dorei	5.9880239521
+UniRef90_A6KWZ9	5.9790732436
+UniRef90_A6KWZ9|g__Bacteroides.s__Bacteroides_dorei	2.9895366218
+UniRef90_A6KWZ9|g__Bacteroides.s__Bacteroides_vulgatus	2.9895366218
+UniRef90_A6L5B8	5.9790732436
+UniRef90_A6L5B8|g__Bacteroides.s__Bacteroides_dorei	5.9790732436
+UniRef90_I9FG33	5.9701492537
+UniRef90_I9FG33|g__Bacteroides.s__Bacteroides_dorei	5.9701492537
+UniRef90_A6KXG6	5.9523809524
+UniRef90_A6KXG6|g__Bacteroides.s__Bacteroides_dorei	5.9523809524
+UniRef90_A6L4J3	5.9523809524
+UniRef90_A6L4J3|g__Bacteroides.s__Bacteroides_dorei	5.9523809524
+UniRef90_A6L4R1	5.9523809524
+UniRef90_A6L4R1|g__Bacteroides.s__Bacteroides_dorei	5.9523809524
+UniRef90_D4V8Y2	5.9523809524
+UniRef90_D4V8Y2|g__Bacteroides.s__Bacteroides_vulgatus	5.9523809524
+UniRef90_R7P079	5.9523809524
+UniRef90_R7P079|g__Bacteroides.s__Bacteroides_dorei	3.9682539683
+UniRef90_R7P079|g__Bacteroides.s__Bacteroides_vulgatus	1.9841269841
+UniRef90_A6L1J2	5.9523809524
+UniRef90_A6L1J2|g__Bacteroides.s__Bacteroides_vulgatus	5.9523809524
+UniRef90_I8W3H7	5.9523809524
+UniRef90_I8W3H7|g__Bacteroides.s__Bacteroides_dorei	5.9523809524
+UniRef90_R9HJU6	5.9523809524
+UniRef90_R9HJU6|g__Bacteroides.s__Bacteroides_vulgatus	5.9523809524
+UniRef90_R7P3T3	5.9480702994
+UniRef90_R7P3T3|g__Bacteroides.s__Bacteroides_vulgatus	3.4825870647
+UniRef90_R7P3T3|g__Bacteroides.s__Bacteroides_dorei	2.4654832347
+UniRef90_I9QZD4	5.9391239792
+UniRef90_I9QZD4|g__Bacteroides.s__Bacteroides_dorei	5.9391239792
+UniRef90_A6L6B2	5.9372349449
+UniRef90_A6L6B2|g__Bacteroides.s__Bacteroides_dorei	5.0890585242
+UniRef90_A6L6B2|g__Bacteroides.s__Bacteroides_vulgatus	0.8481764207
+UniRef90_R6HUY2	5.9364796676
+UniRef90_R6HUY2|g__Bacteroides.s__Bacteroides_vulgatus	3.5618878005
+UniRef90_R6HUY2|g__Bacteroides.s__Bacteroides_dorei	2.3745918670
+UniRef90_A6L013	5.9259259259
+UniRef90_A6L013|g__Bacteroides.s__Bacteroides_dorei	2.9629629630
+UniRef90_A6L013|g__Bacteroides.s__Bacteroides_vulgatus	2.9629629630
+UniRef90_R6HNZ0	5.9259259259
+UniRef90_R6HNZ0|g__Bacteroides.s__Bacteroides_dorei	2.9629629630
+UniRef90_R6HNZ0|g__Bacteroides.s__Bacteroides_vulgatus	2.9629629630
+UniRef90_R9H4V4	5.9259259259
+UniRef90_R9H4V4|g__Bacteroides.s__Bacteroides_vulgatus	5.9259259259
+UniRef90_A6L106	5.9171597633
+UniRef90_A6L106|g__Bacteroides.s__Bacteroides_vulgatus	3.9447731755
+UniRef90_A6L106|g__Bacteroides.s__Bacteroides_dorei	1.9723865878
+UniRef90_F0R2Z4	5.9171597633
+UniRef90_F0R2Z4|g__Bacteroides.s__Bacteroides_vulgatus	3.9447731755
+UniRef90_F0R2Z4|g__Bacteroides.s__Bacteroides_dorei	1.9723865878
+UniRef90_R6HG49	5.8997050147
+UniRef90_R6HG49|g__Bacteroides.s__Bacteroides_vulgatus	5.8997050147
+UniRef90_R6HWV2	5.8997050147
+UniRef90_R6HWV2|g__Bacteroides.s__Bacteroides_dorei	5.8997050147
+UniRef90_R6HXV7	5.8823529412
+UniRef90_R6HXV7|g__Bacteroides.s__Bacteroides_vulgatus	3.9215686275
+UniRef90_R6HXV7|g__Bacteroides.s__Bacteroides_dorei	1.9607843137
+UniRef90_R6IGM3	5.8823529412
+UniRef90_R6IGM3|g__Bacteroides.s__Bacteroides_dorei	3.9215686275
+UniRef90_R6IGM3|g__Bacteroides.s__Bacteroides_vulgatus	1.9607843137
+UniRef90_R7NZW9	5.8737151248
+UniRef90_R7NZW9|g__Bacteroides.s__Bacteroides_dorei	4.4052863436
+UniRef90_R7NZW9|g__Bacteroides.s__Bacteroides_vulgatus	1.4684287812
+UniRef90_A6L2T1	5.8479532164
+UniRef90_A6L2T1|g__Bacteroides.s__Bacteroides_vulgatus	3.8986354776
+UniRef90_A6L2T1|g__Bacteroides.s__Bacteroides_dorei	1.9493177388
+UniRef90_A6L337	5.8479532164
+UniRef90_A6L337|g__Bacteroides.s__Bacteroides_vulgatus	5.8479532164
+UniRef90_A6L7U3	5.8479532164
+UniRef90_A6L7U3|g__Bacteroides.s__Bacteroides_dorei	5.8479532164
+UniRef90_D1K7Q5	5.8479532164
+UniRef90_D1K7Q5|g__Bacteroides.s__Bacteroides_dorei	5.8479532164
+UniRef90_D6D3M7	5.8479532164
+UniRef90_D6D3M7|g__Bacteroides.s__Bacteroides_dorei	5.8479532164
+UniRef90_I8ZF88	5.8479532164
+UniRef90_I8ZF88|g__Bacteroides.s__Bacteroides_vulgatus	5.8479532164
+UniRef90_I9PZL9	5.8479532164
+UniRef90_I9PZL9|g__Bacteroides.s__Bacteroides_dorei	5.8479532164
+UniRef90_R6HLF3	5.8479532164
+UniRef90_R6HLF3|g__Bacteroides.s__Bacteroides_dorei	2.9239766082
+UniRef90_R6HLF3|g__Bacteroides.s__Bacteroides_vulgatus	2.9239766082
+UniRef90_R6HZK4	5.8479532164
+UniRef90_R6HZK4|g__Bacteroides.s__Bacteroides_dorei	3.8986354776
+UniRef90_R6HZK4|g__Bacteroides.s__Bacteroides_vulgatus	1.9493177388
+UniRef90_R9H4G4	5.8479532164
+UniRef90_R9H4G4|g__Bacteroides.s__Bacteroides_vulgatus	5.8479532164
+UniRef90_R9HCH8	5.8479532164
+UniRef90_R9HCH8|g__Bacteroides.s__Bacteroides_vulgatus	5.8479532164
+UniRef90_R9HY20	5.8479532164
+UniRef90_R9HY20|g__Bacteroides.s__Bacteroides_vulgatus	5.8479532164
+UniRef90_R6HHT1	5.8365758755
+UniRef90_R6HHT1|g__Bacteroides.s__Bacteroides_vulgatus	4.5395590143
+UniRef90_R6HHT1|g__Bacteroides.s__Bacteroides_dorei	1.2970168612
+UniRef90_I8WRN5	5.8333333333
+UniRef90_I8WRN5|g__Bacteroides.s__Bacteroides_dorei	5.8333333333
+UniRef90_A6KYC8	5.8252700666
+UniRef90_A6KYC8|g__Bacteroides.s__Bacteroides_dorei	4.8590864917
+UniRef90_A6KYC8|g__Bacteroides.s__Bacteroides_vulgatus	0.9661835749
+UniRef90_R7NUN4	5.8173356603
+UniRef90_R7NUN4|g__Bacteroides.s__Bacteroides_vulgatus	4.0721349622
+UniRef90_R7NUN4|g__Bacteroides.s__Bacteroides_dorei	1.7452006981
+UniRef90_A6KWE2	5.8139534884
+UniRef90_A6KWE2|g__Bacteroides.s__Bacteroides_dorei	5.8139534884
+UniRef90_A6KWY0	5.8139534884
+UniRef90_A6KWY0|g__Bacteroides.s__Bacteroides_dorei	3.8759689922
+UniRef90_A6KWY0|g__Bacteroides.s__Bacteroides_vulgatus	1.9379844961
+UniRef90_A6L1V3	5.8139534884
+UniRef90_A6L1V3|g__Bacteroides.s__Bacteroides_dorei	3.8759689922
+UniRef90_A6L1V3|g__Bacteroides.s__Bacteroides_vulgatus	1.9379844961
+UniRef90_I8WKK5	5.8139534884
+UniRef90_I8WKK5|g__Bacteroides.s__Bacteroides_dorei	5.8139534884
+UniRef90_R7P3R0	5.8139534884
+UniRef90_R7P3R0|g__Bacteroides.s__Bacteroides_dorei	5.8139534884
+UniRef90_R9HKT0	5.8139534884
+UniRef90_R9HKT0|g__Bacteroides.s__Bacteroides_vulgatus	5.8139534884
+UniRef90_R6HLH6	5.7998423956
+UniRef90_R6HLH6|g__Bacteroides.s__Bacteroides_vulgatus	2.9629629630
+UniRef90_R6HLH6|g__Bacteroides.s__Bacteroides_dorei	2.8368794326
+UniRef90_I8WIY4	5.7971014493
+UniRef90_I8WIY4|g__Bacteroides.s__Bacteroides_dorei	2.8985507246
+UniRef90_I8WIY4|g__Bacteroides.s__Bacteroides_vulgatus	2.8985507246
+UniRef90_R6HZK7	5.7971014493
+UniRef90_R6HZK7|g__Bacteroides.s__Bacteroides_vulgatus	3.6231884058
+UniRef90_R6HZK7|g__Bacteroides.s__Bacteroides_dorei	2.1739130435
+UniRef90_A6L7U1	5.7915057915
+UniRef90_A6L7U1|g__Bacteroides.s__Bacteroides_vulgatus	3.2175032175
+UniRef90_A6L7U1|g__Bacteroides.s__Bacteroides_dorei	2.5740025740
+UniRef90_R6HL75	5.7915057915
+UniRef90_R6HL75|g__Bacteroides.s__Bacteroides_dorei	3.2175032175
+UniRef90_R6HL75|g__Bacteroides.s__Bacteroides_vulgatus	2.5740025740
+UniRef90_D4VC42	5.7899090157
+UniRef90_D4VC42|g__Bacteroides.s__Bacteroides_dorei	4.1356492969
+UniRef90_D4VC42|g__Bacteroides.s__Bacteroides_vulgatus	1.6542597188
+UniRef90_Q64WL2	5.7885454377
+UniRef90_Q64WL2|g__Bacteroides.s__Bacteroides_vulgatus	3.2488628980
+UniRef90_Q64WL2|g__Bacteroides.s__Bacteroides_dorei	2.5396825397
+UniRef90_E5UNN5	5.7870370370
+UniRef90_E5UNN5|g__Bacteroides.s__Bacteroides_dorei	5.7870370370
+UniRef90_A6L5H7	5.7720057720
+UniRef90_A6L5H7|g__Bacteroides.s__Bacteroides_dorei	5.7720057720
+UniRef90_R7NYX5	5.7636887608
+UniRef90_R7NYX5|g__Bacteroides.s__Bacteroides_vulgatus	5.7636887608
+UniRef90_C3R9Y1	5.7547587428
+UniRef90_C3R9Y1|g__Bacteroides.s__Bacteroides_dorei	5.7547587428
+UniRef90_A0A015P8C6	5.7471264368
+UniRef90_A0A015P8C6|g__Bacteroides.s__Bacteroides_dorei	5.7471264368
+UniRef90_A6KZK1	5.7471264368
+UniRef90_A6KZK1|g__Bacteroides.s__Bacteroides_vulgatus	5.7471264368
+UniRef90_A6L3H0	5.7471264368
+UniRef90_A6L3H0|g__Bacteroides.s__Bacteroides_vulgatus	5.7471264368
+UniRef90_C3RBC6	5.7471264368
+UniRef90_C3RBC6|g__Bacteroides.s__Bacteroides_dorei	2.8735632184
+UniRef90_C3RBC6|g__Bacteroides.s__Bacteroides_vulgatus	2.8735632184
+UniRef90_E2N7L9	5.7471264368
+UniRef90_E2N7L9|g__Bacteroides.s__Bacteroides_dorei	5.7471264368
+UniRef90_E5X0D4	5.7471264368
+UniRef90_E5X0D4|g__Bacteroides.s__Bacteroides_dorei	5.7471264368
+UniRef90_I8VT13	5.7471264368
+UniRef90_I8VT13|g__Bacteroides.s__Bacteroides_dorei	5.7471264368
+UniRef90_I8WZV0	5.7471264368
+UniRef90_I8WZV0|g__Bacteroides.s__Bacteroides_dorei	5.7471264368
+UniRef90_Q64SG2	5.7471264368
+UniRef90_Q64SG2|g__Bacteroides.s__Bacteroides_dorei	5.7471264368
+UniRef90_R6HTT4	5.7471264368
+UniRef90_R6HTT4|g__Bacteroides.s__Bacteroides_dorei	5.7471264368
+UniRef90_R9HCN7	5.7471264368
+UniRef90_R9HCN7|g__Bacteroides.s__Bacteroides_vulgatus	5.7471264368
+UniRef90_R9HG94	5.7471264368
+UniRef90_R9HG94|g__Bacteroides.s__Bacteroides_vulgatus	5.7471264368
+UniRef90_U6R8C4	5.7471264368
+UniRef90_U6R8C4|g__Bacteroides.s__Bacteroides_dorei	2.8735632184
+UniRef90_U6R8C4|g__Bacteroides.s__Bacteroides_vulgatus	2.8735632184
+UniRef90_A0A015WJ01	5.7471264368
+UniRef90_A0A015WJ01|g__Bacteroides.s__Bacteroides_vulgatus	5.7471264368
+UniRef90_A6L6T7	5.7471264368
+UniRef90_A6L6T7|g__Bacteroides.s__Bacteroides_dorei	5.7471264368
+UniRef90_R6I061	5.7471264368
+UniRef90_R6I061|g__Bacteroides.s__Bacteroides_vulgatus	3.4482758621
+UniRef90_R6I061|g__Bacteroides.s__Bacteroides_dorei	2.2988505747
+UniRef90_R6I182	5.7363047999
+UniRef90_R6I182|g__Bacteroides.s__Bacteroides_dorei	3.8387715931
+UniRef90_R6I182|g__Bacteroides.s__Bacteroides_vulgatus	1.8975332068
+UniRef90_A6LAD4	5.7347670251
+UniRef90_A6LAD4|g__Bacteroides.s__Bacteroides_dorei	4.3010752688
+UniRef90_A6LAD4|g__Bacteroides.s__Bacteroides_vulgatus	1.4336917563
+UniRef90_C6ZA46	5.7252012553
+UniRef90_C6ZA46|g__Bacteroides.s__Bacteroides_vulgatus	3.8204393505
+UniRef90_C6ZA46|g__Bacteroides.s__Bacteroides_dorei	1.9047619048
+UniRef90_A6L7E8	5.7251908397
+UniRef90_A6L7E8|g__Bacteroides.s__Bacteroides_dorei	5.0890585242
+UniRef90_A6L7E8|g__Bacteroides.s__Bacteroides_vulgatus	0.6361323155
+UniRef90_A6L659	5.7224606581
+UniRef90_A6L659|g__Bacteroides.s__Bacteroides_vulgatus	4.2918454936
+UniRef90_A6L659|g__Bacteroides.s__Bacteroides_dorei	1.4306151645
+UniRef90_A6KX31	5.7116987377
+UniRef90_A6KX31|g__Bacteroides.s__Bacteroides_vulgatus	4.5740423099
+UniRef90_A6KX31|g__Bacteroides.s__Bacteroides_dorei	1.1376564278
+UniRef90_C3Q2M8	5.6980056980
+UniRef90_C3Q2M8|g__Bacteroides.s__Bacteroides_dorei	5.6980056980
+UniRef90_I9G2F4	5.6980056980
+UniRef90_I9G2F4|g__Bacteroides.s__Bacteroides_dorei	5.6980056980
+UniRef90_R7P119	5.6980056980
+UniRef90_R7P119|g__Bacteroides.s__Bacteroides_vulgatus	5.6980056980
+UniRef90_R9HY24	5.6980056980
+UniRef90_R9HY24|g__Bacteroides.s__Bacteroides_vulgatus	5.6980056980
+UniRef90_D4V6G2	5.6818181818
+UniRef90_D4V6G2|g__Bacteroides.s__Bacteroides_vulgatus	5.6818181818
+UniRef90_A6L7N6	5.6818181818
+UniRef90_A6L7N6|g__Bacteroides.s__Bacteroides_dorei	5.6818181818
+UniRef90_R6HGN8	5.6737588652
+UniRef90_R6HGN8|g__Bacteroides.s__Bacteroides_dorei	4.2553191489
+UniRef90_R6HGN8|g__Bacteroides.s__Bacteroides_vulgatus	1.4184397163
+UniRef90_D4KV26	5.6617126681
+UniRef90_D4KV26|g__Bacteroides.s__Bacteroides_dorei	5.6617126681
+UniRef90_R7P0Q1	5.6579459978
+UniRef90_R7P0Q1|g__Bacteroides.s__Bacteroides_dorei	2.9368575624
+UniRef90_R7P0Q1|g__Bacteroides.s__Bacteroides_vulgatus	2.7210884354
+UniRef90_A6KXN1	5.6497175141
+UniRef90_A6KXN1|g__Bacteroides.s__Bacteroides_dorei	2.8248587571
+UniRef90_A6KXN1|g__Bacteroides.s__Bacteroides_vulgatus	2.8248587571
+UniRef90_A6L167	5.6497175141
+UniRef90_A6L167|g__Bacteroides.s__Bacteroides_dorei	2.8248587571
+UniRef90_A6L167|g__Bacteroides.s__Bacteroides_vulgatus	2.8248587571
+UniRef90_A6L4R6	5.6497175141
+UniRef90_A6L4R6|g__Bacteroides.s__Bacteroides_vulgatus	5.6497175141
+UniRef90_B6VYK9	5.6497175141
+UniRef90_B6VYK9|g__Bacteroides.s__Bacteroides_dorei	5.6497175141
+UniRef90_B6W0Y8	5.6497175141
+UniRef90_B6W0Y8|g__Bacteroides.s__Bacteroides_dorei	5.6497175141
+UniRef90_I9E8U1	5.6497175141
+UniRef90_I9E8U1|g__Bacteroides.s__Bacteroides_vulgatus	5.6497175141
+UniRef90_I9QQQ0	5.6497175141
+UniRef90_I9QQQ0|g__Bacteroides.s__Bacteroides_dorei	5.6497175141
+UniRef90_K5ZDR7	5.6497175141
+UniRef90_K5ZDR7|g__Bacteroides.s__Bacteroides_vulgatus	5.6497175141
+UniRef90_Q64SG1	5.6497175141
+UniRef90_Q64SG1|g__Bacteroides.s__Bacteroides_dorei	5.6497175141
+UniRef90_R6HR64	5.6497175141
+UniRef90_R6HR64|g__Bacteroides.s__Bacteroides_dorei	5.6497175141
+UniRef90_R6HU12	5.6497175141
+UniRef90_R6HU12|g__Bacteroides.s__Bacteroides_dorei	5.6497175141
+UniRef90_R6HV80	5.6497175141
+UniRef90_R6HV80|g__Bacteroides.s__Bacteroides_dorei	2.8248587571
+UniRef90_R6HV80|g__Bacteroides.s__Bacteroides_vulgatus	2.8248587571
+UniRef90_R7NYX9	5.6497175141
+UniRef90_R7NYX9|g__Bacteroides.s__Bacteroides_vulgatus	5.6497175141
+UniRef90_UPI00046E868E	5.6497175141
+UniRef90_UPI00046E868E|g__Bacteroides.s__Bacteroides_dorei	5.6497175141
+UniRef90_A6L381	5.6497175141
+UniRef90_A6L381|g__Bacteroides.s__Bacteroides_vulgatus	4.7080979284
+UniRef90_A6L381|g__Bacteroides.s__Bacteroides_dorei	0.9416195857
+UniRef90_R7J4Q3	5.6341624969
+UniRef90_R7J4Q3|g__Bacteroides.s__Bacteroides_dorei	3.7348272642
+UniRef90_R7J4Q3|g__Bacteroides.s__Bacteroides_vulgatus	1.8993352327
+UniRef90_A6KZA1	5.6268903727
+UniRef90_A6KZA1|g__Bacteroides.s__Bacteroides_vulgatus	3.3670033670
+UniRef90_A6KZA1|g__Bacteroides.s__Bacteroides_dorei	2.2598870056
+UniRef90_A6KZ66	5.6258790436
+UniRef90_A6KZ66|g__Bacteroides.s__Bacteroides_dorei	2.8129395218
+UniRef90_A6KZ66|g__Bacteroides.s__Bacteroides_vulgatus	2.8129395218
+UniRef90_R6HY65	5.6258790436
+UniRef90_R6HY65|g__Bacteroides.s__Bacteroides_dorei	5.6258790436
+UniRef90_A6L0W9	5.6224899598
+UniRef90_A6L0W9|g__Bacteroides.s__Bacteroides_dorei	4.8192771084
+UniRef90_A6L0W9|g__Bacteroides.s__Bacteroides_vulgatus	0.8032128514
+UniRef90_A6L3I2	5.6179775281
+UniRef90_A6L3I2|g__Bacteroides.s__Bacteroides_dorei	5.6179775281
+UniRef90_D4VCH6	5.6179775281
+UniRef90_D4VCH6|g__Bacteroides.s__Bacteroides_dorei	3.7453183521
+UniRef90_D4VCH6|g__Bacteroides.s__Bacteroides_vulgatus	1.8726591760
+UniRef90_E5VD80	5.6179775281
+UniRef90_E5VD80|g__Bacteroides.s__Bacteroides_vulgatus	5.6179775281
+UniRef90_I9QNA6	5.6179775281
+UniRef90_I9QNA6|g__Bacteroides.s__Bacteroides_dorei	5.6179775281
+UniRef90_A6KZR2	5.6022408964
+UniRef90_A6KZR2|g__Bacteroides.s__Bacteroides_vulgatus	5.6022408964
+UniRef90_A6L2J3	5.6022408964
+UniRef90_A6L2J3|g__Bacteroides.s__Bacteroides_dorei	2.8011204482
+UniRef90_A6L2J3|g__Bacteroides.s__Bacteroides_vulgatus	2.8011204482
+UniRef90_A6L6Y5	5.6022408964
+UniRef90_A6L6Y5|g__Bacteroides.s__Bacteroides_dorei	5.6022408964
+UniRef90_A6L393	5.6022408964
+UniRef90_A6L393|g__Bacteroides.s__Bacteroides_dorei	2.8011204482
+UniRef90_A6L393|g__Bacteroides.s__Bacteroides_vulgatus	2.8011204482
+UniRef90_R7NU90	5.6022408964
+UniRef90_R7NU90|g__Bacteroides.s__Bacteroides_vulgatus	3.7348272642
+UniRef90_R7NU90|g__Bacteroides.s__Bacteroides_dorei	1.8674136321
+UniRef90_R6HXS3	5.5928411633
+UniRef90_R6HXS3|g__Bacteroides.s__Bacteroides_vulgatus	3.3557046980
+UniRef90_R6HXS3|g__Bacteroides.s__Bacteroides_dorei	2.2371364653
+UniRef90_R6HXE9	5.5865921788
+UniRef90_R6HXE9|g__Bacteroides.s__Bacteroides_vulgatus	3.7243947858
+UniRef90_R6HXE9|g__Bacteroides.s__Bacteroides_dorei	1.8621973929
+UniRef90_R7P4N9	5.5865921788
+UniRef90_R7P4N9|g__Bacteroides.s__Bacteroides_dorei	5.5865921788
+UniRef90_R9HCJ6	5.5865921788
+UniRef90_R9HCJ6|g__Bacteroides.s__Bacteroides_vulgatus	5.5865921788
+UniRef90_R9HLB4	5.5865921788
+UniRef90_R9HLB4|g__Bacteroides.s__Bacteroides_vulgatus	5.5865921788
+UniRef90_A6L1D2	5.5846660303
+UniRef90_A6L1D2|g__Bacteroides.s__Bacteroides_dorei	3.2634032634
+UniRef90_A6L1D2|g__Bacteroides.s__Bacteroides_vulgatus	2.3212627669
+UniRef90_D4V985	5.5821371611
+UniRef90_D4V985|g__Bacteroides.s__Bacteroides_vulgatus	5.5821371611
+UniRef90_C3REI2	5.5741360089
+UniRef90_C3REI2|g__Bacteroides.s__Bacteroides_vulgatus	4.4593088071
+UniRef90_C3REI2|g__Bacteroides.s__Bacteroides_dorei	1.1148272018
+UniRef90_R7P407	5.5710306407
+UniRef90_R7P407|g__Bacteroides.s__Bacteroides_dorei	3.7140204271
+UniRef90_R7P407|g__Bacteroides.s__Bacteroides_vulgatus	1.8570102136
+UniRef90_A6L3R7	5.5555555556
+UniRef90_A6L3R7|g__Bacteroides.s__Bacteroides_vulgatus	5.5555555556
+UniRef90_A6L0U8	5.5555555556
+UniRef90_A6L0U8|g__Bacteroides.s__Bacteroides_vulgatus	5.5555555556
+UniRef90_A6L190	5.5555555556
+UniRef90_A6L190|g__Bacteroides.s__Bacteroides_vulgatus	5.5555555556
+UniRef90_A6L2K6	5.5555555556
+UniRef90_A6L2K6|g__Bacteroides.s__Bacteroides_dorei	3.7037037037
+UniRef90_A6L2K6|g__Bacteroides.s__Bacteroides_vulgatus	1.8518518519
+UniRef90_A6L378	5.5555555556
+UniRef90_A6L378|g__Bacteroides.s__Bacteroides_dorei	2.7777777778
+UniRef90_A6L378|g__Bacteroides.s__Bacteroides_vulgatus	2.7777777778
+UniRef90_A6L4S3	5.5555555556
+UniRef90_A6L4S3|g__Bacteroides.s__Bacteroides_vulgatus	5.5555555556
+UniRef90_A6L6D9	5.5555555556
+UniRef90_A6L6D9|g__Bacteroides.s__Bacteroides_dorei	5.5555555556
+UniRef90_B6W2Y4	5.5555555556
+UniRef90_B6W2Y4|g__Bacteroides.s__Bacteroides_dorei	5.5555555556
+UniRef90_C3QUD6	5.5555555556
+UniRef90_C3QUD6|g__Bacteroides.s__Bacteroides_dorei	5.5555555556
+UniRef90_R5VLI2	5.5555555556
+UniRef90_R5VLI2|g__Bacteroides.s__Bacteroides_dorei	5.5555555556
+UniRef90_R6HIG0	5.5555555556
+UniRef90_R6HIG0|g__Bacteroides.s__Bacteroides_vulgatus	5.5555555556
+UniRef90_R6HRT1	5.5555555556
+UniRef90_R6HRT1|g__Bacteroides.s__Bacteroides_dorei	4.1666666667
+UniRef90_R6HRT1|g__Bacteroides.s__Bacteroides_vulgatus	1.3888888889
+UniRef90_R6HWU5	5.5555555556
+UniRef90_R6HWU5|g__Bacteroides.s__Bacteroides_dorei	5.5555555556
+UniRef90_R9H4U3	5.5555555556
+UniRef90_R9H4U3|g__Bacteroides.s__Bacteroides_vulgatus	5.5555555556
+UniRef90_R9HVX9	5.5555555556
+UniRef90_R9HVX9|g__Bacteroides.s__Bacteroides_vulgatus	5.5555555556
+UniRef90_R6HR76	5.5350553506
+UniRef90_R6HR76|g__Bacteroides.s__Bacteroides_dorei	3.6900369004
+UniRef90_R6HR76|g__Bacteroides.s__Bacteroides_vulgatus	1.8450184502
+UniRef90_R6I138	5.5325034578
+UniRef90_R6I138|g__Bacteroides.s__Bacteroides_dorei	5.5325034578
+UniRef90_A6L333	5.5292259084
+UniRef90_A6L333|g__Bacteroides.s__Bacteroides_dorei	3.1595576619
+UniRef90_A6L333|g__Bacteroides.s__Bacteroides_vulgatus	2.3696682464
+UniRef90_A6L2Q4	5.5197629627
+UniRef90_A6L2Q4|g__Bacteroides.s__Bacteroides_dorei	3.9741679086
+UniRef90_A6L2Q4|g__Bacteroides.s__Bacteroides_vulgatus	1.5455950541
+UniRef90_R6IFZ9	5.5126427675
+UniRef90_R6IFZ9|g__Bacteroides.s__Bacteroides_dorei	3.2679738562
+UniRef90_R6IFZ9|g__Bacteroides.s__Bacteroides_vulgatus	2.2446689113
+UniRef90_A6KYM9	5.5096418733
+UniRef90_A6KYM9|g__Bacteroides.s__Bacteroides_dorei	4.8209366391
+UniRef90_A6KYM9|g__Bacteroides.s__Bacteroides_vulgatus	0.6887052342
+UniRef90_A6L0U9	5.5096418733
+UniRef90_A6L0U9|g__Bacteroides.s__Bacteroides_dorei	2.7548209366
+UniRef90_A6L0U9|g__Bacteroides.s__Bacteroides_vulgatus	2.7548209366
+UniRef90_A6L4C2	5.5096418733
+UniRef90_A6L4C2|g__Bacteroides.s__Bacteroides_dorei	4.1322314050
+UniRef90_A6L4C2|g__Bacteroides.s__Bacteroides_vulgatus	1.3774104683
+UniRef90_A6L5D6	5.5096418733
+UniRef90_A6L5D6|g__Bacteroides.s__Bacteroides_vulgatus	5.5096418733
+UniRef90_R6HHC5	5.5096418733
+UniRef90_R6HHC5|g__Bacteroides.s__Bacteroides_dorei	5.5096418733
+UniRef90_R6HM60	5.5096418733
+UniRef90_R6HM60|g__Bacteroides.s__Bacteroides_dorei	5.5096418733
+UniRef90_R7P361	5.5096418733
+UniRef90_R7P361|g__Bacteroides.s__Bacteroides_dorei	5.5096418733
+UniRef90_A6L052	5.5096418733
+UniRef90_A6L052|g__Bacteroides.s__Bacteroides_vulgatus	4.5913682277
+UniRef90_A6L052|g__Bacteroides.s__Bacteroides_dorei	0.9182736455
+UniRef90_A6KZJ2	5.5031446541
+UniRef90_A6KZJ2|g__Bacteroides.s__Bacteroides_dorei	3.1446540881
+UniRef90_A6KZJ2|g__Bacteroides.s__Bacteroides_vulgatus	2.3584905660
+UniRef90_E1WRZ4	5.5009083737
+UniRef90_E1WRZ4|g__Bacteroides.s__Bacteroides_dorei	5.5009083737
+UniRef90_A6KXJ8	5.4983522019
+UniRef90_A6KXJ8|g__Bacteroides.s__Bacteroides_dorei	4.1152263374
+UniRef90_A6KXJ8|g__Bacteroides.s__Bacteroides_vulgatus	1.3831258645
+UniRef90_R6HSY1	5.4954170296
+UniRef90_R6HSY1|g__Bacteroides.s__Bacteroides_dorei	3.5460992908
+UniRef90_R6HSY1|g__Bacteroides.s__Bacteroides_vulgatus	1.9493177388
+UniRef90_A6L417	5.4945054945
+UniRef90_A6L417|g__Bacteroides.s__Bacteroides_dorei	3.6630036630
+UniRef90_A6L417|g__Bacteroides.s__Bacteroides_vulgatus	1.8315018315
+UniRef90_A6L673	5.4945054945
+UniRef90_A6L673|g__Bacteroides.s__Bacteroides_vulgatus	3.6630036630
+UniRef90_A6L673|g__Bacteroides.s__Bacteroides_dorei	1.8315018315
+UniRef90_R6HRF1	5.4945054945
+UniRef90_R6HRF1|g__Bacteroides.s__Bacteroides_vulgatus	3.6630036630
+UniRef90_R6HRF1|g__Bacteroides.s__Bacteroides_dorei	1.8315018315
+UniRef90_R7NW91	5.4869684499
+UniRef90_R7NW91|g__Bacteroides.s__Bacteroides_vulgatus	5.4869684499
+UniRef90_R7P0Q0	5.4824561404
+UniRef90_R7P0Q0|g__Bacteroides.s__Bacteroides_dorei	3.2894736842
+UniRef90_R7P0Q0|g__Bacteroides.s__Bacteroides_vulgatus	2.1929824561
+UniRef90_R7NZX3	5.4824561404
+UniRef90_R7NZX3|g__Bacteroides.s__Bacteroides_vulgatus	5.4824561404
+UniRef90_A6L3B0	5.4644808743
+UniRef90_A6L3B0|g__Bacteroides.s__Bacteroides_dorei	3.1225604996
+UniRef90_A6L3B0|g__Bacteroides.s__Bacteroides_vulgatus	2.3419203747
+UniRef90_A6L042	5.4644808743
+UniRef90_A6L042|g__Bacteroides.s__Bacteroides_vulgatus	5.4644808743
+UniRef90_A6L236	5.4644808743
+UniRef90_A6L236|g__Bacteroides.s__Bacteroides_vulgatus	5.4644808743
+UniRef90_A6L3M1	5.4644808743
+UniRef90_A6L3M1|g__Bacteroides.s__Bacteroides_vulgatus	5.4644808743
+UniRef90_A6L5W2	5.4644808743
+UniRef90_A6L5W2|g__Bacteroides.s__Bacteroides_vulgatus	5.4644808743
+UniRef90_I8WQL3	5.4644808743
+UniRef90_I8WQL3|g__Bacteroides.s__Bacteroides_dorei	5.4644808743
+UniRef90_R6HMX8	5.4644808743
+UniRef90_R6HMX8|g__Bacteroides.s__Bacteroides_dorei	5.4644808743
+UniRef90_R7P2S7	5.4644808743
+UniRef90_R7P2S7|g__Bacteroides.s__Bacteroides_dorei	3.6429872495
+UniRef90_R7P2S7|g__Bacteroides.s__Bacteroides_vulgatus	1.8214936248
+UniRef90_A6KXR9	5.4644808743
+UniRef90_A6KXR9|g__Bacteroides.s__Bacteroides_dorei	3.2786885246
+UniRef90_A6KXR9|g__Bacteroides.s__Bacteroides_vulgatus	2.1857923497
+UniRef90_A6KY58	5.4644808743
+UniRef90_A6KY58|g__Bacteroides.s__Bacteroides_vulgatus	5.4644808743
+UniRef90_U6RFL8	5.4644808743
+UniRef90_U6RFL8|g__Bacteroides.s__Bacteroides_vulgatus	5.4644808743
+UniRef90_A6L0Y9	5.4421768707
+UniRef90_A6L0Y9|g__Bacteroides.s__Bacteroides_dorei	2.7210884354
+UniRef90_A6L0Y9|g__Bacteroides.s__Bacteroides_vulgatus	2.7210884354
+UniRef90_R7NR90	5.4421768707
+UniRef90_R7NR90|g__Bacteroides.s__Bacteroides_dorei	5.4421768707
+UniRef90_R7P6B2	5.4421768707
+UniRef90_R7P6B2|g__Bacteroides.s__Bacteroides_dorei	5.4421768707
+UniRef90_A0A015TX99	5.4330964066
+UniRef90_A0A015TX99|g__Bacteroides.s__Bacteroides_vulgatus	3.2894736842
+UniRef90_A0A015TX99|g__Bacteroides.s__Bacteroides_dorei	2.1436227224
+UniRef90_A6KWH0	5.4263565891
+UniRef90_A6KWH0|g__Bacteroides.s__Bacteroides_dorei	3.1007751938
+UniRef90_A6KWH0|g__Bacteroides.s__Bacteroides_vulgatus	2.3255813953
+UniRef90_R7NXY7	5.4263565891
+UniRef90_R7NXY7|g__Bacteroides.s__Bacteroides_vulgatus	3.1007751938
+UniRef90_R7NXY7|g__Bacteroides.s__Bacteroides_dorei	2.3255813953
+UniRef90_A6L2D8	5.4200542005
+UniRef90_A6L2D8|g__Bacteroides.s__Bacteroides_vulgatus	5.4200542005
+UniRef90_R7P0J0	5.4200542005
+UniRef90_R7P0J0|g__Bacteroides.s__Bacteroides_dorei	2.7100271003
+UniRef90_R7P0J0|g__Bacteroides.s__Bacteroides_vulgatus	2.7100271003
+UniRef90_R9H4Q7	5.4200542005
+UniRef90_R9H4Q7|g__Bacteroides.s__Bacteroides_vulgatus	5.4200542005
+UniRef90_R9HQI4	5.4200542005
+UniRef90_R9HQI4|g__Bacteroides.s__Bacteroides_dorei	2.7100271003
+UniRef90_R9HQI4|g__Bacteroides.s__Bacteroides_vulgatus	2.7100271003
+UniRef90_A6KZ96	5.4128238911
+UniRef90_A6KZ96|g__Bacteroides.s__Bacteroides_dorei	2.7777777778
+UniRef90_A6KZ96|g__Bacteroides.s__Bacteroides_vulgatus	2.6350461133
+UniRef90_R6HNT5	5.4054054054
+UniRef90_R6HNT5|g__Bacteroides.s__Bacteroides_vulgatus	3.6036036036
+UniRef90_R6HNT5|g__Bacteroides.s__Bacteroides_dorei	1.8018018018
+UniRef90_R7NY34	5.3872053872
+UniRef90_R7NY34|g__Bacteroides.s__Bacteroides_vulgatus	4.0404040404
+UniRef90_R7NY34|g__Bacteroides.s__Bacteroides_dorei	1.3468013468
+UniRef90_A6L2P9	5.3852130139
+UniRef90_A6L2P9|g__Bacteroides.s__Bacteroides_dorei	3.8491147036
+UniRef90_A6L2P9|g__Bacteroides.s__Bacteroides_vulgatus	1.5360983103
+UniRef90_A6KZ56	5.3763440860
+UniRef90_A6KZ56|g__Bacteroides.s__Bacteroides_vulgatus	5.3763440860
+UniRef90_A6L0F9	5.3763440860
+UniRef90_A6L0F9|g__Bacteroides.s__Bacteroides_dorei	2.6881720430
+UniRef90_A6L0F9|g__Bacteroides.s__Bacteroides_vulgatus	2.6881720430
+UniRef90_A6L1N4	5.3763440860
+UniRef90_A6L1N4|g__Bacteroides.s__Bacteroides_dorei	2.6881720430
+UniRef90_A6L1N4|g__Bacteroides.s__Bacteroides_vulgatus	2.6881720430
+UniRef90_A6L6E4	5.3763440860
+UniRef90_A6L6E4|g__Bacteroides.s__Bacteroides_dorei	2.6881720430
+UniRef90_A6L6E4|g__Bacteroides.s__Bacteroides_vulgatus	2.6881720430
+UniRef90_I8VTF8	5.3763440860
+UniRef90_I8VTF8|g__Bacteroides.s__Bacteroides_dorei	5.3763440860
+UniRef90_I8VUS8	5.3763440860
+UniRef90_I8VUS8|g__Bacteroides.s__Bacteroides_dorei	5.3763440860
+UniRef90_I9U9A2	5.3763440860
+UniRef90_I9U9A2|g__Bacteroides.s__Bacteroides_vulgatus	5.3763440860
+UniRef90_R6HM58	5.3763440860
+UniRef90_R6HM58|g__Bacteroides.s__Bacteroides_vulgatus	5.3763440860
+UniRef90_R7NVQ9	5.3763440860
+UniRef90_R7NVQ9|g__Bacteroides.s__Bacteroides_dorei	5.3763440860
+UniRef90_R7P1U3	5.3763440860
+UniRef90_R7P1U3|g__Bacteroides.s__Bacteroides_dorei	5.3763440860
+UniRef90_A6L5K8	5.3667262970
+UniRef90_A6L5K8|g__Bacteroides.s__Bacteroides_dorei	4.1741204532
+UniRef90_A6L5K8|g__Bacteroides.s__Bacteroides_vulgatus	1.1926058438
+UniRef90_R7P4J6	5.3619302949
+UniRef90_R7P4J6|g__Bacteroides.s__Bacteroides_dorei	5.3619302949
+UniRef90_A6L4M4	5.3547523427
+UniRef90_A6L4M4|g__Bacteroides.s__Bacteroides_dorei	2.6773761714
+UniRef90_A6L4M4|g__Bacteroides.s__Bacteroides_vulgatus	2.6773761714
+UniRef90_A6KWT8	5.3475935829
+UniRef90_A6KWT8|g__Bacteroides.s__Bacteroides_dorei	4.1592394534
+UniRef90_A6KWT8|g__Bacteroides.s__Bacteroides_vulgatus	1.1883541295
+UniRef90_A6KWW6	5.3475935829
+UniRef90_A6KWW6|g__Bacteroides.s__Bacteroides_dorei	3.5650623886
+UniRef90_A6KWW6|g__Bacteroides.s__Bacteroides_vulgatus	1.7825311943
+UniRef90_R7NX21	5.3440213761
+UniRef90_R7NX21|g__Bacteroides.s__Bacteroides_vulgatus	3.3400133601
+UniRef90_R7NX21|g__Bacteroides.s__Bacteroides_dorei	2.0040080160
+UniRef90_A6L015	5.3333333333
+UniRef90_A6L015|g__Bacteroides.s__Bacteroides_dorei	5.3333333333
+UniRef90_A6L4P6	5.3333333333
+UniRef90_A6L4P6|g__Bacteroides.s__Bacteroides_dorei	5.3333333333
+UniRef90_D4V4K6	5.3333333333
+UniRef90_D4V4K6|g__Bacteroides.s__Bacteroides_vulgatus	5.3333333333
+UniRef90_K5YB38	5.3333333333
+UniRef90_K5YB38|g__Bacteroides.s__Bacteroides_vulgatus	5.3333333333
+UniRef90_R6HMA0	5.3300445824
+UniRef90_R6HMA0|g__Bacteroides.s__Bacteroides_vulgatus	2.7855153203
+UniRef90_R6HMA0|g__Bacteroides.s__Bacteroides_dorei	2.5445292621
+UniRef90_R6HVS5	5.3285968028
+UniRef90_R6HVS5|g__Bacteroides.s__Bacteroides_dorei	5.3285968028
+UniRef90_A6L702	5.3191489362
+UniRef90_A6L702|g__Bacteroides.s__Bacteroides_vulgatus	5.3191489362
+UniRef90_I9RD59	5.3120849934
+UniRef90_I9RD59|g__Bacteroides.s__Bacteroides_dorei	5.3120849934
+UniRef90_A6KXQ9	5.3078556263
+UniRef90_A6KXQ9|g__Bacteroides.s__Bacteroides_dorei	3.1847133758
+UniRef90_A6KXQ9|g__Bacteroides.s__Bacteroides_vulgatus	2.1231422505
+UniRef90_I8VWJ9	5.3078556263
+UniRef90_I8VWJ9|g__Bacteroides.s__Bacteroides_dorei	5.3078556263
+UniRef90_A6KYC3	5.3045286272
+UniRef90_A6KYC3|g__Bacteroides.s__Bacteroides_dorei	3.1746031746
+UniRef90_A6KYC3|g__Bacteroides.s__Bacteroides_vulgatus	2.1299254526
+UniRef90_A6L0G6	5.3030303030
+UniRef90_A6L0G6|g__Bacteroides.s__Bacteroides_dorei	3.7878787879
+UniRef90_A6L0G6|g__Bacteroides.s__Bacteroides_vulgatus	1.5151515152
+UniRef90_R6HKT1	5.3030303030
+UniRef90_R6HKT1|g__Bacteroides.s__Bacteroides_dorei	3.7878787879
+UniRef90_R6HKT1|g__Bacteroides.s__Bacteroides_vulgatus	1.5151515152
+UniRef90_A6L2U4	5.3005020052
+UniRef90_A6L2U4|g__Bacteroides.s__Bacteroides_vulgatus	2.7624309392
+UniRef90_A6L2U4|g__Bacteroides.s__Bacteroides_dorei	2.5380710660
+UniRef90_A0A015YDI9	5.2910052910
+UniRef90_A0A015YDI9|g__Bacteroides.s__Bacteroides_dorei	5.2910052910
+UniRef90_A6KXY8	5.2910052910
+UniRef90_A6KXY8|g__Bacteroides.s__Bacteroides_dorei	2.6455026455
+UniRef90_A6KXY8|g__Bacteroides.s__Bacteroides_vulgatus	2.6455026455
+UniRef90_A6L0Z3	5.2910052910
+UniRef90_A6L0Z3|g__Bacteroides.s__Bacteroides_dorei	5.2910052910
+UniRef90_I8WKW7	5.2910052910
+UniRef90_I8WKW7|g__Bacteroides.s__Bacteroides_dorei	5.2910052910
+UniRef90_I9RE93	5.2910052910
+UniRef90_I9RE93|g__Bacteroides.s__Bacteroides_dorei	5.2910052910
+UniRef90_R6HSK2	5.2910052910
+UniRef90_R6HSK2|g__Bacteroides.s__Bacteroides_vulgatus	5.2910052910
+UniRef90_R6HW39	5.2910052910
+UniRef90_R6HW39|g__Bacteroides.s__Bacteroides_dorei	5.2910052910
+UniRef90_R6IFE0	5.2910052910
+UniRef90_R6IFE0|g__Bacteroides.s__Bacteroides_dorei	5.2910052910
+UniRef90_R6ZJ35	5.2910052910
+UniRef90_R6ZJ35|g__Bacteroides.s__Bacteroides_dorei	5.2910052910
+UniRef90_R7NYU5	5.2910052910
+UniRef90_R7NYU5|g__Bacteroides.s__Bacteroides_vulgatus	3.3670033670
+UniRef90_R7NYU5|g__Bacteroides.s__Bacteroides_dorei	1.9240019240
+UniRef90_R9HFV0	5.2910052910
+UniRef90_R9HFV0|g__Bacteroides.s__Bacteroides_vulgatus	5.2910052910
+UniRef90_R6IE38	5.2711993888
+UniRef90_R6IE38|g__Bacteroides.s__Bacteroides_vulgatus	2.6737967914
+UniRef90_R6IE38|g__Bacteroides.s__Bacteroides_dorei	2.5974025974
+UniRef90_R6CQT9	5.2700922266
+UniRef90_R6CQT9|g__Bacteroides.s__Bacteroides_dorei	2.6350461133
+UniRef90_R6CQT9|g__Bacteroides.s__Bacteroides_vulgatus	2.6350461133
+UniRef90_R6HVM7	5.2700922266
+UniRef90_R6HVM7|g__Bacteroides.s__Bacteroides_dorei	5.2700922266
+UniRef90_R6HLN3	5.2671181339
+UniRef90_R6HLN3|g__Bacteroides.s__Bacteroides_vulgatus	3.0097817908
+UniRef90_R6HLN3|g__Bacteroides.s__Bacteroides_dorei	2.2573363431
+UniRef90_Q650E6	5.2576235542
+UniRef90_Q650E6|g__Bacteroides.s__Bacteroides_vulgatus	5.2576235542
+UniRef90_A6KWY1	5.2493438320
+UniRef90_A6KWY1|g__Bacteroides.s__Bacteroides_dorei	3.9370078740
+UniRef90_A6KWY1|g__Bacteroides.s__Bacteroides_vulgatus	1.3123359580
+UniRef90_C6ZB15	5.2493438320
+UniRef90_C6ZB15|g__Bacteroides.s__Bacteroides_dorei	5.2493438320
+UniRef90_I9R2Q9	5.2493438320
+UniRef90_I9R2Q9|g__Bacteroides.s__Bacteroides_dorei	5.2493438320
+UniRef90_R6HQI6	5.2493438320
+UniRef90_R6HQI6|g__Bacteroides.s__Bacteroides_dorei	2.6246719160
+UniRef90_R6HQI6|g__Bacteroides.s__Bacteroides_vulgatus	2.6246719160
+UniRef90_R7P1R7	5.2415566434
+UniRef90_R7P1R7|g__Bacteroides.s__Bacteroides_vulgatus	2.6455026455
+UniRef90_R7P1R7|g__Bacteroides.s__Bacteroides_dorei	2.5960539979
+UniRef90_A6L427	5.2316890882
+UniRef90_A6L427|g__Bacteroides.s__Bacteroides_vulgatus	4.4843049327
+UniRef90_A6L427|g__Bacteroides.s__Bacteroides_dorei	0.7473841555
+UniRef90_A6KZK0	5.2246603971
+UniRef90_A6KZK0|g__Bacteroides.s__Bacteroides_dorei	3.1347962382
+UniRef90_A6KZK0|g__Bacteroides.s__Bacteroides_vulgatus	2.0898641588
+UniRef90_C3Q2M9	5.2083333333
+UniRef90_C3Q2M9|g__Bacteroides.s__Bacteroides_dorei	5.2083333333
+UniRef90_A6L2D3	5.2083333333
+UniRef90_A6L2D3|g__Bacteroides.s__Bacteroides_vulgatus	5.2083333333
+UniRef90_E5CBU9	5.2083333333
+UniRef90_E5CBU9|g__Bacteroides.s__Bacteroides_dorei	5.2083333333
+UniRef90_E5VD76	5.2083333333
+UniRef90_E5VD76|g__Bacteroides.s__Bacteroides_vulgatus	5.2083333333
+UniRef90_I8VN23	5.2083333333
+UniRef90_I8VN23|g__Bacteroides.s__Bacteroides_dorei	5.2083333333
+UniRef90_R5VTC1	5.2083333333
+UniRef90_R5VTC1|g__Bacteroides.s__Bacteroides_dorei	5.2083333333
+UniRef90_R6E706	5.2083333333
+UniRef90_R6E706|g__Bacteroides.s__Bacteroides_vulgatus	5.2083333333
+UniRef90_R6S0W8	5.2083333333
+UniRef90_R6S0W8|g__Bacteroides.s__Bacteroides_dorei	3.9062500000
+UniRef90_R6S0W8|g__Bacteroides.s__Bacteroides_vulgatus	1.3020833333
+UniRef90_R7P319	5.2083333333
+UniRef90_R7P319|g__Bacteroides.s__Bacteroides_dorei	5.2083333333
+UniRef90_R9HCP3	5.2083333333
+UniRef90_R9HCP3|g__Bacteroides.s__Bacteroides_vulgatus	5.2083333333
+UniRef90_R9HMA5	5.2083333333
+UniRef90_R9HMA5|g__Bacteroides.s__Bacteroides_vulgatus	5.2083333333
+UniRef90_A6L1A0	5.2083333333
+UniRef90_A6L1A0|g__Bacteroides.s__Bacteroides_vulgatus	4.4642857143
+UniRef90_A6L1A0|g__Bacteroides.s__Bacteroides_dorei	0.7440476190
+UniRef90_C6IR47	5.1948051948
+UniRef90_C6IR47|g__Bacteroides.s__Bacteroides_vulgatus	5.1948051948
+UniRef90_R7NRS9	5.1948051948
+UniRef90_R7NRS9|g__Bacteroides.s__Bacteroides_dorei	3.4632034632
+UniRef90_R7NRS9|g__Bacteroides.s__Bacteroides_vulgatus	1.7316017316
+UniRef90_Q5LAB4	5.1921079958
+UniRef90_Q5LAB4|g__Bacteroides.s__Bacteroides_vulgatus	3.1152647975
+UniRef90_Q5LAB4|g__Bacteroides.s__Bacteroides_dorei	2.0768431983
+UniRef90_A6L3K8	5.1813471503
+UniRef90_A6L3K8|g__Bacteroides.s__Bacteroides_dorei	3.4542314335
+UniRef90_A6L3K8|g__Bacteroides.s__Bacteroides_vulgatus	1.7271157168
+UniRef90_R6HQ69	5.1813471503
+UniRef90_R6HQ69|g__Bacteroides.s__Bacteroides_dorei	3.4542314335
+UniRef90_R6HQ69|g__Bacteroides.s__Bacteroides_vulgatus	1.7271157168
+UniRef90_R9HJS7	5.1813471503
+UniRef90_R9HJS7|g__Bacteroides.s__Bacteroides_dorei	5.1813471503
+UniRef90_R7NQ52	5.1779935275
+UniRef90_R7NQ52|g__Bacteroides.s__Bacteroides_dorei	3.8834951456
+UniRef90_R7NQ52|g__Bacteroides.s__Bacteroides_vulgatus	1.2944983819
+UniRef90_R7NX55	5.1695660911
+UniRef90_R7NX55|g__Bacteroides.s__Bacteroides_vulgatus	4.1375743470
+UniRef90_R7NX55|g__Bacteroides.s__Bacteroides_dorei	1.0319917441
+UniRef90_A6KX15	5.1679586563
+UniRef90_A6KX15|g__Bacteroides.s__Bacteroides_vulgatus	3.8759689922
+UniRef90_A6KX15|g__Bacteroides.s__Bacteroides_dorei	1.2919896641
+UniRef90_Q64SA3	5.1679586563
+UniRef90_Q64SA3|g__Bacteroides.s__Bacteroides_dorei	5.1679586563
+UniRef90_R6IFB6	5.1679586563
+UniRef90_R6IFB6|g__Bacteroides.s__Bacteroides_dorei	5.1679586563
+UniRef90_R9HCJ7	5.1679586563
+UniRef90_R9HCJ7|g__Bacteroides.s__Bacteroides_vulgatus	5.1679586563
+UniRef90_R6HSM4	5.1579819022
+UniRef90_R6HSM4|g__Bacteroides.s__Bacteroides_dorei	5.1579819022
+UniRef90_A6L1M2	5.1546391753
+UniRef90_A6L1M2|g__Bacteroides.s__Bacteroides_vulgatus	5.1546391753
+UniRef90_A6L6U9	5.1480051480
+UniRef90_A6L6U9|g__Bacteroides.s__Bacteroides_dorei	2.5740025740
+UniRef90_A6L6U9|g__Bacteroides.s__Bacteroides_vulgatus	2.5740025740
+UniRef90_R7NWG1	5.1457975986
+UniRef90_R7NWG1|g__Bacteroides.s__Bacteroides_dorei	2.8587764437
+UniRef90_R7NWG1|g__Bacteroides.s__Bacteroides_vulgatus	2.2870211549
+UniRef90_W0EVY8	5.1380860629
+UniRef90_W0EVY8|g__Bacteroides.s__Bacteroides_dorei	5.1380860629
+UniRef90_A6L1P7	5.1282051282
+UniRef90_A6L1P7|g__Bacteroides.s__Bacteroides_vulgatus	5.1282051282
+UniRef90_I9R8S1	5.1282051282
+UniRef90_I9R8S1|g__Bacteroides.s__Bacteroides_dorei	5.1282051282
+UniRef90_R6HIE2	5.1282051282
+UniRef90_R6HIE2|g__Bacteroides.s__Bacteroides_dorei	5.1282051282
+UniRef90_R6HLP5	5.1282051282
+UniRef90_R6HLP5|g__Bacteroides.s__Bacteroides_dorei	5.1282051282
+UniRef90_A6KWZ4	5.1282051282
+UniRef90_A6KWZ4|g__Bacteroides.s__Bacteroides_vulgatus	5.1282051282
+UniRef90_A6L3K5	5.1282051282
+UniRef90_A6L3K5|g__Bacteroides.s__Bacteroides_vulgatus	5.1282051282
+UniRef90_C6Z8C2	5.1282051282
+UniRef90_C6Z8C2|g__Bacteroides.s__Bacteroides_vulgatus	5.1282051282
+UniRef90_R6HJ56	5.1282051282
+UniRef90_R6HJ56|g__Bacteroides.s__Bacteroides_dorei	5.1282051282
+UniRef90_R6HW18	5.1282051282
+UniRef90_R6HW18|g__Bacteroides.s__Bacteroides_dorei	5.1282051282
+UniRef90_R9H4L8	5.1282051282
+UniRef90_R9H4L8|g__Bacteroides.s__Bacteroides_vulgatus	5.1282051282
+UniRef90_R9H4T4	5.1282051282
+UniRef90_R9H4T4|g__Bacteroides.s__Bacteroides_vulgatus	5.1282051282
+UniRef90_R6HG46	5.1221598132
+UniRef90_R6HG46|g__Bacteroides.s__Bacteroides_vulgatus	3.9525691700
+UniRef90_R6HG46|g__Bacteroides.s__Bacteroides_dorei	1.1695906433
+UniRef90_A6L4B6	5.1183621241
+UniRef90_A6L4B6|g__Bacteroides.s__Bacteroides_dorei	3.8387715931
+UniRef90_A6L4B6|g__Bacteroides.s__Bacteroides_vulgatus	1.2795905310
+UniRef90_A6L1U1	5.1085568327
+UniRef90_A6L1U1|g__Bacteroides.s__Bacteroides_dorei	3.1928480204
+UniRef90_A6L1U1|g__Bacteroides.s__Bacteroides_vulgatus	1.9157088123
+UniRef90_I8VLU0	5.1085568327
+UniRef90_I8VLU0|g__Bacteroides.s__Bacteroides_dorei	5.1085568327
+UniRef90_Q5LAX0	5.1085568327
+UniRef90_Q5LAX0|g__Bacteroides.s__Bacteroides_dorei	5.1085568327
+UniRef90_R7P4U2	5.1057622174
+UniRef90_R7P4U2|g__Bacteroides.s__Bacteroides_vulgatus	4.3763676149
+UniRef90_R7P4U2|g__Bacteroides.s__Bacteroides_dorei	0.7293946025
+UniRef90_A6KXM4	5.0942710329
+UniRef90_A6KXM4|g__Bacteroides.s__Bacteroides_vulgatus	3.8022813688
+UniRef90_A6KXM4|g__Bacteroides.s__Bacteroides_dorei	1.2919896641
+UniRef90_A6KYL5	5.0890585242
+UniRef90_A6KYL5|g__Bacteroides.s__Bacteroides_dorei	5.0890585242
+UniRef90_A6L754	5.0890585242
+UniRef90_A6L754|g__Bacteroides.s__Bacteroides_dorei	5.0890585242
+UniRef90_I8VY18	5.0890585242
+UniRef90_I8VY18|g__Bacteroides.s__Bacteroides_dorei	5.0890585242
+UniRef90_R6HTJ2	5.0890585242
+UniRef90_R6HTJ2|g__Bacteroides.s__Bacteroides_dorei	5.0890585242
+UniRef90_U6RDV1	5.0890585242
+UniRef90_U6RDV1|g__Bacteroides.s__Bacteroides_dorei	5.0890585242
+UniRef90_R7NPF1	5.0890585242
+UniRef90_R7NPF1|g__Bacteroides.s__Bacteroides_vulgatus	3.3927056828
+UniRef90_R7NPF1|g__Bacteroides.s__Bacteroides_dorei	1.6963528414
+UniRef90_R9H874	5.0890585242
+UniRef90_R9H874|g__Bacteroides.s__Bacteroides_vulgatus	3.3927056828
+UniRef90_R9H874|g__Bacteroides.s__Bacteroides_dorei	1.6963528414
+UniRef90_R6HHK4	5.0813008130
+UniRef90_R6HHK4|g__Bacteroides.s__Bacteroides_dorei	5.0813008130
+UniRef90_R7NY54	5.0761421320
+UniRef90_R7NY54|g__Bacteroides.s__Bacteroides_dorei	2.5380710660
+UniRef90_R7NY54|g__Bacteroides.s__Bacteroides_vulgatus	2.5380710660
+UniRef90_A6KX58	5.0735667174
+UniRef90_A6KX58|g__Bacteroides.s__Bacteroides_vulgatus	5.0735667174
+UniRef90_R6HMV9	5.0697084918
+UniRef90_R6HMV9|g__Bacteroides.s__Bacteroides_dorei	5.0697084918
+UniRef90_R7ELP2	5.0697084918
+UniRef90_R7ELP2|g__Bacteroides.s__Bacteroides_dorei	5.0697084918
+UniRef90_I8UPT5	5.0632911392
+UniRef90_I8UPT5|g__Bacteroides.s__Bacteroides_vulgatus	5.0632911392
+UniRef90_R9H533	5.0614605929
+UniRef90_R9H533|g__Bacteroides.s__Bacteroides_vulgatus	5.0614605929
+UniRef90_A6L163	5.0614605929
+UniRef90_A6L163|g__Bacteroides.s__Bacteroides_vulgatus	3.6153289949
+UniRef90_A6L163|g__Bacteroides.s__Bacteroides_dorei	1.4461315980
+UniRef90_R6IHT4	5.0600885515
+UniRef90_R6IHT4|g__Bacteroides.s__Bacteroides_vulgatus	3.1625553447
+UniRef90_R6IHT4|g__Bacteroides.s__Bacteroides_dorei	1.8975332068
+UniRef90_R6HKN8	5.0505050505
+UniRef90_R6HKN8|g__Bacteroides.s__Bacteroides_dorei	4.0404040404
+UniRef90_R6HKN8|g__Bacteroides.s__Bacteroides_vulgatus	1.0101010101
+UniRef90_R9H4Y9	5.0505050505
+UniRef90_R9H4Y9|g__Bacteroides.s__Bacteroides_vulgatus	5.0505050505
+UniRef90_R9HR76	5.0505050505
+UniRef90_R9HR76|g__Bacteroides.s__Bacteroides_vulgatus	5.0505050505
+UniRef90_A6KXH4	5.0505050505
+UniRef90_A6KXH4|g__Bacteroides.s__Bacteroides_vulgatus	5.0505050505
+UniRef90_A6L3L5	5.0505050505
+UniRef90_A6L3L5|g__Bacteroides.s__Bacteroides_dorei	5.0505050505
+UniRef90_A6L4Q0	5.0505050505
+UniRef90_A6L4Q0|g__Bacteroides.s__Bacteroides_dorei	3.0303030303
+UniRef90_A6L4Q0|g__Bacteroides.s__Bacteroides_vulgatus	2.0202020202
+UniRef90_A6L6U5	5.0505050505
+UniRef90_A6L6U5|g__Bacteroides.s__Bacteroides_vulgatus	5.0505050505
+UniRef90_I9FTF6	5.0505050505
+UniRef90_I9FTF6|g__Bacteroides.s__Bacteroides_vulgatus	5.0505050505
+UniRef90_R6HJN2	5.0505050505
+UniRef90_R6HJN2|g__Bacteroides.s__Bacteroides_vulgatus	3.0303030303
+UniRef90_R6HJN2|g__Bacteroides.s__Bacteroides_dorei	2.0202020202
+UniRef90_R6II42	5.0505050505
+UniRef90_R6II42|g__Bacteroides.s__Bacteroides_vulgatus	5.0505050505
+UniRef90_R6IKU8	5.0505050505
+UniRef90_R6IKU8|g__Bacteroides.s__Bacteroides_dorei	5.0505050505
+UniRef90_R7AEA0	5.0505050505
+UniRef90_R7AEA0|g__Bacteroides.s__Bacteroides_dorei	5.0505050505
+UniRef90_R7NZT8	5.0505050505
+UniRef90_R7NZT8|g__Bacteroides.s__Bacteroides_dorei	3.1565656566
+UniRef90_R7NZT8|g__Bacteroides.s__Bacteroides_vulgatus	1.8939393939
+UniRef90_R7P5F0	5.0505050505
+UniRef90_R7P5F0|g__Bacteroides.s__Bacteroides_vulgatus	3.7878787879
+UniRef90_R7P5F0|g__Bacteroides.s__Bacteroides_dorei	1.2626262626
+UniRef90_I9FDG6	5.0314465409
+UniRef90_I9FDG6|g__Bacteroides.s__Bacteroides_dorei	5.0314465409
+UniRef90_R6AN66	5.0314465409
+UniRef90_R6AN66|g__Bacteroides.s__Bacteroides_dorei	5.0314465409
+UniRef90_R6HXD6	5.0262737034
+UniRef90_R6HXD6|g__Bacteroides.s__Bacteroides_dorei	2.7416038382
+UniRef90_R6HXD6|g__Bacteroides.s__Bacteroides_vulgatus	2.2846698652
+UniRef90_A6L7H7	5.0251256281
+UniRef90_A6L7H7|g__Bacteroides.s__Bacteroides_dorei	3.3500837521
+UniRef90_A6L7H7|g__Bacteroides.s__Bacteroides_vulgatus	1.6750418760
+UniRef90_A6L2S2	5.0200803213
+UniRef90_A6L2S2|g__Bacteroides.s__Bacteroides_dorei	3.0120481928
+UniRef90_A6L2S2|g__Bacteroides.s__Bacteroides_vulgatus	2.0080321285
+UniRef90_A6LIN3	5.0125313283
+UniRef90_A6LIN3|g__Bacteroides.s__Bacteroides_dorei	5.0125313283
+UniRef90_E5X0C0	5.0125313283
+UniRef90_E5X0C0|g__Bacteroides.s__Bacteroides_dorei	5.0125313283
+UniRef90_R6HHS3	5.0125313283
+UniRef90_R6HHS3|g__Bacteroides.s__Bacteroides_dorei	5.0125313283
+UniRef90_R6HNG2	5.0125313283
+UniRef90_R6HNG2|g__Bacteroides.s__Bacteroides_dorei	5.0125313283
+UniRef90_R6ILT0	5.0125313283
+UniRef90_R6ILT0|g__Bacteroides.s__Bacteroides_dorei	5.0125313283
+UniRef90_A6L0A2	5.0000000000
+UniRef90_A6L0A2|g__Bacteroides.s__Bacteroides_vulgatus	5.0000000000
+UniRef90_R6HXY6	4.9972332184
+UniRef90_R6HXY6|g__Bacteroides.s__Bacteroides_dorei	3.2520325203
+UniRef90_R6HXY6|g__Bacteroides.s__Bacteroides_vulgatus	1.7452006981
+UniRef90_A6KZP1	4.9937578027
+UniRef90_A6KZP1|g__Bacteroides.s__Bacteroides_dorei	2.4968789014
+UniRef90_A6KZP1|g__Bacteroides.s__Bacteroides_vulgatus	2.4968789014
+UniRef90_R7NYM7	4.9875311721
+UniRef90_R7NYM7|g__Bacteroides.s__Bacteroides_vulgatus	4.1562759767
+UniRef90_R7NYM7|g__Bacteroides.s__Bacteroides_dorei	0.8312551953
+UniRef90_Q8A5U9	4.9751243781
+UniRef90_Q8A5U9|g__Bacteroides.s__Bacteroides_vulgatus	4.9751243781
+UniRef90_A6KWI0	4.9751243781
+UniRef90_A6KWI0|g__Bacteroides.s__Bacteroides_dorei	3.7313432836
+UniRef90_A6KWI0|g__Bacteroides.s__Bacteroides_vulgatus	1.2437810945
+UniRef90_A6KXR6	4.9751243781
+UniRef90_A6KXR6|g__Bacteroides.s__Bacteroides_dorei	4.9751243781
+UniRef90_A6KYL0	4.9751243781
+UniRef90_A6KYL0|g__Bacteroides.s__Bacteroides_dorei	4.9751243781
+UniRef90_A6KYL7	4.9751243781
+UniRef90_A6KYL7|g__Bacteroides.s__Bacteroides_dorei	3.3167495854
+UniRef90_A6KYL7|g__Bacteroides.s__Bacteroides_vulgatus	1.6583747927
+UniRef90_A6L1D6	4.9751243781
+UniRef90_A6L1D6|g__Bacteroides.s__Bacteroides_vulgatus	4.9751243781
+UniRef90_A6L5C9	4.9751243781
+UniRef90_A6L5C9|g__Bacteroides.s__Bacteroides_vulgatus	4.9751243781
+UniRef90_C3QU74	4.9751243781
+UniRef90_C3QU74|g__Bacteroides.s__Bacteroides_dorei	4.9751243781
+UniRef90_G1ULE5	4.9751243781
+UniRef90_G1ULE5|g__Bacteroides.s__Bacteroides_dorei	4.9751243781
+UniRef90_I9RE48	4.9751243781
+UniRef90_I9RE48|g__Bacteroides.s__Bacteroides_dorei	4.9751243781
+UniRef90_R6G587	4.9751243781
+UniRef90_R6G587|g__Bacteroides.s__Bacteroides_vulgatus	4.9751243781
+UniRef90_R6HKG2	4.9751243781
+UniRef90_R6HKG2|g__Bacteroides.s__Bacteroides_dorei	3.1094527363
+UniRef90_R6HKG2|g__Bacteroides.s__Bacteroides_vulgatus	1.8656716418
+UniRef90_R6HQD1	4.9751243781
+UniRef90_R6HQD1|g__Bacteroides.s__Bacteroides_vulgatus	3.3167495854
+UniRef90_R6HQD1|g__Bacteroides.s__Bacteroides_dorei	1.6583747927
+UniRef90_R6HKV8	4.9698260561
+UniRef90_R6HKV8|g__Bacteroides.s__Bacteroides_dorei	2.4849130280
+UniRef90_R6HKV8|g__Bacteroides.s__Bacteroides_vulgatus	2.4849130280
+UniRef90_I9FLH5	4.9603174603
+UniRef90_I9FLH5|g__Bacteroides.s__Bacteroides_dorei	4.9603174603
+UniRef90_A6KXM5	4.9504950495
+UniRef90_A6KXM5|g__Bacteroides.s__Bacteroides_dorei	3.3003300330
+UniRef90_A6KXM5|g__Bacteroides.s__Bacteroides_vulgatus	1.6501650165
+UniRef90_R9HK38	4.9455984174
+UniRef90_R9HK38|g__Bacteroides.s__Bacteroides_vulgatus	4.9455984174
+UniRef90_A6L050	4.9435028249
+UniRef90_A6L050|g__Bacteroides.s__Bacteroides_dorei	2.8248587571
+UniRef90_A6L050|g__Bacteroides.s__Bacteroides_vulgatus	2.1186440678
+UniRef90_A6L166	4.9382716049
+UniRef90_A6L166|g__Bacteroides.s__Bacteroides_dorei	4.9382716049
+UniRef90_A6L1Y5	4.9382716049
+UniRef90_A6L1Y5|g__Bacteroides.s__Bacteroides_vulgatus	4.9382716049
+UniRef90_R6HY34	4.9382716049
+UniRef90_R6HY34|g__Bacteroides.s__Bacteroides_vulgatus	3.7037037037
+UniRef90_R6HY34|g__Bacteroides.s__Bacteroides_dorei	1.2345679012
+UniRef90_D4V927	4.9330514447
+UniRef90_D4V927|g__Bacteroides.s__Bacteroides_dorei	4.9330514447
+UniRef90_A6L1J4	4.9261083744
+UniRef90_A6L1J4|g__Bacteroides.s__Bacteroides_dorei	4.9261083744
+UniRef90_R6IKW2	4.9261083744
+UniRef90_R6IKW2|g__Bacteroides.s__Bacteroides_vulgatus	3.2840722496
+UniRef90_R6IKW2|g__Bacteroides.s__Bacteroides_dorei	1.6420361248
+UniRef90_A6KXG8	4.9200492005
+UniRef90_A6KXG8|g__Bacteroides.s__Bacteroides_dorei	3.6900369004
+UniRef90_A6KXG8|g__Bacteroides.s__Bacteroides_vulgatus	1.2300123001
+UniRef90_R6IE59	4.9164208456
+UniRef90_R6IE59|g__Bacteroides.s__Bacteroides_vulgatus	3.9331366765
+UniRef90_R6IE59|g__Bacteroides.s__Bacteroides_dorei	0.9832841691
+UniRef90_R7NLJ2	4.9164208456
+UniRef90_R7NLJ2|g__Bacteroides.s__Bacteroides_vulgatus	4.9164208456
+UniRef90_J9H8L2	4.9140049140
+UniRef90_J9H8L2|g__Bacteroides.s__Bacteroides_vulgatus	4.9140049140
+UniRef90_A6KZI7	4.9019607843
+UniRef90_A6KZI7|g__Bacteroides.s__Bacteroides_dorei	3.5014005602
+UniRef90_A6KZI7|g__Bacteroides.s__Bacteroides_vulgatus	1.4005602241
+UniRef90_A6L2S9	4.9019607843
+UniRef90_A6L2S9|g__Bacteroides.s__Bacteroides_vulgatus	4.9019607843
+UniRef90_A6L3J2	4.9019607843
+UniRef90_A6L3J2|g__Bacteroides.s__Bacteroides_dorei	4.9019607843
+UniRef90_C3R8M9	4.9019607843
+UniRef90_C3R8M9|g__Bacteroides.s__Bacteroides_dorei	4.9019607843
+UniRef90_I9QDE2	4.9019607843
+UniRef90_I9QDE2|g__Bacteroides.s__Bacteroides_dorei	4.9019607843
+UniRef90_I9QRI4	4.9019607843
+UniRef90_I9QRI4|g__Bacteroides.s__Bacteroides_dorei	4.9019607843
+UniRef90_R6HKP4	4.9019607843
+UniRef90_R6HKP4|g__Bacteroides.s__Bacteroides_dorei	4.9019607843
+UniRef90_R6HXB1	4.9019607843
+UniRef90_R6HXB1|g__Bacteroides.s__Bacteroides_vulgatus	3.2679738562
+UniRef90_R6HXB1|g__Bacteroides.s__Bacteroides_dorei	1.6339869281
+UniRef90_R9H4T8	4.9019607843
+UniRef90_R9H4T8|g__Bacteroides.s__Bacteroides_vulgatus	4.9019607843
+UniRef90_R9HP17	4.9019607843
+UniRef90_R9HP17|g__Bacteroides.s__Bacteroides_vulgatus	4.9019607843
+UniRef90_J9GE58	4.8814504881
+UniRef90_J9GE58|g__Bacteroides.s__Bacteroides_dorei	3.4867503487
+UniRef90_J9GE58|g__Bacteroides.s__Bacteroides_vulgatus	1.3947001395
+UniRef90_I9FXG7	4.8712595685
+UniRef90_I9FXG7|g__Bacteroides.s__Bacteroides_dorei	2.7835768963
+UniRef90_I9FXG7|g__Bacteroides.s__Bacteroides_vulgatus	2.0876826722
+UniRef90_Q64SA5	4.8712595685
+UniRef90_Q64SA5|g__Bacteroides.s__Bacteroides_dorei	4.8712595685
+UniRef90_R7P4S8	4.8668383522
+UniRef90_R7P4S8|g__Bacteroides.s__Bacteroides_vulgatus	3.2447783360
+UniRef90_R7P4S8|g__Bacteroides.s__Bacteroides_dorei	1.6220600162
+UniRef90_A6L014	4.8661800487
+UniRef90_A6L014|g__Bacteroides.s__Bacteroides_vulgatus	4.8661800487
+UniRef90_A6L519	4.8661800487
+UniRef90_A6L519|g__Bacteroides.s__Bacteroides_dorei	4.8661800487
+UniRef90_I9R4S7	4.8661800487
+UniRef90_I9R4S7|g__Bacteroides.s__Bacteroides_dorei	4.8661800487
+UniRef90_R6HJN1	4.8661800487
+UniRef90_R6HJN1|g__Bacteroides.s__Bacteroides_vulgatus	4.8661800487
+UniRef90_R6HTV0	4.8661800487
+UniRef90_R6HTV0|g__Bacteroides.s__Bacteroides_dorei	4.8661800487
+UniRef90_R7P6C4	4.8661800487
+UniRef90_R7P6C4|g__Bacteroides.s__Bacteroides_dorei	2.4330900243
+UniRef90_R7P6C4|g__Bacteroides.s__Bacteroides_vulgatus	2.4330900243
+UniRef90_R7NWJ4	4.8590864917
+UniRef90_R7NWJ4|g__Bacteroides.s__Bacteroides_vulgatus	3.8872691934
+UniRef90_R7NWJ4|g__Bacteroides.s__Bacteroides_dorei	0.9718172983
+UniRef90_A6L683	4.8484848485
+UniRef90_A6L683|g__Bacteroides.s__Bacteroides_dorei	4.8484848485
+UniRef90_K5ZG74	4.8484848485
+UniRef90_K5ZG74|g__Bacteroides.s__Bacteroides_vulgatus	4.8484848485
+UniRef90_R6TCP7	4.8449612403
+UniRef90_R6TCP7|g__Bacteroides.s__Bacteroides_dorei	3.8759689922
+UniRef90_R6TCP7|g__Bacteroides.s__Bacteroides_vulgatus	0.9689922481
+UniRef90_A6L5D4	4.8426150121
+UniRef90_A6L5D4|g__Bacteroides.s__Bacteroides_dorei	3.2284100081
+UniRef90_A6L5D4|g__Bacteroides.s__Bacteroides_vulgatus	1.6142050040
+UniRef90_A0A015Y5P7	4.8309178744
+UniRef90_A0A015Y5P7|g__Bacteroides.s__Bacteroides_dorei	4.8309178744
+UniRef90_A6KYN9	4.8309178744
+UniRef90_A6KYN9|g__Bacteroides.s__Bacteroides_dorei	2.4154589372
+UniRef90_A6KYN9|g__Bacteroides.s__Bacteroides_vulgatus	2.4154589372
+UniRef90_A6L7E3	4.8309178744
+UniRef90_A6L7E3|g__Bacteroides.s__Bacteroides_vulgatus	4.8309178744
+UniRef90_A7ACH1	4.8309178744
+UniRef90_A7ACH1|g__Bacteroides.s__Bacteroides_dorei	4.8309178744
+UniRef90_I9FXT6	4.8309178744
+UniRef90_I9FXT6|g__Bacteroides.s__Bacteroides_dorei	4.8309178744
+UniRef90_R7P675	4.8225308642
+UniRef90_R7P675|g__Bacteroides.s__Bacteroides_dorei	3.0864197531
+UniRef90_R7P675|g__Bacteroides.s__Bacteroides_vulgatus	1.7361111111
+UniRef90_A6L034	4.8192771084
+UniRef90_A6L034|g__Bacteroides.s__Bacteroides_dorei	4.0160642570
+UniRef90_A6L034|g__Bacteroides.s__Bacteroides_vulgatus	0.8032128514
+UniRef90_R9H4G0	4.8169556840
+UniRef90_R9H4G0|g__Bacteroides.s__Bacteroides_vulgatus	4.8169556840
+UniRef90_I9ULB8	4.8134777377
+UniRef90_I9ULB8|g__Bacteroides.s__Bacteroides_dorei	3.6101083032
+UniRef90_I9ULB8|g__Bacteroides.s__Bacteroides_vulgatus	1.2033694344
+UniRef90_R9H1C5	4.8109965636
+UniRef90_R9H1C5|g__Bacteroides.s__Bacteroides_vulgatus	4.8109965636
+UniRef90_A6KWP3	4.7961630695
+UniRef90_A6KWP3|g__Bacteroides.s__Bacteroides_dorei	2.3980815348
+UniRef90_A6KWP3|g__Bacteroides.s__Bacteroides_vulgatus	2.3980815348
+UniRef90_A6KYQ0	4.7961630695
+UniRef90_A6KYQ0|g__Bacteroides.s__Bacteroides_vulgatus	4.7961630695
+UniRef90_A6L1H7	4.7961630695
+UniRef90_A6L1H7|g__Bacteroides.s__Bacteroides_dorei	3.5971223022
+UniRef90_A6L1H7|g__Bacteroides.s__Bacteroides_vulgatus	1.1990407674
+UniRef90_A6L4Y7	4.7961630695
+UniRef90_A6L4Y7|g__Bacteroides.s__Bacteroides_dorei	2.3980815348
+UniRef90_A6L4Y7|g__Bacteroides.s__Bacteroides_vulgatus	2.3980815348
+UniRef90_Q5L8C6	4.7961630695
+UniRef90_Q5L8C6|g__Bacteroides.s__Bacteroides_dorei	4.7961630695
+UniRef90_R9HKZ4	4.7961630695
+UniRef90_R9HKZ4|g__Bacteroides.s__Bacteroides_vulgatus	4.7961630695
+UniRef90_A6L1J9	4.7912388775
+UniRef90_A6L1J9|g__Bacteroides.s__Bacteroides_dorei	3.4223134839
+UniRef90_A6L1J9|g__Bacteroides.s__Bacteroides_vulgatus	1.3689253936
+UniRef90_R6HXM5	4.7900623396
+UniRef90_R6HXM5|g__Bacteroides.s__Bacteroides_vulgatus	2.4752475248
+UniRef90_R6HXM5|g__Bacteroides.s__Bacteroides_dorei	2.3148148148
+UniRef90_A6L0R3	4.7892720307
+UniRef90_A6L0R3|g__Bacteroides.s__Bacteroides_dorei	4.7892720307
+UniRef90_R6HH27	4.7862064257
+UniRef90_R6HH27|g__Bacteroides.s__Bacteroides_vulgatus	2.7536861005
+UniRef90_R6HH27|g__Bacteroides.s__Bacteroides_dorei	2.0325203252
+UniRef90_A6L065	4.7846889952
+UniRef90_A6L065|g__Bacteroides.s__Bacteroides_dorei	3.1897926635
+UniRef90_A6L065|g__Bacteroides.s__Bacteroides_vulgatus	1.5948963317
+UniRef90_C3QUD0	4.7846889952
+UniRef90_C3QUD0|g__Bacteroides.s__Bacteroides_dorei	4.7846889952
+UniRef90_R6HLI4	4.7846889952
+UniRef90_R6HLI4|g__Bacteroides.s__Bacteroides_dorei	3.9872408293
+UniRef90_R6HLI4|g__Bacteroides.s__Bacteroides_vulgatus	0.7974481659
+UniRef90_R6HS81	4.7846889952
+UniRef90_R6HS81|g__Bacteroides.s__Bacteroides_vulgatus	3.1897926635
+UniRef90_R6HS81|g__Bacteroides.s__Bacteroides_dorei	1.5948963317
+UniRef90_I9R963	4.7789725209
+UniRef90_I9R963|g__Bacteroides.s__Bacteroides_dorei	4.7789725209
+UniRef90_R9HMS5	4.7789725209
+UniRef90_R9HMS5|g__Bacteroides.s__Bacteroides_vulgatus	4.7789725209
+UniRef90_A6L3F6	4.7732696897
+UniRef90_A6L3F6|g__Bacteroides.s__Bacteroides_vulgatus	4.7732696897
+UniRef90_R6IKR6	4.7732696897
+UniRef90_R6IKR6|g__Bacteroides.s__Bacteroides_dorei	3.1821797932
+UniRef90_R6IKR6|g__Bacteroides.s__Bacteroides_vulgatus	1.5910898966
+UniRef90_A6KWI3	4.7619047619
+UniRef90_A6KWI3|g__Bacteroides.s__Bacteroides_vulgatus	4.7619047619
+UniRef90_A6KYK5	4.7619047619
+UniRef90_A6KYK5|g__Bacteroides.s__Bacteroides_dorei	4.7619047619
+UniRef90_E5WU41	4.7619047619
+UniRef90_E5WU41|g__Bacteroides.s__Bacteroides_vulgatus	4.7619047619
+UniRef90_F0R8Y7	4.7619047619
+UniRef90_F0R8Y7|g__Bacteroides.s__Bacteroides_vulgatus	4.7619047619
+UniRef90_I8WKL9	4.7619047619
+UniRef90_I8WKL9|g__Bacteroides.s__Bacteroides_dorei	4.7619047619
+UniRef90_Q64SE2	4.7619047619
+UniRef90_Q64SE2|g__Bacteroides.s__Bacteroides_dorei	4.7619047619
+UniRef90_Q650G5	4.7619047619
+UniRef90_Q650G5|g__Bacteroides.s__Bacteroides_vulgatus	4.7619047619
+UniRef90_R6HWN3	4.7619047619
+UniRef90_R6HWN3|g__Bacteroides.s__Bacteroides_dorei	4.7619047619
+UniRef90_R9HM81	4.7619047619
+UniRef90_R9HM81|g__Bacteroides.s__Bacteroides_vulgatus	4.7619047619
+UniRef90_A6L0S6	4.7534165181
+UniRef90_A6L0S6|g__Bacteroides.s__Bacteroides_dorei	2.9708853238
+UniRef90_A6L0S6|g__Bacteroides.s__Bacteroides_vulgatus	1.7825311943
+UniRef90_R6HV24	4.7483380817
+UniRef90_R6HV24|g__Bacteroides.s__Bacteroides_dorei	2.8490028490
+UniRef90_R6HV24|g__Bacteroides.s__Bacteroides_vulgatus	1.8993352327
+UniRef90_A6L4Q7	4.7468354430
+UniRef90_A6L4Q7|g__Bacteroides.s__Bacteroides_dorei	2.6371308017
+UniRef90_A6L4Q7|g__Bacteroides.s__Bacteroides_vulgatus	2.1097046414
+UniRef90_R6E6X0	4.7449584816
+UniRef90_R6E6X0|g__Bacteroides.s__Bacteroides_vulgatus	4.7449584816
+UniRef90_C3RDB4	4.7393364929
+UniRef90_C3RDB4|g__Bacteroides.s__Bacteroides_dorei	4.7393364929
+UniRef90_Q5L8B5	4.7393364929
+UniRef90_Q5L8B5|g__Bacteroides.s__Bacteroides_vulgatus	4.7393364929
+UniRef90_R6HZH0	4.7393364929
+UniRef90_R6HZH0|g__Bacteroides.s__Bacteroides_vulgatus	3.9494470774
+UniRef90_R6HZH0|g__Bacteroides.s__Bacteroides_dorei	0.7898894155
+UniRef90_I8WPJ8	4.7318611987
+UniRef90_I8WPJ8|g__Bacteroides.s__Bacteroides_dorei	4.7318611987
+UniRef90_R6HJ21	4.7281323877
+UniRef90_R6HJ21|g__Bacteroides.s__Bacteroides_dorei	4.7281323877
+UniRef90_C3Q4M4	4.7281323877
+UniRef90_C3Q4M4|g__Bacteroides.s__Bacteroides_dorei	4.7281323877
+UniRef90_I9E8I1	4.7281323877
+UniRef90_I9E8I1|g__Bacteroides.s__Bacteroides_vulgatus	4.7281323877
+UniRef90_C3RCI6	4.7214353163
+UniRef90_C3RCI6|g__Bacteroides.s__Bacteroides_vulgatus	3.7771482531
+UniRef90_C3RCI6|g__Bacteroides.s__Bacteroides_dorei	0.9442870633
+UniRef90_R6HHY9	4.7214353163
+UniRef90_R6HHY9|g__Bacteroides.s__Bacteroides_vulgatus	3.7771482531
+UniRef90_R6HHY9|g__Bacteroides.s__Bacteroides_dorei	0.9442870633
+UniRef90_R7P138	4.7214353163
+UniRef90_R7P138|g__Bacteroides.s__Bacteroides_dorei	2.8328611898
+UniRef90_R7P138|g__Bacteroides.s__Bacteroides_vulgatus	1.8885741265
+UniRef90_R7P1U8	4.7191697192
+UniRef90_R7P1U8|g__Bacteroides.s__Bacteroides_vulgatus	3.0525030525
+UniRef90_R7P1U8|g__Bacteroides.s__Bacteroides_dorei	1.6666666667
+UniRef90_R7NWW0	4.7169811321
+UniRef90_R7NWW0|g__Bacteroides.s__Bacteroides_vulgatus	4.7169811321
+UniRef90_A6L4V0	4.7114252061
+UniRef90_A6L4V0|g__Bacteroides.s__Bacteroides_dorei	3.5335689046
+UniRef90_A6L4V0|g__Bacteroides.s__Bacteroides_vulgatus	1.1778563015
+UniRef90_R6HN34	4.7114252061
+UniRef90_R6HN34|g__Bacteroides.s__Bacteroides_dorei	2.3557126031
+UniRef90_R6HN34|g__Bacteroides.s__Bacteroides_vulgatus	2.3557126031
+UniRef90_R6HX05	4.7114252061
+UniRef90_R6HX05|g__Bacteroides.s__Bacteroides_dorei	4.7114252061
+UniRef90_I9A1E5	4.7043010753
+UniRef90_I9A1E5|g__Bacteroides.s__Bacteroides_dorei	3.3602150538
+UniRef90_I9A1E5|g__Bacteroides.s__Bacteroides_vulgatus	1.3440860215
+UniRef90_A6KZN9	4.6948356808
+UniRef90_A6KZN9|g__Bacteroides.s__Bacteroides_dorei	4.6948356808
+UniRef90_A6L520	4.6948356808
+UniRef90_A6L520|g__Bacteroides.s__Bacteroides_dorei	4.6948356808
+UniRef90_I8VZ24	4.6948356808
+UniRef90_I8VZ24|g__Bacteroides.s__Bacteroides_dorei	4.6948356808
+UniRef90_I9F7Q8	4.6948356808
+UniRef90_I9F7Q8|g__Bacteroides.s__Bacteroides_dorei	4.6948356808
+UniRef90_R6HGX4	4.6948356808
+UniRef90_R6HGX4|g__Bacteroides.s__Bacteroides_vulgatus	4.6948356808
+UniRef90_R6HJB4	4.6948356808
+UniRef90_R6HJB4|g__Bacteroides.s__Bacteroides_dorei	4.6948356808
+UniRef90_R6HJY2	4.6948356808
+UniRef90_R6HJY2|g__Bacteroides.s__Bacteroides_dorei	4.6948356808
+UniRef90_R6HPT1	4.6948356808
+UniRef90_R6HPT1|g__Bacteroides.s__Bacteroides_dorei	2.3474178404
+UniRef90_R6HPT1|g__Bacteroides.s__Bacteroides_vulgatus	2.3474178404
+UniRef90_A6L4I7	4.6865846514
+UniRef90_A6L4I7|g__Bacteroides.s__Bacteroides_vulgatus	3.5149384886
+UniRef90_A6L4I7|g__Bacteroides.s__Bacteroides_dorei	1.1716461629
+UniRef90_R6HKN0	4.6825025787
+UniRef90_R6HKN0|g__Bacteroides.s__Bacteroides_vulgatus	3.1093004445
+UniRef90_R6HKN0|g__Bacteroides.s__Bacteroides_dorei	1.5732021342
+UniRef90_A6L4W6	4.6783625731
+UniRef90_A6L4W6|g__Bacteroides.s__Bacteroides_vulgatus	3.5087719298
+UniRef90_A6L4W6|g__Bacteroides.s__Bacteroides_dorei	1.1695906433
+UniRef90_R6WVN2	4.6783625731
+UniRef90_R6WVN2|g__Bacteroides.s__Bacteroides_vulgatus	3.5087719298
+UniRef90_R6WVN2|g__Bacteroides.s__Bacteroides_dorei	1.1695906433
+UniRef90_A6L1V8	4.6728971963
+UniRef90_A6L1V8|g__Bacteroides.s__Bacteroides_vulgatus	4.6728971963
+UniRef90_A6L404	4.6685340803
+UniRef90_A6L404|g__Bacteroides.s__Bacteroides_vulgatus	4.6685340803
+UniRef90_I8UPI1	4.6666666667
+UniRef90_I8UPI1|g__Bacteroides.s__Bacteroides_vulgatus	4.6666666667
+UniRef90_R7NTM0	4.6666666667
+UniRef90_R7NTM0|g__Bacteroides.s__Bacteroides_dorei	3.3333333333
+UniRef90_R7NTM0|g__Bacteroides.s__Bacteroides_vulgatus	1.3333333333
+UniRef90_A6L749	4.6620046620
+UniRef90_A6L749|g__Bacteroides.s__Bacteroides_dorei	3.4965034965
+UniRef90_A6L749|g__Bacteroides.s__Bacteroides_vulgatus	1.1655011655
+UniRef90_K1GML3	4.6620046620
+UniRef90_K1GML3|g__Bacteroides.s__Bacteroides_vulgatus	4.6620046620
+UniRef90_R7NWP9	4.6620046620
+UniRef90_R7NWP9|g__Bacteroides.s__Bacteroides_vulgatus	4.6620046620
+UniRef90_R7NXP1	4.6620046620
+UniRef90_R7NXP1|g__Bacteroides.s__Bacteroides_vulgatus	4.6620046620
+UniRef90_A6L3F0	4.6511627907
+UniRef90_A6L3F0|g__Bacteroides.s__Bacteroides_dorei	4.6511627907
+UniRef90_R6HHN7	4.6457607433
+UniRef90_R6HHN7|g__Bacteroides.s__Bacteroides_vulgatus	4.6457607433
+UniRef90_R6HVV5	4.6425255339
+UniRef90_R6HVV5|g__Bacteroides.s__Bacteroides_vulgatus	2.7855153203
+UniRef90_R6HVV5|g__Bacteroides.s__Bacteroides_dorei	1.8570102136
+UniRef90_A6L1J7	4.6296296296
+UniRef90_A6L1J7|g__Bacteroides.s__Bacteroides_dorei	4.6296296296
+UniRef90_A6L4Q3	4.6296296296
+UniRef90_A6L4Q3|g__Bacteroides.s__Bacteroides_vulgatus	4.6296296296
+UniRef90_A6L4Q8	4.6296296296
+UniRef90_A6L4Q8|g__Bacteroides.s__Bacteroides_vulgatus	2.7777777778
+UniRef90_A6L4Q8|g__Bacteroides.s__Bacteroides_dorei	1.8518518519
+UniRef90_A6L6S5	4.6296296296
+UniRef90_A6L6S5|g__Bacteroides.s__Bacteroides_vulgatus	4.6296296296
+UniRef90_A6L735	4.6296296296
+UniRef90_A6L735|g__Bacteroides.s__Bacteroides_dorei	2.3148148148
+UniRef90_A6L735|g__Bacteroides.s__Bacteroides_vulgatus	2.3148148148
+UniRef90_A6LAE0	4.6296296296
+UniRef90_A6LAE0|g__Bacteroides.s__Bacteroides_dorei	4.6296296296
+UniRef90_E5X022	4.6296296296
+UniRef90_E5X022|g__Bacteroides.s__Bacteroides_dorei	4.6296296296
+UniRef90_I9VKK1	4.6296296296
+UniRef90_I9VKK1|g__Bacteroides.s__Bacteroides_dorei	4.6296296296
+UniRef90_I9VKS9	4.6296296296
+UniRef90_I9VKS9|g__Bacteroides.s__Bacteroides_dorei	4.6296296296
+UniRef90_Q64S69	4.6296296296
+UniRef90_Q64S69|g__Bacteroides.s__Bacteroides_dorei	4.6296296296
+UniRef90_Q650D1	4.6296296296
+UniRef90_Q650D1|g__Bacteroides.s__Bacteroides_dorei	4.6296296296
+UniRef90_R6HJB8	4.6296296296
+UniRef90_R6HJB8|g__Bacteroides.s__Bacteroides_dorei	4.6296296296
+UniRef90_R6IEC8	4.6296296296
+UniRef90_R6IEC8|g__Bacteroides.s__Bacteroides_dorei	3.8580246914
+UniRef90_R6IEC8|g__Bacteroides.s__Bacteroides_vulgatus	0.7716049383
+UniRef90_A6L3Y5	4.6253469010
+UniRef90_A6L3Y5|g__Bacteroides.s__Bacteroides_dorei	3.0835646007
+UniRef90_A6L3Y5|g__Bacteroides.s__Bacteroides_vulgatus	1.5417823003
+UniRef90_C6ZA07	4.6216060081
+UniRef90_C6ZA07|g__Bacteroides.s__Bacteroides_vulgatus	4.6216060081
+UniRef90_R6HKT2	4.6216060081
+UniRef90_R6HKT2|g__Bacteroides.s__Bacteroides_dorei	4.6216060081
+UniRef90_R7P0U8	4.6189376443
+UniRef90_R7P0U8|g__Bacteroides.s__Bacteroides_vulgatus	3.0792917629
+UniRef90_R7P0U8|g__Bacteroides.s__Bacteroides_dorei	1.5396458814
+UniRef90_A6L324	4.6168051708
+UniRef90_A6L324|g__Bacteroides.s__Bacteroides_dorei	3.6934441367
+UniRef90_A6L324|g__Bacteroides.s__Bacteroides_vulgatus	0.9233610342
+UniRef90_R6HG06	4.6136101499
+UniRef90_R6HG06|g__Bacteroides.s__Bacteroides_dorei	3.4602076125
+UniRef90_R6HG06|g__Bacteroides.s__Bacteroides_vulgatus	1.1534025375
+UniRef90_R6S216	4.6136101499
+UniRef90_R6S216|g__Bacteroides.s__Bacteroides_dorei	4.6136101499
+UniRef90_R9H030	4.6136101499
+UniRef90_R9H030|g__Bacteroides.s__Bacteroides_vulgatus	4.6136101499
+UniRef90_R9HY34	4.6082949309
+UniRef90_R9HY34|g__Bacteroides.s__Bacteroides_vulgatus	4.6082949309
+UniRef90_A6L100	4.6040515654
+UniRef90_A6L100|g__Bacteroides.s__Bacteroides_vulgatus	3.6832412523
+UniRef90_A6L100|g__Bacteroides.s__Bacteroides_dorei	0.9208103131
+UniRef90_R6HIG3	4.6040515654
+UniRef90_R6HIG3|g__Bacteroides.s__Bacteroides_dorei	4.6040515654
+UniRef90_A6L3M4	4.5977011494
+UniRef90_A6L3M4|g__Bacteroides.s__Bacteroides_dorei	4.5977011494
+UniRef90_C6IR45	4.5977011494
+UniRef90_C6IR45|g__Bacteroides.s__Bacteroides_vulgatus	4.5977011494
+UniRef90_I8V713	4.5977011494
+UniRef90_I8V713|g__Bacteroides.s__Bacteroides_dorei	4.5977011494
+UniRef90_I8VU21	4.5977011494
+UniRef90_I8VU21|g__Bacteroides.s__Bacteroides_dorei	4.5977011494
+UniRef90_I8VY26	4.5977011494
+UniRef90_I8VY26|g__Bacteroides.s__Bacteroides_dorei	4.5977011494
+UniRef90_I8WRS8	4.5977011494
+UniRef90_I8WRS8|g__Bacteroides.s__Bacteroides_dorei	4.5977011494
+UniRef90_R6HPL5	4.5931758530
+UniRef90_R6HPL5|g__Bacteroides.s__Bacteroides_dorei	4.5931758530
+UniRef90_A6L7U5	4.5871559633
+UniRef90_A6L7U5|g__Bacteroides.s__Bacteroides_vulgatus	4.5871559633
+UniRef90_I8W1N0	4.5841519319
+UniRef90_I8W1N0|g__Bacteroides.s__Bacteroides_dorei	4.5841519319
+UniRef90_R6HN10	4.5819014891
+UniRef90_R6HN10|g__Bacteroides.s__Bacteroides_dorei	4.5819014891
+UniRef90_R7NR98	4.5819014891
+UniRef90_R7NR98|g__Bacteroides.s__Bacteroides_dorei	2.2909507446
+UniRef90_R7NR98|g__Bacteroides.s__Bacteroides_vulgatus	2.2909507446
+UniRef90_R7NYC0	4.5819014891
+UniRef90_R7NYC0|g__Bacteroides.s__Bacteroides_dorei	4.5819014891
+UniRef90_A6L2D4	4.5787545788
+UniRef90_A6L2D4|g__Bacteroides.s__Bacteroides_vulgatus	2.7472527473
+UniRef90_A6L2D4|g__Bacteroides.s__Bacteroides_dorei	1.8315018315
+UniRef90_A6KX21	4.5740423099
+UniRef90_A6KX21|g__Bacteroides.s__Bacteroides_dorei	4.5740423099
+UniRef90_R7P4B1	4.5691555126
+UniRef90_R7P4B1|g__Bacteroides.s__Bacteroides_vulgatus	3.1446540881
+UniRef90_R7P4B1|g__Bacteroides.s__Bacteroides_dorei	1.4245014245
+UniRef90_A6KWQ6	4.5662100457
+UniRef90_A6KWQ6|g__Bacteroides.s__Bacteroides_dorei	4.5662100457
+UniRef90_I8WXS2	4.5662100457
+UniRef90_I8WXS2|g__Bacteroides.s__Bacteroides_dorei	4.5662100457
+UniRef90_I8ZSS5	4.5662100457
+UniRef90_I8ZSS5|g__Bacteroides.s__Bacteroides_vulgatus	4.5662100457
+UniRef90_I9Q987	4.5662100457
+UniRef90_I9Q987|g__Bacteroides.s__Bacteroides_dorei	4.5662100457
+UniRef90_A6KZT3	4.5662100457
+UniRef90_A6KZT3|g__Bacteroides.s__Bacteroides_dorei	4.5662100457
+UniRef90_R6HPW2	4.5662100457
+UniRef90_R6HPW2|g__Bacteroides.s__Bacteroides_dorei	3.0441400304
+UniRef90_R6HPW2|g__Bacteroides.s__Bacteroides_vulgatus	1.5220700152
+UniRef90_R7NXD6	4.5662100457
+UniRef90_R7NXD6|g__Bacteroides.s__Bacteroides_dorei	4.5662100457
+UniRef90_A6KXY6	4.5614580097
+UniRef90_A6KXY6|g__Bacteroides.s__Bacteroides_dorei	3.6036036036
+UniRef90_A6KXY6|g__Bacteroides.s__Bacteroides_vulgatus	0.9578544061
+UniRef90_C3RCI7	4.5558086560
+UniRef90_C3RCI7|g__Bacteroides.s__Bacteroides_vulgatus	3.0372057707
+UniRef90_C3RCI7|g__Bacteroides.s__Bacteroides_dorei	1.5186028853
+UniRef90_A6KX96	4.5558086560
+UniRef90_A6KX96|g__Bacteroides.s__Bacteroides_dorei	4.5558086560
+UniRef90_R6HI74	4.5506257110
+UniRef90_R6HI74|g__Bacteroides.s__Bacteroides_dorei	3.4129692833
+UniRef90_R6HI74|g__Bacteroides.s__Bacteroides_vulgatus	1.1376564278
+UniRef90_I9G3P4	4.5454545455
+UniRef90_I9G3P4|g__Bacteroides.s__Bacteroides_dorei	4.5454545455
+UniRef90_A6L7M5	4.5413260672
+UniRef90_A6L7M5|g__Bacteroides.s__Bacteroides_vulgatus	2.7247956403
+UniRef90_A6L7M5|g__Bacteroides.s__Bacteroides_dorei	1.8165304269
+UniRef90_R6HUG9	4.5352242019
+UniRef90_R6HUG9|g__Bacteroides.s__Bacteroides_vulgatus	2.6195153897
+UniRef90_R6HUG9|g__Bacteroides.s__Bacteroides_dorei	1.9157088123
+UniRef90_A6L049	4.5351473923
+UniRef90_A6L049|g__Bacteroides.s__Bacteroides_dorei	2.2675736961
+UniRef90_A6L049|g__Bacteroides.s__Bacteroides_vulgatus	2.2675736961
+UniRef90_A6L081	4.5351473923
+UniRef90_A6L081|g__Bacteroides.s__Bacteroides_vulgatus	3.4013605442
+UniRef90_A6L081|g__Bacteroides.s__Bacteroides_dorei	1.1337868481
+UniRef90_A6KWS4	4.5307443366
+UniRef90_A6KWS4|g__Bacteroides.s__Bacteroides_vulgatus	3.2362459547
+UniRef90_A6KWS4|g__Bacteroides.s__Bacteroides_dorei	1.2944983819
+UniRef90_I9PIE6	4.5248868778
+UniRef90_I9PIE6|g__Bacteroides.s__Bacteroides_vulgatus	4.5248868778
+UniRef90_Q8A8P2	4.5248868778
+UniRef90_Q8A8P2|g__Bacteroides.s__Bacteroides_dorei	4.5248868778
+UniRef90_A6L5L6	4.5216924213
+UniRef90_A6L5L6|g__Bacteroides.s__Bacteroides_dorei	3.3898305085
+UniRef90_A6L5L6|g__Bacteroides.s__Bacteroides_vulgatus	1.1318619128
+UniRef90_Q8A8R5	4.5197740113
+UniRef90_Q8A8R5|g__Bacteroides.s__Bacteroides_dorei	4.5197740113
+UniRef90_A6KZ37	4.5103270510
+UniRef90_A6KZ37|g__Bacteroides.s__Bacteroides_vulgatus	2.8296547821
+UniRef90_A6KZ37|g__Bacteroides.s__Bacteroides_dorei	1.6806722689
+UniRef90_R6HG20	4.5095885954
+UniRef90_R6HG20|g__Bacteroides.s__Bacteroides_dorei	4.5095885954
+UniRef90_A6L787	4.5063560935
+UniRef90_A6L787|g__Bacteroides.s__Bacteroides_dorei	2.2988505747
+UniRef90_A6L787|g__Bacteroides.s__Bacteroides_vulgatus	2.2075055188
+UniRef90_A6KXR4	4.5045045045
+UniRef90_A6KXR4|g__Bacteroides.s__Bacteroides_dorei	3.0030030030
+UniRef90_A6KXR4|g__Bacteroides.s__Bacteroides_vulgatus	1.5015015015
+UniRef90_A6KXS2	4.5045045045
+UniRef90_A6KXS2|g__Bacteroides.s__Bacteroides_dorei	4.5045045045
+UniRef90_A6L176	4.5045045045
+UniRef90_A6L176|g__Bacteroides.s__Bacteroides_dorei	2.2522522523
+UniRef90_A6L176|g__Bacteroides.s__Bacteroides_vulgatus	2.2522522523
+UniRef90_C3PVD2	4.5045045045
+UniRef90_C3PVD2|g__Bacteroides.s__Bacteroides_dorei	4.5045045045
+UniRef90_C6IR50	4.5045045045
+UniRef90_C6IR50|g__Bacteroides.s__Bacteroides_vulgatus	3.0030030030
+UniRef90_C6IR50|g__Bacteroides.s__Bacteroides_dorei	1.5015015015
+UniRef90_I9FAF8	4.5045045045
+UniRef90_I9FAF8|g__Bacteroides.s__Bacteroides_dorei	4.5045045045
+UniRef90_R6HHB5	4.5045045045
+UniRef90_R6HHB5|g__Bacteroides.s__Bacteroides_vulgatus	3.3783783784
+UniRef90_R6HHB5|g__Bacteroides.s__Bacteroides_dorei	1.1261261261
+UniRef90_R6HP34	4.5045045045
+UniRef90_R6HP34|g__Bacteroides.s__Bacteroides_dorei	4.5045045045
+UniRef90_R9H4M6	4.5045045045
+UniRef90_R9H4M6|g__Bacteroides.s__Bacteroides_vulgatus	4.5045045045
+UniRef90_R6HI76	4.4958253051
+UniRef90_R6HI76|g__Bacteroides.s__Bacteroides_vulgatus	3.2113037893
+UniRef90_R6HI76|g__Bacteroides.s__Bacteroides_dorei	1.2845215157
+UniRef90_R9HGG2	4.4943820225
+UniRef90_R9HGG2|g__Bacteroides.s__Bacteroides_vulgatus	4.4943820225
+UniRef90_A6KZR9	4.4893378227
+UniRef90_A6KZR9|g__Bacteroides.s__Bacteroides_dorei	2.2446689113
+UniRef90_A6KZR9|g__Bacteroides.s__Bacteroides_vulgatus	2.2446689113
+UniRef90_R7P3Y6	4.4843049327
+UniRef90_R7P3Y6|g__Bacteroides.s__Bacteroides_dorei	4.4843049327
+UniRef90_A6KZ80	4.4742729306
+UniRef90_A6KZ80|g__Bacteroides.s__Bacteroides_dorei	4.4742729306
+UniRef90_A6L4U5	4.4742729306
+UniRef90_A6L4U5|g__Bacteroides.s__Bacteroides_dorei	2.9828486204
+UniRef90_A6L4U5|g__Bacteroides.s__Bacteroides_vulgatus	1.4914243102
+UniRef90_I8VW33	4.4742729306
+UniRef90_I8VW33|g__Bacteroides.s__Bacteroides_dorei	4.4742729306
+UniRef90_I8W9S5	4.4742729306
+UniRef90_I8W9S5|g__Bacteroides.s__Bacteroides_dorei	4.4742729306
+UniRef90_R7P077	4.4742729306
+UniRef90_R7P077|g__Bacteroides.s__Bacteroides_dorei	2.2371364653
+UniRef90_R7P077|g__Bacteroides.s__Bacteroides_vulgatus	2.2371364653
+UniRef90_D4VIR9	4.4642857143
+UniRef90_D4VIR9|g__Bacteroides.s__Bacteroides_dorei	4.4642857143
+UniRef90_R6HM44	4.4642857143
+UniRef90_R6HM44|g__Bacteroides.s__Bacteroides_dorei	4.4642857143
+UniRef90_R6HMM9	4.4642857143
+UniRef90_R6HMM9|g__Bacteroides.s__Bacteroides_vulgatus	2.9761904762
+UniRef90_R6HMM9|g__Bacteroides.s__Bacteroides_dorei	1.4880952381
+UniRef90_D7K6P6	4.4614404079
+UniRef90_D7K6P6|g__Bacteroides.s__Bacteroides_dorei	4.4614404079
+UniRef90_A6KYI4	4.4444444444
+UniRef90_A6KYI4|g__Bacteroides.s__Bacteroides_vulgatus	4.4444444444
+UniRef90_A6L1R0	4.4444444444
+UniRef90_A6L1R0|g__Bacteroides.s__Bacteroides_dorei	4.4444444444
+UniRef90_A6L3M2	4.4444444444
+UniRef90_A6L3M2|g__Bacteroides.s__Bacteroides_dorei	4.4444444444
+UniRef90_A6L646	4.4444444444
+UniRef90_A6L646|g__Bacteroides.s__Bacteroides_dorei	2.9629629630
+UniRef90_A6L646|g__Bacteroides.s__Bacteroides_vulgatus	1.4814814815
+UniRef90_I8W1Y2	4.4444444444
+UniRef90_I8W1Y2|g__Bacteroides.s__Bacteroides_dorei	4.4444444444
+UniRef90_I9RCW7	4.4444444444
+UniRef90_I9RCW7|g__Bacteroides.s__Bacteroides_dorei	4.4444444444
+UniRef90_Q64SJ1	4.4444444444
+UniRef90_Q64SJ1|g__Bacteroides.s__Bacteroides_dorei	4.4444444444
+UniRef90_R6HWI2	4.4444444444
+UniRef90_R6HWI2|g__Bacteroides.s__Bacteroides_vulgatus	4.4444444444
+UniRef90_R7P3Y7	4.4444444444
+UniRef90_R7P3Y7|g__Bacteroides.s__Bacteroides_dorei	4.4444444444
+UniRef90_A6KZW8	4.4378698225
+UniRef90_A6KZW8|g__Bacteroides.s__Bacteroides_vulgatus	3.9447731755
+UniRef90_A6KZW8|g__Bacteroides.s__Bacteroides_dorei	0.4930966469
+UniRef90_F0R0T4	4.4345898004
+UniRef90_F0R0T4|g__Bacteroides.s__Bacteroides_vulgatus	2.9563932003
+UniRef90_F0R0T4|g__Bacteroides.s__Bacteroides_dorei	1.4781966001
+UniRef90_A6L161	4.4326241135
+UniRef90_A6L161|g__Bacteroides.s__Bacteroides_vulgatus	3.5460992908
+UniRef90_A6L161|g__Bacteroides.s__Bacteroides_dorei	0.8865248227
+UniRef90_R7NXH1	4.4326241135
+UniRef90_R7NXH1|g__Bacteroides.s__Bacteroides_dorei	4.4326241135
+UniRef90_A6KXK8	4.4296788483
+UniRef90_A6KXK8|g__Bacteroides.s__Bacteroides_vulgatus	4.4296788483
+UniRef90_A6KXQ3	4.4296788483
+UniRef90_A6KXQ3|g__Bacteroides.s__Bacteroides_vulgatus	4.4296788483
+UniRef90_I9QPI5	4.4296788483
+UniRef90_I9QPI5|g__Bacteroides.s__Bacteroides_dorei	4.4296788483
+UniRef90_R6HJV6	4.4296788483
+UniRef90_R6HJV6|g__Bacteroides.s__Bacteroides_dorei	2.2148394241
+UniRef90_R6HJV6|g__Bacteroides.s__Bacteroides_vulgatus	2.2148394241
+UniRef90_R6IE22	4.4247787611
+UniRef90_R6IE22|g__Bacteroides.s__Bacteroides_vulgatus	2.9498525074
+UniRef90_R6IE22|g__Bacteroides.s__Bacteroides_dorei	1.4749262537
+UniRef90_A6KZ41	4.4208664898
+UniRef90_A6KZ41|g__Bacteroides.s__Bacteroides_vulgatus	3.5366931919
+UniRef90_A6KZ41|g__Bacteroides.s__Bacteroides_dorei	0.8841732980
+UniRef90_I8UT89	4.4208664898
+UniRef90_I8UT89|g__Bacteroides.s__Bacteroides_vulgatus	4.4208664898
+UniRef90_R7P669	4.4208664898
+UniRef90_R7P669|g__Bacteroides.s__Bacteroides_dorei	2.6525198939
+UniRef90_R7P669|g__Bacteroides.s__Bacteroides_vulgatus	1.7683465959
+UniRef90_A6L2W8	4.4194171870
+UniRef90_A6L2W8|g__Bacteroides.s__Bacteroides_vulgatus	2.2264347309
+UniRef90_A6L2W8|g__Bacteroides.s__Bacteroides_dorei	2.1929824561
+UniRef90_A0A015N9J5	4.4150110375
+UniRef90_A0A015N9J5|g__Bacteroides.s__Bacteroides_dorei	4.4150110375
+UniRef90_A6L586	4.4150110375
+UniRef90_A6L586|g__Bacteroides.s__Bacteroides_vulgatus	4.4150110375
+UniRef90_D4VCJ9	4.4150110375
+UniRef90_D4VCJ9|g__Bacteroides.s__Bacteroides_dorei	4.4150110375
+UniRef90_R6DMB3	4.4150110375
+UniRef90_R6DMB3|g__Bacteroides.s__Bacteroides_vulgatus	4.4150110375
+UniRef90_R7NX96	4.4150110375
+UniRef90_R7NX96|g__Bacteroides.s__Bacteroides_dorei	4.4150110375
+UniRef90_U6RFA3	4.4150110375
+UniRef90_U6RFA3|g__Bacteroides.s__Bacteroides_vulgatus	4.4150110375
+UniRef90_I8W462	4.4077134986
+UniRef90_I8W462|g__Bacteroides.s__Bacteroides_dorei	4.4077134986
+UniRef90_A6L799	4.4052863436
+UniRef90_A6L799|g__Bacteroides.s__Bacteroides_dorei	3.6710719530
+UniRef90_A6L799|g__Bacteroides.s__Bacteroides_vulgatus	0.7342143906
+UniRef90_C3RAK3	4.4052863436
+UniRef90_C3RAK3|g__Bacteroides.s__Bacteroides_dorei	4.4052863436
+UniRef90_A6L539	4.4033465434
+UniRef90_A6L539|g__Bacteroides.s__Bacteroides_dorei	3.5226772347
+UniRef90_A6L539|g__Bacteroides.s__Bacteroides_vulgatus	0.8806693087
+UniRef90_R7NW57	4.4004400440
+UniRef90_R7NW57|g__Bacteroides.s__Bacteroides_dorei	2.2002200220
+UniRef90_R7NW57|g__Bacteroides.s__Bacteroides_vulgatus	2.2002200220
+UniRef90_R6HX86	4.3975373791
+UniRef90_R6HX86|g__Bacteroides.s__Bacteroides_dorei	2.6385224274
+UniRef90_R6HX86|g__Bacteroides.s__Bacteroides_vulgatus	1.7590149516
+UniRef90_R7NU88	4.3942247332
+UniRef90_R7NU88|g__Bacteroides.s__Bacteroides_vulgatus	3.1387319523
+UniRef90_R7NU88|g__Bacteroides.s__Bacteroides_dorei	1.2554927809
+UniRef90_R6HIM6	4.3904408294
+UniRef90_R6HIM6|g__Bacteroides.s__Bacteroides_dorei	2.5528811087
+UniRef90_R6HIM6|g__Bacteroides.s__Bacteroides_vulgatus	1.8375597207
+UniRef90_I8W1Z3	4.3897996357
+UniRef90_I8W1Z3|g__Bacteroides.s__Bacteroides_dorei	3.2786885246
+UniRef90_I8W1Z3|g__Bacteroides.s__Bacteroides_vulgatus	1.1111111111
+UniRef90_A6L4E4	4.3859649123
+UniRef90_A6L4E4|g__Bacteroides.s__Bacteroides_vulgatus	4.3859649123
+UniRef90_R5F0W3	4.3859649123
+UniRef90_R5F0W3|g__Bacteroides.s__Bacteroides_dorei	2.1929824561
+UniRef90_R5F0W3|g__Bacteroides.s__Bacteroides_vulgatus	2.1929824561
+UniRef90_R6IK86	4.3859649123
+UniRef90_R6IK86|g__Bacteroides.s__Bacteroides_dorei	4.3859649123
+UniRef90_R7NX07	4.3777360851
+UniRef90_R7NX07|g__Bacteroides.s__Bacteroides_dorei	3.1269543465
+UniRef90_R7NX07|g__Bacteroides.s__Bacteroides_vulgatus	1.2507817386
+UniRef90_A6L5B6	4.3763676149
+UniRef90_A6L5B6|g__Bacteroides.s__Bacteroides_dorei	2.9175784099
+UniRef90_A6L5B6|g__Bacteroides.s__Bacteroides_vulgatus	1.4587892050
+UniRef90_R6IIR6	4.3731778426
+UniRef90_R6IIR6|g__Bacteroides.s__Bacteroides_vulgatus	3.4013605442
+UniRef90_R6IIR6|g__Bacteroides.s__Bacteroides_dorei	0.9718172983
+UniRef90_A6L3N2	4.3699973563
+UniRef90_A6L3N2|g__Bacteroides.s__Bacteroides_dorei	2.9112081514
+UniRef90_A6L3N2|g__Bacteroides.s__Bacteroides_vulgatus	1.4587892050
+UniRef90_R7NL38	4.3669780512
+UniRef90_R7NL38|g__Bacteroides.s__Bacteroides_vulgatus	2.9239766082
+UniRef90_R7NL38|g__Bacteroides.s__Bacteroides_dorei	1.4430014430
+UniRef90_R6HMH0	4.3630017452
+UniRef90_R6HMH0|g__Bacteroides.s__Bacteroides_dorei	2.6178010471
+UniRef90_R6HMH0|g__Bacteroides.s__Bacteroides_vulgatus	1.7452006981
+UniRef90_A6L039	4.3572984749
+UniRef90_A6L039|g__Bacteroides.s__Bacteroides_vulgatus	3.2679738562
+UniRef90_A6L039|g__Bacteroides.s__Bacteroides_dorei	1.0893246187
+UniRef90_A6L2M9	4.3572984749
+UniRef90_A6L2M9|g__Bacteroides.s__Bacteroides_vulgatus	4.3572984749
+UniRef90_A6L4X0	4.3572984749
+UniRef90_A6L4X0|g__Bacteroides.s__Bacteroides_vulgatus	4.3572984749
+UniRef90_R6HIP9	4.3572984749
+UniRef90_R6HIP9|g__Bacteroides.s__Bacteroides_dorei	4.3572984749
+UniRef90_A6KWS7	4.3525571273
+UniRef90_A6KWS7|g__Bacteroides.s__Bacteroides_vulgatus	2.5389916576
+UniRef90_A6KWS7|g__Bacteroides.s__Bacteroides_dorei	1.8135654697
+UniRef90_R5C1J4	4.3516100957
+UniRef90_R5C1J4|g__Bacteroides.s__Bacteroides_dorei	4.3516100957
+UniRef90_A6KWN3	4.3501903208
+UniRef90_A6KWN3|g__Bacteroides.s__Bacteroides_dorei	2.7188689505
+UniRef90_A6KWN3|g__Bacteroides.s__Bacteroides_vulgatus	1.6313213703
+UniRef90_A6L1F6	4.3478260870
+UniRef90_A6L1F6|g__Bacteroides.s__Bacteroides_dorei	2.8985507246
+UniRef90_A6L1F6|g__Bacteroides.s__Bacteroides_vulgatus	1.4492753623
+UniRef90_I8WGL8	4.3431053203
+UniRef90_I8WGL8|g__Bacteroides.s__Bacteroides_dorei	4.3431053203
+UniRef90_R6HQM8	4.3335725240
+UniRef90_R6HQM8|g__Bacteroides.s__Bacteroides_dorei	2.2371364653
+UniRef90_R6HQM8|g__Bacteroides.s__Bacteroides_vulgatus	2.0964360587
+UniRef90_A6KWU7	4.3290043290
+UniRef90_A6KWU7|g__Bacteroides.s__Bacteroides_dorei	2.8860028860
+UniRef90_A6KWU7|g__Bacteroides.s__Bacteroides_vulgatus	1.4430014430
+UniRef90_A6L2E4	4.3290043290
+UniRef90_A6L2E4|g__Bacteroides.s__Bacteroides_dorei	4.3290043290
+UniRef90_A6L2X6	4.3290043290
+UniRef90_A6L2X6|g__Bacteroides.s__Bacteroides_vulgatus	4.3290043290
+UniRef90_A6L5F4	4.3290043290
+UniRef90_A6L5F4|g__Bacteroides.s__Bacteroides_dorei	3.2467532468
+UniRef90_A6L5F4|g__Bacteroides.s__Bacteroides_vulgatus	1.0822510823
+UniRef90_A6L7Q8	4.3290043290
+UniRef90_A6L7Q8|g__Bacteroides.s__Bacteroides_vulgatus	2.8860028860
+UniRef90_A6L7Q8|g__Bacteroides.s__Bacteroides_dorei	1.4430014430
+UniRef90_C3QUC2	4.3290043290
+UniRef90_C3QUC2|g__Bacteroides.s__Bacteroides_dorei	4.3290043290
+UniRef90_I9FGE6	4.3290043290
+UniRef90_I9FGE6|g__Bacteroides.s__Bacteroides_dorei	4.3290043290
+UniRef90_I9QJM3	4.3290043290
+UniRef90_I9QJM3|g__Bacteroides.s__Bacteroides_dorei	4.3290043290
+UniRef90_Q8A8N4	4.3290043290
+UniRef90_Q8A8N4|g__Bacteroides.s__Bacteroides_dorei	4.3290043290
+UniRef90_R6I1C4	4.3290043290
+UniRef90_R6I1C4|g__Bacteroides.s__Bacteroides_dorei	4.3290043290
+UniRef90_R6IFS6	4.3290043290
+UniRef90_R6IFS6|g__Bacteroides.s__Bacteroides_dorei	4.3290043290
+UniRef90_R7P0X4	4.3290043290
+UniRef90_R7P0X4|g__Bacteroides.s__Bacteroides_vulgatus	4.3290043290
+UniRef90_R7P2Q4	4.3290043290
+UniRef90_R7P2Q4|g__Bacteroides.s__Bacteroides_dorei	2.1645021645
+UniRef90_R7P2Q4|g__Bacteroides.s__Bacteroides_vulgatus	2.1645021645
+UniRef90_I9FN85	4.3196544276
+UniRef90_I9FN85|g__Bacteroides.s__Bacteroides_dorei	4.3196544276
+UniRef90_R6HP40	4.3165467626
+UniRef90_R6HP40|g__Bacteroides.s__Bacteroides_dorei	4.3165467626
+UniRef90_A6L7B3	4.3149946063
+UniRef90_A6L7B3|g__Bacteroides.s__Bacteroides_dorei	4.3149946063
+UniRef90_R6HW22	4.3149946063
+UniRef90_R6HW22|g__Bacteroides.s__Bacteroides_dorei	4.3149946063
+UniRef90_A6L4Y5	4.3103448276
+UniRef90_A6L4Y5|g__Bacteroides.s__Bacteroides_dorei	2.1551724138
+UniRef90_A6L4Y5|g__Bacteroides.s__Bacteroides_vulgatus	2.1551724138
+UniRef90_E5UZL3	4.3103448276
+UniRef90_E5UZL3|g__Bacteroides.s__Bacteroides_vulgatus	4.3103448276
+UniRef90_R6HXU0	4.3103448276
+UniRef90_R6HXU0|g__Bacteroides.s__Bacteroides_vulgatus	4.3103448276
+UniRef90_D4VBZ6	4.3103448276
+UniRef90_D4VBZ6|g__Bacteroides.s__Bacteroides_vulgatus	4.3103448276
+UniRef90_A6KWY4	4.3066322136
+UniRef90_A6KWY4|g__Bacteroides.s__Bacteroides_dorei	3.4453057709
+UniRef90_A6KWY4|g__Bacteroides.s__Bacteroides_vulgatus	0.8613264427
+UniRef90_A6L178	4.3010752688
+UniRef90_A6L178|g__Bacteroides.s__Bacteroides_dorei	4.3010752688
+UniRef90_A6L6X1	4.3010752688
+UniRef90_A6L6X1|g__Bacteroides.s__Bacteroides_vulgatus	4.3010752688
+UniRef90_C3QUD7	4.3010752688
+UniRef90_C3QUD7|g__Bacteroides.s__Bacteroides_dorei	4.3010752688
+UniRef90_R6HSG9	4.3010752688
+UniRef90_R6HSG9|g__Bacteroides.s__Bacteroides_dorei	2.1505376344
+UniRef90_R6HSG9|g__Bacteroides.s__Bacteroides_vulgatus	2.1505376344
+UniRef90_R7P442	4.3010752688
+UniRef90_R7P442|g__Bacteroides.s__Bacteroides_vulgatus	4.3010752688
+UniRef90_R9HVI5	4.3010752688
+UniRef90_R9HVI5|g__Bacteroides.s__Bacteroides_vulgatus	4.3010752688
+UniRef90_R6HUR2	4.2955326460
+UniRef90_R6HUR2|g__Bacteroides.s__Bacteroides_dorei	4.2955326460
+UniRef90_R6HJG9	4.2918454936
+UniRef90_R6HJG9|g__Bacteroides.s__Bacteroides_dorei	2.8612303290
+UniRef90_R6HJG9|g__Bacteroides.s__Bacteroides_vulgatus	1.4306151645
+UniRef90_R6HH22	4.2826552463
+UniRef90_R6HH22|g__Bacteroides.s__Bacteroides_dorei	4.2826552463
+UniRef90_A6L2G4	4.2735042735
+UniRef90_A6L2G4|g__Bacteroides.s__Bacteroides_dorei	4.2735042735
+UniRef90_A6L2I3	4.2735042735
+UniRef90_A6L2I3|g__Bacteroides.s__Bacteroides_vulgatus	4.2735042735
+UniRef90_C3R7K3	4.2735042735
+UniRef90_C3R7K3|g__Bacteroides.s__Bacteroides_dorei	4.2735042735
+UniRef90_I8WXR9	4.2735042735
+UniRef90_I8WXR9|g__Bacteroides.s__Bacteroides_dorei	4.2735042735
+UniRef90_R9HZT6	4.2735042735
+UniRef90_R9HZT6|g__Bacteroides.s__Bacteroides_dorei	4.2735042735
+UniRef90_R9I037	4.2735042735
+UniRef90_R9I037|g__Bacteroides.s__Bacteroides_vulgatus	4.2735042735
+UniRef90_A6L2R8	4.2579075426
+UniRef90_A6L2R8|g__Bacteroides.s__Bacteroides_vulgatus	3.0413625304
+UniRef90_A6L2R8|g__Bacteroides.s__Bacteroides_dorei	1.2165450122
+UniRef90_A0A015UAR2	4.2553191489
+UniRef90_A0A015UAR2|g__Bacteroides.s__Bacteroides_dorei	4.2553191489
+UniRef90_D6CZ30	4.2553191489
+UniRef90_D6CZ30|g__Bacteroides.s__Bacteroides_vulgatus	4.2553191489
+UniRef90_R9HN44	4.2553191489
+UniRef90_R9HN44|g__Bacteroides.s__Bacteroides_vulgatus	4.2553191489
+UniRef90_A6L3I6	4.2517006803
+UniRef90_A6L3I6|g__Bacteroides.s__Bacteroides_dorei	3.4013605442
+UniRef90_A6L3I6|g__Bacteroides.s__Bacteroides_vulgatus	0.8503401361
+UniRef90_J9FUZ5	4.2517006803
+UniRef90_J9FUZ5|g__Bacteroides.s__Bacteroides_dorei	4.2517006803
+UniRef90_A6L305	4.2462845011
+UniRef90_A6L305|g__Bacteroides.s__Bacteroides_dorei	2.1231422505
+UniRef90_A6L305|g__Bacteroides.s__Bacteroides_vulgatus	2.1231422505
+UniRef90_A6L3T8	4.2462845011
+UniRef90_A6L3T8|g__Bacteroides.s__Bacteroides_dorei	4.2462845011
+UniRef90_E5VD77	4.2462845011
+UniRef90_E5VD77|g__Bacteroides.s__Bacteroides_vulgatus	4.2462845011
+UniRef90_Q8ABY6	4.2462845011
+UniRef90_Q8ABY6|g__Bacteroides.s__Bacteroides_dorei	4.2462845011
+UniRef90_R6IHM4	4.2462845011
+UniRef90_R6IHM4|g__Bacteroides.s__Bacteroides_dorei	2.1231422505
+UniRef90_R6IHM4|g__Bacteroides.s__Bacteroides_vulgatus	2.1231422505
+UniRef90_R6IJ16	4.2462845011
+UniRef90_R6IJ16|g__Bacteroides.s__Bacteroides_dorei	2.8308563340
+UniRef90_R6IJ16|g__Bacteroides.s__Bacteroides_vulgatus	1.4154281670
+UniRef90_R7P0T0	4.2462845011
+UniRef90_R7P0T0|g__Bacteroides.s__Bacteroides_dorei	2.1231422505
+UniRef90_R7P0T0|g__Bacteroides.s__Bacteroides_vulgatus	2.1231422505
+UniRef90_R9I112	4.2462845011
+UniRef90_R9I112|g__Bacteroides.s__Bacteroides_vulgatus	4.2462845011
+UniRef90_A6L1E0	4.2377872272
+UniRef90_A6L1E0|g__Bacteroides.s__Bacteroides_dorei	2.1191431594
+UniRef90_A6L1E0|g__Bacteroides.s__Bacteroides_vulgatus	2.1186440678
+UniRef90_R9HSG9	4.2372881356
+UniRef90_R9HSG9|g__Bacteroides.s__Bacteroides_vulgatus	4.2372881356
+UniRef90_E5UN35	4.2328042328
+UniRef90_E5UN35|g__Bacteroides.s__Bacteroides_dorei	4.2328042328
+UniRef90_R7P0B5	4.2328042328
+UniRef90_R7P0B5|g__Bacteroides.s__Bacteroides_dorei	4.2328042328
+UniRef90_R9H525	4.2301184433
+UniRef90_R9H525|g__Bacteroides.s__Bacteroides_vulgatus	4.2301184433
+UniRef90_R6ILE4	4.2283487091
+UniRef90_R6ILE4|g__Bacteroides.s__Bacteroides_dorei	2.1186440678
+UniRef90_R6ILE4|g__Bacteroides.s__Bacteroides_vulgatus	2.1097046414
+UniRef90_R6HZU4	4.2220162702
+UniRef90_R6HZU4|g__Bacteroides.s__Bacteroides_vulgatus	3.4188034188
+UniRef90_R6HZU4|g__Bacteroides.s__Bacteroides_dorei	0.8032128514
+UniRef90_A6KYQ5	4.2194092827
+UniRef90_A6KYQ5|g__Bacteroides.s__Bacteroides_vulgatus	4.2194092827
+UniRef90_A6L3M0	4.2194092827
+UniRef90_A6L3M0|g__Bacteroides.s__Bacteroides_vulgatus	4.2194092827
+UniRef90_I9G2N6	4.2194092827
+UniRef90_I9G2N6|g__Bacteroides.s__Bacteroides_dorei	4.2194092827
+UniRef90_I9RE23	4.2194092827
+UniRef90_I9RE23|g__Bacteroides.s__Bacteroides_dorei	4.2194092827
+UniRef90_K6ADK7	4.2194092827
+UniRef90_K6ADK7|g__Bacteroides.s__Bacteroides_vulgatus	4.2194092827
+UniRef90_Q64WL9	4.2194092827
+UniRef90_Q64WL9|g__Bacteroides.s__Bacteroides_dorei	4.2194092827
+UniRef90_R9HBT7	4.2194092827
+UniRef90_R9HBT7|g__Bacteroides.s__Bacteroides_vulgatus	4.2194092827
+UniRef90_R9HK09	4.2194092827
+UniRef90_R9HK09|g__Bacteroides.s__Bacteroides_vulgatus	4.2194092827
+UniRef90_A6L4W0	4.2117930205
+UniRef90_A6L4W0|g__Bacteroides.s__Bacteroides_dorei	3.6101083032
+UniRef90_A6L4W0|g__Bacteroides.s__Bacteroides_vulgatus	0.6016847172
+UniRef90_I9RCX2	4.2105263158
+UniRef90_I9RCX2|g__Bacteroides.s__Bacteroides_dorei	4.2105263158
+UniRef90_R7NZ34	4.2105263158
+UniRef90_R7NZ34|g__Bacteroides.s__Bacteroides_vulgatus	4.2105263158
+UniRef90_R6IGP1	4.2060988433
+UniRef90_R6IGP1|g__Bacteroides.s__Bacteroides_vulgatus	3.1545741325
+UniRef90_R6IGP1|g__Bacteroides.s__Bacteroides_dorei	1.0515247108
+UniRef90_A6L1Z2	4.2029996512
+UniRef90_A6L1Z2|g__Bacteroides.s__Bacteroides_vulgatus	2.8368794326
+UniRef90_A6L1Z2|g__Bacteroides.s__Bacteroides_dorei	1.3661202186
+UniRef90_E5X0E4	4.2016806723
+UniRef90_E5X0E4|g__Bacteroides.s__Bacteroides_dorei	4.2016806723
+UniRef90_R6HU58	4.2016806723
+UniRef90_R6HU58|g__Bacteroides.s__Bacteroides_dorei	4.2016806723
+UniRef90_R6KUD5	4.2016806723
+UniRef90_R6KUD5|g__Bacteroides.s__Bacteroides_dorei	4.2016806723
+UniRef90_I8VR59	4.1928721174
+UniRef90_I8VR59|g__Bacteroides.s__Bacteroides_dorei	4.1928721174
+UniRef90_I8VRP4	4.1928721174
+UniRef90_I8VRP4|g__Bacteroides.s__Bacteroides_dorei	4.1928721174
+UniRef90_R6HTG9	4.1928721174
+UniRef90_R6HTG9|g__Bacteroides.s__Bacteroides_vulgatus	4.1928721174
+UniRef90_R6IM17	4.1928721174
+UniRef90_R6IM17|g__Bacteroides.s__Bacteroides_vulgatus	4.1928721174
+UniRef90_A6L5J7	4.1927595873
+UniRef90_A6L5J7|g__Bacteroides.s__Bacteroides_dorei	2.7434842250
+UniRef90_A6L5J7|g__Bacteroides.s__Bacteroides_vulgatus	1.4492753623
+UniRef90_R6HWW0	4.1876046901
+UniRef90_R6HWW0|g__Bacteroides.s__Bacteroides_dorei	4.1876046901
+UniRef90_I9B632	4.1862899006
+UniRef90_I9B632|g__Bacteroides.s__Bacteroides_dorei	4.1862899006
+UniRef90_A6L4F8	4.1862899006
+UniRef90_A6L4F8|g__Bacteroides.s__Bacteroides_dorei	2.0931449503
+UniRef90_A6L4F8|g__Bacteroides.s__Bacteroides_vulgatus	2.0931449503
+UniRef90_R7P0R1	4.1813826980
+UniRef90_R7P0R1|g__Bacteroides.s__Bacteroides_dorei	2.8011204482
+UniRef90_R7P0R1|g__Bacteroides.s__Bacteroides_vulgatus	1.3802622498
+UniRef90_A6L3M9	4.1771094403
+UniRef90_A6L3M9|g__Bacteroides.s__Bacteroides_dorei	2.5062656642
+UniRef90_A6L3M9|g__Bacteroides.s__Bacteroides_vulgatus	1.6708437761
+UniRef90_I8WN98	4.1666666667
+UniRef90_I8WN98|g__Bacteroides.s__Bacteroides_dorei	4.1666666667
+UniRef90_R7P4C6	4.1666666667
+UniRef90_R7P4C6|g__Bacteroides.s__Bacteroides_vulgatus	4.1666666667
+UniRef90_R9HCU4	4.1666666667
+UniRef90_R9HCU4|g__Bacteroides.s__Bacteroides_vulgatus	4.1666666667
+UniRef90_I8WSV6	4.1666666667
+UniRef90_I8WSV6|g__Bacteroides.s__Bacteroides_dorei	4.1666666667
+UniRef90_R6DNR9	4.1666666667
+UniRef90_R6DNR9|g__Bacteroides.s__Bacteroides_vulgatus	4.1666666667
+UniRef90_A6KX13	4.1604035784
+UniRef90_A6KX13|g__Bacteroides.s__Bacteroides_vulgatus	3.5587188612
+UniRef90_A6KX13|g__Bacteroides.s__Bacteroides_dorei	0.6016847172
+UniRef90_I9QHG2	4.1580041580
+UniRef90_I9QHG2|g__Bacteroides.s__Bacteroides_dorei	4.1580041580
+UniRef90_A6L1L0	4.1536863967
+UniRef90_A6L1L0|g__Bacteroides.s__Bacteroides_dorei	4.1536863967
+UniRef90_A6L391	4.1407867495
+UniRef90_A6L391|g__Bacteroides.s__Bacteroides_vulgatus	4.1407867495
+UniRef90_A6L3D1	4.1407867495
+UniRef90_A6L3D1|g__Bacteroides.s__Bacteroides_dorei	4.1407867495
+UniRef90_I9QFC1	4.1407867495
+UniRef90_I9QFC1|g__Bacteroides.s__Bacteroides_dorei	4.1407867495
+UniRef90_R6HNH7	4.1407867495
+UniRef90_R6HNH7|g__Bacteroides.s__Bacteroides_dorei	4.1407867495
+UniRef90_R7P4E7	4.1407867495
+UniRef90_R7P4E7|g__Bacteroides.s__Bacteroides_dorei	2.0703933747
+UniRef90_R7P4E7|g__Bacteroides.s__Bacteroides_vulgatus	2.0703933747
+UniRef90_R9H4R4	4.1407867495
+UniRef90_R9H4R4|g__Bacteroides.s__Bacteroides_vulgatus	4.1407867495
+UniRef90_R9HN81	4.1356492969
+UniRef90_R9HN81|g__Bacteroides.s__Bacteroides_vulgatus	4.1356492969
+UniRef90_A6L7A4	4.1322314050
+UniRef90_A6L7A4|g__Bacteroides.s__Bacteroides_dorei	4.1322314050
+UniRef90_I9F216	4.1322314050
+UniRef90_I9F216|g__Bacteroides.s__Bacteroides_dorei	4.1322314050
+UniRef90_R7NYH9	4.1279669763
+UniRef90_R7NYH9|g__Bacteroides.s__Bacteroides_dorei	4.1279669763
+UniRef90_A6L384	4.1237113402
+UniRef90_A6L384|g__Bacteroides.s__Bacteroides_vulgatus	3.4364261168
+UniRef90_A6L384|g__Bacteroides.s__Bacteroides_dorei	0.6872852234
+UniRef90_R7P4I0	4.1219089571
+UniRef90_R7P4I0|g__Bacteroides.s__Bacteroides_vulgatus	2.3767082591
+UniRef90_R7P4I0|g__Bacteroides.s__Bacteroides_dorei	1.7452006981
+UniRef90_A6KZQ1	4.1152263374
+UniRef90_A6KZQ1|g__Bacteroides.s__Bacteroides_vulgatus	4.1152263374
+UniRef90_A6L108	4.1152263374
+UniRef90_A6L108|g__Bacteroides.s__Bacteroides_vulgatus	4.1152263374
+UniRef90_A6L1U0	4.1152263374
+UniRef90_A6L1U0|g__Bacteroides.s__Bacteroides_vulgatus	4.1152263374
+UniRef90_A6L5A6	4.1152263374
+UniRef90_A6L5A6|g__Bacteroides.s__Bacteroides_dorei	2.0576131687
+UniRef90_A6L5A6|g__Bacteroides.s__Bacteroides_vulgatus	2.0576131687
+UniRef90_I9EI26	4.1152263374
+UniRef90_I9EI26|g__Bacteroides.s__Bacteroides_dorei	4.1152263374
+UniRef90_I9FBQ5	4.1152263374
+UniRef90_I9FBQ5|g__Bacteroides.s__Bacteroides_dorei	4.1152263374
+UniRef90_I9FP33	4.1152263374
+UniRef90_I9FP33|g__Bacteroides.s__Bacteroides_dorei	4.1152263374
+UniRef90_I9QEJ3	4.1152263374
+UniRef90_I9QEJ3|g__Bacteroides.s__Bacteroides_dorei	4.1152263374
+UniRef90_I9QK03	4.1152263374
+UniRef90_I9QK03|g__Bacteroides.s__Bacteroides_dorei	4.1152263374
+UniRef90_Q64RB0	4.1152263374
+UniRef90_Q64RB0|g__Bacteroides.s__Bacteroides_dorei	2.0576131687
+UniRef90_Q64RB0|g__Bacteroides.s__Bacteroides_vulgatus	2.0576131687
+UniRef90_A6L169	4.1067761807
+UniRef90_A6L169|g__Bacteroides.s__Bacteroides_vulgatus	2.7378507871
+UniRef90_A6L169|g__Bacteroides.s__Bacteroides_dorei	1.3689253936
+UniRef90_R6HT29	4.1050903120
+UniRef90_R6HT29|g__Bacteroides.s__Bacteroides_dorei	2.4630541872
+UniRef90_R6HT29|g__Bacteroides.s__Bacteroides_vulgatus	1.6420361248
+UniRef90_R6HYS3	4.1025641026
+UniRef90_R6HYS3|g__Bacteroides.s__Bacteroides_dorei	2.0512820513
+UniRef90_R6HYS3|g__Bacteroides.s__Bacteroides_vulgatus	2.0512820513
+UniRef90_C3QUC1	4.0950040950
+UniRef90_C3QUC1|g__Bacteroides.s__Bacteroides_dorei	4.0950040950
+UniRef90_R7P0G6	4.0941658137
+UniRef90_R7P0G6|g__Bacteroides.s__Bacteroides_vulgatus	4.0941658137
+UniRef90_A6L4R8	4.0935672515
+UniRef90_A6L4R8|g__Bacteroides.s__Bacteroides_vulgatus	2.3391812865
+UniRef90_A6L4R8|g__Bacteroides.s__Bacteroides_dorei	1.7543859649
+UniRef90_A6KYL9	4.0927694407
+UniRef90_A6KYL9|g__Bacteroides.s__Bacteroides_vulgatus	2.7285129604
+UniRef90_A6KYL9|g__Bacteroides.s__Bacteroides_dorei	1.3642564802
+UniRef90_A6KXK6	4.0899795501
+UniRef90_A6KXK6|g__Bacteroides.s__Bacteroides_vulgatus	4.0899795501
+UniRef90_A6L1P2	4.0899795501
+UniRef90_A6L1P2|g__Bacteroides.s__Bacteroides_dorei	2.0449897751
+UniRef90_A6L1P2|g__Bacteroides.s__Bacteroides_vulgatus	2.0449897751
+UniRef90_Q8A3G8	4.0899795501
+UniRef90_Q8A3G8|g__Bacteroides.s__Bacteroides_vulgatus	4.0899795501
+UniRef90_R6IKB4	4.0899795501
+UniRef90_R6IKB4|g__Bacteroides.s__Bacteroides_vulgatus	4.0899795501
+UniRef90_R7CYX2	4.0899795501
+UniRef90_R7CYX2|g__Bacteroides.s__Bacteroides_dorei	2.0449897751
+UniRef90_R7CYX2|g__Bacteroides.s__Bacteroides_vulgatus	2.0449897751
+UniRef90_R7P2W7	4.0899795501
+UniRef90_R7P2W7|g__Bacteroides.s__Bacteroides_vulgatus	4.0899795501
+UniRef90_R7P1K7	4.0863981319
+UniRef90_R7P1K7|g__Bacteroides.s__Bacteroides_vulgatus	2.9188558085
+UniRef90_R7P1K7|g__Bacteroides.s__Bacteroides_dorei	1.1675423234
+UniRef90_A6L085	4.0816326531
+UniRef90_A6L085|g__Bacteroides.s__Bacteroides_vulgatus	2.7210884354
+UniRef90_A6L085|g__Bacteroides.s__Bacteroides_dorei	1.3605442177
+UniRef90_E1WWN3	4.0816326531
+UniRef90_E1WWN3|g__Bacteroides.s__Bacteroides_dorei	4.0816326531
+UniRef90_R6HT81	4.0816326531
+UniRef90_R6HT81|g__Bacteroides.s__Bacteroides_vulgatus	4.0816326531
+UniRef90_Q650D2	4.0788730204
+UniRef90_Q650D2|g__Bacteroides.s__Bacteroides_vulgatus	2.0422131426
+UniRef90_Q650D2|g__Bacteroides.s__Bacteroides_dorei	2.0366598778
+UniRef90_I9PI97	4.0774719674
+UniRef90_I9PI97|g__Bacteroides.s__Bacteroides_vulgatus	4.0774719674
+UniRef90_R7NYI7	4.0743641381
+UniRef90_R7NYI7|g__Bacteroides.s__Bacteroides_dorei	3.0581039755
+UniRef90_R7NYI7|g__Bacteroides.s__Bacteroides_vulgatus	1.0162601626
+UniRef90_A6LAD9	4.0681484796
+UniRef90_A6LAD9|g__Bacteroides.s__Bacteroides_dorei	3.0487804878
+UniRef90_A6LAD9|g__Bacteroides.s__Bacteroides_vulgatus	1.0193679918
+UniRef90_A6L7M7	4.0650406504
+UniRef90_A6L7M7|g__Bacteroides.s__Bacteroides_vulgatus	4.0650406504
+UniRef90_I9F0G1	4.0650406504
+UniRef90_I9F0G1|g__Bacteroides.s__Bacteroides_dorei	4.0650406504
+UniRef90_I9QAH1	4.0650406504
+UniRef90_I9QAH1|g__Bacteroides.s__Bacteroides_dorei	4.0650406504
+UniRef90_R6HJP3	4.0650406504
+UniRef90_R6HJP3|g__Bacteroides.s__Bacteroides_dorei	2.0325203252
+UniRef90_R6HJP3|g__Bacteroides.s__Bacteroides_vulgatus	2.0325203252
+UniRef90_R7NWG3	4.0650406504
+UniRef90_R7NWG3|g__Bacteroides.s__Bacteroides_vulgatus	4.0650406504
+UniRef90_A6L3F2	4.0526849037
+UniRef90_A6L3F2|g__Bacteroides.s__Bacteroides_vulgatus	3.0395136778
+UniRef90_A6L3F2|g__Bacteroides.s__Bacteroides_dorei	1.0131712259
+UniRef90_A6L1M9	4.0485829960
+UniRef90_A6L1M9|g__Bacteroides.s__Bacteroides_dorei	4.0485829960
+UniRef90_A6L3H8	4.0485829960
+UniRef90_A6L3H8|g__Bacteroides.s__Bacteroides_vulgatus	4.0485829960
+UniRef90_R6I0K2	4.0485829960
+UniRef90_R6I0K2|g__Bacteroides.s__Bacteroides_vulgatus	4.0485829960
+UniRef90_A6L751	4.0465351543
+UniRef90_A6L751|g__Bacteroides.s__Bacteroides_vulgatus	2.5290844714
+UniRef90_A6L751|g__Bacteroides.s__Bacteroides_dorei	1.5174506829
+UniRef90_R6HUF9	4.0465351543
+UniRef90_R6HUF9|g__Bacteroides.s__Bacteroides_dorei	3.0349013657
+UniRef90_R6HUF9|g__Bacteroides.s__Bacteroides_vulgatus	1.0116337886
+UniRef90_A6L5F6	4.0431595843
+UniRef90_A6L5F6|g__Bacteroides.s__Bacteroides_dorei	3.4542314335
+UniRef90_A6L5F6|g__Bacteroides.s__Bacteroides_vulgatus	0.5889281508
+UniRef90_A6KXL0	4.0404040404
+UniRef90_A6KXL0|g__Bacteroides.s__Bacteroides_dorei	4.0404040404
+UniRef90_A6L128	4.0404040404
+UniRef90_A6L128|g__Bacteroides.s__Bacteroides_vulgatus	4.0404040404
+UniRef90_C3R5U6	4.0404040404
+UniRef90_C3R5U6|g__Bacteroides.s__Bacteroides_vulgatus	4.0404040404
+UniRef90_I9QS65	4.0404040404
+UniRef90_I9QS65|g__Bacteroides.s__Bacteroides_dorei	4.0404040404
+UniRef90_R9H119	4.0404040404
+UniRef90_R9H119|g__Bacteroides.s__Bacteroides_vulgatus	4.0404040404
+UniRef90_A6KWR0	4.0322580645
+UniRef90_A6KWR0|g__Bacteroides.s__Bacteroides_vulgatus	2.6881720430
+UniRef90_A6KWR0|g__Bacteroides.s__Bacteroides_dorei	1.3440860215
+UniRef90_A6L7B9	4.0322580645
+UniRef90_A6L7B9|g__Bacteroides.s__Bacteroides_vulgatus	2.6881720430
+UniRef90_A6L7B9|g__Bacteroides.s__Bacteroides_dorei	1.3440860215
+UniRef90_Q64WJ6	4.0322580645
+UniRef90_Q64WJ6|g__Bacteroides.s__Bacteroides_dorei	4.0322580645
+UniRef90_A6L661	4.0281973817
+UniRef90_A6L661|g__Bacteroides.s__Bacteroides_vulgatus	4.0281973817
+UniRef90_A6L743	4.0257648953
+UniRef90_A6L743|g__Bacteroides.s__Bacteroides_dorei	3.2206119163
+UniRef90_A6L743|g__Bacteroides.s__Bacteroides_vulgatus	0.8051529791
+UniRef90_R6HTL5	4.0241448692
+UniRef90_R6HTL5|g__Bacteroides.s__Bacteroides_dorei	4.0241448692
+UniRef90_A0A015U517	4.0160642570
+UniRef90_A0A015U517|g__Bacteroides.s__Bacteroides_dorei	4.0160642570
+UniRef90_A6KZV1	4.0160642570
+UniRef90_A6KZV1|g__Bacteroides.s__Bacteroides_dorei	3.0120481928
+UniRef90_A6KZV1|g__Bacteroides.s__Bacteroides_vulgatus	1.0040160643
+UniRef90_A6L170	4.0160642570
+UniRef90_A6L170|g__Bacteroides.s__Bacteroides_dorei	2.0080321285
+UniRef90_A6L170|g__Bacteroides.s__Bacteroides_vulgatus	2.0080321285
+UniRef90_A6L3C2	4.0160642570
+UniRef90_A6L3C2|g__Bacteroides.s__Bacteroides_dorei	4.0160642570
+UniRef90_A6L7J6	4.0160642570
+UniRef90_A6L7J6|g__Bacteroides.s__Bacteroides_dorei	4.0160642570
+UniRef90_C3QU96	4.0160642570
+UniRef90_C3QU96|g__Bacteroides.s__Bacteroides_dorei	4.0160642570
+UniRef90_I8VYZ4	4.0160642570
+UniRef90_I8VYZ4|g__Bacteroides.s__Bacteroides_dorei	4.0160642570
+UniRef90_I9R1Y4	4.0160642570
+UniRef90_I9R1Y4|g__Bacteroides.s__Bacteroides_dorei	4.0160642570
+UniRef90_R6HUD6	4.0160642570
+UniRef90_R6HUD6|g__Bacteroides.s__Bacteroides_dorei	4.0160642570
+UniRef90_A6L5K4	4.0160642570
+UniRef90_A6L5K4|g__Bacteroides.s__Bacteroides_vulgatus	4.0160642570
+UniRef90_R6HM67	4.0126874752
+UniRef90_R6HM67|g__Bacteroides.s__Bacteroides_vulgatus	2.3515579071
+UniRef90_R6HM67|g__Bacteroides.s__Bacteroides_dorei	1.6611295681
+UniRef90_R6HMW4	4.0091638030
+UniRef90_R6HMW4|g__Bacteroides.s__Bacteroides_dorei	2.8636884307
+UniRef90_R6HMW4|g__Bacteroides.s__Bacteroides_vulgatus	1.1454753723
+UniRef90_C3R7A1	4.0040040040
+UniRef90_C3R7A1|g__Bacteroides.s__Bacteroides_dorei	2.0020020020
+UniRef90_C3R7A1|g__Bacteroides.s__Bacteroides_vulgatus	2.0020020020
+UniRef90_E0NQV0	4.0040040040
+UniRef90_E0NQV0|g__Bacteroides.s__Bacteroides_dorei	4.0040040040
+UniRef90_A6KZ10	4.0022870212
+UniRef90_A6KZ10|g__Bacteroides.s__Bacteroides_vulgatus	4.0022870212
+UniRef90_R6HNI7	3.9933993399
+UniRef90_R6HNI7|g__Bacteroides.s__Bacteroides_dorei	3.3333333333
+UniRef90_R6HNI7|g__Bacteroides.s__Bacteroides_vulgatus	0.6600660066
+UniRef90_R6IE77	3.9920159681
+UniRef90_R6IE77|g__Bacteroides.s__Bacteroides_vulgatus	2.6613439787
+UniRef90_R6IE77|g__Bacteroides.s__Bacteroides_dorei	1.3306719894
+UniRef90_A6KYR8	3.9920159681
+UniRef90_A6KYR8|g__Bacteroides.s__Bacteroides_vulgatus	3.9920159681
+UniRef90_A6L0E3	3.9920159681
+UniRef90_A6L0E3|g__Bacteroides.s__Bacteroides_vulgatus	3.9920159681
+UniRef90_A6L0S5	3.9920159681
+UniRef90_A6L0S5|g__Bacteroides.s__Bacteroides_vulgatus	2.9940119760
+UniRef90_A6L0S5|g__Bacteroides.s__Bacteroides_dorei	0.9980039920
+UniRef90_R6ILB7	3.9920159681
+UniRef90_R6ILB7|g__Bacteroides.s__Bacteroides_dorei	3.9920159681
+UniRef90_R7P3T9	3.9920159681
+UniRef90_R7P3T9|g__Bacteroides.s__Bacteroides_dorei	3.9920159681
+UniRef90_R9H4Q1	3.9920159681
+UniRef90_R9H4Q1|g__Bacteroides.s__Bacteroides_vulgatus	3.9920159681
+UniRef90_I9QJL9	3.9840637450
+UniRef90_I9QJL9|g__Bacteroides.s__Bacteroides_dorei	3.9840637450
+UniRef90_R6HRM2	3.9840637450
+UniRef90_R6HRM2|g__Bacteroides.s__Bacteroides_vulgatus	3.9840637450
+UniRef90_R7NZ92	3.9840637450
+UniRef90_R7NZ92|g__Bacteroides.s__Bacteroides_dorei	3.9840637450
+UniRef90_D1K0P2	3.9800995025
+UniRef90_D1K0P2|g__Bacteroides.s__Bacteroides_dorei	3.9800995025
+UniRef90_R6HJX1	3.9800995025
+UniRef90_R6HJX1|g__Bacteroides.s__Bacteroides_dorei	3.9800995025
+UniRef90_A6L2U9	3.9777247414
+UniRef90_A6L2U9|g__Bacteroides.s__Bacteroides_dorei	3.9777247414
+UniRef90_A6KZM1	3.9777247414
+UniRef90_A6KZM1|g__Bacteroides.s__Bacteroides_dorei	3.9777247414
+UniRef90_R6IM67	3.9761431412
+UniRef90_R6IM67|g__Bacteroides.s__Bacteroides_dorei	3.3134526176
+UniRef90_R6IM67|g__Bacteroides.s__Bacteroides_vulgatus	0.6626905235
+UniRef90_A6KXT1	3.9750141965
+UniRef90_A6KXT1|g__Bacteroides.s__Bacteroides_dorei	2.8392958546
+UniRef90_A6KXT1|g__Bacteroides.s__Bacteroides_vulgatus	1.1357183419
+UniRef90_A6KZV4	3.9689237649
+UniRef90_A6KZV4|g__Bacteroides.s__Bacteroides_dorei	2.3187587484
+UniRef90_A6KZV4|g__Bacteroides.s__Bacteroides_vulgatus	1.6501650165
+UniRef90_A6L3L8	3.9682539683
+UniRef90_A6L3L8|g__Bacteroides.s__Bacteroides_vulgatus	3.9682539683
+UniRef90_A6L4C4	3.9682539683
+UniRef90_A6L4C4|g__Bacteroides.s__Bacteroides_vulgatus	3.9682539683
+UniRef90_A6L605	3.9682539683
+UniRef90_A6L605|g__Bacteroides.s__Bacteroides_vulgatus	3.9682539683
+UniRef90_C3QQQ3	3.9682539683
+UniRef90_C3QQQ3|g__Bacteroides.s__Bacteroides_dorei	3.9682539683
+UniRef90_C6Z1Z9	3.9682539683
+UniRef90_C6Z1Z9|g__Bacteroides.s__Bacteroides_vulgatus	3.9682539683
+UniRef90_D4VCK0	3.9682539683
+UniRef90_D4VCK0|g__Bacteroides.s__Bacteroides_vulgatus	2.6455026455
+UniRef90_D4VCK0|g__Bacteroides.s__Bacteroides_dorei	1.3227513228
+UniRef90_E5UU07	3.9682539683
+UniRef90_E5UU07|g__Bacteroides.s__Bacteroides_dorei	3.9682539683
+UniRef90_I8VW79	3.9682539683
+UniRef90_I8VW79|g__Bacteroides.s__Bacteroides_dorei	3.9682539683
+UniRef90_R6HH23	3.9682539683
+UniRef90_R6HH23|g__Bacteroides.s__Bacteroides_vulgatus	3.9682539683
+UniRef90_R6HNC8	3.9682539683
+UniRef90_R6HNC8|g__Bacteroides.s__Bacteroides_dorei	3.9682539683
+UniRef90_A6KWF8	3.9603960396
+UniRef90_A6KWF8|g__Bacteroides.s__Bacteroides_vulgatus	3.9603960396
+UniRef90_I8WRL4	3.9564787339
+UniRef90_I8WRL4|g__Bacteroides.s__Bacteroides_dorei	3.9564787339
+UniRef90_A6L2L8	3.9525691700
+UniRef90_A6L2L8|g__Bacteroides.s__Bacteroides_vulgatus	2.6350461133
+UniRef90_A6L2L8|g__Bacteroides.s__Bacteroides_dorei	1.3175230567
+UniRef90_R6HWH7	3.9525691700
+UniRef90_R6HWH7|g__Bacteroides.s__Bacteroides_dorei	3.9525691700
+UniRef90_R9H530	3.9525691700
+UniRef90_R9H530|g__Bacteroides.s__Bacteroides_vulgatus	3.9525691700
+UniRef90_R6HV00	3.9499768964
+UniRef90_R6HV00|g__Bacteroides.s__Bacteroides_vulgatus	2.3923444976
+UniRef90_R6HV00|g__Bacteroides.s__Bacteroides_dorei	1.5576323988
+UniRef90_A6KXA6	3.9494470774
+UniRef90_A6KXA6|g__Bacteroides.s__Bacteroides_vulgatus	2.3696682464
+UniRef90_A6KXA6|g__Bacteroides.s__Bacteroides_dorei	1.5797788310
+UniRef90_B5A7G0	3.9447731755
+UniRef90_B5A7G0|g__Bacteroides.s__Bacteroides_dorei	3.9447731755
+UniRef90_Q650D9	3.9447731755
+UniRef90_Q650D9|g__Bacteroides.s__Bacteroides_dorei	3.9447731755
+UniRef90_R7NZK0	3.9447731755
+UniRef90_R7NZK0|g__Bacteroides.s__Bacteroides_vulgatus	3.9447731755
+UniRef90_A6KZV5	3.9331366765
+UniRef90_A6KZV5|g__Bacteroides.s__Bacteroides_dorei	3.9331366765
+UniRef90_A6L653	3.9215686275
+UniRef90_A6L653|g__Bacteroides.s__Bacteroides_dorei	3.9215686275
+UniRef90_C3RGI7	3.9215686275
+UniRef90_C3RGI7|g__Bacteroides.s__Bacteroides_dorei	3.9215686275
+UniRef90_D4V995	3.9215686275
+UniRef90_D4V995|g__Bacteroides.s__Bacteroides_dorei	3.9215686275
+UniRef90_I9RE66	3.9215686275
+UniRef90_I9RE66|g__Bacteroides.s__Bacteroides_dorei	3.9215686275
+UniRef90_Q5LHW2	3.9215686275
+UniRef90_Q5LHW2|g__Bacteroides.s__Bacteroides_vulgatus	3.9215686275
+UniRef90_R6HMP1	3.9215686275
+UniRef90_R6HMP1|g__Bacteroides.s__Bacteroides_dorei	3.9215686275
+UniRef90_R7P6A2	3.9215686275
+UniRef90_R7P6A2|g__Bacteroides.s__Bacteroides_vulgatus	3.9215686275
+UniRef90_A6KXT0	3.9164490862
+UniRef90_A6KXT0|g__Bacteroides.s__Bacteroides_dorei	2.1758050479
+UniRef90_A6KXT0|g__Bacteroides.s__Bacteroides_vulgatus	1.7406440383
+UniRef90_K5ZHS6	3.9123630673
+UniRef90_K5ZHS6|g__Bacteroides.s__Bacteroides_dorei	3.9123630673
+UniRef90_A6L2N2	3.9062500000
+UniRef90_A6L2N2|g__Bacteroides.s__Bacteroides_dorei	3.9062500000
+UniRef90_R6IFT7	3.9062500000
+UniRef90_R6IFT7|g__Bacteroides.s__Bacteroides_vulgatus	2.6041666667
+UniRef90_R6IFT7|g__Bacteroides.s__Bacteroides_dorei	1.3020833333
+UniRef90_A6L1D1	3.9051795012
+UniRef90_A6L1D1|g__Bacteroides.s__Bacteroides_vulgatus	2.0325203252
+UniRef90_A6L1D1|g__Bacteroides.s__Bacteroides_dorei	1.8726591760
+UniRef90_R6I0Z6	3.8940809969
+UniRef90_R6I0Z6|g__Bacteroides.s__Bacteroides_vulgatus	2.3364485981
+UniRef90_R6I0Z6|g__Bacteroides.s__Bacteroides_dorei	1.5576323988
+UniRef90_R7NXI7	3.8885689460
+UniRef90_R7NXI7|g__Bacteroides.s__Bacteroides_dorei	2.5864856127
+UniRef90_R7NXI7|g__Bacteroides.s__Bacteroides_vulgatus	1.3020833333
+UniRef90_I9FG12	3.8872691934
+UniRef90_I9FG12|g__Bacteroides.s__Bacteroides_dorei	3.8872691934
+UniRef90_A6L1I9	3.8759689922
+UniRef90_A6L1I9|g__Bacteroides.s__Bacteroides_vulgatus	3.8759689922
+UniRef90_A6L6B3	3.8759689922
+UniRef90_A6L6B3|g__Bacteroides.s__Bacteroides_vulgatus	3.8759689922
+UniRef90_A6L7C2	3.8759689922
+UniRef90_A6L7C2|g__Bacteroides.s__Bacteroides_vulgatus	3.8759689922
+UniRef90_Q650E0	3.8759689922
+UniRef90_Q650E0|g__Bacteroides.s__Bacteroides_dorei	2.9069767442
+UniRef90_Q650E0|g__Bacteroides.s__Bacteroides_vulgatus	0.9689922481
+UniRef90_R6HG25	3.8759689922
+UniRef90_R6HG25|g__Bacteroides.s__Bacteroides_dorei	3.8759689922
+UniRef90_C3REX8	3.8695411830
+UniRef90_C3REX8|g__Bacteroides.s__Bacteroides_dorei	3.8695411830
+UniRef90_A6KWN2	3.8684719536
+UniRef90_A6KWN2|g__Bacteroides.s__Bacteroides_vulgatus	2.5789813024
+UniRef90_A6KWN2|g__Bacteroides.s__Bacteroides_dorei	1.2894906512
+UniRef90_A6L2H1	3.8647342995
+UniRef90_A6L2H1|g__Bacteroides.s__Bacteroides_dorei	3.8647342995
+UniRef90_A6L7B6	3.8647342995
+UniRef90_A6L7B6|g__Bacteroides.s__Bacteroides_dorei	3.8647342995
+UniRef90_R5FN87	3.8647342995
+UniRef90_R5FN87|g__Bacteroides.s__Bacteroides_dorei	3.8647342995
+UniRef90_R7P471	3.8647342995
+UniRef90_R7P471|g__Bacteroides.s__Bacteroides_dorei	2.8985507246
+UniRef90_R7P471|g__Bacteroides.s__Bacteroides_vulgatus	0.9661835749
+UniRef90_A6KWS8	3.8580246914
+UniRef90_A6KWS8|g__Bacteroides.s__Bacteroides_vulgatus	2.3148148148
+UniRef90_A6KWS8|g__Bacteroides.s__Bacteroides_dorei	1.5432098765
+UniRef90_A0A015XPQ3	3.8535645472
+UniRef90_A0A015XPQ3|g__Bacteroides.s__Bacteroides_vulgatus	3.8535645472
+UniRef90_A6L0V5	3.8535645472
+UniRef90_A6L0V5|g__Bacteroides.s__Bacteroides_vulgatus	3.8535645472
+UniRef90_A6L4J6	3.8535645472
+UniRef90_A6L4J6|g__Bacteroides.s__Bacteroides_dorei	3.8535645472
+UniRef90_A6L7N0	3.8535645472
+UniRef90_A6L7N0|g__Bacteroides.s__Bacteroides_vulgatus	3.8535645472
+UniRef90_C3PVL2	3.8535645472
+UniRef90_C3PVL2|g__Bacteroides.s__Bacteroides_dorei	3.8535645472
+UniRef90_R6IJA2	3.8535645472
+UniRef90_R6IJA2|g__Bacteroides.s__Bacteroides_dorei	3.8535645472
+UniRef90_R6HWN1	3.8491147036
+UniRef90_R6HWN1|g__Bacteroides.s__Bacteroides_dorei	3.8491147036
+UniRef90_R6HU29	3.8491147036
+UniRef90_R6HU29|g__Bacteroides.s__Bacteroides_vulgatus	2.3094688222
+UniRef90_R6HU29|g__Bacteroides.s__Bacteroides_dorei	1.5396458814
+UniRef90_U6RGV5	3.8461538462
+UniRef90_U6RGV5|g__Bacteroides.s__Bacteroides_vulgatus	3.8461538462
+UniRef90_A6L235	3.8402457757
+UniRef90_A6L235|g__Bacteroides.s__Bacteroides_vulgatus	2.3041474654
+UniRef90_A6L235|g__Bacteroides.s__Bacteroides_dorei	1.5360983103
+UniRef90_A6KXK2	3.8314176245
+UniRef90_A6KXK2|g__Bacteroides.s__Bacteroides_dorei	2.5542784163
+UniRef90_A6KXK2|g__Bacteroides.s__Bacteroides_vulgatus	1.2771392082
+UniRef90_A6L1N1	3.8314176245
+UniRef90_A6L1N1|g__Bacteroides.s__Bacteroides_dorei	3.8314176245
+UniRef90_A6L528	3.8314176245
+UniRef90_A6L528|g__Bacteroides.s__Bacteroides_vulgatus	3.8314176245
+UniRef90_G5SN03	3.8314176245
+UniRef90_G5SN03|g__Bacteroides.s__Bacteroides_dorei	3.8314176245
+UniRef90_I9G2E2	3.8314176245
+UniRef90_I9G2E2|g__Bacteroides.s__Bacteroides_dorei	3.8314176245
+UniRef90_R6HHF0	3.8314176245
+UniRef90_R6HHF0|g__Bacteroides.s__Bacteroides_dorei	3.8314176245
+UniRef90_R7NWL2	3.8314176245
+UniRef90_R7NWL2|g__Bacteroides.s__Bacteroides_vulgatus	2.8735632184
+UniRef90_R7NWL2|g__Bacteroides.s__Bacteroides_dorei	0.9578544061
+UniRef90_R7P2C3	3.8314176245
+UniRef90_R7P2C3|g__Bacteroides.s__Bacteroides_dorei	3.8314176245
+UniRef90_A6L1R8	3.8204393505
+UniRef90_A6L1R8|g__Bacteroides.s__Bacteroides_dorei	2.8653295129
+UniRef90_A6L1R8|g__Bacteroides.s__Bacteroides_vulgatus	0.9551098376
+UniRef90_A6L430	3.8204393505
+UniRef90_A6L430|g__Bacteroides.s__Bacteroides_dorei	3.8204393505
+UniRef90_D4VC51	3.8204393505
+UniRef90_D4VC51|g__Bacteroides.s__Bacteroides_vulgatus	3.8204393505
+UniRef90_R6HLW9	3.8204393505
+UniRef90_R6HLW9|g__Bacteroides.s__Bacteroides_dorei	2.8653295129
+UniRef90_R6HLW9|g__Bacteroides.s__Bacteroides_vulgatus	0.9551098376
+UniRef90_R7NWX0	3.8167938931
+UniRef90_R7NWX0|g__Bacteroides.s__Bacteroides_vulgatus	3.8167938931
+UniRef90_A6KY57	3.8095238095
+UniRef90_A6KY57|g__Bacteroides.s__Bacteroides_vulgatus	3.8095238095
+UniRef90_A6L0W8	3.8095238095
+UniRef90_A6L0W8|g__Bacteroides.s__Bacteroides_dorei	1.9047619048
+UniRef90_A6L0W8|g__Bacteroides.s__Bacteroides_vulgatus	1.9047619048
+UniRef90_A6L7B7	3.8095238095
+UniRef90_A6L7B7|g__Bacteroides.s__Bacteroides_vulgatus	3.8095238095
+UniRef90_C3QUE4	3.8095238095
+UniRef90_C3QUE4|g__Bacteroides.s__Bacteroides_dorei	3.8095238095
+UniRef90_I8W278	3.8095238095
+UniRef90_I8W278|g__Bacteroides.s__Bacteroides_dorei	3.8095238095
+UniRef90_I9F988	3.8095238095
+UniRef90_I9F988|g__Bacteroides.s__Bacteroides_dorei	3.8095238095
+UniRef90_R6D133	3.8095238095
+UniRef90_R6D133|g__Bacteroides.s__Bacteroides_vulgatus	3.8095238095
+UniRef90_A6L1Y2	3.8022813688
+UniRef90_A6L1Y2|g__Bacteroides.s__Bacteroides_vulgatus	2.5348542459
+UniRef90_A6L1Y2|g__Bacteroides.s__Bacteroides_dorei	1.2674271229
+UniRef90_A0A015PWK0	3.7986704653
+UniRef90_A0A015PWK0|g__Bacteroides.s__Bacteroides_dorei	3.7986704653
+UniRef90_I8UT56	3.7986704653
+UniRef90_I8UT56|g__Bacteroides.s__Bacteroides_vulgatus	2.8490028490
+UniRef90_I8UT56|g__Bacteroides.s__Bacteroides_dorei	0.9496676163
+UniRef90_I9F997	3.7986704653
+UniRef90_I9F997|g__Bacteroides.s__Bacteroides_dorei	3.7986704653
+UniRef90_A6L0W2	3.7932669512
+UniRef90_A6L0W2|g__Bacteroides.s__Bacteroides_vulgatus	2.5062656642
+UniRef90_A6L0W2|g__Bacteroides.s__Bacteroides_dorei	1.2870012870
+UniRef90_A6KXA4	3.7878787879
+UniRef90_A6KXA4|g__Bacteroides.s__Bacteroides_dorei	2.2727272727
+UniRef90_A6KXA4|g__Bacteroides.s__Bacteroides_vulgatus	1.5151515152
+UniRef90_A6L234	3.7878787879
+UniRef90_A6L234|g__Bacteroides.s__Bacteroides_vulgatus	3.7878787879
+UniRef90_A6L2K5	3.7878787879
+UniRef90_A6L2K5|g__Bacteroides.s__Bacteroides_dorei	3.7878787879
+UniRef90_A6L4N8	3.7878787879
+UniRef90_A6L4N8|g__Bacteroides.s__Bacteroides_dorei	1.8939393939
+UniRef90_A6L4N8|g__Bacteroides.s__Bacteroides_vulgatus	1.8939393939
+UniRef90_Q650D0	3.7878787879
+UniRef90_Q650D0|g__Bacteroides.s__Bacteroides_dorei	3.7878787879
+UniRef90_R6HI05	3.7878787879
+UniRef90_R6HI05|g__Bacteroides.s__Bacteroides_dorei	2.5252525253
+UniRef90_R6HI05|g__Bacteroides.s__Bacteroides_vulgatus	1.2626262626
+UniRef90_R6HMB6	3.7878787879
+UniRef90_R6HMB6|g__Bacteroides.s__Bacteroides_dorei	3.7878787879
+UniRef90_R6IFF3	3.7878787879
+UniRef90_R6IFF3|g__Bacteroides.s__Bacteroides_vulgatus	3.7878787879
+UniRef90_R7P3V0	3.7878787879
+UniRef90_R7P3V0|g__Bacteroides.s__Bacteroides_dorei	1.8939393939
+UniRef90_R7P3V0|g__Bacteroides.s__Bacteroides_vulgatus	1.8939393939
+UniRef90_R7NYZ8	3.7863665935
+UniRef90_R7NYZ8|g__Bacteroides.s__Bacteroides_vulgatus	2.1291696238
+UniRef90_R7NYZ8|g__Bacteroides.s__Bacteroides_dorei	1.6571969697
+UniRef90_A6KXU4	3.7771482531
+UniRef90_A6KXU4|g__Bacteroides.s__Bacteroides_dorei	1.8885741265
+UniRef90_A6KXU4|g__Bacteroides.s__Bacteroides_vulgatus	1.8885741265
+UniRef90_R5JG85	3.7735849057
+UniRef90_R5JG85|g__Bacteroides.s__Bacteroides_vulgatus	2.5157232704
+UniRef90_R5JG85|g__Bacteroides.s__Bacteroides_dorei	1.2578616352
+UniRef90_R6IM10	3.7695207324
+UniRef90_R6IM10|g__Bacteroides.s__Bacteroides_dorei	3.7695207324
+UniRef90_R6IGG7	3.7667488648
+UniRef90_R6IGG7|g__Bacteroides.s__Bacteroides_dorei	1.8993352327
+UniRef90_R6IGG7|g__Bacteroides.s__Bacteroides_vulgatus	1.8674136321
+UniRef90_R7P4R7	3.7664783427
+UniRef90_R7P4R7|g__Bacteroides.s__Bacteroides_vulgatus	3.7664783427
+UniRef90_R6I0N8	3.7664783427
+UniRef90_R6I0N8|g__Bacteroides.s__Bacteroides_vulgatus	3.7664783427
+UniRef90_R7NU10	3.7664783427
+UniRef90_R7NU10|g__Bacteroides.s__Bacteroides_vulgatus	3.7664783427
+UniRef90_R7P2U3	3.7664783427
+UniRef90_R7P2U3|g__Bacteroides.s__Bacteroides_vulgatus	3.7664783427
+UniRef90_R7P3C8	3.7664783427
+UniRef90_R7P3C8|g__Bacteroides.s__Bacteroides_dorei	3.1387319523
+UniRef90_R7P3C8|g__Bacteroides.s__Bacteroides_vulgatus	0.6277463905
+UniRef90_D4V6M2	3.7639449404
+UniRef90_D4V6M2|g__Bacteroides.s__Bacteroides_dorei	2.2624434389
+UniRef90_D4V6M2|g__Bacteroides.s__Bacteroides_vulgatus	1.5015015015
+UniRef90_C3Q4C4	3.7593984962
+UniRef90_C3Q4C4|g__Bacteroides.s__Bacteroides_dorei	3.7593984962
+UniRef90_R6HVS7	3.7523452158
+UniRef90_R6HVS7|g__Bacteroides.s__Bacteroides_dorei	2.5015634772
+UniRef90_R6HVS7|g__Bacteroides.s__Bacteroides_vulgatus	1.2507817386
+UniRef90_R7P1Z5	3.7523452158
+UniRef90_R7P1Z5|g__Bacteroides.s__Bacteroides_vulgatus	2.5015634772
+UniRef90_R7P1Z5|g__Bacteroides.s__Bacteroides_dorei	1.2507817386
+UniRef90_A6L719	3.7453183521
+UniRef90_A6L719|g__Bacteroides.s__Bacteroides_dorei	2.2471910112
+UniRef90_A6L719|g__Bacteroides.s__Bacteroides_vulgatus	1.4981273408
+UniRef90_A0A015SXD6	3.7453183521
+UniRef90_A0A015SXD6|g__Bacteroides.s__Bacteroides_dorei	3.7453183521
+UniRef90_A6KX20	3.7453183521
+UniRef90_A6KX20|g__Bacteroides.s__Bacteroides_vulgatus	3.7453183521
+UniRef90_C3QU91	3.7453183521
+UniRef90_C3QU91|g__Bacteroides.s__Bacteroides_dorei	3.7453183521
+UniRef90_I8Z9V7	3.7453183521
+UniRef90_I8Z9V7|g__Bacteroides.s__Bacteroides_dorei	3.7453183521
+UniRef90_I9QNV0	3.7453183521
+UniRef90_I9QNV0|g__Bacteroides.s__Bacteroides_dorei	3.7453183521
+UniRef90_I9RF94	3.7453183521
+UniRef90_I9RF94|g__Bacteroides.s__Bacteroides_dorei	3.7453183521
+UniRef90_K6AYF6	3.7453183521
+UniRef90_K6AYF6|g__Bacteroides.s__Bacteroides_dorei	3.7453183521
+UniRef90_Q64WL3	3.7453183521
+UniRef90_Q64WL3|g__Bacteroides.s__Bacteroides_dorei	3.7453183521
+UniRef90_R6I003	3.7453183521
+UniRef90_R6I003|g__Bacteroides.s__Bacteroides_dorei	3.7453183521
+UniRef90_R9H526	3.7453183521
+UniRef90_R9H526|g__Bacteroides.s__Bacteroides_vulgatus	3.7453183521
+UniRef90_R6HG28	3.7369207773
+UniRef90_R6HG28|g__Bacteroides.s__Bacteroides_dorei	2.9895366218
+UniRef90_R6HG28|g__Bacteroides.s__Bacteroides_vulgatus	0.7473841555
+UniRef90_I8WB03	3.7348272642
+UniRef90_I8WB03|g__Bacteroides.s__Bacteroides_dorei	3.7348272642
+UniRef90_A6KXV9	3.7313432836
+UniRef90_A6KXV9|g__Bacteroides.s__Bacteroides_vulgatus	2.4875621891
+UniRef90_A6KXV9|g__Bacteroides.s__Bacteroides_dorei	1.2437810945
+UniRef90_I9QX22	3.7313432836
+UniRef90_I9QX22|g__Bacteroides.s__Bacteroides_dorei	3.7313432836
+UniRef90_R9H5M7	3.7313432836
+UniRef90_R9H5M7|g__Bacteroides.s__Bacteroides_vulgatus	3.7313432836
+UniRef90_C3RGP9	3.7273695421
+UniRef90_C3RGP9|g__Bacteroides.s__Bacteroides_vulgatus	2.1299254526
+UniRef90_C3RGP9|g__Bacteroides.s__Bacteroides_dorei	1.5974440895
+UniRef90_A6KWB7	3.7243947858
+UniRef90_A6KWB7|g__Bacteroides.s__Bacteroides_dorei	3.7243947858
+UniRef90_A6L5C6	3.7243947858
+UniRef90_A6L5C6|g__Bacteroides.s__Bacteroides_dorei	3.7243947858
+UniRef90_I8WPH7	3.7243947858
+UniRef90_I8WPH7|g__Bacteroides.s__Bacteroides_dorei	3.7243947858
+UniRef90_I9RE58	3.7243947858
+UniRef90_I9RE58|g__Bacteroides.s__Bacteroides_dorei	3.7243947858
+UniRef90_R5UBD2	3.7243947858
+UniRef90_R5UBD2|g__Bacteroides.s__Bacteroides_dorei	3.7243947858
+UniRef90_R6HL43	3.7243947858
+UniRef90_R6HL43|g__Bacteroides.s__Bacteroides_dorei	3.7243947858
+UniRef90_R7NWD9	3.7243947858
+UniRef90_R7NWD9|g__Bacteroides.s__Bacteroides_vulgatus	3.7243947858
+UniRef90_R9H4L7	3.7174721190
+UniRef90_R9H4L7|g__Bacteroides.s__Bacteroides_vulgatus	3.7174721190
+UniRef90_R7NXW7	3.7140204271
+UniRef90_R7NXW7|g__Bacteroides.s__Bacteroides_dorei	1.8570102136
+UniRef90_R7NXW7|g__Bacteroides.s__Bacteroides_vulgatus	1.8570102136
+UniRef90_R7NWF0	3.7117026882
+UniRef90_R7NWF0|g__Bacteroides.s__Bacteroides_dorei	2.7700831025
+UniRef90_R7NWF0|g__Bacteroides.s__Bacteroides_vulgatus	0.9416195857
+UniRef90_R6HTE0	3.7037037037
+UniRef90_R6HTE0|g__Bacteroides.s__Bacteroides_vulgatus	3.0864197531
+UniRef90_R6HTE0|g__Bacteroides.s__Bacteroides_dorei	0.6172839506
+UniRef90_A6KYQ6	3.7037037037
+UniRef90_A6KYQ6|g__Bacteroides.s__Bacteroides_dorei	3.7037037037
+UniRef90_A6KZZ4	3.7037037037
+UniRef90_A6KZZ4|g__Bacteroides.s__Bacteroides_vulgatus	2.4691358025
+UniRef90_A6KZZ4|g__Bacteroides.s__Bacteroides_dorei	1.2345679012
+UniRef90_A6L4T4	3.7037037037
+UniRef90_A6L4T4|g__Bacteroides.s__Bacteroides_dorei	1.8518518519
+UniRef90_A6L4T4|g__Bacteroides.s__Bacteroides_vulgatus	1.8518518519
+UniRef90_A6L553	3.7037037037
+UniRef90_A6L553|g__Bacteroides.s__Bacteroides_vulgatus	3.7037037037
+UniRef90_D4VDR9	3.7037037037
+UniRef90_D4VDR9|g__Bacteroides.s__Bacteroides_dorei	3.7037037037
+UniRef90_E5X045	3.7037037037
+UniRef90_E5X045|g__Bacteroides.s__Bacteroides_dorei	3.7037037037
+UniRef90_I9F4C7	3.7037037037
+UniRef90_I9F4C7|g__Bacteroides.s__Bacteroides_dorei	3.7037037037
+UniRef90_I9FRU7	3.7037037037
+UniRef90_I9FRU7|g__Bacteroides.s__Bacteroides_dorei	3.7037037037
+UniRef90_Q64SI2	3.7037037037
+UniRef90_Q64SI2|g__Bacteroides.s__Bacteroides_dorei	3.7037037037
+UniRef90_R6IG43	3.7037037037
+UniRef90_R6IG43|g__Bacteroides.s__Bacteroides_dorei	3.7037037037
+UniRef90_R7NPU3	3.7037037037
+UniRef90_R7NPU3|g__Bacteroides.s__Bacteroides_vulgatus	2.4691358025
+UniRef90_R7NPU3|g__Bacteroides.s__Bacteroides_dorei	1.2345679012
+UniRef90_R9H485	3.7037037037
+UniRef90_R9H485|g__Bacteroides.s__Bacteroides_vulgatus	3.7037037037
+UniRef90_A6KXG2	3.7029154788
+UniRef90_A6KXG2|g__Bacteroides.s__Bacteroides_dorei	2.5868440503
+UniRef90_A6KXG2|g__Bacteroides.s__Bacteroides_vulgatus	1.1160714286
+UniRef90_I9QMY3	3.6934441367
+UniRef90_I9QMY3|g__Bacteroides.s__Bacteroides_dorei	3.6934441367
+UniRef90_I9RCE5	3.6900369004
+UniRef90_I9RCE5|g__Bacteroides.s__Bacteroides_dorei	3.6900369004
+UniRef90_R6HHX5	3.6900369004
+UniRef90_R6HHX5|g__Bacteroides.s__Bacteroides_dorei	3.6900369004
+UniRef90_R6IFA6	3.6900369004
+UniRef90_R6IFA6|g__Bacteroides.s__Bacteroides_dorei	3.6900369004
+UniRef90_R7NYK6	3.6900369004
+UniRef90_R7NYK6|g__Bacteroides.s__Bacteroides_dorei	2.4600246002
+UniRef90_R7NYK6|g__Bacteroides.s__Bacteroides_vulgatus	1.2300123001
+UniRef90_A6L075	3.6873156342
+UniRef90_A6L075|g__Bacteroides.s__Bacteroides_vulgatus	2.9498525074
+UniRef90_A6L075|g__Bacteroides.s__Bacteroides_dorei	0.7374631268
+UniRef90_R7NX74	3.6866359447
+UniRef90_R7NX74|g__Bacteroides.s__Bacteroides_vulgatus	3.6866359447
+UniRef90_R6HLC7	3.6832412523
+UniRef90_R6HLC7|g__Bacteroides.s__Bacteroides_dorei	3.6832412523
+UniRef90_R6I0P4	3.6832412523
+UniRef90_R6I0P4|g__Bacteroides.s__Bacteroides_dorei	3.6832412523
+UniRef90_R7P5T5	3.6832412523
+UniRef90_R7P5T5|g__Bacteroides.s__Bacteroides_dorei	1.8416206262
+UniRef90_R7P5T5|g__Bacteroides.s__Bacteroides_vulgatus	1.8416206262
+UniRef90_R9HVX5	3.6832412523
+UniRef90_R9HVX5|g__Bacteroides.s__Bacteroides_vulgatus	3.6832412523
+UniRef90_A6KZ47	3.6764705882
+UniRef90_A6KZ47|g__Bacteroides.s__Bacteroides_dorei	2.4509803922
+UniRef90_A6KZ47|g__Bacteroides.s__Bacteroides_vulgatus	1.2254901961
+UniRef90_A6L7P5	3.6764705882
+UniRef90_A6L7P5|g__Bacteroides.s__Bacteroides_dorei	3.0637254902
+UniRef90_A6L7P5|g__Bacteroides.s__Bacteroides_vulgatus	0.6127450980
+UniRef90_R6HJ39	3.6764705882
+UniRef90_R6HJ39|g__Bacteroides.s__Bacteroides_dorei	2.4509803922
+UniRef90_R6HJ39|g__Bacteroides.s__Bacteroides_vulgatus	1.2254901961
+UniRef90_R6IGT0	3.6764705882
+UniRef90_R6IGT0|g__Bacteroides.s__Bacteroides_dorei	3.6764705882
+UniRef90_D6D2J4	3.6630036630
+UniRef90_D6D2J4|g__Bacteroides.s__Bacteroides_vulgatus	3.6630036630
+UniRef90_I9R223	3.6630036630
+UniRef90_I9R223|g__Bacteroides.s__Bacteroides_dorei	3.6630036630
+UniRef90_Q8ABY4	3.6630036630
+UniRef90_Q8ABY4|g__Bacteroides.s__Bacteroides_dorei	1.8315018315
+UniRef90_Q8ABY4|g__Bacteroides.s__Bacteroides_vulgatus	1.8315018315
+UniRef90_R5MWH5	3.6529680365
+UniRef90_R5MWH5|g__Bacteroides.s__Bacteroides_vulgatus	2.7397260274
+UniRef90_R5MWH5|g__Bacteroides.s__Bacteroides_dorei	0.9132420091
+UniRef90_Q8A8P4	3.6496350365
+UniRef90_Q8A8P4|g__Bacteroides.s__Bacteroides_dorei	3.6496350365
+UniRef90_A6L0Y6	3.6429872495
+UniRef90_A6L0Y6|g__Bacteroides.s__Bacteroides_vulgatus	3.6429872495
+UniRef90_D2ET08	3.6429872495
+UniRef90_D2ET08|g__Bacteroides.s__Bacteroides_dorei	3.6429872495
+UniRef90_R6HM96	3.6429872495
+UniRef90_R6HM96|g__Bacteroides.s__Bacteroides_vulgatus	3.6429872495
+UniRef90_R6HTU0	3.6429872495
+UniRef90_R6HTU0|g__Bacteroides.s__Bacteroides_vulgatus	2.4286581664
+UniRef90_R6HTU0|g__Bacteroides.s__Bacteroides_dorei	1.2143290832
+UniRef90_R7NZZ8	3.6429872495
+UniRef90_R7NZZ8|g__Bacteroides.s__Bacteroides_vulgatus	3.6429872495
+UniRef90_R9H4D5	3.6363636364
+UniRef90_R9H4D5|g__Bacteroides.s__Bacteroides_vulgatus	3.6363636364
+UniRef90_R7NQ79	3.6343373375
+UniRef90_R7NQ79|g__Bacteroides.s__Bacteroides_vulgatus	1.9379844961
+UniRef90_R7NQ79|g__Bacteroides.s__Bacteroides_dorei	1.6963528414
+UniRef90_R6IJD7	3.6341637794
+UniRef90_R6IJD7|g__Bacteroides.s__Bacteroides_dorei	2.4242424242
+UniRef90_R6IJD7|g__Bacteroides.s__Bacteroides_vulgatus	1.2099213551
+UniRef90_A6L6S9	3.6330608538
+UniRef90_A6L6S9|g__Bacteroides.s__Bacteroides_dorei	3.6330608538
+UniRef90_I8WTD1	3.6330608538
+UniRef90_I8WTD1|g__Bacteroides.s__Bacteroides_vulgatus	3.6330608538
+UniRef90_I9J2P9	3.6231884058
+UniRef90_I9J2P9|g__Bacteroides.s__Bacteroides_vulgatus	3.6231884058
+UniRef90_R6RZC5	3.6231884058
+UniRef90_R6RZC5|g__Bacteroides.s__Bacteroides_vulgatus	2.4154589372
+UniRef90_R6RZC5|g__Bacteroides.s__Bacteroides_dorei	1.2077294686
+UniRef90_A6L0V4	3.6231884058
+UniRef90_A6L0V4|g__Bacteroides.s__Bacteroides_dorei	3.6231884058
+UniRef90_A6L5J1	3.6231884058
+UniRef90_A6L5J1|g__Bacteroides.s__Bacteroides_vulgatus	3.6231884058
+UniRef90_A6L6A7	3.6231884058
+UniRef90_A6L6A7|g__Bacteroides.s__Bacteroides_dorei	1.8115942029
+UniRef90_A6L6A7|g__Bacteroides.s__Bacteroides_vulgatus	1.8115942029
+UniRef90_I8V468	3.6231884058
+UniRef90_I8V468|g__Bacteroides.s__Bacteroides_dorei	3.6231884058
+UniRef90_Q5L896	3.6231884058
+UniRef90_Q5L896|g__Bacteroides.s__Bacteroides_dorei	3.6231884058
+UniRef90_R6HGH0	3.6231884058
+UniRef90_R6HGH0|g__Bacteroides.s__Bacteroides_vulgatus	3.6231884058
+UniRef90_R6HIN3	3.6231884058
+UniRef90_R6HIN3|g__Bacteroides.s__Bacteroides_dorei	1.8115942029
+UniRef90_R6HIN3|g__Bacteroides.s__Bacteroides_vulgatus	1.8115942029
+UniRef90_R6HTR4	3.6231884058
+UniRef90_R6HTR4|g__Bacteroides.s__Bacteroides_dorei	3.6231884058
+UniRef90_R6Z924	3.6231884058
+UniRef90_R6Z924|g__Bacteroides.s__Bacteroides_dorei	3.6231884058
+UniRef90_R9H570	3.6231884058
+UniRef90_R9H570|g__Bacteroides.s__Bacteroides_vulgatus	3.6231884058
+UniRef90_A6KY18	3.6133694670
+UniRef90_A6KY18|g__Bacteroides.s__Bacteroides_dorei	2.7100271003
+UniRef90_A6KY18|g__Bacteroides.s__Bacteroides_vulgatus	0.9033423668
+UniRef90_I9QRT4	3.6133694670
+UniRef90_I9QRT4|g__Bacteroides.s__Bacteroides_dorei	3.6133694670
+UniRef90_R6HVZ3	3.6119711042
+UniRef90_R6HVZ3|g__Bacteroides.s__Bacteroides_vulgatus	3.6119711042
+UniRef90_A6L585	3.6036036036
+UniRef90_A6L585|g__Bacteroides.s__Bacteroides_dorei	3.6036036036
+UniRef90_A6L5A0	3.6036036036
+UniRef90_A6L5A0|g__Bacteroides.s__Bacteroides_dorei	1.8018018018
+UniRef90_A6L5A0|g__Bacteroides.s__Bacteroides_vulgatus	1.8018018018
+UniRef90_R9HLN0	3.6036036036
+UniRef90_R9HLN0|g__Bacteroides.s__Bacteroides_vulgatus	3.6036036036
+UniRef90_R9HN26	3.6036036036
+UniRef90_R9HN26|g__Bacteroides.s__Bacteroides_vulgatus	3.6036036036
+UniRef90_R7P1N5	3.5997120230
+UniRef90_R7P1N5|g__Bacteroides.s__Bacteroides_vulgatus	2.8797696184
+UniRef90_R7P1N5|g__Bacteroides.s__Bacteroides_dorei	0.7199424046
+UniRef90_R9I335	3.5971223022
+UniRef90_R9I335|g__Bacteroides.s__Bacteroides_vulgatus	2.3980815348
+UniRef90_R9I335|g__Bacteroides.s__Bacteroides_dorei	1.1990407674
+UniRef90_UPI0004697FB6	3.5938903863
+UniRef90_UPI0004697FB6|g__Bacteroides.s__Bacteroides_vulgatus	3.5938903863
+UniRef90_R6HMP2	3.5895917925
+UniRef90_R6HMP2|g__Bacteroides.s__Bacteroides_vulgatus	2.9922202274
+UniRef90_R6HMP2|g__Bacteroides.s__Bacteroides_dorei	0.5973715651
+UniRef90_A6L793	3.5842293907
+UniRef90_A6L793|g__Bacteroides.s__Bacteroides_dorei	2.1505376344
+UniRef90_A6L793|g__Bacteroides.s__Bacteroides_vulgatus	1.4336917563
+UniRef90_A6L092	3.5842293907
+UniRef90_A6L092|g__Bacteroides.s__Bacteroides_dorei	3.5842293907
+UniRef90_A6L1U2	3.5842293907
+UniRef90_A6L1U2|g__Bacteroides.s__Bacteroides_dorei	1.7921146953
+UniRef90_A6L1U2|g__Bacteroides.s__Bacteroides_vulgatus	1.7921146953
+UniRef90_A6L5J5	3.5842293907
+UniRef90_A6L5J5|g__Bacteroides.s__Bacteroides_dorei	1.7921146953
+UniRef90_A6L5J5|g__Bacteroides.s__Bacteroides_vulgatus	1.7921146953
+UniRef90_C3R7K5	3.5842293907
+UniRef90_C3R7K5|g__Bacteroides.s__Bacteroides_dorei	3.5842293907
+UniRef90_D1K640	3.5842293907
+UniRef90_D1K640|g__Bacteroides.s__Bacteroides_dorei	3.5842293907
+UniRef90_I9G1D2	3.5842293907
+UniRef90_I9G1D2|g__Bacteroides.s__Bacteroides_dorei	3.5842293907
+UniRef90_R9HG07	3.5842293907
+UniRef90_R9HG07|g__Bacteroides.s__Bacteroides_vulgatus	3.5842293907
+UniRef90_Q64SE6	3.5778175313
+UniRef90_Q64SE6|g__Bacteroides.s__Bacteroides_dorei	3.5778175313
+UniRef90_A6KXB2	3.5765379113
+UniRef90_A6KXB2|g__Bacteroides.s__Bacteroides_dorei	2.1459227468
+UniRef90_A6KXB2|g__Bacteroides.s__Bacteroides_vulgatus	1.4306151645
+UniRef90_D4V8X7	3.5746201966
+UniRef90_D4V8X7|g__Bacteroides.s__Bacteroides_vulgatus	3.5746201966
+UniRef90_R6HKC7	3.5724100027
+UniRef90_R6HKC7|g__Bacteroides.s__Bacteroides_dorei	2.4732069250
+UniRef90_R6HKC7|g__Bacteroides.s__Bacteroides_vulgatus	1.0992030778
+UniRef90_A6KZ08	3.5650623886
+UniRef90_A6KZ08|g__Bacteroides.s__Bacteroides_dorei	3.5650623886
+UniRef90_A6L6X6	3.5650623886
+UniRef90_A6L6X6|g__Bacteroides.s__Bacteroides_dorei	1.7825311943
+UniRef90_A6L6X6|g__Bacteroides.s__Bacteroides_vulgatus	1.7825311943
+UniRef90_R7P2U2	3.5650623886
+UniRef90_R7P2U2|g__Bacteroides.s__Bacteroides_vulgatus	3.5650623886
+UniRef90_R9H0W0	3.5650623886
+UniRef90_R9H0W0|g__Bacteroides.s__Bacteroides_vulgatus	3.5650623886
+UniRef90_A6KWN9	3.5631069612
+UniRef90_A6KWN9|g__Bacteroides.s__Bacteroides_vulgatus	3.5631069612
+UniRef90_R7NVP8	3.5612535613
+UniRef90_R7NVP8|g__Bacteroides.s__Bacteroides_vulgatus	3.5612535613
+UniRef90_I9PIS9	3.5603026257
+UniRef90_I9PIS9|g__Bacteroides.s__Bacteroides_vulgatus	3.5603026257
+UniRef90_A6L5J9	3.5587188612
+UniRef90_A6L5J9|g__Bacteroides.s__Bacteroides_vulgatus	3.5587188612
+UniRef90_D4V4L9	3.5488450123
+UniRef90_D4V4L9|g__Bacteroides.s__Bacteroides_vulgatus	2.6455026455
+UniRef90_D4V4L9|g__Bacteroides.s__Bacteroides_dorei	0.9033423668
+UniRef90_A6KX83	3.5460992908
+UniRef90_A6KX83|g__Bacteroides.s__Bacteroides_vulgatus	3.5460992908
+UniRef90_A6L2D9	3.5460992908
+UniRef90_A6L2D9|g__Bacteroides.s__Bacteroides_vulgatus	3.5460992908
+UniRef90_A6L745	3.5460992908
+UniRef90_A6L745|g__Bacteroides.s__Bacteroides_vulgatus	3.5460992908
+UniRef90_A6L7T5	3.5460992908
+UniRef90_A6L7T5|g__Bacteroides.s__Bacteroides_vulgatus	3.5460992908
+UniRef90_I9QS58	3.5460992908
+UniRef90_I9QS58|g__Bacteroides.s__Bacteroides_dorei	3.5460992908
+UniRef90_J9D529	3.5460992908
+UniRef90_J9D529|g__Bacteroides.s__Bacteroides_dorei	3.5460992908
+UniRef90_Q5L8D3	3.5460992908
+UniRef90_Q5L8D3|g__Bacteroides.s__Bacteroides_vulgatus	3.5460992908
+UniRef90_A6L7E4	3.5366931919
+UniRef90_A6L7E4|g__Bacteroides.s__Bacteroides_dorei	1.7683465959
+UniRef90_A6L7E4|g__Bacteroides.s__Bacteroides_vulgatus	1.7683465959
+UniRef90_R7NZ81	3.5366931919
+UniRef90_R7NZ81|g__Bacteroides.s__Bacteroides_dorei	2.6525198939
+UniRef90_R7NZ81|g__Bacteroides.s__Bacteroides_vulgatus	0.8841732980
+UniRef90_I8WQD0	3.5335689046
+UniRef90_I8WQD0|g__Bacteroides.s__Bacteroides_dorei	3.5335689046
+UniRef90_I8ZHA0	3.5320088300
+UniRef90_I8ZHA0|g__Bacteroides.s__Bacteroides_vulgatus	3.5320088300
+UniRef90_A6L7W0	3.5310734463
+UniRef90_A6L7W0|g__Bacteroides.s__Bacteroides_vulgatus	3.5310734463
+UniRef90_I9PIY2	3.5273368607
+UniRef90_I9PIY2|g__Bacteroides.s__Bacteroides_vulgatus	3.5273368607
+UniRef90_I9RD14	3.5273368607
+UniRef90_I9RD14|g__Bacteroides.s__Bacteroides_dorei	3.5273368607
+UniRef90_R6IGR7	3.5273368607
+UniRef90_R6IGR7|g__Bacteroides.s__Bacteroides_dorei	3.5273368607
+UniRef90_R6IGU7	3.5273368607
+UniRef90_R6IGU7|g__Bacteroides.s__Bacteroides_vulgatus	3.5273368607
+UniRef90_R6HWG8	3.5228243418
+UniRef90_R6HWG8|g__Bacteroides.s__Bacteroides_dorei	3.1963470320
+UniRef90_R6HWG8|g__Bacteroides.s__Bacteroides_vulgatus	0.3264773098
+UniRef90_R6HW03	3.5222542427
+UniRef90_R6HW03|g__Bacteroides.s__Bacteroides_dorei	3.2020493116
+UniRef90_R6HW03|g__Bacteroides.s__Bacteroides_vulgatus	0.3202049312
+UniRef90_R6Y9C3	3.5211267606
+UniRef90_R6Y9C3|g__Bacteroides.s__Bacteroides_dorei	3.5211267606
+UniRef90_A6L7Q7	3.5180299033
+UniRef90_A6L7Q7|g__Bacteroides.s__Bacteroides_dorei	2.6385224274
+UniRef90_A6L7Q7|g__Bacteroides.s__Bacteroides_vulgatus	0.8795074758
+UniRef90_Q64S46	3.5180299033
+UniRef90_Q64S46|g__Bacteroides.s__Bacteroides_dorei	1.7590149516
+UniRef90_Q64S46|g__Bacteroides.s__Bacteroides_vulgatus	1.7590149516
+UniRef90_Q64UJ7	3.5180299033
+UniRef90_Q64UJ7|g__Bacteroides.s__Bacteroides_dorei	3.5180299033
+UniRef90_R6HX44	3.5180299033
+UniRef90_R6HX44|g__Bacteroides.s__Bacteroides_dorei	2.6385224274
+UniRef90_R6HX44|g__Bacteroides.s__Bacteroides_vulgatus	0.8795074758
+UniRef90_A6KYR7	3.5149384886
+UniRef90_A6KYR7|g__Bacteroides.s__Bacteroides_vulgatus	3.5149384886
+UniRef90_C3R7Z6	3.5128805621
+UniRef90_C3R7Z6|g__Bacteroides.s__Bacteroides_dorei	3.5128805621
+UniRef90_A6KWS0	3.5118552092
+UniRef90_A6KWS0|g__Bacteroides.s__Bacteroides_vulgatus	3.5118552092
+UniRef90_A6L1W9	3.5087719298
+UniRef90_A6L1W9|g__Bacteroides.s__Bacteroides_vulgatus	3.5087719298
+UniRef90_A6L4E1	3.5087719298
+UniRef90_A6L4E1|g__Bacteroides.s__Bacteroides_dorei	3.5087719298
+UniRef90_C3Q5C8	3.5087719298
+UniRef90_C3Q5C8|g__Bacteroides.s__Bacteroides_dorei	3.5087719298
+UniRef90_C3R6B7	3.5087719298
+UniRef90_C3R6B7|g__Bacteroides.s__Bacteroides_dorei	3.5087719298
+UniRef90_I9QJ93	3.5087719298
+UniRef90_I9QJ93|g__Bacteroides.s__Bacteroides_dorei	3.5087719298
+UniRef90_Q64SH6	3.5087719298
+UniRef90_Q64SH6|g__Bacteroides.s__Bacteroides_dorei	3.5087719298
+UniRef90_R6HKH1	3.5087719298
+UniRef90_R6HKH1|g__Bacteroides.s__Bacteroides_dorei	1.7543859649
+UniRef90_R6HKH1|g__Bacteroides.s__Bacteroides_vulgatus	1.7543859649
+UniRef90_R6HRH0	3.5087719298
+UniRef90_R6HRH0|g__Bacteroides.s__Bacteroides_vulgatus	3.5087719298
+UniRef90_R6HSF0	3.5087719298
+UniRef90_R6HSF0|g__Bacteroides.s__Bacteroides_dorei	3.5087719298
+UniRef90_A6L1D3	3.5087719298
+UniRef90_A6L1D3|g__Bacteroides.s__Bacteroides_dorei	2.8070175439
+UniRef90_A6L1D3|g__Bacteroides.s__Bacteroides_vulgatus	0.7017543860
+UniRef90_R9HFN4	3.4995625547
+UniRef90_R9HFN4|g__Bacteroides.s__Bacteroides_vulgatus	3.4995625547
+UniRef90_A6L2H0	3.4965034965
+UniRef90_A6L2H0|g__Bacteroides.s__Bacteroides_dorei	2.3310023310
+UniRef90_A6L2H0|g__Bacteroides.s__Bacteroides_vulgatus	1.1655011655
+UniRef90_Q8AAW1	3.4940600978
+UniRef90_Q8AAW1|g__Bacteroides.s__Bacteroides_dorei	3.4940600978
+UniRef90_R6IM76	3.4907821534
+UniRef90_R6IM76|g__Bacteroides.s__Bacteroides_vulgatus	1.8726591760
+UniRef90_R6IM76|g__Bacteroides.s__Bacteroides_dorei	1.6181229773
+UniRef90_A6KX92	3.4904013962
+UniRef90_A6KX92|g__Bacteroides.s__Bacteroides_vulgatus	3.4904013962
+UniRef90_A6L2T2	3.4904013962
+UniRef90_A6L2T2|g__Bacteroides.s__Bacteroides_dorei	3.4904013962
+UniRef90_I8WRP3	3.4904013962
+UniRef90_I8WRP3|g__Bacteroides.s__Bacteroides_dorei	3.4904013962
+UniRef90_I9QRG4	3.4904013962
+UniRef90_I9QRG4|g__Bacteroides.s__Bacteroides_dorei	3.4904013962
+UniRef90_R6ILV7	3.4904013962
+UniRef90_R6ILV7|g__Bacteroides.s__Bacteroides_vulgatus	3.4904013962
+UniRef90_A6L2M8	3.4904013962
+UniRef90_A6L2M8|g__Bacteroides.s__Bacteroides_dorei	2.3269342641
+UniRef90_A6L2M8|g__Bacteroides.s__Bacteroides_vulgatus	1.1634671321
+UniRef90_R6IF10	3.4892051505
+UniRef90_R6IF10|g__Bacteroides.s__Bacteroides_vulgatus	2.4242424242
+UniRef90_R6IF10|g__Bacteroides.s__Bacteroides_dorei	1.0649627263
+UniRef90_A6L4I2	3.4885237350
+UniRef90_A6L4I2|g__Bacteroides.s__Bacteroides_vulgatus	2.3148148148
+UniRef90_A6L4I2|g__Bacteroides.s__Bacteroides_dorei	1.1737089202
+UniRef90_A6L7K4	3.4843205575
+UniRef90_A6L7K4|g__Bacteroides.s__Bacteroides_vulgatus	2.3228803717
+UniRef90_A6L7K4|g__Bacteroides.s__Bacteroides_dorei	1.1614401858
+UniRef90_R6HIV4	3.4782608696
+UniRef90_R6HIV4|g__Bacteroides.s__Bacteroides_dorei	1.7391304348
+UniRef90_R6HIV4|g__Bacteroides.s__Bacteroides_vulgatus	1.7391304348
+UniRef90_A0A015XQT0	3.4722222222
+UniRef90_A0A015XQT0|g__Bacteroides.s__Bacteroides_vulgatus	3.4722222222
+UniRef90_A6KZZ6	3.4722222222
+UniRef90_A6KZZ6|g__Bacteroides.s__Bacteroides_dorei	3.4722222222
+UniRef90_A6L0G2	3.4722222222
+UniRef90_A6L0G2|g__Bacteroides.s__Bacteroides_dorei	3.4722222222
+UniRef90_A6L5A1	3.4722222222
+UniRef90_A6L5A1|g__Bacteroides.s__Bacteroides_vulgatus	3.4722222222
+UniRef90_D4V4X8	3.4722222222
+UniRef90_D4V4X8|g__Bacteroides.s__Bacteroides_vulgatus	3.4722222222
+UniRef90_I9A7T7	3.4722222222
+UniRef90_I9A7T7|g__Bacteroides.s__Bacteroides_dorei	3.4722222222
+UniRef90_I9R511	3.4722222222
+UniRef90_I9R511|g__Bacteroides.s__Bacteroides_dorei	3.4722222222
+UniRef90_I9UE09	3.4722222222
+UniRef90_I9UE09|g__Bacteroides.s__Bacteroides_dorei	3.4722222222
+UniRef90_R6HT56	3.4722222222
+UniRef90_R6HT56|g__Bacteroides.s__Bacteroides_dorei	3.4722222222
+UniRef90_R6IGN3	3.4722222222
+UniRef90_R6IGN3|g__Bacteroides.s__Bacteroides_dorei	3.4722222222
+UniRef90_R7NY01	3.4722222222
+UniRef90_R7NY01|g__Bacteroides.s__Bacteroides_dorei	3.4722222222
+UniRef90_A6KYE3	3.4722222222
+UniRef90_A6KYE3|g__Bacteroides.s__Bacteroides_dorei	3.4722222222
+UniRef90_A6L2X5	3.4632034632
+UniRef90_A6L2X5|g__Bacteroides.s__Bacteroides_vulgatus	3.4632034632
+UniRef90_Q8A1A2	3.4632034632
+UniRef90_Q8A1A2|g__Bacteroides.s__Bacteroides_dorei	2.5974025974
+UniRef90_Q8A1A2|g__Bacteroides.s__Bacteroides_vulgatus	0.8658008658
+UniRef90_R7NXU5	3.4632034632
+UniRef90_R7NXU5|g__Bacteroides.s__Bacteroides_vulgatus	3.4632034632
+UniRef90_D6CWS9	3.4621818229
+UniRef90_D6CWS9|g__Bacteroides.s__Bacteroides_vulgatus	2.0703933747
+UniRef90_D6CWS9|g__Bacteroides.s__Bacteroides_dorei	1.3917884482
+UniRef90_R7P170	3.4602076125
+UniRef90_R7P170|g__Bacteroides.s__Bacteroides_vulgatus	3.4602076125
+UniRef90_A6L3L7	3.4542314335
+UniRef90_A6L3L7|g__Bacteroides.s__Bacteroides_dorei	3.4542314335
+UniRef90_F0R0T1	3.4542314335
+UniRef90_F0R0T1|g__Bacteroides.s__Bacteroides_dorei	3.4542314335
+UniRef90_R9H0Y4	3.4542314335
+UniRef90_R9H0Y4|g__Bacteroides.s__Bacteroides_vulgatus	3.4542314335
+UniRef90_R6HHL5	3.4506556246
+UniRef90_R6HHL5|g__Bacteroides.s__Bacteroides_dorei	3.4506556246
+UniRef90_C3RB27	3.4453057709
+UniRef90_C3RB27|g__Bacteroides.s__Bacteroides_dorei	3.4453057709
+UniRef90_A6L6U1	3.4444285624
+UniRef90_A6L6U1|g__Bacteroides.s__Bacteroides_dorei	2.2870211549
+UniRef90_A6L6U1|g__Bacteroides.s__Bacteroides_vulgatus	1.1574074074
+UniRef90_C6YZH6	3.4423407917
+UniRef90_C6YZH6|g__Bacteroides.s__Bacteroides_vulgatus	3.4423407917
+UniRef90_A6KZ64	3.4408602151
+UniRef90_A6KZ64|g__Bacteroides.s__Bacteroides_vulgatus	2.5806451613
+UniRef90_A6KZ64|g__Bacteroides.s__Bacteroides_dorei	0.8602150538
+UniRef90_A6KXC6	3.4364261168
+UniRef90_A6KXC6|g__Bacteroides.s__Bacteroides_vulgatus	3.4364261168
+UniRef90_A6KZB1	3.4364261168
+UniRef90_A6KZB1|g__Bacteroides.s__Bacteroides_dorei	1.7182130584
+UniRef90_A6KZB1|g__Bacteroides.s__Bacteroides_vulgatus	1.7182130584
+UniRef90_I8ZIS3	3.4364261168
+UniRef90_I8ZIS3|g__Bacteroides.s__Bacteroides_vulgatus	3.4364261168
+UniRef90_I9R3Y6	3.4364261168
+UniRef90_I9R3Y6|g__Bacteroides.s__Bacteroides_dorei	3.4364261168
+UniRef90_I9RE19	3.4364261168
+UniRef90_I9RE19|g__Bacteroides.s__Bacteroides_dorei	3.4364261168
+UniRef90_R6HY55	3.4364261168
+UniRef90_R6HY55|g__Bacteroides.s__Bacteroides_dorei	3.4364261168
+UniRef90_R6IHB6	3.4364261168
+UniRef90_R6IHB6|g__Bacteroides.s__Bacteroides_dorei	1.7182130584
+UniRef90_R6IHB6|g__Bacteroides.s__Bacteroides_vulgatus	1.7182130584
+UniRef90_R9HXF4	3.4364261168
+UniRef90_R9HXF4|g__Bacteroides.s__Bacteroides_vulgatus	3.4364261168
+UniRef90_A6L209	3.4364261168
+UniRef90_A6L209|g__Bacteroides.s__Bacteroides_dorei	2.2909507446
+UniRef90_A6L209|g__Bacteroides.s__Bacteroides_vulgatus	1.1454753723
+UniRef90_R6HTE6	3.4364261168
+UniRef90_R6HTE6|g__Bacteroides.s__Bacteroides_vulgatus	3.4364261168
+UniRef90_D4VIQ8	3.4293552812
+UniRef90_D4VIQ8|g__Bacteroides.s__Bacteroides_dorei	3.4293552812
+UniRef90_A6KZT2	3.4275921165
+UniRef90_A6KZT2|g__Bacteroides.s__Bacteroides_vulgatus	3.4275921165
+UniRef90_I9J611	3.4247375926
+UniRef90_I9J611|g__Bacteroides.s__Bacteroides_dorei	2.2909507446
+UniRef90_I9J611|g__Bacteroides.s__Bacteroides_vulgatus	1.1337868481
+UniRef90_R7P0C7	3.4238558376
+UniRef90_R7P0C7|g__Bacteroides.s__Bacteroides_dorei	2.5396825397
+UniRef90_R7P0C7|g__Bacteroides.s__Bacteroides_vulgatus	0.8841732980
+UniRef90_I8W0V4	3.4188034188
+UniRef90_I8W0V4|g__Bacteroides.s__Bacteroides_dorei	3.4188034188
+UniRef90_C3R9M1	3.4083162918
+UniRef90_C3R9M1|g__Bacteroides.s__Bacteroides_dorei	2.0449897751
+UniRef90_C3R9M1|g__Bacteroides.s__Bacteroides_vulgatus	1.3633265167
+UniRef90_A6KWI7	3.4013605442
+UniRef90_A6KWI7|g__Bacteroides.s__Bacteroides_vulgatus	3.4013605442
+UniRef90_A6KWU6	3.4013605442
+UniRef90_A6KWU6|g__Bacteroides.s__Bacteroides_vulgatus	3.4013605442
+UniRef90_A6KX10	3.4013605442
+UniRef90_A6KX10|g__Bacteroides.s__Bacteroides_dorei	3.4013605442
+UniRef90_C3PZ15	3.4013605442
+UniRef90_C3PZ15|g__Bacteroides.s__Bacteroides_dorei	3.4013605442
+UniRef90_I9R3S8	3.4013605442
+UniRef90_I9R3S8|g__Bacteroides.s__Bacteroides_dorei	3.4013605442
+UniRef90_Q8ABZ4	3.4013605442
+UniRef90_Q8ABZ4|g__Bacteroides.s__Bacteroides_dorei	3.4013605442
+UniRef90_R6HLW5	3.4013605442
+UniRef90_R6HLW5|g__Bacteroides.s__Bacteroides_dorei	3.4013605442
+UniRef90_A6KZ39	3.3944331297
+UniRef90_A6KZ39|g__Bacteroides.s__Bacteroides_dorei	2.7155465037
+UniRef90_A6KZ39|g__Bacteroides.s__Bacteroides_vulgatus	0.6788866259
+UniRef90_R6HIJ0	3.3927056828
+UniRef90_R6HIJ0|g__Bacteroides.s__Bacteroides_dorei	3.3927056828
+UniRef90_R6HJJ6	3.3919210607
+UniRef90_R6HJJ6|g__Bacteroides.s__Bacteroides_vulgatus	3.3919210607
+UniRef90_R9H4G5	3.3898305085
+UniRef90_R9H4G5|g__Bacteroides.s__Bacteroides_vulgatus	3.3898305085
+UniRef90_R7NRE8	3.3840947547
+UniRef90_R7NRE8|g__Bacteroides.s__Bacteroides_dorei	1.6920473773
+UniRef90_R7NRE8|g__Bacteroides.s__Bacteroides_vulgatus	1.6920473773
+UniRef90_R7P3N1	3.3840947547
+UniRef90_R7P3N1|g__Bacteroides.s__Bacteroides_vulgatus	3.3840947547
+UniRef90_A6L740	3.3806626099
+UniRef90_A6L740|g__Bacteroides.s__Bacteroides_dorei	2.0283975659
+UniRef90_A6L740|g__Bacteroides.s__Bacteroides_vulgatus	1.3522650439
+UniRef90_A6L113	3.3745781777
+UniRef90_A6L113|g__Bacteroides.s__Bacteroides_vulgatus	3.3745781777
+UniRef90_A6KWD4	3.3698423243
+UniRef90_A6KWD4|g__Bacteroides.s__Bacteroides_vulgatus	3.3698423243
+UniRef90_A6LIP2	3.3670033670
+UniRef90_A6LIP2|g__Bacteroides.s__Bacteroides_dorei	3.3670033670
+UniRef90_I8WFJ8	3.3670033670
+UniRef90_I8WFJ8|g__Bacteroides.s__Bacteroides_dorei	3.3670033670
+UniRef90_I9QQW6	3.3670033670
+UniRef90_I9QQW6|g__Bacteroides.s__Bacteroides_dorei	3.3670033670
+UniRef90_Q5L8C3	3.3670033670
+UniRef90_Q5L8C3|g__Bacteroides.s__Bacteroides_vulgatus	3.3670033670
+UniRef90_Q64SD6	3.3670033670
+UniRef90_Q64SD6|g__Bacteroides.s__Bacteroides_dorei	3.3670033670
+UniRef90_R6HL13	3.3670033670
+UniRef90_R6HL13|g__Bacteroides.s__Bacteroides_dorei	1.6835016835
+UniRef90_R6HL13|g__Bacteroides.s__Bacteroides_vulgatus	1.6835016835
+UniRef90_R6HTP8	3.3670033670
+UniRef90_R6HTP8|g__Bacteroides.s__Bacteroides_vulgatus	3.3670033670
+UniRef90_R9HMX6	3.3670033670
+UniRef90_R9HMX6|g__Bacteroides.s__Bacteroides_vulgatus	3.3670033670
+UniRef90_C6Z3C5	3.3670033670
+UniRef90_C6Z3C5|g__Bacteroides.s__Bacteroides_vulgatus	3.3670033670
+UniRef90_A6L237	3.3670033670
+UniRef90_A6L237|g__Bacteroides.s__Bacteroides_dorei	1.8130018130
+UniRef90_A6L237|g__Bacteroides.s__Bacteroides_vulgatus	1.5540015540
+UniRef90_A6KWM9	3.3557046980
+UniRef90_A6KWM9|g__Bacteroides.s__Bacteroides_dorei	2.2371364653
+UniRef90_A6KWM9|g__Bacteroides.s__Bacteroides_vulgatus	1.1185682327
+UniRef90_Q5L8D6	3.3557046980
+UniRef90_Q5L8D6|g__Bacteroides.s__Bacteroides_dorei	2.2371364653
+UniRef90_Q5L8D6|g__Bacteroides.s__Bacteroides_vulgatus	1.1185682327
+UniRef90_A6L2U2	3.3500837521
+UniRef90_A6L2U2|g__Bacteroides.s__Bacteroides_vulgatus	3.3500837521
+UniRef90_A6L4A2	3.3500837521
+UniRef90_A6L4A2|g__Bacteroides.s__Bacteroides_dorei	3.3500837521
+UniRef90_I8UU25	3.3500837521
+UniRef90_I8UU25|g__Bacteroides.s__Bacteroides_dorei	3.3500837521
+UniRef90_Q64SA2	3.3500837521
+UniRef90_Q64SA2|g__Bacteroides.s__Bacteroides_dorei	3.3500837521
+UniRef90_R6HTA2	3.3500837521
+UniRef90_R6HTA2|g__Bacteroides.s__Bacteroides_dorei	3.3500837521
+UniRef90_R7P682	3.3500837521
+UniRef90_R7P682|g__Bacteroides.s__Bacteroides_vulgatus	3.3500837521
+UniRef90_R7NZP0	3.3444816054
+UniRef90_R7NZP0|g__Bacteroides.s__Bacteroides_dorei	2.7870680045
+UniRef90_R7NZP0|g__Bacteroides.s__Bacteroides_vulgatus	0.5574136009
+UniRef90_A6KZV7	3.3444816054
+UniRef90_A6KZV7|g__Bacteroides.s__Bacteroides_dorei	2.2296544036
+UniRef90_A6KZV7|g__Bacteroides.s__Bacteroides_vulgatus	1.1148272018
+UniRef90_A6L2V0	3.3416875522
+UniRef90_A6L2V0|g__Bacteroides.s__Bacteroides_dorei	1.6708437761
+UniRef90_A6L2V0|g__Bacteroides.s__Bacteroides_vulgatus	1.6708437761
+UniRef90_A6L4U3	3.3333333333
+UniRef90_A6L4U3|g__Bacteroides.s__Bacteroides_dorei	3.3333333333
+UniRef90_A6L5E7	3.3333333333
+UniRef90_A6L5E7|g__Bacteroides.s__Bacteroides_dorei	3.3333333333
+UniRef90_C3QUE3	3.3333333333
+UniRef90_C3QUE3|g__Bacteroides.s__Bacteroides_dorei	3.3333333333
+UniRef90_I9FKC2	3.3333333333
+UniRef90_I9FKC2|g__Bacteroides.s__Bacteroides_dorei	3.3333333333
+UniRef90_I9PI92	3.3333333333
+UniRef90_I9PI92|g__Bacteroides.s__Bacteroides_vulgatus	3.3333333333
+UniRef90_Q9AE24	3.3333333333
+UniRef90_Q9AE24|g__Bacteroides.s__Bacteroides_dorei	3.3333333333
+UniRef90_R6HKR3	3.3333333333
+UniRef90_R6HKR3|g__Bacteroides.s__Bacteroides_vulgatus	3.3333333333
+UniRef90_R6HQN1	3.3333333333
+UniRef90_R6HQN1|g__Bacteroides.s__Bacteroides_dorei	3.3333333333
+UniRef90_R6IGM0	3.3333333333
+UniRef90_R6IGM0|g__Bacteroides.s__Bacteroides_dorei	2.5000000000
+UniRef90_R6IGM0|g__Bacteroides.s__Bacteroides_vulgatus	0.8333333333
+UniRef90_R6II60	3.3333333333
+UniRef90_R6II60|g__Bacteroides.s__Bacteroides_dorei	3.3333333333
+UniRef90_R6IJA7	3.3333333333
+UniRef90_R6IJA7|g__Bacteroides.s__Bacteroides_dorei	3.3333333333
+UniRef90_R7NX82	3.3333333333
+UniRef90_R7NX82|g__Bacteroides.s__Bacteroides_dorei	2.2222222222
+UniRef90_R7NX82|g__Bacteroides.s__Bacteroides_vulgatus	1.1111111111
+UniRef90_R7NZL0	3.3333333333
+UniRef90_R7NZL0|g__Bacteroides.s__Bacteroides_vulgatus	3.3333333333
+UniRef90_R7P6A0	3.3333333333
+UniRef90_R7P6A0|g__Bacteroides.s__Bacteroides_dorei	3.3333333333
+UniRef90_R9HPI8	3.3333333333
+UniRef90_R9HPI8|g__Bacteroides.s__Bacteroides_vulgatus	3.3333333333
+UniRef90_R9HPX3	3.3333333333
+UniRef90_R9HPX3|g__Bacteroides.s__Bacteroides_vulgatus	3.3333333333
+UniRef90_R9HVX4	3.3333333333
+UniRef90_R9HVX4|g__Bacteroides.s__Bacteroides_vulgatus	3.3333333333
+UniRef90_R7P3C2	3.3333333333
+UniRef90_R7P3C2|g__Bacteroides.s__Bacteroides_dorei	2.0000000000
+UniRef90_R7P3C2|g__Bacteroides.s__Bacteroides_vulgatus	1.3333333333
+UniRef90_U6RFX0	3.3333333333
+UniRef90_U6RFX0|g__Bacteroides.s__Bacteroides_dorei	2.6666666667
+UniRef90_U6RFX0|g__Bacteroides.s__Bacteroides_vulgatus	0.6666666667
+UniRef90_A6L2R4	3.3306719894
+UniRef90_A6L2R4|g__Bacteroides.s__Bacteroides_dorei	2.0000000000
+UniRef90_A6L2R4|g__Bacteroides.s__Bacteroides_vulgatus	1.3306719894
+UniRef90_R7P5G9	3.3250207814
+UniRef90_R7P5G9|g__Bacteroides.s__Bacteroides_vulgatus	3.3250207814
+UniRef90_A6L775	3.3167495854
+UniRef90_A6L775|g__Bacteroides.s__Bacteroides_dorei	3.3167495854
+UniRef90_E1WS11	3.3167495854
+UniRef90_E1WS11|g__Bacteroides.s__Bacteroides_dorei	1.6583747927
+UniRef90_E1WS11|g__Bacteroides.s__Bacteroides_vulgatus	1.6583747927
+UniRef90_E5CBS7	3.3167495854
+UniRef90_E5CBS7|g__Bacteroides.s__Bacteroides_dorei	3.3167495854
+UniRef90_I9B8Y9	3.3167495854
+UniRef90_I9B8Y9|g__Bacteroides.s__Bacteroides_dorei	3.3167495854
+UniRef90_Q8A8P6	3.3134526176
+UniRef90_Q8A8P6|g__Bacteroides.s__Bacteroides_vulgatus	1.9880715706
+UniRef90_Q8A8P6|g__Bacteroides.s__Bacteroides_dorei	1.3253810471
+UniRef90_R7NZ73	3.3134526176
+UniRef90_R7NZ73|g__Bacteroides.s__Bacteroides_vulgatus	2.6507620941
+UniRef90_R7NZ73|g__Bacteroides.s__Bacteroides_dorei	0.6626905235
+UniRef90_R7NXK5	3.3112582781
+UniRef90_R7NXK5|g__Bacteroides.s__Bacteroides_vulgatus	2.2075055188
+UniRef90_R7NXK5|g__Bacteroides.s__Bacteroides_dorei	1.1037527594
+UniRef90_J9G4D6	3.3085194376
+UniRef90_J9G4D6|g__Bacteroides.s__Bacteroides_dorei	1.6542597188
+UniRef90_J9G4D6|g__Bacteroides.s__Bacteroides_vulgatus	1.6542597188
+UniRef90_R6HX47	3.3085194376
+UniRef90_R6HX47|g__Bacteroides.s__Bacteroides_dorei	1.6542597188
+UniRef90_R6HX47|g__Bacteroides.s__Bacteroides_vulgatus	1.6542597188
+UniRef90_R9H067	3.3085194376
+UniRef90_R9H067|g__Bacteroides.s__Bacteroides_vulgatus	3.3085194376
+UniRef90_R9HCK1	3.3085194376
+UniRef90_R9HCK1|g__Bacteroides.s__Bacteroides_vulgatus	3.3085194376
+UniRef90_A6L2F0	3.3003300330
+UniRef90_A6L2F0|g__Bacteroides.s__Bacteroides_vulgatus	1.9801980198
+UniRef90_A6L2F0|g__Bacteroides.s__Bacteroides_dorei	1.3201320132
+UniRef90_D4V3G2	3.3003300330
+UniRef90_D4V3G2|g__Bacteroides.s__Bacteroides_vulgatus	3.3003300330
+UniRef90_R7NUX5	3.3003300330
+UniRef90_R7NUX5|g__Bacteroides.s__Bacteroides_dorei	3.3003300330
+UniRef90_R7NX08	3.3003300330
+UniRef90_R7NX08|g__Bacteroides.s__Bacteroides_dorei	3.3003300330
+UniRef90_R7NZI6	3.3003300330
+UniRef90_R7NZI6|g__Bacteroides.s__Bacteroides_vulgatus	2.2002200220
+UniRef90_R7NZI6|g__Bacteroides.s__Bacteroides_dorei	1.1001100110
+UniRef90_UPI0004695389	3.2948929160
+UniRef90_UPI0004695389|g__Bacteroides.s__Bacteroides_dorei	3.2948929160
+UniRef90_R9HKK1	3.2930845225
+UniRef90_R9HKK1|g__Bacteroides.s__Bacteroides_dorei	1.8294914014
+UniRef90_R9HKK1|g__Bacteroides.s__Bacteroides_vulgatus	1.4635931211
+UniRef90_A6L522	3.2921810700
+UniRef90_A6L522|g__Bacteroides.s__Bacteroides_dorei	3.2921810700
+UniRef90_I9FDH0	3.2921810700
+UniRef90_I9FDH0|g__Bacteroides.s__Bacteroides_dorei	3.2921810700
+UniRef90_R7P221	3.2921810700
+UniRef90_R7P221|g__Bacteroides.s__Bacteroides_vulgatus	3.2921810700
+UniRef90_A6KWW9	3.2894736842
+UniRef90_A6KWW9|g__Bacteroides.s__Bacteroides_vulgatus	2.1929824561
+UniRef90_A6KWW9|g__Bacteroides.s__Bacteroides_dorei	1.0964912281
+UniRef90_A6L4F2	3.2894736842
+UniRef90_A6L4F2|g__Bacteroides.s__Bacteroides_dorei	3.2894736842
+UniRef90_R6ILG6	3.2894736842
+UniRef90_R6ILG6|g__Bacteroides.s__Bacteroides_dorei	2.1929824561
+UniRef90_R6ILG6|g__Bacteroides.s__Bacteroides_vulgatus	1.0964912281
+UniRef90_A6KZA0	3.2840722496
+UniRef90_A6KZA0|g__Bacteroides.s__Bacteroides_dorei	2.4630541872
+UniRef90_A6KZA0|g__Bacteroides.s__Bacteroides_vulgatus	0.8210180624
+UniRef90_A6L3I7	3.2840722496
+UniRef90_A6L3I7|g__Bacteroides.s__Bacteroides_dorei	1.6420361248
+UniRef90_A6L3I7|g__Bacteroides.s__Bacteroides_vulgatus	1.6420361248
+UniRef90_C3QUB1	3.2840722496
+UniRef90_C3QUB1|g__Bacteroides.s__Bacteroides_dorei	3.2840722496
+UniRef90_R9I8Y7	3.2834981111
+UniRef90_R9I8Y7|g__Bacteroides.s__Bacteroides_dorei	3.2834981111
+UniRef90_A6L6W6	3.2786885246
+UniRef90_A6L6W6|g__Bacteroides.s__Bacteroides_dorei	2.1857923497
+UniRef90_A6L6W6|g__Bacteroides.s__Bacteroides_vulgatus	1.0928961749
+UniRef90_A6L423	3.2783211084
+UniRef90_A6L423|g__Bacteroides.s__Bacteroides_vulgatus	2.4449877751
+UniRef90_A6L423|g__Bacteroides.s__Bacteroides_dorei	0.8333333333
+UniRef90_R6HR23	3.2760032760
+UniRef90_R6HR23|g__Bacteroides.s__Bacteroides_dorei	3.2760032760
+UniRef90_A6KYP0	3.2679738562
+UniRef90_A6KYP0|g__Bacteroides.s__Bacteroides_dorei	3.2679738562
+UniRef90_C3Q2N1	3.2679738562
+UniRef90_C3Q2N1|g__Bacteroides.s__Bacteroides_dorei	3.2679738562
+UniRef90_C3QU88	3.2679738562
+UniRef90_C3QU88|g__Bacteroides.s__Bacteroides_dorei	3.2679738562
+UniRef90_D4VSU5	3.2679738562
+UniRef90_D4VSU5|g__Bacteroides.s__Bacteroides_vulgatus	3.2679738562
+UniRef90_I9QDY6	3.2679738562
+UniRef90_I9QDY6|g__Bacteroides.s__Bacteroides_dorei	3.2679738562
+UniRef90_Q5LHK5	3.2679738562
+UniRef90_Q5LHK5|g__Bacteroides.s__Bacteroides_dorei	3.2679738562
+UniRef90_Q650D7	3.2679738562
+UniRef90_Q650D7|g__Bacteroides.s__Bacteroides_dorei	1.6339869281
+UniRef90_Q650D7|g__Bacteroides.s__Bacteroides_vulgatus	1.6339869281
+UniRef90_R6DNS5	3.2679738562
+UniRef90_R6DNS5|g__Bacteroides.s__Bacteroides_vulgatus	3.2679738562
+UniRef90_R6HWX9	3.2679738562
+UniRef90_R6HWX9|g__Bacteroides.s__Bacteroides_dorei	3.2679738562
+UniRef90_R7DU55	3.2644488350
+UniRef90_R7DU55|g__Bacteroides.s__Bacteroides_dorei	2.1715526602
+UniRef90_R7DU55|g__Bacteroides.s__Bacteroides_vulgatus	1.0928961749
+UniRef90_R7P2W4	3.2600031883
+UniRef90_R7P2W4|g__Bacteroides.s__Bacteroides_dorei	1.6339869281
+UniRef90_R7P2W4|g__Bacteroides.s__Bacteroides_vulgatus	1.6260162602
+UniRef90_A0A015VSZ2	3.2588454376
+UniRef90_A0A015VSZ2|g__Bacteroides.s__Bacteroides_vulgatus	1.8621973929
+UniRef90_A0A015VSZ2|g__Bacteroides.s__Bacteroides_dorei	1.3966480447
+UniRef90_R6ILW8	3.2573289902
+UniRef90_R6ILW8|g__Bacteroides.s__Bacteroides_dorei	3.2573289902
+UniRef90_A6LIN6	3.2573289902
+UniRef90_A6LIN6|g__Bacteroides.s__Bacteroides_dorei	2.1715526602
+UniRef90_A6LIN6|g__Bacteroides.s__Bacteroides_vulgatus	1.0857763301
+UniRef90_A6L304	3.2520325203
+UniRef90_A6L304|g__Bacteroides.s__Bacteroides_dorei	2.1680216802
+UniRef90_A6L304|g__Bacteroides.s__Bacteroides_vulgatus	1.0840108401
+UniRef90_A6L3V8	3.2520325203
+UniRef90_A6L3V8|g__Bacteroides.s__Bacteroides_vulgatus	2.4390243902
+UniRef90_A6L3V8|g__Bacteroides.s__Bacteroides_dorei	0.8130081301
+UniRef90_A6L386	3.2467532468
+UniRef90_A6L386|g__Bacteroides.s__Bacteroides_dorei	3.2467532468
+UniRef90_R6IM42	3.2425421530
+UniRef90_R6IM42|g__Bacteroides.s__Bacteroides_dorei	3.2425421530
+UniRef90_Q64RN6	3.2362459547
+UniRef90_Q64RN6|g__Bacteroides.s__Bacteroides_vulgatus	3.2362459547
+UniRef90_A6KXM3	3.2362459547
+UniRef90_A6KXM3|g__Bacteroides.s__Bacteroides_dorei	1.6181229773
+UniRef90_A6KXM3|g__Bacteroides.s__Bacteroides_vulgatus	1.6181229773
+UniRef90_A6L763	3.2362459547
+UniRef90_A6L763|g__Bacteroides.s__Bacteroides_dorei	3.2362459547
+UniRef90_I9QI19	3.2362459547
+UniRef90_I9QI19|g__Bacteroides.s__Bacteroides_dorei	3.2362459547
+UniRef90_R6HRL1	3.2362459547
+UniRef90_R6HRL1|g__Bacteroides.s__Bacteroides_dorei	3.2362459547
+UniRef90_R6HRV7	3.2362459547
+UniRef90_R6HRV7|g__Bacteroides.s__Bacteroides_dorei	1.6181229773
+UniRef90_R6HRV7|g__Bacteroides.s__Bacteroides_vulgatus	1.6181229773
+UniRef90_R9HUR3	3.2362459547
+UniRef90_R9HUR3|g__Bacteroides.s__Bacteroides_vulgatus	3.2362459547
+UniRef90_R6HXE7	3.2284100081
+UniRef90_R6HXE7|g__Bacteroides.s__Bacteroides_dorei	3.2284100081
+UniRef90_A6L3A6	3.2258064516
+UniRef90_A6L3A6|g__Bacteroides.s__Bacteroides_dorei	2.1505376344
+UniRef90_A6L3A6|g__Bacteroides.s__Bacteroides_vulgatus	1.0752688172
+UniRef90_R6ZHI6	3.2241230142
+UniRef90_R6ZHI6|g__Bacteroides.s__Bacteroides_dorei	3.2241230142
+UniRef90_A6KZD6	3.2206119163
+UniRef90_A6KZD6|g__Bacteroides.s__Bacteroides_dorei	1.6103059581
+UniRef90_A6KZD6|g__Bacteroides.s__Bacteroides_vulgatus	1.6103059581
+UniRef90_A6L5K5	3.2206119163
+UniRef90_A6L5K5|g__Bacteroides.s__Bacteroides_dorei	3.2206119163
+UniRef90_I9FC32	3.2206119163
+UniRef90_I9FC32|g__Bacteroides.s__Bacteroides_dorei	3.2206119163
+UniRef90_R9HI95	3.2206119163
+UniRef90_R9HI95|g__Bacteroides.s__Bacteroides_vulgatus	3.2206119163
+UniRef90_A6L1R9	3.2128514056
+UniRef90_A6L1R9|g__Bacteroides.s__Bacteroides_dorei	2.4096385542
+UniRef90_A6L1R9|g__Bacteroides.s__Bacteroides_vulgatus	0.8032128514
+UniRef90_C3RAK2	3.2128514056
+UniRef90_C3RAK2|g__Bacteroides.s__Bacteroides_dorei	3.2128514056
+UniRef90_A6L5K6	3.2051282051
+UniRef90_A6L5K6|g__Bacteroides.s__Bacteroides_dorei	3.2051282051
+UniRef90_C3R7K4	3.2051282051
+UniRef90_C3R7K4|g__Bacteroides.s__Bacteroides_dorei	3.2051282051
+UniRef90_C6Z204	3.2051282051
+UniRef90_C6Z204|g__Bacteroides.s__Bacteroides_vulgatus	3.2051282051
+UniRef90_Q5L8B4	3.2051282051
+UniRef90_Q5L8B4|g__Bacteroides.s__Bacteroides_vulgatus	3.2051282051
+UniRef90_R6IFX0	3.2051282051
+UniRef90_R6IFX0|g__Bacteroides.s__Bacteroides_vulgatus	3.2051282051
+UniRef90_R6IJ94	3.2051282051
+UniRef90_R6IJ94|g__Bacteroides.s__Bacteroides_dorei	3.2051282051
+UniRef90_R9HLI4	3.2051282051
+UniRef90_R9HLI4|g__Bacteroides.s__Bacteroides_vulgatus	3.2051282051
+UniRef90_R6HQF8	3.2007315958
+UniRef90_R6HQF8|g__Bacteroides.s__Bacteroides_vulgatus	1.8289894833
+UniRef90_R6HQF8|g__Bacteroides.s__Bacteroides_dorei	1.3717421125
+UniRef90_R6IHX9	3.1974420464
+UniRef90_R6IHX9|g__Bacteroides.s__Bacteroides_vulgatus	3.1974420464
+UniRef90_I9QFD8	3.1948881789
+UniRef90_I9QFD8|g__Bacteroides.s__Bacteroides_dorei	3.1948881789
+UniRef90_A6L518	3.1948881789
+UniRef90_A6L518|g__Bacteroides.s__Bacteroides_vulgatus	2.1299254526
+UniRef90_A6L518|g__Bacteroides.s__Bacteroides_dorei	1.0649627263
+UniRef90_R6IHF0	3.1897926635
+UniRef90_R6IHF0|g__Bacteroides.s__Bacteroides_dorei	3.1897926635
+UniRef90_R9H4L3	3.1897926635
+UniRef90_R9H4L3|g__Bacteroides.s__Bacteroides_vulgatus	3.1897926635
+UniRef90_A6L4P0	3.1867431485
+UniRef90_A6L4P0|g__Bacteroides.s__Bacteroides_vulgatus	2.5493945188
+UniRef90_A6L4P0|g__Bacteroides.s__Bacteroides_dorei	0.6373486297
+UniRef90_A6KWL3	3.1847133758
+UniRef90_A6KWL3|g__Bacteroides.s__Bacteroides_dorei	3.1847133758
+UniRef90_R7P0I2	3.1847133758
+UniRef90_R7P0I2|g__Bacteroides.s__Bacteroides_dorei	2.1231422505
+UniRef90_R7P0I2|g__Bacteroides.s__Bacteroides_vulgatus	1.0615711253
+UniRef90_R7NNG2	3.1821797932
+UniRef90_R7NNG2|g__Bacteroides.s__Bacteroides_vulgatus	3.1821797932
+UniRef90_R6HUX8	3.1746031746
+UniRef90_R6HUX8|g__Bacteroides.s__Bacteroides_dorei	3.1746031746
+UniRef90_D6D8M6	3.1746031746
+UniRef90_D6D8M6|g__Bacteroides.s__Bacteroides_vulgatus	2.1164021164
+UniRef90_D6D8M6|g__Bacteroides.s__Bacteroides_dorei	1.0582010582
+UniRef90_D4V887	3.1746031746
+UniRef90_D4V887|g__Bacteroides.s__Bacteroides_vulgatus	3.1746031746
+UniRef90_R6HI72	3.1746031746
+UniRef90_R6HI72|g__Bacteroides.s__Bacteroides_vulgatus	3.1746031746
+UniRef90_R6HQ64	3.1746031746
+UniRef90_R6HQ64|g__Bacteroides.s__Bacteroides_dorei	3.1746031746
+UniRef90_R7EHR2	3.1746031746
+UniRef90_R7EHR2|g__Bacteroides.s__Bacteroides_vulgatus	3.1746031746
+UniRef90_R9HQX3	3.1746031746
+UniRef90_R9HQX3|g__Bacteroides.s__Bacteroides_vulgatus	3.1746031746
+UniRef90_I9J135	3.1670625495
+UniRef90_I9J135|g__Bacteroides.s__Bacteroides_vulgatus	3.1670625495
+UniRef90_R9HLZ6	3.1670625495
+UniRef90_R9HLZ6|g__Bacteroides.s__Bacteroides_vulgatus	3.1670625495
+UniRef90_A6KYP7	3.1595576619
+UniRef90_A6KYP7|g__Bacteroides.s__Bacteroides_dorei	3.1595576619
+UniRef90_A6L4K4	3.1595576619
+UniRef90_A6L4K4|g__Bacteroides.s__Bacteroides_dorei	3.1595576619
+UniRef90_C6ZAZ6	3.1595576619
+UniRef90_C6ZAZ6|g__Bacteroides.s__Bacteroides_dorei	3.1595576619
+UniRef90_R6HTS2	3.1565656566
+UniRef90_R6HTS2|g__Bacteroides.s__Bacteroides_vulgatus	2.5252525253
+UniRef90_R6HTS2|g__Bacteroides.s__Bacteroides_dorei	0.6313131313
+UniRef90_A6L0Z6	3.1545741325
+UniRef90_A6L0Z6|g__Bacteroides.s__Bacteroides_dorei	2.1030494217
+UniRef90_A6L0Z6|g__Bacteroides.s__Bacteroides_vulgatus	1.0515247108
+UniRef90_E1WQJ6	3.1545741325
+UniRef90_E1WQJ6|g__Bacteroides.s__Bacteroides_dorei	2.1030494217
+UniRef90_E1WQJ6|g__Bacteroides.s__Bacteroides_vulgatus	1.0515247108
+UniRef90_A6KZS1	3.1520882585
+UniRef90_A6KZS1|g__Bacteroides.s__Bacteroides_vulgatus	3.1520882585
+UniRef90_A6L200	3.1520882585
+UniRef90_A6L200|g__Bacteroides.s__Bacteroides_dorei	1.5760441292
+UniRef90_A6L200|g__Bacteroides.s__Bacteroides_vulgatus	1.5760441292
+UniRef90_R6IFK5	3.1488978857
+UniRef90_R6IFK5|g__Bacteroides.s__Bacteroides_vulgatus	1.5948963317
+UniRef90_R6IFK5|g__Bacteroides.s__Bacteroides_dorei	1.5540015540
+UniRef90_A6L7T0	3.1446540881
+UniRef90_A6L7T0|g__Bacteroides.s__Bacteroides_dorei	3.1446540881
+UniRef90_R7NP40	3.1446540881
+UniRef90_R7NP40|g__Bacteroides.s__Bacteroides_vulgatus	1.8867924528
+UniRef90_R7NP40|g__Bacteroides.s__Bacteroides_dorei	1.2578616352
+UniRef90_A6L2M2	3.1446540881
+UniRef90_A6L2M2|g__Bacteroides.s__Bacteroides_vulgatus	3.1446540881
+UniRef90_D4VC44	3.1446540881
+UniRef90_D4VC44|g__Bacteroides.s__Bacteroides_dorei	3.1446540881
+UniRef90_D4VDZ2	3.1446540881
+UniRef90_D4VDZ2|g__Bacteroides.s__Bacteroides_dorei	3.1446540881
+UniRef90_I8ZXL7	3.1446540881
+UniRef90_I8ZXL7|g__Bacteroides.s__Bacteroides_dorei	3.1446540881
+UniRef90_R6HHX8	3.1446540881
+UniRef90_R6HHX8|g__Bacteroides.s__Bacteroides_dorei	3.1446540881
+UniRef90_R6HYM7	3.1446540881
+UniRef90_R6HYM7|g__Bacteroides.s__Bacteroides_vulgatus	3.1446540881
+UniRef90_R6HZK1	3.1446540881
+UniRef90_R6HZK1|g__Bacteroides.s__Bacteroides_dorei	3.1446540881
+UniRef90_A6L3Q8	3.1412991939
+UniRef90_A6L3Q8|g__Bacteroides.s__Bacteroides_vulgatus	2.7027027027
+UniRef90_A6L3Q8|g__Bacteroides.s__Bacteroides_dorei	0.4385964912
+UniRef90_C3Q078	3.1397174254
+UniRef90_C3Q078|g__Bacteroides.s__Bacteroides_dorei	2.6164311879
+UniRef90_C3Q078|g__Bacteroides.s__Bacteroides_vulgatus	0.5232862376
+UniRef90_R6HYS9	3.1397174254
+UniRef90_R6HYS9|g__Bacteroides.s__Bacteroides_vulgatus	3.1397174254
+UniRef90_I9QEH9	3.1347962382
+UniRef90_I9QEH9|g__Bacteroides.s__Bacteroides_dorei	3.1347962382
+UniRef90_A6L070	3.1298904538
+UniRef90_A6L070|g__Bacteroides.s__Bacteroides_dorei	2.3474178404
+UniRef90_A6L070|g__Bacteroides.s__Bacteroides_vulgatus	0.7824726135
+UniRef90_I9QI96	3.1298904538
+UniRef90_I9QI96|g__Bacteroides.s__Bacteroides_dorei	3.1298904538
+UniRef90_I9RGL2	3.1298904538
+UniRef90_I9RGL2|g__Bacteroides.s__Bacteroides_vulgatus	2.3474178404
+UniRef90_I9RGL2|g__Bacteroides.s__Bacteroides_dorei	0.7824726135
+UniRef90_R6IFN1	3.1298904538
+UniRef90_R6IFN1|g__Bacteroides.s__Bacteroides_dorei	3.1298904538
+UniRef90_R6YUN4	3.1298904538
+UniRef90_R6YUN4|g__Bacteroides.s__Bacteroides_dorei	3.1298904538
+UniRef90_R7NWS6	3.1298904538
+UniRef90_R7NWS6|g__Bacteroides.s__Bacteroides_dorei	2.3474178404
+UniRef90_R7NWS6|g__Bacteroides.s__Bacteroides_vulgatus	0.7824726135
+UniRef90_R7P4H0	3.1298904538
+UniRef90_R7P4H0|g__Bacteroides.s__Bacteroides_vulgatus	3.1298904538
+UniRef90_A6KXX0	3.1152647975
+UniRef90_A6KXX0|g__Bacteroides.s__Bacteroides_vulgatus	3.1152647975
+UniRef90_A6L3D4	3.1152647975
+UniRef90_A6L3D4|g__Bacteroides.s__Bacteroides_dorei	3.1152647975
+UniRef90_A6L7K0	3.1152647975
+UniRef90_A6L7K0|g__Bacteroides.s__Bacteroides_vulgatus	3.1152647975
+UniRef90_I8VTF0	3.1152647975
+UniRef90_I8VTF0|g__Bacteroides.s__Bacteroides_dorei	3.1152647975
+UniRef90_I9R3V5	3.1152647975
+UniRef90_I9R3V5|g__Bacteroides.s__Bacteroides_dorei	3.1152647975
+UniRef90_K5CQW8	3.1152647975
+UniRef90_K5CQW8|g__Bacteroides.s__Bacteroides_dorei	3.1152647975
+UniRef90_R6HVS3	3.1152647975
+UniRef90_R6HVS3|g__Bacteroides.s__Bacteroides_dorei	3.1152647975
+UniRef90_R9HM97	3.1152647975
+UniRef90_R9HM97|g__Bacteroides.s__Bacteroides_vulgatus	3.1152647975
+UniRef90_R7P4T3	3.1111111111
+UniRef90_R7P4T3|g__Bacteroides.s__Bacteroides_dorei	3.1111111111
+UniRef90_A6KYD8	3.1104199067
+UniRef90_A6KYD8|g__Bacteroides.s__Bacteroides_dorei	3.1104199067
+UniRef90_A6L3S6	3.1085604974
+UniRef90_A6L3S6|g__Bacteroides.s__Bacteroides_vulgatus	3.1085604974
+UniRef90_A6L710	3.1080031080
+UniRef90_A6L710|g__Bacteroides.s__Bacteroides_dorei	1.5540015540
+UniRef90_A6L710|g__Bacteroides.s__Bacteroides_vulgatus	1.5540015540
+UniRef90_R9H3P1	3.1080031080
+UniRef90_R9H3P1|g__Bacteroides.s__Bacteroides_vulgatus	3.1080031080
+UniRef90_I9F7R2	3.1007751938
+UniRef90_I9F7R2|g__Bacteroides.s__Bacteroides_dorei	3.1007751938
+UniRef90_R7NUI6	3.1007751938
+UniRef90_R7NUI6|g__Bacteroides.s__Bacteroides_vulgatus	3.1007751938
+UniRef90_R7NW02	3.1007751938
+UniRef90_R7NW02|g__Bacteroides.s__Bacteroides_dorei	1.5503875969
+UniRef90_R7NW02|g__Bacteroides.s__Bacteroides_vulgatus	1.5503875969
+UniRef90_C3RFF7	3.1007751938
+UniRef90_C3RFF7|g__Bacteroides.s__Bacteroides_dorei	2.5839793282
+UniRef90_C3RFF7|g__Bacteroides.s__Bacteroides_vulgatus	0.5167958656
+UniRef90_A6L511	3.0959752322
+UniRef90_A6L511|g__Bacteroides.s__Bacteroides_dorei	3.0959752322
+UniRef90_A6L224	3.0935808198
+UniRef90_A6L224|g__Bacteroides.s__Bacteroides_vulgatus	3.0935808198
+UniRef90_A6L6Y6	3.0911901082
+UniRef90_A6L6Y6|g__Bacteroides.s__Bacteroides_dorei	3.0911901082
+UniRef90_A6KX00	3.0900998643
+UniRef90_A6KX00|g__Bacteroides.s__Bacteroides_vulgatus	1.5540015540
+UniRef90_A6KX00|g__Bacteroides.s__Bacteroides_dorei	1.5360983103
+UniRef90_A6KYS3	3.0864197531
+UniRef90_A6KYS3|g__Bacteroides.s__Bacteroides_dorei	1.5432098765
+UniRef90_A6KYS3|g__Bacteroides.s__Bacteroides_vulgatus	1.5432098765
+UniRef90_A6KZX5	3.0864197531
+UniRef90_A6KZX5|g__Bacteroides.s__Bacteroides_dorei	3.0864197531
+UniRef90_A7ACP0	3.0864197531
+UniRef90_A7ACP0|g__Bacteroides.s__Bacteroides_vulgatus	3.0864197531
+UniRef90_D1K5A5	3.0864197531
+UniRef90_D1K5A5|g__Bacteroides.s__Bacteroides_dorei	3.0864197531
+UniRef90_R6HK68	3.0864197531
+UniRef90_R6HK68|g__Bacteroides.s__Bacteroides_dorei	3.0864197531
+UniRef90_R6HKX5	3.0864197531
+UniRef90_R6HKX5|g__Bacteroides.s__Bacteroides_dorei	3.0864197531
+UniRef90_R7NXF4	3.0864197531
+UniRef90_R7NXF4|g__Bacteroides.s__Bacteroides_vulgatus	3.0864197531
+UniRef90_R6HSZ5	3.0792917629
+UniRef90_R6HSZ5|g__Bacteroides.s__Bacteroides_vulgatus	3.0792917629
+UniRef90_R6IGH0	3.0792917629
+UniRef90_R6IGH0|g__Bacteroides.s__Bacteroides_dorei	3.0792917629
+UniRef90_A6L2G3	3.0769230769
+UniRef90_A6L2G3|g__Bacteroides.s__Bacteroides_dorei	2.0512820513
+UniRef90_A6L2G3|g__Bacteroides.s__Bacteroides_vulgatus	1.0256410256
+UniRef90_D4WTQ4	3.0769230769
+UniRef90_D4WTQ4|g__Bacteroides.s__Bacteroides_vulgatus	3.0769230769
+UniRef90_R6HH09	3.0727655343
+UniRef90_R6HH09|g__Bacteroides.s__Bacteroides_vulgatus	1.8450184502
+UniRef90_R6HH09|g__Bacteroides.s__Bacteroides_dorei	1.2277470841
+UniRef90_R6M750	3.0721966206
+UniRef90_R6M750|g__Bacteroides.s__Bacteroides_dorei	3.0721966206
+UniRef90_R6HNN6	3.0637254902
+UniRef90_R6HNN6|g__Bacteroides.s__Bacteroides_dorei	1.8382352941
+UniRef90_R6HNN6|g__Bacteroides.s__Bacteroides_vulgatus	1.2254901961
+UniRef90_A0A016GIZ2	3.0581039755
+UniRef90_A0A016GIZ2|g__Bacteroides.s__Bacteroides_dorei	3.0581039755
+UniRef90_A6L159	3.0581039755
+UniRef90_A6L159|g__Bacteroides.s__Bacteroides_vulgatus	2.2935779817
+UniRef90_A6L159|g__Bacteroides.s__Bacteroides_dorei	0.7645259939
+UniRef90_A6L512	3.0581039755
+UniRef90_A6L512|g__Bacteroides.s__Bacteroides_vulgatus	3.0581039755
+UniRef90_C3R8C4	3.0581039755
+UniRef90_C3R8C4|g__Bacteroides.s__Bacteroides_vulgatus	2.0387359837
+UniRef90_C3R8C4|g__Bacteroides.s__Bacteroides_dorei	1.0193679918
+UniRef90_I8W3H4	3.0581039755
+UniRef90_I8W3H4|g__Bacteroides.s__Bacteroides_dorei	3.0581039755
+UniRef90_I9PQB8	3.0581039755
+UniRef90_I9PQB8|g__Bacteroides.s__Bacteroides_dorei	3.0581039755
+UniRef90_Q64ZR0	3.0581039755
+UniRef90_Q64ZR0|g__Bacteroides.s__Bacteroides_dorei	1.5290519878
+UniRef90_Q64ZR0|g__Bacteroides.s__Bacteroides_vulgatus	1.5290519878
+UniRef90_R6HSX0	3.0581039755
+UniRef90_R6HSX0|g__Bacteroides.s__Bacteroides_dorei	3.0581039755
+UniRef90_R6IMD9	3.0581039755
+UniRef90_R6IMD9|g__Bacteroides.s__Bacteroides_vulgatus	2.2935779817
+UniRef90_R6IMD9|g__Bacteroides.s__Bacteroides_dorei	0.7645259939
+UniRef90_R7NXQ9	3.0581039755
+UniRef90_R7NXQ9|g__Bacteroides.s__Bacteroides_dorei	3.0581039755
+UniRef90_R9HIX9	3.0581039755
+UniRef90_R9HIX9|g__Bacteroides.s__Bacteroides_vulgatus	3.0581039755
+UniRef90_A6L4X8	3.0581039755
+UniRef90_A6L4X8|g__Bacteroides.s__Bacteroides_vulgatus	2.5484199796
+UniRef90_A6L4X8|g__Bacteroides.s__Bacteroides_dorei	0.5096839959
+UniRef90_R6HQ52	3.0530404650
+UniRef90_R6HQ52|g__Bacteroides.s__Bacteroides_vulgatus	1.5649452269
+UniRef90_R6HQ52|g__Bacteroides.s__Bacteroides_dorei	1.4880952381
+UniRef90_D4VB57	3.0487804878
+UniRef90_D4VB57|g__Bacteroides.s__Bacteroides_dorei	3.0487804878
+UniRef90_R6IJW4	3.0487804878
+UniRef90_R6IJW4|g__Bacteroides.s__Bacteroides_vulgatus	2.0325203252
+UniRef90_R6IJW4|g__Bacteroides.s__Bacteroides_dorei	1.0162601626
+UniRef90_C3PVD8	3.0442035029
+UniRef90_C3PVD8|g__Bacteroides.s__Bacteroides_dorei	1.5290519878
+UniRef90_C3PVD8|g__Bacteroides.s__Bacteroides_vulgatus	1.5151515152
+UniRef90_A6L6E2	3.0441400304
+UniRef90_A6L6E2|g__Bacteroides.s__Bacteroides_dorei	3.0441400304
+UniRef90_A6L6Z2	3.0441400304
+UniRef90_A6L6Z2|g__Bacteroides.s__Bacteroides_vulgatus	3.0441400304
+UniRef90_R6HJQ7	3.0441400304
+UniRef90_R6HJQ7|g__Bacteroides.s__Bacteroides_dorei	3.0441400304
+UniRef90_R6IB38	3.0441400304
+UniRef90_R6IB38|g__Bacteroides.s__Bacteroides_vulgatus	3.0441400304
+UniRef90_R6IFY3	3.0413625304
+UniRef90_R6IFY3|g__Bacteroides.s__Bacteroides_dorei	3.0413625304
+UniRef90_R7NWJ6	3.0413625304
+UniRef90_R7NWJ6|g__Bacteroides.s__Bacteroides_vulgatus	1.8248175182
+UniRef90_R7NWJ6|g__Bacteroides.s__Bacteroides_dorei	1.2165450122
+UniRef90_D4V8V5	3.0395136778
+UniRef90_D4V8V5|g__Bacteroides.s__Bacteroides_vulgatus	3.0395136778
+UniRef90_E1WS00	3.0395136778
+UniRef90_E1WS00|g__Bacteroides.s__Bacteroides_dorei	3.0395136778
+UniRef90_R9HMV1	3.0372057707
+UniRef90_R9HMV1|g__Bacteroides.s__Bacteroides_vulgatus	3.0372057707
+UniRef90_C3PZ21	3.0303030303
+UniRef90_C3PZ21|g__Bacteroides.s__Bacteroides_dorei	3.0303030303
+UniRef90_D1K005	3.0303030303
+UniRef90_D1K005|g__Bacteroides.s__Bacteroides_dorei	3.0303030303
+UniRef90_D4VEF6	3.0303030303
+UniRef90_D4VEF6|g__Bacteroides.s__Bacteroides_vulgatus	3.0303030303
+UniRef90_I8VIS8	3.0303030303
+UniRef90_I8VIS8|g__Bacteroides.s__Bacteroides_dorei	3.0303030303
+UniRef90_R6HXD5	3.0303030303
+UniRef90_R6HXD5|g__Bacteroides.s__Bacteroides_dorei	3.0303030303
+UniRef90_R9HCK6	3.0257186082
+UniRef90_R9HCK6|g__Bacteroides.s__Bacteroides_vulgatus	3.0257186082
+UniRef90_A6KZD0	3.0248033878
+UniRef90_A6KZD0|g__Bacteroides.s__Bacteroides_vulgatus	2.4198427102
+UniRef90_A6KZD0|g__Bacteroides.s__Bacteroides_dorei	0.6049606776
+UniRef90_A6L162	3.0234315949
+UniRef90_A6L162|g__Bacteroides.s__Bacteroides_dorei	1.5117157974
+UniRef90_A6L162|g__Bacteroides.s__Bacteroides_vulgatus	1.5117157974
+UniRef90_C3R8N6	3.0211480363
+UniRef90_C3R8N6|g__Bacteroides.s__Bacteroides_dorei	3.0211480363
+UniRef90_A6KXB1	3.0165912519
+UniRef90_A6KXB1|g__Bacteroides.s__Bacteroides_vulgatus	3.0165912519
+UniRef90_I8W9V0	3.0165912519
+UniRef90_I8W9V0|g__Bacteroides.s__Bacteroides_dorei	3.0165912519
+UniRef90_R6IE48	3.0165912519
+UniRef90_R6IE48|g__Bacteroides.s__Bacteroides_vulgatus	2.2624434389
+UniRef90_R6IE48|g__Bacteroides.s__Bacteroides_dorei	0.7541478130
+UniRef90_R9HCM3	3.0165912519
+UniRef90_R9HCM3|g__Bacteroides.s__Bacteroides_vulgatus	3.0165912519
+UniRef90_A6L2R1	3.0030030030
+UniRef90_A6L2R1|g__Bacteroides.s__Bacteroides_dorei	2.0020020020
+UniRef90_A6L2R1|g__Bacteroides.s__Bacteroides_vulgatus	1.0010010010
+UniRef90_A6L0C8	3.0030030030
+UniRef90_A6L0C8|g__Bacteroides.s__Bacteroides_vulgatus	3.0030030030
+UniRef90_A6L7R0	3.0030030030
+UniRef90_A6L7R0|g__Bacteroides.s__Bacteroides_vulgatus	3.0030030030
+UniRef90_E5VFC0	3.0030030030
+UniRef90_E5VFC0|g__Bacteroides.s__Bacteroides_dorei	3.0030030030
+UniRef90_R7NLX7	3.0030030030
+UniRef90_R7NLX7|g__Bacteroides.s__Bacteroides_vulgatus	3.0030030030
+UniRef90_A6L421	2.9962546816
+UniRef90_A6L421|g__Bacteroides.s__Bacteroides_dorei	2.2471910112
+UniRef90_A6L421|g__Bacteroides.s__Bacteroides_vulgatus	0.7490636704
+UniRef90_R7P411	2.9940119760
+UniRef90_R7P411|g__Bacteroides.s__Bacteroides_vulgatus	2.9940119760
+UniRef90_I8VP14	2.9940119760
+UniRef90_I8VP14|g__Bacteroides.s__Bacteroides_dorei	2.9940119760
+UniRef90_A6L4B5	2.9895366218
+UniRef90_A6L4B5|g__Bacteroides.s__Bacteroides_dorei	2.9895366218
+UniRef90_I9PJ26	2.9895366218
+UniRef90_I9PJ26|g__Bacteroides.s__Bacteroides_vulgatus	2.9895366218
+UniRef90_R6HSI3	2.9895366218
+UniRef90_R6HSI3|g__Bacteroides.s__Bacteroides_dorei	1.4947683109
+UniRef90_R6HSI3|g__Bacteroides.s__Bacteroides_vulgatus	1.4947683109
+UniRef90_R6HYT4	2.9895366218
+UniRef90_R6HYT4|g__Bacteroides.s__Bacteroides_dorei	2.9895366218
+UniRef90_R6ILA6	2.9895366218
+UniRef90_R6ILA6|g__Bacteroides.s__Bacteroides_dorei	2.9895366218
+UniRef90_A6L6D8	2.9761904762
+UniRef90_A6L6D8|g__Bacteroides.s__Bacteroides_dorei	2.9761904762
+UniRef90_A6L7I4	2.9761904762
+UniRef90_A6L7I4|g__Bacteroides.s__Bacteroides_dorei	2.9761904762
+UniRef90_R9HCF2	2.9673590504
+UniRef90_R9HCF2|g__Bacteroides.s__Bacteroides_dorei	2.9673590504
+UniRef90_A6L181	2.9655990510
+UniRef90_A6L181|g__Bacteroides.s__Bacteroides_vulgatus	2.9655990510
+UniRef90_A6L4K3	2.9648454045
+UniRef90_A6L4K3|g__Bacteroides.s__Bacteroides_vulgatus	2.9648454045
+UniRef90_A6KWL9	2.9629629630
+UniRef90_A6KWL9|g__Bacteroides.s__Bacteroides_dorei	2.9629629630
+UniRef90_A6L1M6	2.9629629630
+UniRef90_A6L1M6|g__Bacteroides.s__Bacteroides_dorei	2.9629629630
+UniRef90_A6L3K9	2.9498525074
+UniRef90_A6L3K9|g__Bacteroides.s__Bacteroides_dorei	1.9665683382
+UniRef90_A6L3K9|g__Bacteroides.s__Bacteroides_vulgatus	0.9832841691
+UniRef90_A6L4B8	2.9498525074
+UniRef90_A6L4B8|g__Bacteroides.s__Bacteroides_dorei	2.9498525074
+UniRef90_A6LAA9	2.9498525074
+UniRef90_A6LAA9|g__Bacteroides.s__Bacteroides_vulgatus	2.9498525074
+UniRef90_R6HFI3	2.9498525074
+UniRef90_R6HFI3|g__Bacteroides.s__Bacteroides_dorei	2.9498525074
+UniRef90_R6HLE1	2.9498525074
+UniRef90_R6HLE1|g__Bacteroides.s__Bacteroides_dorei	2.9498525074
+UniRef90_R6HTT9	2.9498525074
+UniRef90_R6HTT9|g__Bacteroides.s__Bacteroides_dorei	2.9498525074
+UniRef90_R7P0G0	2.9498525074
+UniRef90_R7P0G0|g__Bacteroides.s__Bacteroides_dorei	2.9498525074
+UniRef90_R9HEP7	2.9498525074
+UniRef90_R9HEP7|g__Bacteroides.s__Bacteroides_vulgatus	2.9498525074
+UniRef90_A6KXG7	2.9433406917
+UniRef90_A6KXG7|g__Bacteroides.s__Bacteroides_vulgatus	2.9433406917
+UniRef90_A6KYT8	2.9368575624
+UniRef90_A6KYT8|g__Bacteroides.s__Bacteroides_dorei	2.9368575624
+UniRef90_R9HQV4	2.9368575624
+UniRef90_R9HQV4|g__Bacteroides.s__Bacteroides_vulgatus	2.9368575624
+UniRef90_C3RCI9	2.9360937731
+UniRef90_C3RCI9|g__Bacteroides.s__Bacteroides_vulgatus	1.9782393670
+UniRef90_C3RCI9|g__Bacteroides.s__Bacteroides_dorei	0.9578544061
+UniRef90_A6L3E7	2.9342723005
+UniRef90_A6L3E7|g__Bacteroides.s__Bacteroides_vulgatus	2.9342723005
+UniRef90_R9H546	2.9342723005
+UniRef90_R9H546|g__Bacteroides.s__Bacteroides_vulgatus	2.9342723005
+UniRef90_I8UPN7	2.9239766082
+UniRef90_I8UPN7|g__Bacteroides.s__Bacteroides_vulgatus	2.9239766082
+UniRef90_A6L084	2.9239766082
+UniRef90_A6L084|g__Bacteroides.s__Bacteroides_dorei	2.3391812865
+UniRef90_A6L084|g__Bacteroides.s__Bacteroides_vulgatus	0.5847953216
+UniRef90_A6L685	2.9239766082
+UniRef90_A6L685|g__Bacteroides.s__Bacteroides_vulgatus	2.9239766082
+UniRef90_C6Z4Q9	2.9239766082
+UniRef90_C6Z4Q9|g__Bacteroides.s__Bacteroides_vulgatus	2.9239766082
+UniRef90_F0R8Y5	2.9239766082
+UniRef90_F0R8Y5|g__Bacteroides.s__Bacteroides_vulgatus	2.9239766082
+UniRef90_I9FG24	2.9239766082
+UniRef90_I9FG24|g__Bacteroides.s__Bacteroides_dorei	2.9239766082
+UniRef90_I9QCZ5	2.9239766082
+UniRef90_I9QCZ5|g__Bacteroides.s__Bacteroides_dorei	2.9239766082
+UniRef90_R6IHK8	2.9239766082
+UniRef90_R6IHK8|g__Bacteroides.s__Bacteroides_dorei	1.4619883041
+UniRef90_R6IHK8|g__Bacteroides.s__Bacteroides_vulgatus	1.4619883041
+UniRef90_R7EL02	2.9239766082
+UniRef90_R7EL02|g__Bacteroides.s__Bacteroides_dorei	2.9239766082
+UniRef90_R9HFF9	2.9239766082
+UniRef90_R9HFF9|g__Bacteroides.s__Bacteroides_vulgatus	2.9239766082
+UniRef90_A6L5B7	2.9154518950
+UniRef90_A6L5B7|g__Bacteroides.s__Bacteroides_vulgatus	2.9154518950
+UniRef90_A6L7C9	2.9112081514
+UniRef90_A6L7C9|g__Bacteroides.s__Bacteroides_vulgatus	2.9112081514
+UniRef90_R9HFQ5	2.9112081514
+UniRef90_R9HFQ5|g__Bacteroides.s__Bacteroides_vulgatus	2.9112081514
+UniRef90_D4V6D4	2.9086678301
+UniRef90_D4V6D4|g__Bacteroides.s__Bacteroides_dorei	1.7452006981
+UniRef90_D4V6D4|g__Bacteroides.s__Bacteroides_vulgatus	1.1634671321
+UniRef90_A6L711	2.9080369007
+UniRef90_A6L711|g__Bacteroides.s__Bacteroides_dorei	1.4556040757
+UniRef90_A6L711|g__Bacteroides.s__Bacteroides_vulgatus	1.4524328250
+UniRef90_R6HJM5	2.9069767442
+UniRef90_R6HJM5|g__Bacteroides.s__Bacteroides_dorei	1.9379844961
+UniRef90_R6HJM5|g__Bacteroides.s__Bacteroides_vulgatus	0.9689922481
+UniRef90_R9H4X6	2.9069767442
+UniRef90_R9H4X6|g__Bacteroides.s__Bacteroides_vulgatus	2.9069767442
+UniRef90_R6K3Z5	2.9048656500
+UniRef90_R6K3Z5|g__Bacteroides.s__Bacteroides_vulgatus	2.9048656500
+UniRef90_A6KWD5	2.8985507246
+UniRef90_A6KWD5|g__Bacteroides.s__Bacteroides_dorei	2.8985507246
+UniRef90_A6L6B9	2.8985507246
+UniRef90_A6L6B9|g__Bacteroides.s__Bacteroides_dorei	2.8985507246
+UniRef90_R7P2I9	2.8985507246
+UniRef90_R7P2I9|g__Bacteroides.s__Bacteroides_vulgatus	2.8985507246
+UniRef90_R7NU34	2.8935185185
+UniRef90_R7NU34|g__Bacteroides.s__Bacteroides_dorei	2.8935185185
+UniRef90_A6KZ38	2.8922631960
+UniRef90_A6KZ38|g__Bacteroides.s__Bacteroides_dorei	1.4461315980
+UniRef90_A6KZ38|g__Bacteroides.s__Bacteroides_vulgatus	1.4461315980
+UniRef90_A6L105	2.8901734104
+UniRef90_A6L105|g__Bacteroides.s__Bacteroides_vulgatus	2.8901734104
+UniRef90_R9HFE8	2.8901734104
+UniRef90_R9HFE8|g__Bacteroides.s__Bacteroides_vulgatus	2.8901734104
+UniRef90_A6KXG0	2.8860028860
+UniRef90_A6KXG0|g__Bacteroides.s__Bacteroides_dorei	2.8860028860
+UniRef90_D4V4X3	2.8860028860
+UniRef90_D4V4X3|g__Bacteroides.s__Bacteroides_dorei	1.4430014430
+UniRef90_D4V4X3|g__Bacteroides.s__Bacteroides_vulgatus	1.4430014430
+UniRef90_R6HJR7	2.8860028860
+UniRef90_R6HJR7|g__Bacteroides.s__Bacteroides_dorei	1.4430014430
+UniRef90_R6HJR7|g__Bacteroides.s__Bacteroides_vulgatus	1.4430014430
+UniRef90_R6HTB2	2.8860028860
+UniRef90_R6HTB2|g__Bacteroides.s__Bacteroides_vulgatus	2.8860028860
+UniRef90_R6HTW0	2.8860028860
+UniRef90_R6HTW0|g__Bacteroides.s__Bacteroides_dorei	1.4430014430
+UniRef90_R6HTW0|g__Bacteroides.s__Bacteroides_vulgatus	1.4430014430
+UniRef90_R6HLZ6	2.8785261946
+UniRef90_R6HLZ6|g__Bacteroides.s__Bacteroides_dorei	1.7271157168
+UniRef90_R6HLZ6|g__Bacteroides.s__Bacteroides_vulgatus	1.1514104778
+UniRef90_R9H503	2.8776978417
+UniRef90_R9H503|g__Bacteroides.s__Bacteroides_vulgatus	2.8776978417
+UniRef90_A0A015UAM4	2.8735632184
+UniRef90_A0A015UAM4|g__Bacteroides.s__Bacteroides_dorei	2.8735632184
+UniRef90_G1UMX9	2.8735632184
+UniRef90_G1UMX9|g__Bacteroides.s__Bacteroides_dorei	2.8735632184
+UniRef90_I8VW75	2.8735632184
+UniRef90_I8VW75|g__Bacteroides.s__Bacteroides_dorei	2.8735632184
+UniRef90_I8WD85	2.8735632184
+UniRef90_I8WD85|g__Bacteroides.s__Bacteroides_dorei	2.8735632184
+UniRef90_I9PKH4	2.8735632184
+UniRef90_I9PKH4|g__Bacteroides.s__Bacteroides_dorei	2.8735632184
+UniRef90_I9RF79	2.8735632184
+UniRef90_I9RF79|g__Bacteroides.s__Bacteroides_dorei	2.8735632184
+UniRef90_Q64SE0	2.8735632184
+UniRef90_Q64SE0|g__Bacteroides.s__Bacteroides_dorei	2.8735632184
+UniRef90_R7P0V1	2.8735632184
+UniRef90_R7P0V1|g__Bacteroides.s__Bacteroides_dorei	1.4367816092
+UniRef90_R7P0V1|g__Bacteroides.s__Bacteroides_vulgatus	1.4367816092
+UniRef90_R9HR79	2.8735632184
+UniRef90_R9HR79|g__Bacteroides.s__Bacteroides_vulgatus	2.8735632184
+UniRef90_R7NLZ2	2.8735632184
+UniRef90_R7NLZ2|g__Bacteroides.s__Bacteroides_dorei	2.8735632184
+UniRef90_R9H4U6	2.8735632184
+UniRef90_R9H4U6|g__Bacteroides.s__Bacteroides_vulgatus	2.8735632184
+UniRef90_R6HTG3	2.8623277298
+UniRef90_R6HTG3|g__Bacteroides.s__Bacteroides_dorei	2.2484541877
+UniRef90_R6HTG3|g__Bacteroides.s__Bacteroides_vulgatus	0.6138735421
+UniRef90_A6KYH4	2.8612303290
+UniRef90_A6KYH4|g__Bacteroides.s__Bacteroides_vulgatus	2.8612303290
+UniRef90_D4VAS1	2.8612303290
+UniRef90_D4VAS1|g__Bacteroides.s__Bacteroides_vulgatus	2.8612303290
+UniRef90_A6L677	2.8571428571
+UniRef90_A6L677|g__Bacteroides.s__Bacteroides_vulgatus	2.8571428571
+UniRef90_A6KYM3	2.8551034975
+UniRef90_A6KYM3|g__Bacteroides.s__Bacteroides_vulgatus	2.1413276231
+UniRef90_A6KYM3|g__Bacteroides.s__Bacteroides_dorei	0.7137758744
+UniRef90_A6L7C3	2.8538812785
+UniRef90_A6L7C3|g__Bacteroides.s__Bacteroides_vulgatus	2.8538812785
+UniRef90_A6L431	2.8490028490
+UniRef90_A6L431|g__Bacteroides.s__Bacteroides_dorei	1.4245014245
+UniRef90_A6L431|g__Bacteroides.s__Bacteroides_vulgatus	1.4245014245
+UniRef90_C3Q2P2	2.8490028490
+UniRef90_C3Q2P2|g__Bacteroides.s__Bacteroides_dorei	1.4245014245
+UniRef90_C3Q2P2|g__Bacteroides.s__Bacteroides_vulgatus	1.4245014245
+UniRef90_R7NRM4	2.8490028490
+UniRef90_R7NRM4|g__Bacteroides.s__Bacteroides_vulgatus	2.8490028490
+UniRef90_R7NYS5	2.8490028490
+UniRef90_R7NYS5|g__Bacteroides.s__Bacteroides_dorei	2.8490028490
+UniRef90_C6ZBQ5	2.8409090909
+UniRef90_C6ZBQ5|g__Bacteroides.s__Bacteroides_dorei	2.8409090909
+UniRef90_R6RX94	2.8409090909
+UniRef90_R6RX94|g__Bacteroides.s__Bacteroides_dorei	2.8409090909
+UniRef90_R6HSC5	2.8399295915
+UniRef90_R6HSC5|g__Bacteroides.s__Bacteroides_vulgatus	1.4245014245
+UniRef90_R6HSC5|g__Bacteroides.s__Bacteroides_dorei	1.4154281670
+UniRef90_A6LE58	2.8368794326
+UniRef90_A6LE58|g__Bacteroides.s__Bacteroides_dorei	2.8368794326
+UniRef90_R7P2T4	2.8368794326
+UniRef90_R7P2T4|g__Bacteroides.s__Bacteroides_dorei	1.4184397163
+UniRef90_R7P2T4|g__Bacteroides.s__Bacteroides_vulgatus	1.4184397163
+UniRef90_A6KXS0	2.8319763993
+UniRef90_A6KXS0|g__Bacteroides.s__Bacteroides_dorei	1.9212295869
+UniRef90_A6KXS0|g__Bacteroides.s__Bacteroides_vulgatus	0.9107468124
+UniRef90_A6L1A3	2.8308563340
+UniRef90_A6L1A3|g__Bacteroides.s__Bacteroides_vulgatus	2.8308563340
+UniRef90_A6KZN7	2.8248587571
+UniRef90_A6KZN7|g__Bacteroides.s__Bacteroides_dorei	2.8248587571
+UniRef90_A6L0X7	2.8248587571
+UniRef90_A6L0X7|g__Bacteroides.s__Bacteroides_dorei	1.4124293785
+UniRef90_A6L0X7|g__Bacteroides.s__Bacteroides_vulgatus	1.4124293785
+UniRef90_C3Q7Y6	2.8248587571
+UniRef90_C3Q7Y6|g__Bacteroides.s__Bacteroides_vulgatus	2.8248587571
+UniRef90_C3R692	2.8248587571
+UniRef90_C3R692|g__Bacteroides.s__Bacteroides_dorei	2.8248587571
+UniRef90_D4V992	2.8248587571
+UniRef90_D4V992|g__Bacteroides.s__Bacteroides_dorei	1.4124293785
+UniRef90_D4V992|g__Bacteroides.s__Bacteroides_vulgatus	1.4124293785
+UniRef90_R9HCG5	2.8248587571
+UniRef90_R9HCG5|g__Bacteroides.s__Bacteroides_vulgatus	2.8248587571
+UniRef90_E5UWJ6	2.8169014085
+UniRef90_E5UWJ6|g__Bacteroides.s__Bacteroides_vulgatus	2.8169014085
+UniRef90_R6DH93	2.8129395218
+UniRef90_R6DH93|g__Bacteroides.s__Bacteroides_vulgatus	2.8129395218
+UniRef90_I9QU15	2.8070175439
+UniRef90_I9QU15|g__Bacteroides.s__Bacteroides_dorei	2.8070175439
+UniRef90_A6KZL3	2.8011204482
+UniRef90_A6KZL3|g__Bacteroides.s__Bacteroides_vulgatus	2.8011204482
+UniRef90_A6L623	2.8011204482
+UniRef90_A6L623|g__Bacteroides.s__Bacteroides_vulgatus	2.8011204482
+UniRef90_C6IR52	2.8011204482
+UniRef90_C6IR52|g__Bacteroides.s__Bacteroides_vulgatus	2.8011204482
+UniRef90_D4V6C7	2.8011204482
+UniRef90_D4V6C7|g__Bacteroides.s__Bacteroides_vulgatus	2.8011204482
+UniRef90_G1ULR2	2.8011204482
+UniRef90_G1ULR2|g__Bacteroides.s__Bacteroides_dorei	2.8011204482
+UniRef90_I9R6Y6	2.8011204482
+UniRef90_I9R6Y6|g__Bacteroides.s__Bacteroides_dorei	2.8011204482
+UniRef90_R6HJ63	2.8011204482
+UniRef90_R6HJ63|g__Bacteroides.s__Bacteroides_vulgatus	2.8011204482
+UniRef90_R6IH63	2.8011204482
+UniRef90_R6IH63|g__Bacteroides.s__Bacteroides_dorei	2.8011204482
+UniRef90_A6KXV6	2.7964205817
+UniRef90_A6KXV6|g__Bacteroides.s__Bacteroides_dorei	2.7964205817
+UniRef90_C3QUB8	2.7894002789
+UniRef90_C3QUB8|g__Bacteroides.s__Bacteroides_dorei	2.7894002789
+UniRef90_D4V4X2	2.7894002789
+UniRef90_D4V4X2|g__Bacteroides.s__Bacteroides_dorei	1.3947001395
+UniRef90_D4V4X2|g__Bacteroides.s__Bacteroides_vulgatus	1.3947001395
+UniRef90_R6HT16	2.7894002789
+UniRef90_R6HT16|g__Bacteroides.s__Bacteroides_dorei	2.7894002789
+UniRef90_R6HV73	2.7894002789
+UniRef90_R6HV73|g__Bacteroides.s__Bacteroides_dorei	2.7894002789
+UniRef90_R6HVB2	2.7894002789
+UniRef90_R6HVB2|g__Bacteroides.s__Bacteroides_dorei	2.7894002789
+UniRef90_R6HWS2	2.7894002789
+UniRef90_R6HWS2|g__Bacteroides.s__Bacteroides_dorei	2.7894002789
+UniRef90_A6L227	2.7835768963
+UniRef90_A6L227|g__Bacteroides.s__Bacteroides_dorei	1.3917884482
+UniRef90_A6L227|g__Bacteroides.s__Bacteroides_vulgatus	1.3917884482
+UniRef90_R6ILU6	2.7835768963
+UniRef90_R6ILU6|g__Bacteroides.s__Bacteroides_vulgatus	2.0876826722
+UniRef90_R6ILU6|g__Bacteroides.s__Bacteroides_dorei	0.6958942241
+UniRef90_A6KYG4	2.7777777778
+UniRef90_A6KYG4|g__Bacteroides.s__Bacteroides_dorei	2.7777777778
+UniRef90_A6L779	2.7777777778
+UniRef90_A6L779|g__Bacteroides.s__Bacteroides_dorei	1.3888888889
+UniRef90_A6L779|g__Bacteroides.s__Bacteroides_vulgatus	1.3888888889
+UniRef90_A6L7D3	2.7777777778
+UniRef90_A6L7D3|g__Bacteroides.s__Bacteroides_vulgatus	2.7777777778
+UniRef90_G5SN04	2.7777777778
+UniRef90_G5SN04|g__Bacteroides.s__Bacteroides_dorei	2.7777777778
+UniRef90_I9SPP1	2.7777777778
+UniRef90_I9SPP1|g__Bacteroides.s__Bacteroides_dorei	2.7777777778
+UniRef90_R7P027	2.7777777778
+UniRef90_R7P027|g__Bacteroides.s__Bacteroides_vulgatus	2.7777777778
+UniRef90_R9HMI6	2.7777777778
+UniRef90_R9HMI6|g__Bacteroides.s__Bacteroides_vulgatus	2.7777777778
+UniRef90_R9I826	2.7777777778
+UniRef90_R9I826|g__Bacteroides.s__Bacteroides_dorei	2.7777777778
+UniRef90_R6HLJ1	2.7721228761
+UniRef90_R6HLJ1|g__Bacteroides.s__Bacteroides_dorei	2.7721228761
+UniRef90_I8VIY7	2.7720027720
+UniRef90_I8VIY7|g__Bacteroides.s__Bacteroides_vulgatus	2.0790020790
+UniRef90_I8VIY7|g__Bacteroides.s__Bacteroides_dorei	0.6930006930
+UniRef90_R5C195	2.7720027720
+UniRef90_R5C195|g__Bacteroides.s__Bacteroides_dorei	2.7720027720
+UniRef90_A6KZF2	2.7700831025
+UniRef90_A6KZF2|g__Bacteroides.s__Bacteroides_vulgatus	2.7700831025
+UniRef90_A6L0S1	2.7700831025
+UniRef90_A6L0S1|g__Bacteroides.s__Bacteroides_dorei	2.7700831025
+UniRef90_A6KZM9	2.7662517289
+UniRef90_A6KZM9|g__Bacteroides.s__Bacteroides_dorei	1.3831258645
+UniRef90_A6KZM9|g__Bacteroides.s__Bacteroides_vulgatus	1.3831258645
+UniRef90_I8W5Z5	2.7662517289
+UniRef90_I8W5Z5|g__Bacteroides.s__Bacteroides_dorei	2.7662517289
+UniRef90_Q5L8B2	2.7662517289
+UniRef90_Q5L8B2|g__Bacteroides.s__Bacteroides_dorei	2.7662517289
+UniRef90_R6HP54	2.7662517289
+UniRef90_R6HP54|g__Bacteroides.s__Bacteroides_dorei	2.7662517289
+UniRef90_R7NY84	2.7662517289
+UniRef90_R7NY84|g__Bacteroides.s__Bacteroides_dorei	2.7662517289
+UniRef90_C3R8B6	2.7639579878
+UniRef90_C3R8B6|g__Bacteroides.s__Bacteroides_dorei	2.7639579878
+UniRef90_R6HJZ8	2.7624309392
+UniRef90_R6HJZ8|g__Bacteroides.s__Bacteroides_dorei	2.7624309392
+UniRef90_R6HNP3	2.7624309392
+UniRef90_R6HNP3|g__Bacteroides.s__Bacteroides_vulgatus	2.7624309392
+UniRef90_A6L6Y3	2.7548209366
+UniRef90_A6L6Y3|g__Bacteroides.s__Bacteroides_vulgatus	2.7548209366
+UniRef90_E5UU15	2.7548209366
+UniRef90_E5UU15|g__Bacteroides.s__Bacteroides_dorei	2.7548209366
+UniRef90_R6HR72	2.7548209366
+UniRef90_R6HR72|g__Bacteroides.s__Bacteroides_dorei	1.3774104683
+UniRef90_R6HR72|g__Bacteroides.s__Bacteroides_vulgatus	1.3774104683
+UniRef90_R6HS30	2.7548209366
+UniRef90_R6HS30|g__Bacteroides.s__Bacteroides_vulgatus	2.7548209366
+UniRef90_A6L534	2.7548209366
+UniRef90_A6L534|g__Bacteroides.s__Bacteroides_dorei	2.7548209366
+UniRef90_R7P2U4	2.7548209366
+UniRef90_R7P2U4|g__Bacteroides.s__Bacteroides_vulgatus	2.7548209366
+UniRef90_R7NV25	2.7472527473
+UniRef90_R7NV25|g__Bacteroides.s__Bacteroides_vulgatus	2.7472527473
+UniRef90_A6L030	2.7463096464
+UniRef90_A6L030|g__Bacteroides.s__Bacteroides_vulgatus	2.7463096464
+UniRef90_A0A016NLU2	2.7434842250
+UniRef90_A0A016NLU2|g__Bacteroides.s__Bacteroides_dorei	2.7434842250
+UniRef90_C3REE8	2.7434842250
+UniRef90_C3REE8|g__Bacteroides.s__Bacteroides_dorei	1.3717421125
+UniRef90_C3REE8|g__Bacteroides.s__Bacteroides_vulgatus	1.3717421125
+UniRef90_R6HLJ5	2.7434842250
+UniRef90_R6HLJ5|g__Bacteroides.s__Bacteroides_dorei	1.3717421125
+UniRef90_R6HLJ5|g__Bacteroides.s__Bacteroides_vulgatus	1.3717421125
+UniRef90_R9HC01	2.7434842250
+UniRef90_R9HC01|g__Bacteroides.s__Bacteroides_vulgatus	2.7434842250
+UniRef90_A6KYR6	2.7322404372
+UniRef90_A6KYR6|g__Bacteroides.s__Bacteroides_vulgatus	2.7322404372
+UniRef90_A6L3N1	2.7322404372
+UniRef90_A6L3N1|g__Bacteroides.s__Bacteroides_dorei	2.7322404372
+UniRef90_A6L6V5	2.7322404372
+UniRef90_A6L6V5|g__Bacteroides.s__Bacteroides_dorei	2.7322404372
+UniRef90_C3R6T8	2.7322404372
+UniRef90_C3R6T8|g__Bacteroides.s__Bacteroides_vulgatus	2.7322404372
+UniRef90_E5UQ53	2.7322404372
+UniRef90_E5UQ53|g__Bacteroides.s__Bacteroides_dorei	2.7322404372
+UniRef90_E5X0B7	2.7322404372
+UniRef90_E5X0B7|g__Bacteroides.s__Bacteroides_dorei	2.7322404372
+UniRef90_R6HJD0	2.7322404372
+UniRef90_R6HJD0|g__Bacteroides.s__Bacteroides_dorei	2.7322404372
+UniRef90_R6J7M6	2.7322404372
+UniRef90_R6J7M6|g__Bacteroides.s__Bacteroides_dorei	2.7322404372
+UniRef90_R7NXB6	2.7322404372
+UniRef90_R7NXB6|g__Bacteroides.s__Bacteroides_vulgatus	2.7322404372
+UniRef90_R7P4K1	2.7322404372
+UniRef90_R7P4K1|g__Bacteroides.s__Bacteroides_dorei	2.7322404372
+UniRef90_R9HMK5	2.7322404372
+UniRef90_R9HMK5|g__Bacteroides.s__Bacteroides_vulgatus	2.7322404372
+UniRef90_R6IM48	2.7266530334
+UniRef90_R6IM48|g__Bacteroides.s__Bacteroides_dorei	1.3633265167
+UniRef90_R6IM48|g__Bacteroides.s__Bacteroides_vulgatus	1.3633265167
+UniRef90_R7NXX3	2.7233115468
+UniRef90_R7NXX3|g__Bacteroides.s__Bacteroides_dorei	2.7233115468
+UniRef90_E5CBU2	2.7210884354
+UniRef90_E5CBU2|g__Bacteroides.s__Bacteroides_vulgatus	2.0408163265
+UniRef90_E5CBU2|g__Bacteroides.s__Bacteroides_dorei	0.6802721088
+UniRef90_R6HM19	2.7210884354
+UniRef90_R6HM19|g__Bacteroides.s__Bacteroides_dorei	2.7210884354
+UniRef90_R7DWY8	2.7210884354
+UniRef90_R7DWY8|g__Bacteroides.s__Bacteroides_dorei	2.0408163265
+UniRef90_R7DWY8|g__Bacteroides.s__Bacteroides_vulgatus	0.6802721088
+UniRef90_R9HPB1	2.7210884354
+UniRef90_R9HPB1|g__Bacteroides.s__Bacteroides_vulgatus	2.7210884354
+UniRef90_A6L4G5	2.7173913043
+UniRef90_A6L4G5|g__Bacteroides.s__Bacteroides_dorei	1.8115942029
+UniRef90_A6L4G5|g__Bacteroides.s__Bacteroides_vulgatus	0.9057971014
+UniRef90_C3Q4C5	2.7173913043
+UniRef90_C3Q4C5|g__Bacteroides.s__Bacteroides_dorei	2.7173913043
+UniRef90_R6HXZ3	2.7137042062
+UniRef90_R6HXZ3|g__Bacteroides.s__Bacteroides_dorei	1.8091361375
+UniRef90_R6HXZ3|g__Bacteroides.s__Bacteroides_vulgatus	0.9045680687
+UniRef90_A6L306	2.7100271003
+UniRef90_A6L306|g__Bacteroides.s__Bacteroides_vulgatus	2.7100271003
+UniRef90_A6L5U6	2.7100271003
+UniRef90_A6L5U6|g__Bacteroides.s__Bacteroides_dorei	2.7100271003
+UniRef90_C3QUB3	2.7100271003
+UniRef90_C3QUB3|g__Bacteroides.s__Bacteroides_dorei	2.7100271003
+UniRef90_R6HPZ2	2.7100271003
+UniRef90_R6HPZ2|g__Bacteroides.s__Bacteroides_vulgatus	2.7100271003
+UniRef90_R6HTP4	2.7100271003
+UniRef90_R6HTP4|g__Bacteroides.s__Bacteroides_vulgatus	2.7100271003
+UniRef90_R9H4S5	2.7100271003
+UniRef90_R9H4S5|g__Bacteroides.s__Bacteroides_vulgatus	2.7100271003
+UniRef90_A6L7I3	2.7035150570
+UniRef90_A6L7I3|g__Bacteroides.s__Bacteroides_dorei	2.7035150570
+UniRef90_R6HPC9	2.6997633608
+UniRef90_R6HPC9|g__Bacteroides.s__Bacteroides_dorei	2.6997633608
+UniRef90_D4V3W6	2.6990553306
+UniRef90_D4V3W6|g__Bacteroides.s__Bacteroides_vulgatus	2.6990553306
+UniRef90_A6L4J7	2.6881720430
+UniRef90_A6L4J7|g__Bacteroides.s__Bacteroides_vulgatus	2.6881720430
+UniRef90_A6L5D7	2.6881720430
+UniRef90_A6L5D7|g__Bacteroides.s__Bacteroides_dorei	2.6881720430
+UniRef90_A6L7E5	2.6881720430
+UniRef90_A6L7E5|g__Bacteroides.s__Bacteroides_vulgatus	2.6881720430
+UniRef90_I8VW09	2.6881720430
+UniRef90_I8VW09|g__Bacteroides.s__Bacteroides_dorei	2.6881720430
+UniRef90_I9QHH1	2.6881720430
+UniRef90_I9QHH1|g__Bacteroides.s__Bacteroides_dorei	2.6881720430
+UniRef90_R6IKQ5	2.6881720430
+UniRef90_R6IKQ5|g__Bacteroides.s__Bacteroides_vulgatus	2.6881720430
+UniRef90_R9H4I0	2.6881720430
+UniRef90_R9H4I0|g__Bacteroides.s__Bacteroides_vulgatus	2.6881720430
+UniRef90_R9HLK4	2.6881720430
+UniRef90_R9HLK4|g__Bacteroides.s__Bacteroides_vulgatus	2.6881720430
+UniRef90_R6HVH0	2.6827632461
+UniRef90_R6HVH0|g__Bacteroides.s__Bacteroides_dorei	2.6827632461
+UniRef90_R7NYU3	2.6809651475
+UniRef90_R7NYU3|g__Bacteroides.s__Bacteroides_dorei	1.7873100983
+UniRef90_R7NYU3|g__Bacteroides.s__Bacteroides_vulgatus	0.8936550492
+UniRef90_A6KXD2	2.6773761714
+UniRef90_A6KXD2|g__Bacteroides.s__Bacteroides_dorei	2.6773761714
+UniRef90_I8VWF6	2.6773761714
+UniRef90_I8VWF6|g__Bacteroides.s__Bacteroides_dorei	2.6773761714
+UniRef90_R5U4C5	2.6773761714
+UniRef90_R5U4C5|g__Bacteroides.s__Bacteroides_dorei	2.6773761714
+UniRef90_R6HTI6	2.6773761714
+UniRef90_R6HTI6|g__Bacteroides.s__Bacteroides_dorei	2.0080321285
+UniRef90_R6HTI6|g__Bacteroides.s__Bacteroides_vulgatus	0.6693440428
+UniRef90_R6HV37	2.6773761714
+UniRef90_R6HV37|g__Bacteroides.s__Bacteroides_dorei	2.6773761714
+UniRef90_I8W1G8	2.6702269693
+UniRef90_I8W1G8|g__Bacteroides.s__Bacteroides_dorei	2.6702269693
+UniRef90_K5YBR4	2.6666666667
+UniRef90_K5YBR4|g__Bacteroides.s__Bacteroides_dorei	2.6666666667
+UniRef90_A6L1D5	2.6666666667
+UniRef90_A6L1D5|g__Bacteroides.s__Bacteroides_vulgatus	2.6666666667
+UniRef90_A6L433	2.6666666667
+UniRef90_A6L433|g__Bacteroides.s__Bacteroides_vulgatus	1.7777777778
+UniRef90_A6L433|g__Bacteroides.s__Bacteroides_dorei	0.8888888889
+UniRef90_A6L5W9	2.6666666667
+UniRef90_A6L5W9|g__Bacteroides.s__Bacteroides_vulgatus	2.6666666667
+UniRef90_C3R540	2.6666666667
+UniRef90_C3R540|g__Bacteroides.s__Bacteroides_dorei	2.6666666667
+UniRef90_C3R6S8	2.6666666667
+UniRef90_C3R6S8|g__Bacteroides.s__Bacteroides_vulgatus	2.6666666667
+UniRef90_Q64S79	2.6666666667
+UniRef90_Q64S79|g__Bacteroides.s__Bacteroides_dorei	2.6666666667
+UniRef90_R7NZY4	2.6666666667
+UniRef90_R7NZY4|g__Bacteroides.s__Bacteroides_vulgatus	2.6666666667
+UniRef90_R9H3N8	2.6581605529
+UniRef90_R9H3N8|g__Bacteroides.s__Bacteroides_vulgatus	2.6581605529
+UniRef90_A0A015P8Y2	2.6560424967
+UniRef90_A0A015P8Y2|g__Bacteroides.s__Bacteroides_dorei	2.6560424967
+UniRef90_R6HWT9	2.6560424967
+UniRef90_R6HWT9|g__Bacteroides.s__Bacteroides_dorei	1.3280212483
+UniRef90_R6HWT9|g__Bacteroides.s__Bacteroides_vulgatus	1.3280212483
+UniRef90_R9HQP2	2.6507620941
+UniRef90_R9HQP2|g__Bacteroides.s__Bacteroides_vulgatus	2.6507620941
+UniRef90_A6L1Q6	2.6455026455
+UniRef90_A6L1Q6|g__Bacteroides.s__Bacteroides_vulgatus	2.6455026455
+UniRef90_A6L5E1	2.6455026455
+UniRef90_A6L5E1|g__Bacteroides.s__Bacteroides_vulgatus	2.6455026455
+UniRef90_A6L7I5	2.6455026455
+UniRef90_A6L7I5|g__Bacteroides.s__Bacteroides_vulgatus	2.6455026455
+UniRef90_R5JE14	2.6455026455
+UniRef90_R5JE14|g__Bacteroides.s__Bacteroides_dorei	2.6455026455
+UniRef90_R6HHC9	2.6455026455
+UniRef90_R6HHC9|g__Bacteroides.s__Bacteroides_dorei	1.3227513228
+UniRef90_R6HHC9|g__Bacteroides.s__Bacteroides_vulgatus	1.3227513228
+UniRef90_R6IM38	2.6455026455
+UniRef90_R6IM38|g__Bacteroides.s__Bacteroides_vulgatus	2.6455026455
+UniRef90_R6HPZ7	2.6392187912
+UniRef90_R6HPZ7|g__Bacteroides.s__Bacteroides_vulgatus	2.6392187912
+UniRef90_A6L0P9	2.6385224274
+UniRef90_A6L0P9|g__Bacteroides.s__Bacteroides_dorei	2.6385224274
+UniRef90_Q650C5	2.6385224274
+UniRef90_Q650C5|g__Bacteroides.s__Bacteroides_dorei	2.6385224274
+UniRef90_R7P1D3	2.6385224274
+UniRef90_R7P1D3|g__Bacteroides.s__Bacteroides_dorei	2.6385224274
+UniRef90_A6KXR3	2.6350461133
+UniRef90_A6KXR3|g__Bacteroides.s__Bacteroides_dorei	2.6350461133
+UniRef90_I8WRN9	2.6350461133
+UniRef90_I8WRN9|g__Bacteroides.s__Bacteroides_dorei	2.6350461133
+UniRef90_R6HQW8	2.6350461133
+UniRef90_R6HQW8|g__Bacteroides.s__Bacteroides_dorei	2.6350461133
+UniRef90_R6HVV9	2.6350461133
+UniRef90_R6HVV9|g__Bacteroides.s__Bacteroides_dorei	2.6350461133
+UniRef90_A6KYQ4	2.6315789474
+UniRef90_A6KYQ4|g__Bacteroides.s__Bacteroides_dorei	1.7543859649
+UniRef90_A6KYQ4|g__Bacteroides.s__Bacteroides_vulgatus	0.8771929825
+UniRef90_A6L1U3	2.6298487837
+UniRef90_A6L1U3|g__Bacteroides.s__Bacteroides_dorei	1.3149243918
+UniRef90_A6L1U3|g__Bacteroides.s__Bacteroides_vulgatus	1.3149243918
+UniRef90_A6L406	2.6298487837
+UniRef90_A6L406|g__Bacteroides.s__Bacteroides_dorei	1.9723865878
+UniRef90_A6L406|g__Bacteroides.s__Bacteroides_vulgatus	0.6574621959
+UniRef90_A6L4I9	2.6298487837
+UniRef90_A6L4I9|g__Bacteroides.s__Bacteroides_vulgatus	2.6298487837
+UniRef90_R6II35	2.6298487837
+UniRef90_R6II35|g__Bacteroides.s__Bacteroides_dorei	2.6298487837
+UniRef90_R6IIV9	2.6298487837
+UniRef90_R6IIV9|g__Bacteroides.s__Bacteroides_dorei	2.6298487837
+UniRef90_R9H2W8	2.6298487837
+UniRef90_R9H2W8|g__Bacteroides.s__Bacteroides_vulgatus	2.6298487837
+UniRef90_A0A015X9A0	2.6246719160
+UniRef90_A0A015X9A0|g__Bacteroides.s__Bacteroides_dorei	2.6246719160
+UniRef90_A6L2I4	2.6246719160
+UniRef90_A6L2I4|g__Bacteroides.s__Bacteroides_dorei	1.3123359580
+UniRef90_A6L2I4|g__Bacteroides.s__Bacteroides_vulgatus	1.3123359580
+UniRef90_C3RCI5	2.6246719160
+UniRef90_C3RCI5|g__Bacteroides.s__Bacteroides_vulgatus	1.9685039370
+UniRef90_C3RCI5|g__Bacteroides.s__Bacteroides_dorei	0.6561679790
+UniRef90_I9R5I5	2.6246719160
+UniRef90_I9R5I5|g__Bacteroides.s__Bacteroides_dorei	2.6246719160
+UniRef90_R6HH13	2.6246719160
+UniRef90_R6HH13|g__Bacteroides.s__Bacteroides_dorei	2.6246719160
+UniRef90_R6HIT1	2.6246719160
+UniRef90_R6HIT1|g__Bacteroides.s__Bacteroides_dorei	2.6246719160
+UniRef90_R7P373	2.6246719160
+UniRef90_R7P373|g__Bacteroides.s__Bacteroides_vulgatus	2.6246719160
+UniRef90_R9HQF4	2.6246719160
+UniRef90_R9HQF4|g__Bacteroides.s__Bacteroides_vulgatus	2.6246719160
+UniRef90_A6L045	2.6195153897
+UniRef90_A6L045|g__Bacteroides.s__Bacteroides_vulgatus	2.6195153897
+UniRef90_R6IEI5	2.6195153897
+UniRef90_R6IEI5|g__Bacteroides.s__Bacteroides_dorei	2.6195153897
+UniRef90_R6IIG2	2.6178010471
+UniRef90_R6IIG2|g__Bacteroides.s__Bacteroides_dorei	1.7452006981
+UniRef90_R6IIG2|g__Bacteroides.s__Bacteroides_vulgatus	0.8726003490
+UniRef90_I9F8X4	2.6164311879
+UniRef90_I9F8X4|g__Bacteroides.s__Bacteroides_dorei	2.6164311879
+UniRef90_A6L797	2.6143790850
+UniRef90_A6L797|g__Bacteroides.s__Bacteroides_vulgatus	2.6143790850
+UniRef90_I9EZQ2	2.6143790850
+UniRef90_I9EZQ2|g__Bacteroides.s__Bacteroides_dorei	2.6143790850
+UniRef90_R6HUK1	2.6143790850
+UniRef90_R6HUK1|g__Bacteroides.s__Bacteroides_dorei	2.6143790850
+UniRef90_R6IF98	2.6143790850
+UniRef90_R6IF98|g__Bacteroides.s__Bacteroides_dorei	2.6143790850
+UniRef90_R6HXN4	2.6082420449
+UniRef90_R6HXN4|g__Bacteroides.s__Bacteroides_dorei	2.6082420449
+UniRef90_R6HUG2	2.6067122841
+UniRef90_R6HUG2|g__Bacteroides.s__Bacteroides_dorei	2.6067122841
+UniRef90_A6L3Z9	2.6041666667
+UniRef90_A6L3Z9|g__Bacteroides.s__Bacteroides_vulgatus	2.6041666667
+UniRef90_D4VC33	2.6041666667
+UniRef90_D4VC33|g__Bacteroides.s__Bacteroides_vulgatus	2.6041666667
+UniRef90_A6KWI4	2.6041666667
+UniRef90_A6KWI4|g__Bacteroides.s__Bacteroides_dorei	1.3020833333
+UniRef90_A6KWI4|g__Bacteroides.s__Bacteroides_vulgatus	1.3020833333
+UniRef90_A6KZJ5	2.6041666667
+UniRef90_A6KZJ5|g__Bacteroides.s__Bacteroides_dorei	2.6041666667
+UniRef90_A6L0A0	2.6041666667
+UniRef90_A6L0A0|g__Bacteroides.s__Bacteroides_vulgatus	2.6041666667
+UniRef90_E5X0E0	2.6041666667
+UniRef90_E5X0E0|g__Bacteroides.s__Bacteroides_dorei	2.6041666667
+UniRef90_Q64WN1	2.6041666667
+UniRef90_Q64WN1|g__Bacteroides.s__Bacteroides_dorei	2.6041666667
+UniRef90_R6I015	2.6041666667
+UniRef90_R6I015|g__Bacteroides.s__Bacteroides_dorei	2.6041666667
+UniRef90_R7P1C9	2.6041666667
+UniRef90_R7P1C9|g__Bacteroides.s__Bacteroides_dorei	2.6041666667
+UniRef90_R9HCL0	2.6041666667
+UniRef90_R9HCL0|g__Bacteroides.s__Bacteroides_vulgatus	2.6041666667
+UniRef90_A6L208	2.6001040042
+UniRef90_A6L208|g__Bacteroides.s__Bacteroides_vulgatus	2.6001040042
+UniRef90_I9Q7F0	2.5990903184
+UniRef90_I9Q7F0|g__Bacteroides.s__Bacteroides_dorei	2.5990903184
+UniRef90_A6KZJ6	2.5940337224
+UniRef90_A6KZJ6|g__Bacteroides.s__Bacteroides_dorei	1.2970168612
+UniRef90_A6KZJ6|g__Bacteroides.s__Bacteroides_vulgatus	1.2970168612
+UniRef90_A6L5G7	2.5940337224
+UniRef90_A6L5G7|g__Bacteroides.s__Bacteroides_dorei	2.5940337224
+UniRef90_I9R867	2.5940337224
+UniRef90_I9R867|g__Bacteroides.s__Bacteroides_dorei	2.5940337224
+UniRef90_R6IK15	2.5940337224
+UniRef90_R6IK15|g__Bacteroides.s__Bacteroides_dorei	2.5940337224
+UniRef90_A6KZA2	2.5920165889
+UniRef90_A6KZA2|g__Bacteroides.s__Bacteroides_dorei	1.5552099533
+UniRef90_A6KZA2|g__Bacteroides.s__Bacteroides_vulgatus	1.0368066356
+UniRef90_C3Q1B5	2.5906735751
+UniRef90_C3Q1B5|g__Bacteroides.s__Bacteroides_vulgatus	1.7271157168
+UniRef90_C3Q1B5|g__Bacteroides.s__Bacteroides_dorei	0.8635578584
+UniRef90_D7J6Y0	2.5906735751
+UniRef90_D7J6Y0|g__Bacteroides.s__Bacteroides_vulgatus	2.5906735751
+UniRef90_I9R3Q9	2.5906735751
+UniRef90_I9R3Q9|g__Bacteroides.s__Bacteroides_dorei	2.5906735751
+UniRef90_I8WGL4	2.5839793282
+UniRef90_I8WGL4|g__Bacteroides.s__Bacteroides_dorei	2.5839793282
+UniRef90_Q64SC1	2.5839793282
+UniRef90_Q64SC1|g__Bacteroides.s__Bacteroides_dorei	2.5839793282
+UniRef90_R6HK17	2.5839793282
+UniRef90_R6HK17|g__Bacteroides.s__Bacteroides_dorei	2.5839793282
+UniRef90_R9HVI9	2.5839793282
+UniRef90_R9HVI9|g__Bacteroides.s__Bacteroides_vulgatus	2.5839793282
+UniRef90_A6L3H3	2.5751115469
+UniRef90_A6L3H3|g__Bacteroides.s__Bacteroides_vulgatus	1.3717421125
+UniRef90_A6L3H3|g__Bacteroides.s__Bacteroides_dorei	1.2033694344
+UniRef90_R7NTV8	2.5740025740
+UniRef90_R7NTV8|g__Bacteroides.s__Bacteroides_vulgatus	2.5740025740
+UniRef90_D1K6W0	2.5718111171
+UniRef90_D1K6W0|g__Bacteroides.s__Bacteroides_vulgatus	1.7115960633
+UniRef90_D1K6W0|g__Bacteroides.s__Bacteroides_dorei	0.8602150538
+UniRef90_A6L0F0	2.5641025641
+UniRef90_A6L0F0|g__Bacteroides.s__Bacteroides_vulgatus	2.5641025641
+UniRef90_C3R4F4	2.5641025641
+UniRef90_C3R4F4|g__Bacteroides.s__Bacteroides_dorei	2.5641025641
+UniRef90_I9G2K9	2.5641025641
+UniRef90_I9G2K9|g__Bacteroides.s__Bacteroides_dorei	2.5641025641
+UniRef90_A6L7A8	2.5575447570
+UniRef90_A6L7A8|g__Bacteroides.s__Bacteroides_dorei	1.7050298380
+UniRef90_A6L7A8|g__Bacteroides.s__Bacteroides_vulgatus	0.8525149190
+UniRef90_A6KY05	2.5549342564
+UniRef90_A6KY05|g__Bacteroides.s__Bacteroides_dorei	1.7497812773
+UniRef90_A6KY05|g__Bacteroides.s__Bacteroides_vulgatus	0.8051529791
+UniRef90_A6L096	2.5542784163
+UniRef90_A6L096|g__Bacteroides.s__Bacteroides_vulgatus	1.9157088123
+UniRef90_A6L096|g__Bacteroides.s__Bacteroides_dorei	0.6385696041
+UniRef90_A6L1U8	2.5542784163
+UniRef90_A6L1U8|g__Bacteroides.s__Bacteroides_vulgatus	2.5542784163
+UniRef90_A6LIP6	2.5542784163
+UniRef90_A6LIP6|g__Bacteroides.s__Bacteroides_dorei	1.2771392082
+UniRef90_A6LIP6|g__Bacteroides.s__Bacteroides_vulgatus	1.2771392082
+UniRef90_R6HL70	2.5542784163
+UniRef90_R6HL70|g__Bacteroides.s__Bacteroides_dorei	2.5542784163
+UniRef90_A6KXH5	2.5493945188
+UniRef90_A6KXH5|g__Bacteroides.s__Bacteroides_vulgatus	2.5493945188
+UniRef90_I8VWG3	2.5449341840
+UniRef90_I8VWG3|g__Bacteroides.s__Bacteroides_dorei	2.5449341840
+UniRef90_I9RKM0	2.5445292621
+UniRef90_I9RKM0|g__Bacteroides.s__Bacteroides_dorei	2.5445292621
+UniRef90_I9U9E7	2.5445292621
+UniRef90_I9U9E7|g__Bacteroides.s__Bacteroides_vulgatus	2.5445292621
+UniRef90_R6HJL8	2.5445292621
+UniRef90_R6HJL8|g__Bacteroides.s__Bacteroides_vulgatus	2.5445292621
+UniRef90_R7P497	2.5402134098
+UniRef90_R7P497|g__Bacteroides.s__Bacteroides_vulgatus	2.1739130435
+UniRef90_R7P497|g__Bacteroides.s__Bacteroides_dorei	0.3663003663
+UniRef90_A6L313	2.5396825397
+UniRef90_A6L313|g__Bacteroides.s__Bacteroides_vulgatus	2.5396825397
+UniRef90_A6L2V7	2.5380710660
+UniRef90_A6L2V7|g__Bacteroides.s__Bacteroides_vulgatus	2.5380710660
+UniRef90_R6I126	2.5380710660
+UniRef90_R6I126|g__Bacteroides.s__Bacteroides_dorei	2.5380710660
+UniRef90_I9RCZ2	2.5348542459
+UniRef90_I9RCZ2|g__Bacteroides.s__Bacteroides_dorei	2.5348542459
+UniRef90_A6LIN1	2.5348542459
+UniRef90_A6LIN1|g__Bacteroides.s__Bacteroides_dorei	2.5348542459
+UniRef90_I8UPV9	2.5348542459
+UniRef90_I8UPV9|g__Bacteroides.s__Bacteroides_vulgatus	2.5348542459
+UniRef90_I9F741	2.5348542459
+UniRef90_I9F741|g__Bacteroides.s__Bacteroides_dorei	2.5348542459
+UniRef90_R6HL67	2.5348542459
+UniRef90_R6HL67|g__Bacteroides.s__Bacteroides_vulgatus	2.5348542459
+UniRef90_R7DKA9	2.5348542459
+UniRef90_R7DKA9|g__Bacteroides.s__Bacteroides_vulgatus	2.5348542459
+UniRef90_R6HF38	2.5316455696
+UniRef90_R6HF38|g__Bacteroides.s__Bacteroides_vulgatus	2.5316455696
+UniRef90_A6KXK9	2.5290844714
+UniRef90_A6KXK9|g__Bacteroides.s__Bacteroides_dorei	1.5174506829
+UniRef90_A6KXK9|g__Bacteroides.s__Bacteroides_vulgatus	1.0116337886
+UniRef90_A6L4L0	2.5252525253
+UniRef90_A6L4L0|g__Bacteroides.s__Bacteroides_vulgatus	1.6835016835
+UniRef90_A6L4L0|g__Bacteroides.s__Bacteroides_dorei	0.8417508418
+UniRef90_A6L0F3	2.5252525253
+UniRef90_A6L0F3|g__Bacteroides.s__Bacteroides_dorei	2.5252525253
+UniRef90_A6L0U6	2.5252525253
+UniRef90_A6L0U6|g__Bacteroides.s__Bacteroides_vulgatus	2.5252525253
+UniRef90_A6L0V7	2.5252525253
+UniRef90_A6L0V7|g__Bacteroides.s__Bacteroides_vulgatus	2.5252525253
+UniRef90_A6L527	2.5252525253
+UniRef90_A6L527|g__Bacteroides.s__Bacteroides_vulgatus	2.5252525253
+UniRef90_D1K7L8	2.5252525253
+UniRef90_D1K7L8|g__Bacteroides.s__Bacteroides_dorei	2.5252525253
+UniRef90_Q8ABY3	2.5252525253
+UniRef90_Q8ABY3|g__Bacteroides.s__Bacteroides_dorei	2.5252525253
+UniRef90_R9HLA0	2.5252525253
+UniRef90_R9HLA0|g__Bacteroides.s__Bacteroides_vulgatus	2.5252525253
+UniRef90_A0A016B3G9	2.5157232704
+UniRef90_A0A016B3G9|g__Bacteroides.s__Bacteroides_dorei	2.5157232704
+UniRef90_A6KXM0	2.5157232704
+UniRef90_A6KXM0|g__Bacteroides.s__Bacteroides_dorei	2.5157232704
+UniRef90_A6KZ95	2.5157232704
+UniRef90_A6KZ95|g__Bacteroides.s__Bacteroides_dorei	1.2578616352
+UniRef90_A6KZ95|g__Bacteroides.s__Bacteroides_vulgatus	1.2578616352
+UniRef90_A6L6U6	2.5157232704
+UniRef90_A6L6U6|g__Bacteroides.s__Bacteroides_dorei	2.5157232704
+UniRef90_C3RF92	2.5157232704
+UniRef90_C3RF92|g__Bacteroides.s__Bacteroides_vulgatus	2.5157232704
+UniRef90_R6HIK5	2.5157232704
+UniRef90_R6HIK5|g__Bacteroides.s__Bacteroides_vulgatus	2.5157232704
+UniRef90_R6HVI1	2.5157232704
+UniRef90_R6HVI1|g__Bacteroides.s__Bacteroides_dorei	1.8867924528
+UniRef90_R6HVI1|g__Bacteroides.s__Bacteroides_vulgatus	0.6289308176
+UniRef90_R6HWK3	2.5141430423
+UniRef90_R6HWK3|g__Bacteroides.s__Bacteroides_vulgatus	1.2578616352
+UniRef90_R6HWK3|g__Bacteroides.s__Bacteroides_dorei	1.2562814070
+UniRef90_A6KZL1	2.5125628141
+UniRef90_A6KZL1|g__Bacteroides.s__Bacteroides_vulgatus	2.5125628141
+UniRef90_Q64SA4	2.5109855618
+UniRef90_Q64SA4|g__Bacteroides.s__Bacteroides_dorei	2.5109855618
+UniRef90_A6L1P0	2.5089605735
+UniRef90_A6L1P0|g__Bacteroides.s__Bacteroides_dorei	1.9713261649
+UniRef90_A6L1P0|g__Bacteroides.s__Bacteroides_vulgatus	0.5376344086
+UniRef90_A6KZY0	2.5062656642
+UniRef90_A6KZY0|g__Bacteroides.s__Bacteroides_dorei	2.5062656642
+UniRef90_A6L723	2.5062656642
+UniRef90_A6L723|g__Bacteroides.s__Bacteroides_dorei	1.2531328321
+UniRef90_A6L723|g__Bacteroides.s__Bacteroides_vulgatus	1.2531328321
+UniRef90_G1UL93	2.5062656642
+UniRef90_G1UL93|g__Bacteroides.s__Bacteroides_dorei	2.5062656642
+UniRef90_J9F6T1	2.5062656642
+UniRef90_J9F6T1|g__Bacteroides.s__Bacteroides_dorei	2.5062656642
+UniRef90_R6HL05	2.5062656642
+UniRef90_R6HL05|g__Bacteroides.s__Bacteroides_dorei	2.5062656642
+UniRef90_R6HL32	2.5062656642
+UniRef90_R6HL32|g__Bacteroides.s__Bacteroides_dorei	2.5062656642
+UniRef90_R6HVG0	2.5062656642
+UniRef90_R6HVG0|g__Bacteroides.s__Bacteroides_dorei	1.2531328321
+UniRef90_R6HVG0|g__Bacteroides.s__Bacteroides_vulgatus	1.2531328321
+UniRef90_R6HW81	2.5062656642
+UniRef90_R6HW81|g__Bacteroides.s__Bacteroides_dorei	2.5062656642
+UniRef90_R6HMK8	2.5015634772
+UniRef90_R6HMK8|g__Bacteroides.s__Bacteroides_dorei	2.5015634772
+UniRef90_E5X0D0	2.5000000000
+UniRef90_E5X0D0|g__Bacteroides.s__Bacteroides_dorei	2.5000000000
+UniRef90_C6ZB06	2.4968789014
+UniRef90_C6ZB06|g__Bacteroides.s__Bacteroides_dorei	2.4968789014
+UniRef90_R5W667	2.4968789014
+UniRef90_R5W667|g__Bacteroides.s__Bacteroides_dorei	2.4968789014
+UniRef90_A6KX11	2.4937655860
+UniRef90_A6KX11|g__Bacteroides.s__Bacteroides_dorei	1.6625103907
+UniRef90_A6KX11|g__Bacteroides.s__Bacteroides_vulgatus	0.8312551953
+UniRef90_A6L0G7	2.4875621891
+UniRef90_A6L0G7|g__Bacteroides.s__Bacteroides_vulgatus	2.4875621891
+UniRef90_A6L3B3	2.4875621891
+UniRef90_A6L3B3|g__Bacteroides.s__Bacteroides_vulgatus	2.4875621891
+UniRef90_A6L594	2.4875621891
+UniRef90_A6L594|g__Bacteroides.s__Bacteroides_vulgatus	2.4875621891
+UniRef90_A6L5D2	2.4875621891
+UniRef90_A6L5D2|g__Bacteroides.s__Bacteroides_dorei	1.8656716418
+UniRef90_A6L5D2|g__Bacteroides.s__Bacteroides_vulgatus	0.6218905473
+UniRef90_E1WS02	2.4875621891
+UniRef90_E1WS02|g__Bacteroides.s__Bacteroides_dorei	2.4875621891
+UniRef90_F0R8Z9	2.4875621891
+UniRef90_F0R8Z9|g__Bacteroides.s__Bacteroides_dorei	1.2437810945
+UniRef90_F0R8Z9|g__Bacteroides.s__Bacteroides_vulgatus	1.2437810945
+UniRef90_Q64S71	2.4875621891
+UniRef90_Q64S71|g__Bacteroides.s__Bacteroides_dorei	2.4875621891
+UniRef90_R7NV48	2.4875621891
+UniRef90_R7NV48|g__Bacteroides.s__Bacteroides_dorei	2.4875621891
+UniRef90_R7P0E2	2.4875621891
+UniRef90_R7P0E2|g__Bacteroides.s__Bacteroides_vulgatus	2.4875621891
+UniRef90_R7P193	2.4875621891
+UniRef90_R7P193|g__Bacteroides.s__Bacteroides_vulgatus	1.6583747927
+UniRef90_R7P193|g__Bacteroides.s__Bacteroides_dorei	0.8291873964
+UniRef90_R9HQX7	2.4875621891
+UniRef90_R9HQX7|g__Bacteroides.s__Bacteroides_vulgatus	2.4875621891
+UniRef90_A6KZ04	2.4857071837
+UniRef90_A6KZ04|g__Bacteroides.s__Bacteroides_dorei	2.4857071837
+UniRef90_R9HLC6	2.4829298572
+UniRef90_R9HLC6|g__Bacteroides.s__Bacteroides_vulgatus	2.4829298572
+UniRef90_D4VEF4	2.4794813435
+UniRef90_D4VEF4|g__Bacteroides.s__Bacteroides_dorei	1.8621973929
+UniRef90_D4VEF4|g__Bacteroides.s__Bacteroides_vulgatus	0.6172839506
+UniRef90_D1K0P0	2.4783147460
+UniRef90_D1K0P0|g__Bacteroides.s__Bacteroides_dorei	2.4783147460
+UniRef90_R6HFW0	2.4783147460
+UniRef90_R6HFW0|g__Bacteroides.s__Bacteroides_dorei	2.4783147460
+UniRef90_C3R904	2.4764735017
+UniRef90_C3R904|g__Bacteroides.s__Bacteroides_dorei	2.4764735017
+UniRef90_E1WRZ6	2.4752475248
+UniRef90_E1WRZ6|g__Bacteroides.s__Bacteroides_dorei	2.4752475248
+UniRef90_A6L582	2.4691358025
+UniRef90_A6L582|g__Bacteroides.s__Bacteroides_vulgatus	2.4691358025
+UniRef90_C3R8N5	2.4691358025
+UniRef90_C3R8N5|g__Bacteroides.s__Bacteroides_dorei	2.4691358025
+UniRef90_D4V9L7	2.4691358025
+UniRef90_D4V9L7|g__Bacteroides.s__Bacteroides_vulgatus	2.4691358025
+UniRef90_I9BJN0	2.4691358025
+UniRef90_I9BJN0|g__Bacteroides.s__Bacteroides_vulgatus	2.4691358025
+UniRef90_R6HJ83	2.4691358025
+UniRef90_R6HJ83|g__Bacteroides.s__Bacteroides_dorei	2.4691358025
+UniRef90_R6HMV6	2.4691358025
+UniRef90_R6HMV6|g__Bacteroides.s__Bacteroides_vulgatus	2.4691358025
+UniRef90_R7P099	2.4691358025
+UniRef90_R7P099|g__Bacteroides.s__Bacteroides_vulgatus	2.4691358025
+UniRef90_A6KXZ7	2.4657198273
+UniRef90_A6KXZ7|g__Bacteroides.s__Bacteroides_dorei	2.2156573117
+UniRef90_A6KXZ7|g__Bacteroides.s__Bacteroides_vulgatus	0.2500625156
+UniRef90_R7NZ11	2.4645717807
+UniRef90_R7NZ11|g__Bacteroides.s__Bacteroides_dorei	2.4645717807
+UniRef90_R9H1S4	2.4645717807
+UniRef90_R9H1S4|g__Bacteroides.s__Bacteroides_vulgatus	2.4645717807
+UniRef90_R6HMY8	2.4630541872
+UniRef90_R6HMY8|g__Bacteroides.s__Bacteroides_dorei	1.6420361248
+UniRef90_R6HMY8|g__Bacteroides.s__Bacteroides_vulgatus	0.8210180624
+UniRef90_R6HWK7	2.4622960911
+UniRef90_R6HWK7|g__Bacteroides.s__Bacteroides_vulgatus	1.5389350569
+UniRef90_R6HWK7|g__Bacteroides.s__Bacteroides_dorei	0.9233610342
+UniRef90_A6KZ94	2.4600246002
+UniRef90_A6KZ94|g__Bacteroides.s__Bacteroides_dorei	2.4600246002
+UniRef90_A6L5H1	2.4600246002
+UniRef90_A6L5H1|g__Bacteroides.s__Bacteroides_dorei	1.2300123001
+UniRef90_A6L5H1|g__Bacteroides.s__Bacteroides_vulgatus	1.2300123001
+UniRef90_C3Q1W2	2.4600246002
+UniRef90_C3Q1W2|g__Bacteroides.s__Bacteroides_vulgatus	2.4600246002
+UniRef90_I9A3I5	2.4600246002
+UniRef90_I9A3I5|g__Bacteroides.s__Bacteroides_vulgatus	2.4600246002
+UniRef90_I9R4E9	2.4509803922
+UniRef90_I9R4E9|g__Bacteroides.s__Bacteroides_dorei	2.4509803922
+UniRef90_Q9F5V2	2.4509803922
+UniRef90_Q9F5V2|g__Bacteroides.s__Bacteroides_vulgatus	2.4509803922
+UniRef90_R6HTP7	2.4509803922
+UniRef90_R6HTP7|g__Bacteroides.s__Bacteroides_dorei	2.4509803922
+UniRef90_R7NWH5	2.4509803922
+UniRef90_R7NWH5|g__Bacteroides.s__Bacteroides_dorei	1.2254901961
+UniRef90_R7NWH5|g__Bacteroides.s__Bacteroides_vulgatus	1.2254901961
+UniRef90_A6KZE3	2.4473813020
+UniRef90_A6KZE3|g__Bacteroides.s__Bacteroides_vulgatus	2.4473813020
+UniRef90_A6L1Z3	2.4420024420
+UniRef90_A6L1Z3|g__Bacteroides.s__Bacteroides_dorei	2.4420024420
+UniRef90_A6L7A7	2.4420024420
+UniRef90_A6L7A7|g__Bacteroides.s__Bacteroides_dorei	1.2210012210
+UniRef90_A6L7A7|g__Bacteroides.s__Bacteroides_vulgatus	1.2210012210
+UniRef90_I9B8V7	2.4420024420
+UniRef90_I9B8V7|g__Bacteroides.s__Bacteroides_dorei	2.4420024420
+UniRef90_A6L4Y3	2.4390243902
+UniRef90_A6L4Y3|g__Bacteroides.s__Bacteroides_dorei	1.6260162602
+UniRef90_A6L4Y3|g__Bacteroides.s__Bacteroides_vulgatus	0.8130081301
+UniRef90_A6L6V6	2.4330900243
+UniRef90_A6L6V6|g__Bacteroides.s__Bacteroides_vulgatus	2.4330900243
+UniRef90_C3QUG3	2.4330900243
+UniRef90_C3QUG3|g__Bacteroides.s__Bacteroides_dorei	2.4330900243
+UniRef90_K6BLD5	2.4330900243
+UniRef90_K6BLD5|g__Bacteroides.s__Bacteroides_vulgatus	2.4330900243
+UniRef90_Q8ABX0	2.4330900243
+UniRef90_Q8ABX0|g__Bacteroides.s__Bacteroides_dorei	2.4330900243
+UniRef90_A6KXD5	2.4301336574
+UniRef90_A6KXD5|g__Bacteroides.s__Bacteroides_dorei	1.6200891049
+UniRef90_A6KXD5|g__Bacteroides.s__Bacteroides_vulgatus	0.8100445525
+UniRef90_A6KZ98	2.4245309635
+UniRef90_A6KZ98|g__Bacteroides.s__Bacteroides_dorei	1.2254901961
+UniRef90_A6KZ98|g__Bacteroides.s__Bacteroides_vulgatus	1.1990407674
+UniRef90_A6L5J6	2.4242424242
+UniRef90_A6L5J6|g__Bacteroides.s__Bacteroides_vulgatus	2.4242424242
+UniRef90_C3PZ16	2.4242424242
+UniRef90_C3PZ16|g__Bacteroides.s__Bacteroides_dorei	2.4242424242
+UniRef90_I9QUY8	2.4242424242
+UniRef90_I9QUY8|g__Bacteroides.s__Bacteroides_dorei	2.4242424242
+UniRef90_I9R2R4	2.4242424242
+UniRef90_I9R2R4|g__Bacteroides.s__Bacteroides_dorei	2.4242424242
+UniRef90_A6L728	2.4213075061
+UniRef90_A6L728|g__Bacteroides.s__Bacteroides_dorei	1.6142050040
+UniRef90_A6L728|g__Bacteroides.s__Bacteroides_vulgatus	0.8071025020
+UniRef90_I9R6K8	2.4213075061
+UniRef90_I9R6K8|g__Bacteroides.s__Bacteroides_dorei	2.4213075061
+UniRef90_R5RQN3	2.4198427102
+UniRef90_R5RQN3|g__Bacteroides.s__Bacteroides_vulgatus	2.4198427102
+UniRef90_E5X3V4	2.4154589372
+UniRef90_E5X3V4|g__Bacteroides.s__Bacteroides_vulgatus	2.4154589372
+UniRef90_Q64SG8	2.4154589372
+UniRef90_Q64SG8|g__Bacteroides.s__Bacteroides_dorei	2.4154589372
+UniRef90_R6HLR0	2.4154589372
+UniRef90_R6HLR0|g__Bacteroides.s__Bacteroides_vulgatus	2.4154589372
+UniRef90_R7NYT8	2.4154589372
+UniRef90_R7NYT8|g__Bacteroides.s__Bacteroides_dorei	2.4154589372
+UniRef90_R9HMP9	2.4154589372
+UniRef90_R9HMP9|g__Bacteroides.s__Bacteroides_vulgatus	2.4154589372
+UniRef90_U6RSC0	2.4154589372
+UniRef90_U6RSC0|g__Bacteroides.s__Bacteroides_dorei	2.4154589372
+UniRef90_R9HNH2	2.4096385542
+UniRef90_R9HNH2|g__Bacteroides.s__Bacteroides_vulgatus	2.4096385542
+UniRef90_A6L383	2.4067388688
+UniRef90_A6L383|g__Bacteroides.s__Bacteroides_vulgatus	2.4067388688
+UniRef90_D7J6V8	2.4067388688
+UniRef90_D7J6V8|g__Bacteroides.s__Bacteroides_dorei	2.4067388688
+UniRef90_I9B0I1	2.4067388688
+UniRef90_I9B0I1|g__Bacteroides.s__Bacteroides_dorei	2.4067388688
+UniRef90_I9QZK0	2.4067388688
+UniRef90_I9QZK0|g__Bacteroides.s__Bacteroides_dorei	2.4067388688
+UniRef90_R7P1C1	2.4067388688
+UniRef90_R7P1C1|g__Bacteroides.s__Bacteroides_vulgatus	2.4067388688
+UniRef90_R7P0Z2	2.4050024050
+UniRef90_R7P0Z2|g__Bacteroides.s__Bacteroides_vulgatus	1.9240019240
+UniRef90_R7P0Z2|g__Bacteroides.s__Bacteroides_dorei	0.4810004810
+UniRef90_R5K610	2.4038461538
+UniRef90_R5K610|g__Bacteroides.s__Bacteroides_vulgatus	1.6025641026
+UniRef90_R5K610|g__Bacteroides.s__Bacteroides_dorei	0.8012820513
+UniRef90_E5UQN9	2.3980815348
+UniRef90_E5UQN9|g__Bacteroides.s__Bacteroides_dorei	2.3980815348
+UniRef90_I9PJN5	2.3980815348
+UniRef90_I9PJN5|g__Bacteroides.s__Bacteroides_dorei	2.3980815348
+UniRef90_I9QQW0	2.3980815348
+UniRef90_I9QQW0|g__Bacteroides.s__Bacteroides_dorei	2.3980815348
+UniRef90_K5XZ06	2.3980815348
+UniRef90_K5XZ06|g__Bacteroides.s__Bacteroides_vulgatus	2.3980815348
+UniRef90_R6HEY2	2.3980815348
+UniRef90_R6HEY2|g__Bacteroides.s__Bacteroides_dorei	2.3980815348
+UniRef90_R7NZW3	2.3980815348
+UniRef90_R7NZW3|g__Bacteroides.s__Bacteroides_dorei	2.3980815348
+UniRef90_R9HD80	2.3980815348
+UniRef90_R9HD80|g__Bacteroides.s__Bacteroides_vulgatus	2.3980815348
+UniRef90_R9HXJ5	2.3980815348
+UniRef90_R9HXJ5|g__Bacteroides.s__Bacteroides_vulgatus	2.3980815348
+UniRef90_R9ID01	2.3980815348
+UniRef90_R9ID01|g__Bacteroides.s__Bacteroides_dorei	2.3980815348
+UniRef90_Q8A8P1	2.3902539324
+UniRef90_Q8A8P1|g__Bacteroides.s__Bacteroides_vulgatus	1.2165450122
+UniRef90_Q8A8P1|g__Bacteroides.s__Bacteroides_dorei	1.1737089202
+UniRef90_D1K116	2.3894862605
+UniRef90_D1K116|g__Bacteroides.s__Bacteroides_dorei	2.3894862605
+UniRef90_R7NYH7	2.3894862605
+UniRef90_R7NYH7|g__Bacteroides.s__Bacteroides_dorei	2.3894862605
+UniRef90_R9H0X8	2.3894862605
+UniRef90_R9H0X8|g__Bacteroides.s__Bacteroides_vulgatus	2.3894862605
+UniRef90_R6IJY1	2.3885471254
+UniRef90_R6IJY1|g__Bacteroides.s__Bacteroides_vulgatus	1.5948963317
+UniRef90_R6IJY1|g__Bacteroides.s__Bacteroides_dorei	0.7936507937
+UniRef90_R9HSX6	2.3866348449
+UniRef90_R9HSX6|g__Bacteroides.s__Bacteroides_vulgatus	2.3866348449
+UniRef90_A6KXF5	2.3809523810
+UniRef90_A6KXF5|g__Bacteroides.s__Bacteroides_vulgatus	2.3809523810
+UniRef90_A6KZP9	2.3809523810
+UniRef90_A6KZP9|g__Bacteroides.s__Bacteroides_dorei	2.3809523810
+UniRef90_A6L0W6	2.3809523810
+UniRef90_A6L0W6|g__Bacteroides.s__Bacteroides_vulgatus	2.3809523810
+UniRef90_A6L4N2	2.3809523810
+UniRef90_A6L4N2|g__Bacteroides.s__Bacteroides_dorei	1.5873015873
+UniRef90_A6L4N2|g__Bacteroides.s__Bacteroides_vulgatus	0.7936507937
+UniRef90_R6DE23	2.3809523810
+UniRef90_R6DE23|g__Bacteroides.s__Bacteroides_vulgatus	2.3809523810
+UniRef90_R6I1F1	2.3809523810
+UniRef90_R6I1F1|g__Bacteroides.s__Bacteroides_vulgatus	2.3809523810
+UniRef90_R6HQL1	2.3767082591
+UniRef90_R6HQL1|g__Bacteroides.s__Bacteroides_dorei	2.3767082591
+UniRef90_R7NWC5	2.3767082591
+UniRef90_R7NWC5|g__Bacteroides.s__Bacteroides_dorei	1.1883541295
+UniRef90_R7NWC5|g__Bacteroides.s__Bacteroides_vulgatus	1.1883541295
+UniRef90_A6KYQ9	2.3724792408
+UniRef90_A6KYQ9|g__Bacteroides.s__Bacteroides_vulgatus	2.3724792408
+UniRef90_A6L2M3	2.3724792408
+UniRef90_A6L2M3|g__Bacteroides.s__Bacteroides_vulgatus	2.3724792408
+UniRef90_Q64SD9	2.3724792408
+UniRef90_Q64SD9|g__Bacteroides.s__Bacteroides_dorei	2.3724792408
+UniRef90_R6HHV7	2.3724792408
+UniRef90_R6HHV7|g__Bacteroides.s__Bacteroides_dorei	2.3724792408
+UniRef90_R9H4W1	2.3724792408
+UniRef90_R9H4W1|g__Bacteroides.s__Bacteroides_vulgatus	2.3724792408
+UniRef90_R9HEI0	2.3724792408
+UniRef90_R9HEI0|g__Bacteroides.s__Bacteroides_vulgatus	2.3724792408
+UniRef90_R9IBV8	2.3707918445
+UniRef90_R9IBV8|g__Bacteroides.s__Bacteroides_vulgatus	2.3707918445
+UniRef90_C3R6T5	2.3682652457
+UniRef90_C3R6T5|g__Bacteroides.s__Bacteroides_dorei	1.1841326229
+UniRef90_C3R6T5|g__Bacteroides.s__Bacteroides_vulgatus	1.1841326229
+UniRef90_A6L581	2.3640661939
+UniRef90_A6L581|g__Bacteroides.s__Bacteroides_vulgatus	2.3640661939
+UniRef90_A6L5Z8	2.3640661939
+UniRef90_A6L5Z8|g__Bacteroides.s__Bacteroides_vulgatus	2.3640661939
+UniRef90_I9QJZ3	2.3640661939
+UniRef90_I9QJZ3|g__Bacteroides.s__Bacteroides_dorei	2.3640661939
+UniRef90_Q64S97	2.3640661939
+UniRef90_Q64S97|g__Bacteroides.s__Bacteroides_dorei	2.3640661939
+UniRef90_R6HG74	2.3640661939
+UniRef90_R6HG74|g__Bacteroides.s__Bacteroides_dorei	2.3640661939
+UniRef90_R6HHK7	2.3640661939
+UniRef90_R6HHK7|g__Bacteroides.s__Bacteroides_dorei	2.3640661939
+UniRef90_I9R3Q4	2.3619722468
+UniRef90_I9R3Q4|g__Bacteroides.s__Bacteroides_dorei	2.3619722468
+UniRef90_A7V2X1	2.3598820059
+UniRef90_A7V2X1|g__Bacteroides.s__Bacteroides_dorei	2.3598820059
+UniRef90_C3RBP1	2.3529411765
+UniRef90_C3RBP1|g__Bacteroides.s__Bacteroides_dorei	2.3529411765
+UniRef90_I9RE88	2.3515579071
+UniRef90_I9RE88|g__Bacteroides.s__Bacteroides_dorei	2.3515579071
+UniRef90_A6KXF6	2.3474178404
+UniRef90_A6KXF6|g__Bacteroides.s__Bacteroides_vulgatus	2.3474178404
+UniRef90_A6L219	2.3474178404
+UniRef90_A6L219|g__Bacteroides.s__Bacteroides_dorei	1.1737089202
+UniRef90_A6L219|g__Bacteroides.s__Bacteroides_vulgatus	1.1737089202
+UniRef90_A6L3J4	2.3474178404
+UniRef90_A6L3J4|g__Bacteroides.s__Bacteroides_vulgatus	2.3474178404
+UniRef90_A6L6U3	2.3474178404
+UniRef90_A6L6U3|g__Bacteroides.s__Bacteroides_dorei	2.3474178404
+UniRef90_D4VBY4	2.3474178404
+UniRef90_D4VBY4|g__Bacteroides.s__Bacteroides_vulgatus	2.3474178404
+UniRef90_A6KWW2	2.3391812865
+UniRef90_A6KWW2|g__Bacteroides.s__Bacteroides_vulgatus	2.3391812865
+UniRef90_A6KWW5	2.3391812865
+UniRef90_A6KWW5|g__Bacteroides.s__Bacteroides_vulgatus	2.3391812865
+UniRef90_A6L1E2	2.3391812865
+UniRef90_A6L1E2|g__Bacteroides.s__Bacteroides_dorei	2.3391812865
+UniRef90_A6L1N2	2.3391812865
+UniRef90_A6L1N2|g__Bacteroides.s__Bacteroides_dorei	1.7543859649
+UniRef90_A6L1N2|g__Bacteroides.s__Bacteroides_vulgatus	0.5847953216
+UniRef90_R6HI27	2.3328177534
+UniRef90_R6HI27|g__Bacteroides.s__Bacteroides_dorei	1.5540015540
+UniRef90_R6HI27|g__Bacteroides.s__Bacteroides_vulgatus	0.7788161994
+UniRef90_R6HZU8	2.3314583843
+UniRef90_R6HZU8|g__Bacteroides.s__Bacteroides_dorei	1.1820330969
+UniRef90_R6HZU8|g__Bacteroides.s__Bacteroides_vulgatus	1.1494252874
+UniRef90_A6L0B3	2.3310023310
+UniRef90_A6L0B3|g__Bacteroides.s__Bacteroides_vulgatus	2.3310023310
+UniRef90_D1K6P9	2.3310023310
+UniRef90_D1K6P9|g__Bacteroides.s__Bacteroides_dorei	2.3310023310
+UniRef90_F3PQQ1	2.3310023310
+UniRef90_F3PQQ1|g__Bacteroides.s__Bacteroides_vulgatus	2.3310023310
+UniRef90_R7NU50	2.3310023310
+UniRef90_R7NU50|g__Bacteroides.s__Bacteroides_vulgatus	2.3310023310
+UniRef90_R7P386	2.3255813953
+UniRef90_R7P386|g__Bacteroides.s__Bacteroides_vulgatus	2.3255813953
+UniRef90_I9U3T3	2.3228803717
+UniRef90_I9U3T3|g__Bacteroides.s__Bacteroides_dorei	2.3228803717
+UniRef90_R7P1F0	2.3228803717
+UniRef90_R7P1F0|g__Bacteroides.s__Bacteroides_dorei	2.3228803717
+UniRef90_E6SU34	2.3201856148
+UniRef90_E6SU34|g__Bacteroides.s__Bacteroides_dorei	1.5467904099
+UniRef90_E6SU34|g__Bacteroides.s__Bacteroides_vulgatus	0.7733952049
+UniRef90_A6KWS5	2.3148148148
+UniRef90_A6KWS5|g__Bacteroides.s__Bacteroides_dorei	2.3148148148
+UniRef90_C6Z9D8	2.3148148148
+UniRef90_C6Z9D8|g__Bacteroides.s__Bacteroides_dorei	2.3148148148
+UniRef90_I8UTY8	2.3148148148
+UniRef90_I8UTY8|g__Bacteroides.s__Bacteroides_dorei	2.3148148148
+UniRef90_R6IH20	2.3148148148
+UniRef90_R6IH20|g__Bacteroides.s__Bacteroides_dorei	2.3148148148
+UniRef90_R9I5T3	2.3148148148
+UniRef90_R9I5T3|g__Bacteroides.s__Bacteroides_vulgatus	2.3148148148
+UniRef90_R7P4T8	2.3094688222
+UniRef90_R7P4T8|g__Bacteroides.s__Bacteroides_vulgatus	2.3094688222
+UniRef90_R6IKM5	2.3041474654
+UniRef90_R6IKM5|g__Bacteroides.s__Bacteroides_dorei	1.5360983103
+UniRef90_R6IKM5|g__Bacteroides.s__Bacteroides_vulgatus	0.7680491551
+UniRef90_R7NYW3	2.3020257827
+UniRef90_R7NYW3|g__Bacteroides.s__Bacteroides_vulgatus	2.3020257827
+UniRef90_A6L2H6	2.2988505747
+UniRef90_A6L2H6|g__Bacteroides.s__Bacteroides_dorei	2.2988505747
+UniRef90_A6L3S2	2.2988505747
+UniRef90_A6L3S2|g__Bacteroides.s__Bacteroides_vulgatus	2.2988505747
+UniRef90_R7P310	2.2988505747
+UniRef90_R7P310|g__Bacteroides.s__Bacteroides_dorei	2.2988505747
+UniRef90_A6KWG4	2.2909507446
+UniRef90_A6KWG4|g__Bacteroides.s__Bacteroides_vulgatus	2.2909507446
+UniRef90_C3RCE6	2.2909507446
+UniRef90_C3RCE6|g__Bacteroides.s__Bacteroides_dorei	1.1454753723
+UniRef90_C3RCE6|g__Bacteroides.s__Bacteroides_vulgatus	1.1454753723
+UniRef90_A6KZH0	2.2831050228
+UniRef90_A6KZH0|g__Bacteroides.s__Bacteroides_vulgatus	2.2831050228
+UniRef90_A6KZN4	2.2831050228
+UniRef90_A6KZN4|g__Bacteroides.s__Bacteroides_dorei	1.1415525114
+UniRef90_A6KZN4|g__Bacteroides.s__Bacteroides_vulgatus	1.1415525114
+UniRef90_A6L2T3	2.2831050228
+UniRef90_A6L2T3|g__Bacteroides.s__Bacteroides_vulgatus	2.2831050228
+UniRef90_A6L7T7	2.2831050228
+UniRef90_A6L7T7|g__Bacteroides.s__Bacteroides_dorei	2.2831050228
+UniRef90_C3R6T0	2.2831050228
+UniRef90_C3R6T0|g__Bacteroides.s__Bacteroides_dorei	1.1415525114
+UniRef90_C3R6T0|g__Bacteroides.s__Bacteroides_vulgatus	1.1415525114
+UniRef90_I9G645	2.2831050228
+UniRef90_I9G645|g__Bacteroides.s__Bacteroides_dorei	1.1415525114
+UniRef90_I9G645|g__Bacteroides.s__Bacteroides_vulgatus	1.1415525114
+UniRef90_I9QRI0	2.2831050228
+UniRef90_I9QRI0|g__Bacteroides.s__Bacteroides_dorei	2.2831050228
+UniRef90_I9RC29	2.2831050228
+UniRef90_I9RC29|g__Bacteroides.s__Bacteroides_dorei	2.2831050228
+UniRef90_R6HQZ5	2.2831050228
+UniRef90_R6HQZ5|g__Bacteroides.s__Bacteroides_vulgatus	2.2831050228
+UniRef90_R6HTI9	2.2831050228
+UniRef90_R6HTI9|g__Bacteroides.s__Bacteroides_dorei	2.2831050228
+UniRef90_R6IEJ6	2.2831050228
+UniRef90_R6IEJ6|g__Bacteroides.s__Bacteroides_dorei	2.2831050228
+UniRef90_R7NVM4	2.2831050228
+UniRef90_R7NVM4|g__Bacteroides.s__Bacteroides_dorei	2.2831050228
+UniRef90_R7P593	2.2831050228
+UniRef90_R7P593|g__Bacteroides.s__Bacteroides_dorei	2.2831050228
+UniRef90_R9H480	2.2831050228
+UniRef90_R9H480|g__Bacteroides.s__Bacteroides_vulgatus	2.2831050228
+UniRef90_A6L412	2.2831050228
+UniRef90_A6L412|g__Bacteroides.s__Bacteroides_vulgatus	1.5220700152
+UniRef90_A6L412|g__Bacteroides.s__Bacteroides_dorei	0.7610350076
+UniRef90_R6HLS6	2.2727272727
+UniRef90_R6HLS6|g__Bacteroides.s__Bacteroides_vulgatus	1.5151515152
+UniRef90_R6HLS6|g__Bacteroides.s__Bacteroides_dorei	0.7575757576
+UniRef90_C3Q860	2.2714366837
+UniRef90_C3Q860|g__Bacteroides.s__Bacteroides_dorei	1.1357183419
+UniRef90_C3Q860|g__Bacteroides.s__Bacteroides_vulgatus	1.1357183419
+UniRef90_A6KYG7	2.2675736961
+UniRef90_A6KYG7|g__Bacteroides.s__Bacteroides_dorei	2.2675736961
+UniRef90_A6L1P4	2.2675736961
+UniRef90_A6L1P4|g__Bacteroides.s__Bacteroides_dorei	2.2675736961
+UniRef90_A6L1S9	2.2675736961
+UniRef90_A6L1S9|g__Bacteroides.s__Bacteroides_vulgatus	2.2675736961
+UniRef90_C3PZ19	2.2675736961
+UniRef90_C3PZ19|g__Bacteroides.s__Bacteroides_dorei	2.2675736961
+UniRef90_I8WD89	2.2675736961
+UniRef90_I8WD89|g__Bacteroides.s__Bacteroides_dorei	2.2675736961
+UniRef90_R7P1J7	2.2614201719
+UniRef90_R7P1J7|g__Bacteroides.s__Bacteroides_dorei	1.8091361375
+UniRef90_R7P1J7|g__Bacteroides.s__Bacteroides_vulgatus	0.4522840344
+UniRef90_A6KXH3	2.2598870056
+UniRef90_A6KXH3|g__Bacteroides.s__Bacteroides_dorei	1.6949152542
+UniRef90_A6KXH3|g__Bacteroides.s__Bacteroides_vulgatus	0.5649717514
+UniRef90_R6HG11	2.2598870056
+UniRef90_R6HG11|g__Bacteroides.s__Bacteroides_dorei	2.2598870056
+UniRef90_R6HLI6	2.2598870056
+UniRef90_R6HLI6|g__Bacteroides.s__Bacteroides_dorei	2.2598870056
+UniRef90_R9HMC9	2.2598870056
+UniRef90_R9HMC9|g__Bacteroides.s__Bacteroides_vulgatus	2.2598870056
+UniRef90_I8WBD6	2.2560631698
+UniRef90_I8WBD6|g__Bacteroides.s__Bacteroides_dorei	2.2560631698
+UniRef90_A6KXK4	2.2522522523
+UniRef90_A6KXK4|g__Bacteroides.s__Bacteroides_dorei	2.2522522523
+UniRef90_C3RC93	2.2522522523
+UniRef90_C3RC93|g__Bacteroides.s__Bacteroides_dorei	2.2522522523
+UniRef90_D1K5A2	2.2522522523
+UniRef90_D1K5A2|g__Bacteroides.s__Bacteroides_dorei	2.2522522523
+UniRef90_R7P1H6	2.2522522523
+UniRef90_R7P1H6|g__Bacteroides.s__Bacteroides_dorei	2.2522522523
+UniRef90_R7P223	2.2522522523
+UniRef90_R7P223|g__Bacteroides.s__Bacteroides_vulgatus	2.2522522523
+UniRef90_R9HHY4	2.2522522523
+UniRef90_R9HHY4|g__Bacteroides.s__Bacteroides_vulgatus	2.2522522523
+UniRef90_R7NZ24	2.2508717446
+UniRef90_R7NZ24|g__Bacteroides.s__Bacteroides_dorei	1.4880952381
+UniRef90_R7NZ24|g__Bacteroides.s__Bacteroides_vulgatus	0.7627765065
+UniRef90_A6L0V2	2.2446689113
+UniRef90_A6L0V2|g__Bacteroides.s__Bacteroides_dorei	2.2446689113
+UniRef90_A6L1U7	2.2446689113
+UniRef90_A6L1U7|g__Bacteroides.s__Bacteroides_dorei	2.2446689113
+UniRef90_A6L3G5	2.2371364653
+UniRef90_A6L3G5|g__Bacteroides.s__Bacteroides_vulgatus	2.2371364653
+UniRef90_F7LMH8	2.2371364653
+UniRef90_F7LMH8|g__Bacteroides.s__Bacteroides_dorei	2.2371364653
+UniRef90_R7P1M9	2.2371364653
+UniRef90_R7P1M9|g__Bacteroides.s__Bacteroides_dorei	2.2371364653
+UniRef90_R5MS39	2.2296544036
+UniRef90_R5MS39|g__Bacteroides.s__Bacteroides_dorei	2.2296544036
+UniRef90_R5VCW4	2.2296544036
+UniRef90_R5VCW4|g__Bacteroides.s__Bacteroides_dorei	1.1148272018
+UniRef90_R5VCW4|g__Bacteroides.s__Bacteroides_vulgatus	1.1148272018
+UniRef90_R7NYG8	2.2296544036
+UniRef90_R7NYG8|g__Bacteroides.s__Bacteroides_vulgatus	2.2296544036
+UniRef90_R6HNB1	2.2259321091
+UniRef90_R6HNB1|g__Bacteroides.s__Bacteroides_dorei	2.2259321091
+UniRef90_A6KWI5	2.2222222222
+UniRef90_A6KWI5|g__Bacteroides.s__Bacteroides_vulgatus	2.2222222222
+UniRef90_I9QQ99	2.2222222222
+UniRef90_I9QQ99|g__Bacteroides.s__Bacteroides_dorei	2.2222222222
+UniRef90_R6HML1	2.2222222222
+UniRef90_R6HML1|g__Bacteroides.s__Bacteroides_dorei	2.2222222222
+UniRef90_R7LIA0	2.2222222222
+UniRef90_R7LIA0|g__Bacteroides.s__Bacteroides_vulgatus	2.2222222222
+UniRef90_R7P5V1	2.2222222222
+UniRef90_R7P5V1|g__Bacteroides.s__Bacteroides_vulgatus	2.2222222222
+UniRef90_R9H797	2.2222222222
+UniRef90_R9H797|g__Bacteroides.s__Bacteroides_vulgatus	2.2222222222
+UniRef90_R6HUQ7	2.2148394241
+UniRef90_R6HUQ7|g__Bacteroides.s__Bacteroides_vulgatus	2.2148394241
+UniRef90_R9HMZ6	2.2148394241
+UniRef90_R9HMZ6|g__Bacteroides.s__Bacteroides_vulgatus	2.2148394241
+UniRef90_I9U550	2.2125830326
+UniRef90_I9U550|g__Bacteroides.s__Bacteroides_dorei	1.4847809948
+UniRef90_I9U550|g__Bacteroides.s__Bacteroides_vulgatus	0.7278020378
+UniRef90_A6KWQ4	2.2099690360
+UniRef90_A6KWQ4|g__Bacteroides.s__Bacteroides_dorei	1.1086474501
+UniRef90_A6KWQ4|g__Bacteroides.s__Bacteroides_vulgatus	1.1013215859
+UniRef90_C3RGJ5	2.2087278363
+UniRef90_C3RGJ5|g__Bacteroides.s__Bacteroides_dorei	1.8395879323
+UniRef90_C3RGJ5|g__Bacteroides.s__Bacteroides_vulgatus	0.3691399040
+UniRef90_R6HTU4	2.2075055188
+UniRef90_R6HTU4|g__Bacteroides.s__Bacteroides_dorei	1.4716703458
+UniRef90_R6HTU4|g__Bacteroides.s__Bacteroides_vulgatus	0.7358351729
+UniRef90_A6KYN7	2.2075055188
+UniRef90_A6KYN7|g__Bacteroides.s__Bacteroides_vulgatus	2.2075055188
+UniRef90_A6KZ09	2.2075055188
+UniRef90_A6KZ09|g__Bacteroides.s__Bacteroides_dorei	1.1037527594
+UniRef90_A6KZ09|g__Bacteroides.s__Bacteroides_vulgatus	1.1037527594
+UniRef90_A6L3Y9	2.2075055188
+UniRef90_A6L3Y9|g__Bacteroides.s__Bacteroides_vulgatus	2.2075055188
+UniRef90_C3R530	2.2075055188
+UniRef90_C3R530|g__Bacteroides.s__Bacteroides_dorei	2.2075055188
+UniRef90_D1JY74	2.2075055188
+UniRef90_D1JY74|g__Bacteroides.s__Bacteroides_dorei	2.2075055188
+UniRef90_I8WPH2	2.2075055188
+UniRef90_I8WPH2|g__Bacteroides.s__Bacteroides_dorei	2.2075055188
+UniRef90_R6C6P5	2.2075055188
+UniRef90_R6C6P5|g__Bacteroides.s__Bacteroides_dorei	2.2075055188
+UniRef90_R6DNZ4	2.2075055188
+UniRef90_R6DNZ4|g__Bacteroides.s__Bacteroides_vulgatus	2.2075055188
+UniRef90_R6I044	2.2075055188
+UniRef90_R6I044|g__Bacteroides.s__Bacteroides_dorei	2.2075055188
+UniRef90_D4VD15	2.2050716648
+UniRef90_D4VD15|g__Bacteroides.s__Bacteroides_vulgatus	2.2050716648
+UniRef90_A6L1N6	2.2031826387
+UniRef90_A6L1N6|g__Bacteroides.s__Bacteroides_dorei	2.2031826387
+UniRef90_A6KXK3	2.2002200220
+UniRef90_A6KXK3|g__Bacteroides.s__Bacteroides_dorei	1.1001100110
+UniRef90_A6KXK3|g__Bacteroides.s__Bacteroides_vulgatus	1.1001100110
+UniRef90_A6L204	2.2002200220
+UniRef90_A6L204|g__Bacteroides.s__Bacteroides_vulgatus	2.2002200220
+UniRef90_R7P5N0	2.1978021978
+UniRef90_R7P5N0|g__Bacteroides.s__Bacteroides_vulgatus	1.4652014652
+UniRef90_R7P5N0|g__Bacteroides.s__Bacteroides_dorei	0.7326007326
+UniRef90_A6KWB9	2.1965952773
+UniRef90_A6KWB9|g__Bacteroides.s__Bacteroides_dorei	2.1965952773
+UniRef90_A6KZ69	2.1929824561
+UniRef90_A6KZ69|g__Bacteroides.s__Bacteroides_dorei	2.1929824561
+UniRef90_A6KZF3	2.1929824561
+UniRef90_A6KZF3|g__Bacteroides.s__Bacteroides_vulgatus	2.1929824561
+UniRef90_I8W600	2.1929824561
+UniRef90_I8W600|g__Bacteroides.s__Bacteroides_dorei	2.1929824561
+UniRef90_P70882	2.1893814997
+UniRef90_P70882|g__Bacteroides.s__Bacteroides_dorei	2.1893814997
+UniRef90_I9G2M5	2.1834061135
+UniRef90_I9G2M5|g__Bacteroides.s__Bacteroides_dorei	2.1834061135
+UniRef90_A6L199	2.1786492375
+UniRef90_A6L199|g__Bacteroides.s__Bacteroides_vulgatus	2.1786492375
+UniRef90_A6L301	2.1786492375
+UniRef90_A6L301|g__Bacteroides.s__Bacteroides_vulgatus	2.1786492375
+UniRef90_A6L3I3	2.1786492375
+UniRef90_A6L3I3|g__Bacteroides.s__Bacteroides_dorei	2.1786492375
+UniRef90_A6L7U8	2.1786492375
+UniRef90_A6L7U8|g__Bacteroides.s__Bacteroides_vulgatus	2.1786492375
+UniRef90_I8WI79	2.1786492375
+UniRef90_I8WI79|g__Bacteroides.s__Bacteroides_dorei	2.1786492375
+UniRef90_I9G2J0	2.1786492375
+UniRef90_I9G2J0|g__Bacteroides.s__Bacteroides_dorei	2.1786492375
+UniRef90_R6HJT4	2.1786492375
+UniRef90_R6HJT4|g__Bacteroides.s__Bacteroides_dorei	1.0893246187
+UniRef90_R6HJT4|g__Bacteroides.s__Bacteroides_vulgatus	1.0893246187
+UniRef90_R9H0Y1	2.1786492375
+UniRef90_R9H0Y1|g__Bacteroides.s__Bacteroides_vulgatus	2.1786492375
+UniRef90_A6KWY5	2.1715526602
+UniRef90_A6KWY5|g__Bacteroides.s__Bacteroides_vulgatus	2.1715526602
+UniRef90_R6N2H5	2.1715526602
+UniRef90_R6N2H5|g__Bacteroides.s__Bacteroides_dorei	1.0857763301
+UniRef90_R6N2H5|g__Bacteroides.s__Bacteroides_vulgatus	1.0857763301
+UniRef90_R6HXR0	2.1685254027
+UniRef90_R6HXR0|g__Bacteroides.s__Bacteroides_dorei	2.1685254027
+UniRef90_A6KZD9	2.1645021645
+UniRef90_A6KZD9|g__Bacteroides.s__Bacteroides_dorei	2.1645021645
+UniRef90_A6L741	2.1645021645
+UniRef90_A6L741|g__Bacteroides.s__Bacteroides_vulgatus	2.1645021645
+UniRef90_A6LB82	2.1645021645
+UniRef90_A6LB82|g__Bacteroides.s__Bacteroides_vulgatus	2.1645021645
+UniRef90_C3PUQ1	2.1645021645
+UniRef90_C3PUQ1|g__Bacteroides.s__Bacteroides_dorei	2.1645021645
+UniRef90_R6B568	2.1645021645
+UniRef90_R6B568|g__Bacteroides.s__Bacteroides_vulgatus	2.1645021645
+UniRef90_R6HNM9	2.1645021645
+UniRef90_R6HNM9|g__Bacteroides.s__Bacteroides_vulgatus	2.1645021645
+UniRef90_C3Q859	2.1611608521
+UniRef90_C3Q859|g__Bacteroides.s__Bacteroides_vulgatus	2.1611608521
+UniRef90_I8ZLY4	2.1574973031
+UniRef90_I8ZLY4|g__Bacteroides.s__Bacteroides_dorei	2.1574973031
+UniRef90_I9F3X8	2.1574973031
+UniRef90_I9F3X8|g__Bacteroides.s__Bacteroides_dorei	2.1574973031
+UniRef90_I9G0U7	2.1574973031
+UniRef90_I9G0U7|g__Bacteroides.s__Bacteroides_dorei	2.1574973031
+UniRef90_R6IGK4	2.1574973031
+UniRef90_R6IGK4|g__Bacteroides.s__Bacteroides_dorei	2.1574973031
+UniRef90_R7NYN3	2.1574973031
+UniRef90_R7NYN3|g__Bacteroides.s__Bacteroides_vulgatus	2.1574973031
+UniRef90_R9H2X3	2.1551724138
+UniRef90_R9H2X3|g__Bacteroides.s__Bacteroides_vulgatus	2.1551724138
+UniRef90_A0A015QXQ5	2.1505376344
+UniRef90_A0A015QXQ5|g__Bacteroides.s__Bacteroides_dorei	2.1505376344
+UniRef90_A6KWL6	2.1505376344
+UniRef90_A6KWL6|g__Bacteroides.s__Bacteroides_dorei	2.1505376344
+UniRef90_K9DT83	2.1505376344
+UniRef90_K9DT83|g__Bacteroides.s__Bacteroides_dorei	2.1505376344
+UniRef90_R7P3X0	2.1505376344
+UniRef90_R7P3X0|g__Bacteroides.s__Bacteroides_vulgatus	2.1505376344
+UniRef90_UPI00046A51E2	2.1459227468
+UniRef90_UPI00046A51E2|g__Bacteroides.s__Bacteroides_vulgatus	2.1459227468
+UniRef90_A6KWF1	2.1436227224
+UniRef90_A6KWF1|g__Bacteroides.s__Bacteroides_dorei	1.0718113612
+UniRef90_A6KWF1|g__Bacteroides.s__Bacteroides_vulgatus	1.0718113612
+UniRef90_R6HVW8	2.1436227224
+UniRef90_R6HVW8|g__Bacteroides.s__Bacteroides_vulgatus	2.1436227224
+UniRef90_Q64SE5	2.1367521368
+UniRef90_Q64SE5|g__Bacteroides.s__Bacteroides_dorei	2.1367521368
+UniRef90_R6HML2	2.1367521368
+UniRef90_R6HML2|g__Bacteroides.s__Bacteroides_vulgatus	2.1367521368
+UniRef90_A6KWE7	2.1367521368
+UniRef90_A6KWE7|g__Bacteroides.s__Bacteroides_vulgatus	2.1367521368
+UniRef90_D4V9S8	2.1367521368
+UniRef90_D4V9S8|g__Bacteroides.s__Bacteroides_vulgatus	2.1367521368
+UniRef90_R6HJS8	2.1367521368
+UniRef90_R6HJS8|g__Bacteroides.s__Bacteroides_vulgatus	2.1367521368
+UniRef90_R6HX10	2.1367521368
+UniRef90_R6HX10|g__Bacteroides.s__Bacteroides_vulgatus	2.1367521368
+UniRef90_R6HXH4	2.1367521368
+UniRef90_R6HXH4|g__Bacteroides.s__Bacteroides_vulgatus	2.1367521368
+UniRef90_R7P2A0	2.1367521368
+UniRef90_R7P2A0|g__Bacteroides.s__Bacteroides_dorei	1.0683760684
+UniRef90_R7P2A0|g__Bacteroides.s__Bacteroides_vulgatus	1.0683760684
+UniRef90_A6L4F7	2.1333333333
+UniRef90_A6L4F7|g__Bacteroides.s__Bacteroides_vulgatus	2.1333333333
+UniRef90_R9HN27	2.1333333333
+UniRef90_R9HN27|g__Bacteroides.s__Bacteroides_vulgatus	2.1333333333
+UniRef90_A6L6S8	2.1306839662
+UniRef90_A6L6S8|g__Bacteroides.s__Bacteroides_dorei	1.4214641080
+UniRef90_A6L6S8|g__Bacteroides.s__Bacteroides_vulgatus	0.7092198582
+UniRef90_I9RD23	2.1299254526
+UniRef90_I9RD23|g__Bacteroides.s__Bacteroides_dorei	2.1299254526
+UniRef90_R9I0L1	2.1299254526
+UniRef90_R9I0L1|g__Bacteroides.s__Bacteroides_vulgatus	2.1299254526
+UniRef90_U6R9S1	2.1299254526
+UniRef90_U6R9S1|g__Bacteroides.s__Bacteroides_vulgatus	2.1299254526
+UniRef90_I8WQN3	2.1276595745
+UniRef90_I8WQN3|g__Bacteroides.s__Bacteroides_dorei	2.1276595745
+UniRef90_A6L336	2.1231422505
+UniRef90_A6L336|g__Bacteroides.s__Bacteroides_dorei	2.1231422505
+UniRef90_R7NMZ2	2.1231422505
+UniRef90_R7NMZ2|g__Bacteroides.s__Bacteroides_dorei	1.0615711253
+UniRef90_R7NMZ2|g__Bacteroides.s__Bacteroides_vulgatus	1.0615711253
+UniRef90_C3RE97	2.1186464453
+UniRef90_C3RE97|g__Bacteroides.s__Bacteroides_dorei	2.1186464453
+UniRef90_C3Q1B0	2.1164021164
+UniRef90_C3Q1B0|g__Bacteroides.s__Bacteroides_dorei	1.0582010582
+UniRef90_C3Q1B0|g__Bacteroides.s__Bacteroides_vulgatus	1.0582010582
+UniRef90_R6YQA7	2.1164021164
+UniRef90_R6YQA7|g__Bacteroides.s__Bacteroides_vulgatus	2.1164021164
+UniRef90_A6L3Z8	2.1141649049
+UniRef90_A6L3Z8|g__Bacteroides.s__Bacteroides_dorei	1.4094432699
+UniRef90_A6L3Z8|g__Bacteroides.s__Bacteroides_vulgatus	0.7047216350
+UniRef90_I8UQJ4	2.1130480718
+UniRef90_I8UQJ4|g__Bacteroides.s__Bacteroides_dorei	2.1130480718
+UniRef90_C3RGN2	2.1097046414
+UniRef90_C3RGN2|g__Bacteroides.s__Bacteroides_dorei	2.1097046414
+UniRef90_I9QPD0	2.1097046414
+UniRef90_I9QPD0|g__Bacteroides.s__Bacteroides_dorei	2.1097046414
+UniRef90_R7P4F1	2.1043771044
+UniRef90_R7P4F1|g__Bacteroides.s__Bacteroides_dorei	2.1043771044
+UniRef90_A0A015V960	2.1030494217
+UniRef90_A0A015V960|g__Bacteroides.s__Bacteroides_dorei	2.1030494217
+UniRef90_I8WRL8	2.1030494217
+UniRef90_I8WRL8|g__Bacteroides.s__Bacteroides_dorei	2.1030494217
+UniRef90_Q64S76	2.1030494217
+UniRef90_Q64S76|g__Bacteroides.s__Bacteroides_dorei	2.1030494217
+UniRef90_R7NT22	2.1030494217
+UniRef90_R7NT22|g__Bacteroides.s__Bacteroides_dorei	2.1030494217
+UniRef90_R9HH24	2.1030494217
+UniRef90_R9HH24|g__Bacteroides.s__Bacteroides_vulgatus	2.1030494217
+UniRef90_R6HTN5	2.0980893872
+UniRef90_R6HTN5|g__Bacteroides.s__Bacteroides_vulgatus	1.5748031496
+UniRef90_R6HTN5|g__Bacteroides.s__Bacteroides_dorei	0.5232862376
+UniRef90_A6KWH2	2.0964360587
+UniRef90_A6KWH2|g__Bacteroides.s__Bacteroides_dorei	2.0964360587
+UniRef90_A6L2S8	2.0964360587
+UniRef90_A6L2S8|g__Bacteroides.s__Bacteroides_vulgatus	2.0964360587
+UniRef90_R9I4U4	2.0964360587
+UniRef90_R9I4U4|g__Bacteroides.s__Bacteroides_vulgatus	2.0964360587
+UniRef90_R9HQW8	2.0920502092
+UniRef90_R9HQW8|g__Bacteroides.s__Bacteroides_vulgatus	2.0920502092
+UniRef90_A6KZ28	2.0898641588
+UniRef90_A6KZ28|g__Bacteroides.s__Bacteroides_dorei	2.0898641588
+UniRef90_C6Z6B7	2.0898641588
+UniRef90_C6Z6B7|g__Bacteroides.s__Bacteroides_vulgatus	2.0898641588
+UniRef90_R6IHC7	2.0898641588
+UniRef90_R6IHC7|g__Bacteroides.s__Bacteroides_dorei	2.0898641588
+UniRef90_R6UWT7	2.0898641588
+UniRef90_R6UWT7|g__Bacteroides.s__Bacteroides_dorei	2.0898641588
+UniRef90_R9H0G8	2.0898641588
+UniRef90_R9H0G8|g__Bacteroides.s__Bacteroides_vulgatus	2.0898641588
+UniRef90_R9HUM1	2.0898641588
+UniRef90_R9HUM1|g__Bacteroides.s__Bacteroides_vulgatus	2.0898641588
+UniRef90_A6L424	2.0833333333
+UniRef90_A6L424|g__Bacteroides.s__Bacteroides_dorei	2.0833333333
+UniRef90_A6L712	2.0833333333
+UniRef90_A6L712|g__Bacteroides.s__Bacteroides_dorei	2.0833333333
+UniRef90_A6L7R8	2.0833333333
+UniRef90_A6L7R8|g__Bacteroides.s__Bacteroides_vulgatus	2.0833333333
+UniRef90_R6HFK0	2.0833333333
+UniRef90_R6HFK0|g__Bacteroides.s__Bacteroides_vulgatus	2.0833333333
+UniRef90_R9HMB0	2.0833333333
+UniRef90_R9HMB0|g__Bacteroides.s__Bacteroides_vulgatus	2.0833333333
+UniRef90_R6IH34	2.0800832033
+UniRef90_R6IH34|g__Bacteroides.s__Bacteroides_dorei	1.5600624025
+UniRef90_R6IH34|g__Bacteroides.s__Bacteroides_vulgatus	0.5200208008
+UniRef90_A6L7C4	2.0768431983
+UniRef90_A6L7C4|g__Bacteroides.s__Bacteroides_vulgatus	2.0768431983
+UniRef90_R9H419	2.0755500208
+UniRef90_R9H419|g__Bacteroides.s__Bacteroides_vulgatus	2.0755500208
+UniRef90_A6KX79	2.0703933747
+UniRef90_A6KX79|g__Bacteroides.s__Bacteroides_vulgatus	2.0703933747
+UniRef90_A6L6W1	2.0703933747
+UniRef90_A6L6W1|g__Bacteroides.s__Bacteroides_dorei	2.0703933747
+UniRef90_C6ZA05	2.0703933747
+UniRef90_C6ZA05|g__Bacteroides.s__Bacteroides_vulgatus	2.0703933747
+UniRef90_I9FBU8	2.0703933747
+UniRef90_I9FBU8|g__Bacteroides.s__Bacteroides_dorei	2.0703933747
+UniRef90_Q64RA9	2.0661157025
+UniRef90_Q64RA9|g__Bacteroides.s__Bacteroides_dorei	2.0661157025
+UniRef90_A6KYR1	2.0639834881
+UniRef90_A6KYR1|g__Bacteroides.s__Bacteroides_dorei	2.0639834881
+UniRef90_R6HKD6	2.0639834881
+UniRef90_R6HKD6|g__Bacteroides.s__Bacteroides_dorei	1.0319917441
+UniRef90_R6HKD6|g__Bacteroides.s__Bacteroides_vulgatus	1.0319917441
+UniRef90_R6HID7	2.0618556701
+UniRef90_R6HID7|g__Bacteroides.s__Bacteroides_vulgatus	1.3745704467
+UniRef90_R6HID7|g__Bacteroides.s__Bacteroides_dorei	0.6872852234
+UniRef90_R7P4D8	2.0618556701
+UniRef90_R7P4D8|g__Bacteroides.s__Bacteroides_vulgatus	1.3745704467
+UniRef90_R7P4D8|g__Bacteroides.s__Bacteroides_dorei	0.6872852234
+UniRef90_A6L4U0	2.0576131687
+UniRef90_A6L4U0|g__Bacteroides.s__Bacteroides_dorei	2.0576131687
+UniRef90_C3RD72	2.0576131687
+UniRef90_C3RD72|g__Bacteroides.s__Bacteroides_vulgatus	2.0576131687
+UniRef90_I0PZX4	2.0576131687
+UniRef90_I0PZX4|g__Bacteroides.s__Bacteroides_dorei	2.0576131687
+UniRef90_R6CF49	2.0576131687
+UniRef90_R6CF49|g__Bacteroides.s__Bacteroides_vulgatus	2.0576131687
+UniRef90_R6I141	2.0528611753
+UniRef90_R6I141|g__Bacteroides.s__Bacteroides_dorei	2.0528611753
+UniRef90_C3PZ87	2.0512820513
+UniRef90_C3PZ87|g__Bacteroides.s__Bacteroides_vulgatus	2.0512820513
+UniRef90_R6ILM6	2.0512820513
+UniRef90_R6ILM6|g__Bacteroides.s__Bacteroides_dorei	2.0512820513
+UniRef90_R9HMA1	2.0512820513
+UniRef90_R9HMA1|g__Bacteroides.s__Bacteroides_vulgatus	2.0512820513
+UniRef90_A6KXU2	2.0449897751
+UniRef90_A6KXU2|g__Bacteroides.s__Bacteroides_vulgatus	2.0449897751
+UniRef90_A6L3X2	2.0449897751
+UniRef90_A6L3X2|g__Bacteroides.s__Bacteroides_dorei	2.0449897751
+UniRef90_A6L4A6	2.0449897751
+UniRef90_A6L4A6|g__Bacteroides.s__Bacteroides_vulgatus	2.0449897751
+UniRef90_A6L5K1	2.0449897751
+UniRef90_A6L5K1|g__Bacteroides.s__Bacteroides_vulgatus	2.0449897751
+UniRef90_R6IMF1	2.0449897751
+UniRef90_R6IMF1|g__Bacteroides.s__Bacteroides_vulgatus	2.0449897751
+UniRef90_R7P4C0	2.0449897751
+UniRef90_R7P4C0|g__Bacteroides.s__Bacteroides_vulgatus	2.0449897751
+UniRef90_R9H435	2.0449897751
+UniRef90_R9H435|g__Bacteroides.s__Bacteroides_vulgatus	2.0449897751
+UniRef90_W0ETG2	2.0449897751
+UniRef90_W0ETG2|g__Bacteroides.s__Bacteroides_vulgatus	2.0449897751
+UniRef90_D4VBX4	2.0418580909
+UniRef90_D4VBX4|g__Bacteroides.s__Bacteroides_vulgatus	2.0418580909
+UniRef90_R9HU69	2.0366598778
+UniRef90_R9HU69|g__Bacteroides.s__Bacteroides_vulgatus	2.0366598778
+UniRef90_A6L2Q8	2.0325203252
+UniRef90_A6L2Q8|g__Bacteroides.s__Bacteroides_dorei	2.0325203252
+UniRef90_A6L6Z0	2.0325203252
+UniRef90_A6L6Z0|g__Bacteroides.s__Bacteroides_vulgatus	2.0325203252
+UniRef90_C3Q274	2.0325203252
+UniRef90_C3Q274|g__Bacteroides.s__Bacteroides_dorei	2.0325203252
+UniRef90_D4V8A1	2.0325203252
+UniRef90_D4V8A1|g__Bacteroides.s__Bacteroides_vulgatus	2.0325203252
+UniRef90_Q64SC2	2.0325203252
+UniRef90_Q64SC2|g__Bacteroides.s__Bacteroides_dorei	2.0325203252
+UniRef90_R5RHN8	2.0325203252
+UniRef90_R5RHN8|g__Bacteroides.s__Bacteroides_vulgatus	2.0325203252
+UniRef90_R6HRS4	2.0325203252
+UniRef90_R6HRS4|g__Bacteroides.s__Bacteroides_dorei	2.0325203252
+UniRef90_R7NMJ8	2.0325203252
+UniRef90_R7NMJ8|g__Bacteroides.s__Bacteroides_dorei	2.0325203252
+UniRef90_W0EV06	2.0325203252
+UniRef90_W0EV06|g__Bacteroides.s__Bacteroides_dorei	2.0325203252
+UniRef90_Q8A8R7	2.0325203252
+UniRef90_Q8A8R7|g__Bacteroides.s__Bacteroides_vulgatus	2.0325203252
+UniRef90_I9FD87	2.0263424519
+UniRef90_I9FD87|g__Bacteroides.s__Bacteroides_dorei	2.0263424519
+UniRef90_I9RHQ5	2.0263424519
+UniRef90_I9RHQ5|g__Bacteroides.s__Bacteroides_vulgatus	2.0263424519
+UniRef90_R6HLJ2	2.0263424519
+UniRef90_R6HLJ2|g__Bacteroides.s__Bacteroides_dorei	2.0263424519
+UniRef90_R5U255	2.0242914980
+UniRef90_R5U255|g__Bacteroides.s__Bacteroides_dorei	1.3495276653
+UniRef90_R5U255|g__Bacteroides.s__Bacteroides_vulgatus	0.6747638327
+UniRef90_C3REY2	2.0217336366
+UniRef90_C3REY2|g__Bacteroides.s__Bacteroides_dorei	2.0217336366
+UniRef90_A6L0X5	2.0202020202
+UniRef90_A6L0X5|g__Bacteroides.s__Bacteroides_vulgatus	2.0202020202
+UniRef90_A6L233	2.0202020202
+UniRef90_A6L233|g__Bacteroides.s__Bacteroides_dorei	2.0202020202
+UniRef90_A6L2I0	2.0202020202
+UniRef90_A6L2I0|g__Bacteroides.s__Bacteroides_vulgatus	2.0202020202
+UniRef90_A6L3B8	2.0202020202
+UniRef90_A6L3B8|g__Bacteroides.s__Bacteroides_vulgatus	2.0202020202
+UniRef90_C6IR32	2.0202020202
+UniRef90_C6IR32|g__Bacteroides.s__Bacteroides_vulgatus	2.0202020202
+UniRef90_R6HNL1	2.0202020202
+UniRef90_R6HNL1|g__Bacteroides.s__Bacteroides_dorei	2.0202020202
+UniRef90_R6HXK8	2.0202020202
+UniRef90_R6HXK8|g__Bacteroides.s__Bacteroides_dorei	2.0202020202
+UniRef90_R6I1B5	2.0202020202
+UniRef90_R6I1B5|g__Bacteroides.s__Bacteroides_dorei	2.0202020202
+UniRef90_R6HLH5	2.0140986908
+UniRef90_R6HLH5|g__Bacteroides.s__Bacteroides_dorei	2.0140986908
+UniRef90_A6KXF9	2.0080321285
+UniRef90_A6KXF9|g__Bacteroides.s__Bacteroides_dorei	2.0080321285
+UniRef90_A6L4E3	2.0080321285
+UniRef90_A6L4E3|g__Bacteroides.s__Bacteroides_dorei	2.0080321285
+UniRef90_K5ZRE6	2.0080321285
+UniRef90_K5ZRE6|g__Bacteroides.s__Bacteroides_dorei	2.0080321285
+UniRef90_R6HWT3	2.0080321285
+UniRef90_R6HWT3|g__Bacteroides.s__Bacteroides_dorei	2.0080321285
+UniRef90_R7P126	2.0080321285
+UniRef90_R7P126|g__Bacteroides.s__Bacteroides_dorei	2.0080321285
+UniRef90_A6L3P5	2.0020020020
+UniRef90_A6L3P5|g__Bacteroides.s__Bacteroides_vulgatus	2.0020020020
+UniRef90_I9QCB4	2.0020020020
+UniRef90_I9QCB4|g__Bacteroides.s__Bacteroides_dorei	2.0020020020
+UniRef90_I9RAQ8	2.0020020020
+UniRef90_I9RAQ8|g__Bacteroides.s__Bacteroides_dorei	2.0020020020
+UniRef90_R6IJ96	2.0020020020
+UniRef90_R6IJ96|g__Bacteroides.s__Bacteroides_dorei	2.0020020020
+UniRef90_R6IL68	2.0020020020
+UniRef90_R6IL68|g__Bacteroides.s__Bacteroides_vulgatus	2.0020020020
+UniRef90_A6L3Y6	2.0008003201
+UniRef90_A6L3Y6|g__Bacteroides.s__Bacteroides_dorei	1.6006402561
+UniRef90_A6L3Y6|g__Bacteroides.s__Bacteroides_vulgatus	0.4001600640
+UniRef90_A0A016C4A5	1.9960079840
+UniRef90_A0A016C4A5|g__Bacteroides.s__Bacteroides_dorei	1.9960079840
+UniRef90_A6LIN4	1.9960079840
+UniRef90_A6LIN4|g__Bacteroides.s__Bacteroides_vulgatus	1.9960079840
+UniRef90_D1K275	1.9960079840
+UniRef90_D1K275|g__Bacteroides.s__Bacteroides_dorei	1.9960079840
+UniRef90_I8WPC3	1.9960079840
+UniRef90_I8WPC3|g__Bacteroides.s__Bacteroides_dorei	1.9960079840
+UniRef90_Q64SH0	1.9960079840
+UniRef90_Q64SH0|g__Bacteroides.s__Bacteroides_dorei	1.9960079840
+UniRef90_Q8A8N2	1.9960079840
+UniRef90_Q8A8N2|g__Bacteroides.s__Bacteroides_dorei	1.9960079840
+UniRef90_R6HHY6	1.9960079840
+UniRef90_R6HHY6|g__Bacteroides.s__Bacteroides_dorei	1.9960079840
+UniRef90_A6KZN1	1.9900497512
+UniRef90_A6KZN1|g__Bacteroides.s__Bacteroides_dorei	1.9900497512
+UniRef90_A6L3V7	1.9841269841
+UniRef90_A6L3V7|g__Bacteroides.s__Bacteroides_dorei	1.9841269841
+UniRef90_I9QK18	1.9841269841
+UniRef90_I9QK18|g__Bacteroides.s__Bacteroides_dorei	1.9841269841
+UniRef90_K5XZY6	1.9841269841
+UniRef90_K5XZY6|g__Bacteroides.s__Bacteroides_vulgatus	1.9841269841
+UniRef90_K5ZNQ2	1.9841269841
+UniRef90_K5ZNQ2|g__Bacteroides.s__Bacteroides_dorei	1.9841269841
+UniRef90_R6HKE1	1.9841269841
+UniRef90_R6HKE1|g__Bacteroides.s__Bacteroides_dorei	1.9841269841
+UniRef90_R9H597	1.9841269841
+UniRef90_R9H597|g__Bacteroides.s__Bacteroides_vulgatus	1.9841269841
+UniRef90_D4V4X6	1.9782393670
+UniRef90_D4V4X6|g__Bacteroides.s__Bacteroides_dorei	0.9891196835
+UniRef90_D4V4X6|g__Bacteroides.s__Bacteroides_vulgatus	0.9891196835
+UniRef90_R9HC78	1.9782393670
+UniRef90_R9HC78|g__Bacteroides.s__Bacteroides_vulgatus	1.9782393670
+UniRef90_R9HCQ8	1.9782393670
+UniRef90_R9HCQ8|g__Bacteroides.s__Bacteroides_vulgatus	1.9782393670
+UniRef90_R5MJ40	1.9723865878
+UniRef90_R5MJ40|g__Bacteroides.s__Bacteroides_vulgatus	1.3149243918
+UniRef90_R5MJ40|g__Bacteroides.s__Bacteroides_dorei	0.6574621959
+UniRef90_A6L046	1.9723865878
+UniRef90_A6L046|g__Bacteroides.s__Bacteroides_dorei	1.9723865878
+UniRef90_A6L0T3	1.9723865878
+UniRef90_A6L0T3|g__Bacteroides.s__Bacteroides_dorei	1.9723865878
+UniRef90_I9QS73	1.9723865878
+UniRef90_I9QS73|g__Bacteroides.s__Bacteroides_dorei	1.9723865878
+UniRef90_R7EBD7	1.9723865878
+UniRef90_R7EBD7|g__Bacteroides.s__Bacteroides_dorei	1.9723865878
+UniRef90_R6HGJ1	1.9685039370
+UniRef90_R6HGJ1|g__Bacteroides.s__Bacteroides_vulgatus	1.9685039370
+UniRef90_I9QS77	1.9665683382
+UniRef90_I9QS77|g__Bacteroides.s__Bacteroides_dorei	1.9665683382
+UniRef90_R6HW33	1.9665683382
+UniRef90_R6HW33|g__Bacteroides.s__Bacteroides_dorei	1.9665683382
+UniRef90_D4V5U9	1.9607843137
+UniRef90_D4V5U9|g__Bacteroides.s__Bacteroides_vulgatus	1.9607843137
+UniRef90_C7XG44	1.9607843137
+UniRef90_C7XG44|g__Bacteroides.s__Bacteroides_dorei	1.9607843137
+UniRef90_K1FAD2	1.9607843137
+UniRef90_K1FAD2|g__Bacteroides.s__Bacteroides_dorei	0.9803921569
+UniRef90_K1FAD2|g__Bacteroides.s__Bacteroides_vulgatus	0.9803921569
+UniRef90_R6II47	1.9607843137
+UniRef90_R6II47|g__Bacteroides.s__Bacteroides_dorei	0.9803921569
+UniRef90_R6II47|g__Bacteroides.s__Bacteroides_vulgatus	0.9803921569
+UniRef90_R6IHK0	1.9550342131
+UniRef90_R6IHK0|g__Bacteroides.s__Bacteroides_vulgatus	1.9550342131
+UniRef90_R7P045	1.9521717911
+UniRef90_R7P045|g__Bacteroides.s__Bacteroides_dorei	0.9760858956
+UniRef90_R7P045|g__Bacteroides.s__Bacteroides_vulgatus	0.9760858956
+UniRef90_A6L2W5	1.9493177388
+UniRef90_A6L2W5|g__Bacteroides.s__Bacteroides_dorei	1.9493177388
+UniRef90_A6L4A3	1.9493177388
+UniRef90_A6L4A3|g__Bacteroides.s__Bacteroides_dorei	1.9493177388
+UniRef90_E4VR59	1.9493177388
+UniRef90_E4VR59|g__Bacteroides.s__Bacteroides_dorei	1.9493177388
+UniRef90_I9G2E7	1.9493177388
+UniRef90_I9G2E7|g__Bacteroides.s__Bacteroides_dorei	1.9493177388
+UniRef90_R7P039	1.9493177388
+UniRef90_R7P039|g__Bacteroides.s__Bacteroides_dorei	1.9493177388
+UniRef90_R9H1C2	1.9493177388
+UniRef90_R9H1C2|g__Bacteroides.s__Bacteroides_vulgatus	1.9493177388
+UniRef90_R6HH26	1.9464720195
+UniRef90_R6HH26|g__Bacteroides.s__Bacteroides_vulgatus	1.9464720195
+UniRef90_I9FX50	1.9455252918
+UniRef90_I9FX50|g__Bacteroides.s__Bacteroides_dorei	1.9455252918
+UniRef90_R7P1M3	1.9455252918
+UniRef90_R7P1M3|g__Bacteroides.s__Bacteroides_vulgatus	1.2970168612
+UniRef90_R7P1M3|g__Bacteroides.s__Bacteroides_dorei	0.6485084306
+UniRef90_R5R951	1.9436345967
+UniRef90_R5R951|g__Bacteroides.s__Bacteroides_dorei	1.4577259475
+UniRef90_R5R951|g__Bacteroides.s__Bacteroides_vulgatus	0.4859086492
+UniRef90_R7P5R4	1.9436345967
+UniRef90_R7P5R4|g__Bacteroides.s__Bacteroides_dorei	0.9718172983
+UniRef90_R7P5R4|g__Bacteroides.s__Bacteroides_vulgatus	0.9718172983
+UniRef90_R5RDU9	1.9417475728
+UniRef90_R5RDU9|g__Bacteroides.s__Bacteroides_dorei	1.9417475728
+UniRef90_Q64SJ2	1.9379844961
+UniRef90_Q64SJ2|g__Bacteroides.s__Bacteroides_dorei	1.9379844961
+UniRef90_R6HN99	1.9379844961
+UniRef90_R6HN99|g__Bacteroides.s__Bacteroides_dorei	1.9379844961
+UniRef90_R7EM94	1.9379844961
+UniRef90_R7EM94|g__Bacteroides.s__Bacteroides_dorei	1.9379844961
+UniRef90_D4V709	1.9267822736
+UniRef90_D4V709|g__Bacteroides.s__Bacteroides_vulgatus	1.9267822736
+UniRef90_R7NUK7	1.9267822736
+UniRef90_R7NUK7|g__Bacteroides.s__Bacteroides_vulgatus	1.9267822736
+UniRef90_A6L2L3	1.9240019240
+UniRef90_A6L2L3|g__Bacteroides.s__Bacteroides_dorei	0.9620009620
+UniRef90_A6L2L3|g__Bacteroides.s__Bacteroides_vulgatus	0.9620009620
+UniRef90_R6HVW7	1.9230769231
+UniRef90_R6HVW7|g__Bacteroides.s__Bacteroides_vulgatus	1.9230769231
+UniRef90_A6L0S9	1.9212295869
+UniRef90_A6L0S9|g__Bacteroides.s__Bacteroides_vulgatus	1.9212295869
+UniRef90_A6L3B5	1.9212295869
+UniRef90_A6L3B5|g__Bacteroides.s__Bacteroides_vulgatus	1.9212295869
+UniRef90_A6L7C5	1.9212295869
+UniRef90_A6L7C5|g__Bacteroides.s__Bacteroides_vulgatus	1.9212295869
+UniRef90_I8VN51	1.9212295869
+UniRef90_I8VN51|g__Bacteroides.s__Bacteroides_dorei	1.9212295869
+UniRef90_I8W0W0	1.9212295869
+UniRef90_I8W0W0|g__Bacteroides.s__Bacteroides_dorei	1.9212295869
+UniRef90_I8XZF0	1.9212295869
+UniRef90_I8XZF0|g__Bacteroides.s__Bacteroides_dorei	1.9212295869
+UniRef90_D4VDS6	1.9157088123
+UniRef90_D4VDS6|g__Bacteroides.s__Bacteroides_dorei	1.9157088123
+UniRef90_D1K551	1.9157088123
+UniRef90_D1K551|g__Bacteroides.s__Bacteroides_dorei	1.9157088123
+UniRef90_D1K8Q1	1.9157088123
+UniRef90_D1K8Q1|g__Bacteroides.s__Bacteroides_dorei	0.9578544061
+UniRef90_D1K8Q1|g__Bacteroides.s__Bacteroides_vulgatus	0.9578544061
+UniRef90_R9H8D9	1.9157088123
+UniRef90_R9H8D9|g__Bacteroides.s__Bacteroides_vulgatus	1.9157088123
+UniRef90_A6L7B4	1.9102196753
+UniRef90_A6L7B4|g__Bacteroides.s__Bacteroides_dorei	1.9102196753
+UniRef90_C3PZ20	1.9102196753
+UniRef90_C3PZ20|g__Bacteroides.s__Bacteroides_dorei	1.9102196753
+UniRef90_C6Z208	1.9102196753
+UniRef90_C6Z208|g__Bacteroides.s__Bacteroides_vulgatus	1.9102196753
+UniRef90_I9QGR5	1.9102196753
+UniRef90_I9QGR5|g__Bacteroides.s__Bacteroides_dorei	1.9102196753
+UniRef90_Q64SH2	1.9102196753
+UniRef90_Q64SH2|g__Bacteroides.s__Bacteroides_dorei	1.9102196753
+UniRef90_R6HP88	1.9102196753
+UniRef90_R6HP88|g__Bacteroides.s__Bacteroides_vulgatus	1.9102196753
+UniRef90_R9HGH3	1.9083969466
+UniRef90_R9HGH3|g__Bacteroides.s__Bacteroides_vulgatus	1.9083969466
+UniRef90_A6L2P8	1.9047619048
+UniRef90_A6L2P8|g__Bacteroides.s__Bacteroides_vulgatus	1.9047619048
+UniRef90_R6HHJ3	1.9047619048
+UniRef90_R6HHJ3|g__Bacteroides.s__Bacteroides_dorei	1.9047619048
+UniRef90_R6ILN1	1.9047619048
+UniRef90_R6ILN1|g__Bacteroides.s__Bacteroides_dorei	1.9047619048
+UniRef90_R9H540	1.9047619048
+UniRef90_R9H540|g__Bacteroides.s__Bacteroides_vulgatus	1.9047619048
+UniRef90_A6L7B5	1.8993352327
+UniRef90_A6L7B5|g__Bacteroides.s__Bacteroides_vulgatus	1.8993352327
+UniRef90_D4VCH9	1.8993352327
+UniRef90_D4VCH9|g__Bacteroides.s__Bacteroides_vulgatus	1.8993352327
+UniRef90_D4VE38	1.8993352327
+UniRef90_D4VE38|g__Bacteroides.s__Bacteroides_dorei	1.8993352327
+UniRef90_R6HFP6	1.8993352327
+UniRef90_R6HFP6|g__Bacteroides.s__Bacteroides_vulgatus	1.8993352327
+UniRef90_R6HLN4	1.8993352327
+UniRef90_R6HLN4|g__Bacteroides.s__Bacteroides_dorei	1.8993352327
+UniRef90_A6L5D3	1.8939393939
+UniRef90_A6L5D3|g__Bacteroides.s__Bacteroides_dorei	1.8939393939
+UniRef90_A6L645	1.8939393939
+UniRef90_A6L645|g__Bacteroides.s__Bacteroides_vulgatus	1.8939393939
+UniRef90_I8WPK2	1.8939393939
+UniRef90_I8WPK2|g__Bacteroides.s__Bacteroides_dorei	1.8939393939
+UniRef90_C3Q273	1.8885741265
+UniRef90_C3Q273|g__Bacteroides.s__Bacteroides_dorei	1.8885741265
+UniRef90_R9HR40	1.8885741265
+UniRef90_R9HR40|g__Bacteroides.s__Bacteroides_vulgatus	1.8885741265
+UniRef90_I9FIQ9	1.8867924528
+UniRef90_I9FIQ9|g__Bacteroides.s__Bacteroides_dorei	1.8867924528
+UniRef90_A6KY59	1.8832391714
+UniRef90_A6KY59|g__Bacteroides.s__Bacteroides_vulgatus	1.8832391714
+UniRef90_A6L6Z6	1.8832391714
+UniRef90_A6L6Z6|g__Bacteroides.s__Bacteroides_dorei	1.8832391714
+UniRef90_C3Q5L4	1.8832391714
+UniRef90_C3Q5L4|g__Bacteroides.s__Bacteroides_dorei	1.8832391714
+UniRef90_I8VZ19	1.8832391714
+UniRef90_I8VZ19|g__Bacteroides.s__Bacteroides_dorei	1.8832391714
+UniRef90_I8WPD1	1.8832391714
+UniRef90_I8WPD1|g__Bacteroides.s__Bacteroides_dorei	1.8832391714
+UniRef90_R6HSG1	1.8832391714
+UniRef90_R6HSG1|g__Bacteroides.s__Bacteroides_vulgatus	1.8832391714
+UniRef90_R6HWK9	1.8832391714
+UniRef90_R6HWK9|g__Bacteroides.s__Bacteroides_vulgatus	1.8832391714
+UniRef90_R6HX29	1.8832391714
+UniRef90_R6HX29|g__Bacteroides.s__Bacteroides_dorei	1.8832391714
+UniRef90_R6IMB9	1.8832391714
+UniRef90_R6IMB9|g__Bacteroides.s__Bacteroides_vulgatus	1.8832391714
+UniRef90_R7NZ35	1.8832391714
+UniRef90_R7NZ35|g__Bacteroides.s__Bacteroides_dorei	0.9416195857
+UniRef90_R7NZ35|g__Bacteroides.s__Bacteroides_vulgatus	0.9416195857
+UniRef90_A6KWU1	1.8814675447
+UniRef90_A6KWU1|g__Bacteroides.s__Bacteroides_dorei	1.8814675447
+UniRef90_R7DI83	1.8779342723
+UniRef90_R7DI83|g__Bacteroides.s__Bacteroides_vulgatus	1.8779342723
+UniRef90_D1K1Z7	1.8761726079
+UniRef90_D1K1Z7|g__Bacteroides.s__Bacteroides_dorei	1.8761726079
+UniRef90_A0A015U3E0	1.8726591760
+UniRef90_A0A015U3E0|g__Bacteroides.s__Bacteroides_dorei	1.8726591760
+UniRef90_D4V980	1.8726591760
+UniRef90_D4V980|g__Bacteroides.s__Bacteroides_vulgatus	1.8726591760
+UniRef90_E5X024	1.8726591760
+UniRef90_E5X024|g__Bacteroides.s__Bacteroides_dorei	1.8726591760
+UniRef90_I9QM76	1.8726591760
+UniRef90_I9QM76|g__Bacteroides.s__Bacteroides_dorei	1.8726591760
+UniRef90_R6HFJ7	1.8726591760
+UniRef90_R6HFJ7|g__Bacteroides.s__Bacteroides_dorei	1.8726591760
+UniRef90_R6HIA5	1.8726591760
+UniRef90_R6HIA5|g__Bacteroides.s__Bacteroides_dorei	1.8726591760
+UniRef90_R6HR28	1.8726591760
+UniRef90_R6HR28|g__Bacteroides.s__Bacteroides_dorei	1.8726591760
+UniRef90_R6HT39	1.8726591760
+UniRef90_R6HT39|g__Bacteroides.s__Bacteroides_dorei	1.8726591760
+UniRef90_R7P6F8	1.8726591760
+UniRef90_R7P6F8|g__Bacteroides.s__Bacteroides_vulgatus	1.8726591760
+UniRef90_C3R905	1.8674136321
+UniRef90_C3R905|g__Bacteroides.s__Bacteroides_dorei	1.8674136321
+UniRef90_C6Z5M7	1.8621973929
+UniRef90_C6Z5M7|g__Bacteroides.s__Bacteroides_vulgatus	1.8621973929
+UniRef90_A6L7Q3	1.8621973929
+UniRef90_A6L7Q3|g__Bacteroides.s__Bacteroides_vulgatus	1.8621973929
+UniRef90_D1K9K1	1.8621973929
+UniRef90_D1K9K1|g__Bacteroides.s__Bacteroides_dorei	1.8621973929
+UniRef90_D4V4X9	1.8621973929
+UniRef90_D4V4X9|g__Bacteroides.s__Bacteroides_dorei	0.9310986965
+UniRef90_D4V4X9|g__Bacteroides.s__Bacteroides_vulgatus	0.9310986965
+UniRef90_I9QKC7	1.8621973929
+UniRef90_I9QKC7|g__Bacteroides.s__Bacteroides_dorei	1.8621973929
+UniRef90_Q8A8Q2	1.8621973929
+UniRef90_Q8A8Q2|g__Bacteroides.s__Bacteroides_dorei	0.9310986965
+UniRef90_Q8A8Q2|g__Bacteroides.s__Bacteroides_vulgatus	0.9310986965
+UniRef90_R6HIG9	1.8621973929
+UniRef90_R6HIG9|g__Bacteroides.s__Bacteroides_dorei	1.8621973929
+UniRef90_R6HJW5	1.8621973929
+UniRef90_R6HJW5|g__Bacteroides.s__Bacteroides_dorei	1.8621973929
+UniRef90_R9HKZ3	1.8621973929
+UniRef90_R9HKZ3|g__Bacteroides.s__Bacteroides_vulgatus	1.8621973929
+UniRef90_C3PWE4	1.8587360595
+UniRef90_C3PWE4|g__Bacteroides.s__Bacteroides_vulgatus	1.8587360595
+UniRef90_I9G2L6	1.8587360595
+UniRef90_I9G2L6|g__Bacteroides.s__Bacteroides_dorei	1.8587360595
+UniRef90_A6L2S4	1.8570102136
+UniRef90_A6L2S4|g__Bacteroides.s__Bacteroides_dorei	1.8570102136
+UniRef90_C3Q1A9	1.8570102136
+UniRef90_C3Q1A9|g__Bacteroides.s__Bacteroides_dorei	0.9285051068
+UniRef90_C3Q1A9|g__Bacteroides.s__Bacteroides_vulgatus	0.9285051068
+UniRef90_C3QUB5	1.8570102136
+UniRef90_C3QUB5|g__Bacteroides.s__Bacteroides_dorei	1.8570102136
+UniRef90_R6IGF4	1.8570102136
+UniRef90_R6IGF4|g__Bacteroides.s__Bacteroides_dorei	1.3927576602
+UniRef90_R6IGF4|g__Bacteroides.s__Bacteroides_vulgatus	0.4642525534
+UniRef90_R9H8Q4	1.8552875696
+UniRef90_R9H8Q4|g__Bacteroides.s__Bacteroides_vulgatus	1.8552875696
+UniRef90_A6L5A2	1.8518518519
+UniRef90_A6L5A2|g__Bacteroides.s__Bacteroides_dorei	1.8518518519
+UniRef90_F9Z5Q1	1.8518518519
+UniRef90_F9Z5Q1|g__Bacteroides.s__Bacteroides_vulgatus	1.8518518519
+UniRef90_I9RE39	1.8518518519
+UniRef90_I9RE39|g__Bacteroides.s__Bacteroides_dorei	1.8518518519
+UniRef90_A6KYE7	1.8467220683
+UniRef90_A6KYE7|g__Bacteroides.s__Bacteroides_dorei	1.8467220683
+UniRef90_A6L7B0	1.8467220683
+UniRef90_A6L7B0|g__Bacteroides.s__Bacteroides_vulgatus	1.8467220683
+UniRef90_R6HMW3	1.8467220683
+UniRef90_R6HMW3|g__Bacteroides.s__Bacteroides_vulgatus	1.8467220683
+UniRef90_R7P444	1.8467220683
+UniRef90_R7P444|g__Bacteroides.s__Bacteroides_dorei	1.8467220683
+UniRef90_A6KZ57	1.8416206262
+UniRef90_A6KZ57|g__Bacteroides.s__Bacteroides_vulgatus	1.8416206262
+UniRef90_Q5L890	1.8416206262
+UniRef90_Q5L890|g__Bacteroides.s__Bacteroides_dorei	0.9208103131
+UniRef90_Q5L890|g__Bacteroides.s__Bacteroides_vulgatus	0.9208103131
+UniRef90_R9HFA7	1.8416206262
+UniRef90_R9HFA7|g__Bacteroides.s__Bacteroides_dorei	1.8416206262
+UniRef90_C3Q1A8	1.8365472911
+UniRef90_C3Q1A8|g__Bacteroides.s__Bacteroides_dorei	0.9182736455
+UniRef90_C3Q1A8|g__Bacteroides.s__Bacteroides_vulgatus	0.9182736455
+UniRef90_A6KXF8	1.8315018315
+UniRef90_A6KXF8|g__Bacteroides.s__Bacteroides_vulgatus	1.8315018315
+UniRef90_R6HFU2	1.8315018315
+UniRef90_R6HFU2|g__Bacteroides.s__Bacteroides_dorei	1.8315018315
+UniRef90_R6HH37	1.8315018315
+UniRef90_R6HH37|g__Bacteroides.s__Bacteroides_dorei	1.8315018315
+UniRef90_R6HI01	1.8315018315
+UniRef90_R6HI01|g__Bacteroides.s__Bacteroides_dorei	1.8315018315
+UniRef90_R6HMD5	1.8315018315
+UniRef90_R6HMD5|g__Bacteroides.s__Bacteroides_dorei	1.8315018315
+UniRef90_R7EQ15	1.8315018315
+UniRef90_R7EQ15|g__Bacteroides.s__Bacteroides_dorei	1.8315018315
+UniRef90_A6KWQ8	1.8264840183
+UniRef90_A6KWQ8|g__Bacteroides.s__Bacteroides_dorei	1.8264840183
+UniRef90_R6HRE2	1.8264840183
+UniRef90_R6HRE2|g__Bacteroides.s__Bacteroides_dorei	0.9132420091
+UniRef90_R6HRE2|g__Bacteroides.s__Bacteroides_vulgatus	0.9132420091
+UniRef90_A6KZX1	1.8214936248
+UniRef90_A6KZX1|g__Bacteroides.s__Bacteroides_vulgatus	1.8214936248
+UniRef90_A6KZY1	1.8214936248
+UniRef90_A6KZY1|g__Bacteroides.s__Bacteroides_vulgatus	1.8214936248
+UniRef90_A6L4B7	1.8214936248
+UniRef90_A6L4B7|g__Bacteroides.s__Bacteroides_dorei	1.8214936248
+UniRef90_A6L7Q6	1.8214936248
+UniRef90_A6L7Q6|g__Bacteroides.s__Bacteroides_dorei	0.9107468124
+UniRef90_A6L7Q6|g__Bacteroides.s__Bacteroides_vulgatus	0.9107468124
+UniRef90_I8WPG8	1.8214936248
+UniRef90_I8WPG8|g__Bacteroides.s__Bacteroides_dorei	1.8214936248
+UniRef90_R6HIZ5	1.8214936248
+UniRef90_R6HIZ5|g__Bacteroides.s__Bacteroides_vulgatus	1.8214936248
+UniRef90_A6KXU5	1.8115942029
+UniRef90_A6KXU5|g__Bacteroides.s__Bacteroides_vulgatus	1.8115942029
+UniRef90_A6L0T4	1.8115942029
+UniRef90_A6L0T4|g__Bacteroides.s__Bacteroides_dorei	1.8115942029
+UniRef90_A6L697	1.8115942029
+UniRef90_A6L697|g__Bacteroides.s__Bacteroides_vulgatus	1.8115942029
+UniRef90_R6HID8	1.8115942029
+UniRef90_R6HID8|g__Bacteroides.s__Bacteroides_vulgatus	1.8115942029
+UniRef90_R7NRH9	1.8115942029
+UniRef90_R7NRH9|g__Bacteroides.s__Bacteroides_vulgatus	1.8115942029
+UniRef90_R7P2X7	1.8108860754
+UniRef90_R7P2X7|g__Bacteroides.s__Bacteroides_vulgatus	1.1947431302
+UniRef90_R7P2X7|g__Bacteroides.s__Bacteroides_dorei	0.6161429452
+UniRef90_A6KZZ3	1.8083182640
+UniRef90_A6KZZ3|g__Bacteroides.s__Bacteroides_vulgatus	1.2055455093
+UniRef90_A6KZZ3|g__Bacteroides.s__Bacteroides_dorei	0.6027727547
+UniRef90_R7NVJ7	1.8083182640
+UniRef90_R7NVJ7|g__Bacteroides.s__Bacteroides_vulgatus	1.8083182640
+UniRef90_A6KX07	1.8066847335
+UniRef90_A6KX07|g__Bacteroides.s__Bacteroides_vulgatus	1.8066847335
+UniRef90_C3QUC4	1.8066847335
+UniRef90_C3QUC4|g__Bacteroides.s__Bacteroides_dorei	1.8066847335
+UniRef90_A6L338	1.8018018018
+UniRef90_A6L338|g__Bacteroides.s__Bacteroides_vulgatus	1.8018018018
+UniRef90_C3RD74	1.8018018018
+UniRef90_C3RD74|g__Bacteroides.s__Bacteroides_vulgatus	1.8018018018
+UniRef90_R5VHW4	1.8018018018
+UniRef90_R5VHW4|g__Bacteroides.s__Bacteroides_dorei	1.8018018018
+UniRef90_R6HGT4	1.8018018018
+UniRef90_R6HGT4|g__Bacteroides.s__Bacteroides_dorei	1.8018018018
+UniRef90_A6L223	1.7969451932
+UniRef90_A6L223|g__Bacteroides.s__Bacteroides_dorei	1.7969451932
+UniRef90_R9H0W6	1.7969451932
+UniRef90_R9H0W6|g__Bacteroides.s__Bacteroides_vulgatus	1.7969451932
+UniRef90_R9HLL3	1.7969451932
+UniRef90_R9HLL3|g__Bacteroides.s__Bacteroides_vulgatus	1.7969451932
+UniRef90_D1JZW9	1.7921146953
+UniRef90_D1JZW9|g__Bacteroides.s__Bacteroides_dorei	1.7921146953
+UniRef90_I8WN89	1.7921146953
+UniRef90_I8WN89|g__Bacteroides.s__Bacteroides_dorei	1.7921146953
+UniRef90_I9FEK5	1.7921146953
+UniRef90_I9FEK5|g__Bacteroides.s__Bacteroides_dorei	1.7921146953
+UniRef90_R6KBI1	1.7921146953
+UniRef90_R6KBI1|g__Bacteroides.s__Bacteroides_dorei	1.7921146953
+UniRef90_R9H4P8	1.7921146953
+UniRef90_R9H4P8|g__Bacteroides.s__Bacteroides_vulgatus	1.7921146953
+UniRef90_R6HU03	1.7897091723
+UniRef90_R6HU03|g__Bacteroides.s__Bacteroides_dorei	1.7897091723
+UniRef90_R9H393	1.7889087657
+UniRef90_R9H393|g__Bacteroides.s__Bacteroides_vulgatus	1.7889087657
+UniRef90_B6VU53	1.7889087657
+UniRef90_B6VU53|g__Bacteroides.s__Bacteroides_dorei	1.7889087657
+UniRef90_R6IG26	1.7873100983
+UniRef90_R6IG26|g__Bacteroides.s__Bacteroides_dorei	1.7873100983
+UniRef90_R7NZA9	1.7873100983
+UniRef90_R7NZA9|g__Bacteroides.s__Bacteroides_vulgatus	1.7873100983
+UniRef90_I8VRV9	1.7825311943
+UniRef90_I8VRV9|g__Bacteroides.s__Bacteroides_dorei	1.7825311943
+UniRef90_A6L242	1.7777777778
+UniRef90_A6L242|g__Bacteroides.s__Bacteroides_dorei	1.7777777778
+UniRef90_D1K8Q2	1.7777777778
+UniRef90_D1K8Q2|g__Bacteroides.s__Bacteroides_dorei	1.7777777778
+UniRef90_Q64SD8	1.7777777778
+UniRef90_Q64SD8|g__Bacteroides.s__Bacteroides_dorei	1.7777777778
+UniRef90_A6KWQ3	1.7730496454
+UniRef90_A6KWQ3|g__Bacteroides.s__Bacteroides_vulgatus	1.7730496454
+UniRef90_I8UQJ9	1.7730496454
+UniRef90_I8UQJ9|g__Bacteroides.s__Bacteroides_dorei	1.7730496454
+UniRef90_K5ZGK1	1.7730496454
+UniRef90_K5ZGK1|g__Bacteroides.s__Bacteroides_vulgatus	1.7730496454
+UniRef90_Q64WL7	1.7730496454
+UniRef90_Q64WL7|g__Bacteroides.s__Bacteroides_dorei	1.7730496454
+UniRef90_R6HUW1	1.7730496454
+UniRef90_R6HUW1|g__Bacteroides.s__Bacteroides_dorei	1.7730496454
+UniRef90_R6HV28	1.7730496454
+UniRef90_R6HV28|g__Bacteroides.s__Bacteroides_dorei	1.7730496454
+UniRef90_A0A016LN29	1.7683465959
+UniRef90_A0A016LN29|g__Bacteroides.s__Bacteroides_dorei	1.7683465959
+UniRef90_R9H4I8	1.7683465959
+UniRef90_R9H4I8|g__Bacteroides.s__Bacteroides_vulgatus	1.7683465959
+UniRef90_C3RGB5	1.7660044150
+UniRef90_C3RGB5|g__Bacteroides.s__Bacteroides_dorei	1.7660044150
+UniRef90_A6L2F6	1.7636684303
+UniRef90_A6L2F6|g__Bacteroides.s__Bacteroides_dorei	1.7636684303
+UniRef90_A6L4D3	1.7636684303
+UniRef90_A6L4D3|g__Bacteroides.s__Bacteroides_vulgatus	1.7636684303
+UniRef90_A6L7S9	1.7636684303
+UniRef90_A6L7S9|g__Bacteroides.s__Bacteroides_vulgatus	1.7636684303
+UniRef90_I8W9J3	1.7636684303
+UniRef90_I8W9J3|g__Bacteroides.s__Bacteroides_dorei	1.7636684303
+UniRef90_K6A7R4	1.7636684303
+UniRef90_K6A7R4|g__Bacteroides.s__Bacteroides_vulgatus	1.7636684303
+UniRef90_R6HVM2	1.7636684303
+UniRef90_R6HVM2|g__Bacteroides.s__Bacteroides_dorei	1.7636684303
+UniRef90_R7P4I4	1.7636684303
+UniRef90_R7P4I4|g__Bacteroides.s__Bacteroides_dorei	1.7636684303
+UniRef90_R9H1D4	1.7636684303
+UniRef90_R9H1D4|g__Bacteroides.s__Bacteroides_vulgatus	1.7636684303
+UniRef90_A6L0S2	1.7590149516
+UniRef90_A6L0S2|g__Bacteroides.s__Bacteroides_vulgatus	1.7590149516
+UniRef90_R9HLB2	1.7590149516
+UniRef90_R9HLB2|g__Bacteroides.s__Bacteroides_vulgatus	1.7590149516
+UniRef90_A6L409	1.7543859649
+UniRef90_A6L409|g__Bacteroides.s__Bacteroides_dorei	1.7543859649
+UniRef90_A6L6B8	1.7543859649
+UniRef90_A6L6B8|g__Bacteroides.s__Bacteroides_vulgatus	1.7543859649
+UniRef90_I8WEG7	1.7543859649
+UniRef90_I8WEG7|g__Bacteroides.s__Bacteroides_dorei	1.7543859649
+UniRef90_I8ZKF1	1.7543859649
+UniRef90_I8ZKF1|g__Bacteroides.s__Bacteroides_vulgatus	1.7543859649
+UniRef90_R9HI33	1.7513134851
+UniRef90_R9HI33|g__Bacteroides.s__Bacteroides_vulgatus	1.7513134851
+UniRef90_I8VN48	1.7497812773
+UniRef90_I8VN48|g__Bacteroides.s__Bacteroides_dorei	1.7497812773
+UniRef90_A6KXD8	1.7452006981
+UniRef90_A6KXD8|g__Bacteroides.s__Bacteroides_dorei	1.7452006981
+UniRef90_A6KYG5	1.7452006981
+UniRef90_A6KYG5|g__Bacteroides.s__Bacteroides_dorei	1.7452006981
+UniRef90_A6L3A5	1.7452006981
+UniRef90_A6L3A5|g__Bacteroides.s__Bacteroides_vulgatus	1.7452006981
+UniRef90_R6HMN7	1.7452006981
+UniRef90_R6HMN7|g__Bacteroides.s__Bacteroides_dorei	1.7452006981
+UniRef90_R7NXP0	1.7452006981
+UniRef90_R7NXP0|g__Bacteroides.s__Bacteroides_vulgatus	1.7452006981
+UniRef90_R9H426	1.7452006981
+UniRef90_R9H426|g__Bacteroides.s__Bacteroides_vulgatus	1.7452006981
+UniRef90_R9HQS4	1.7452006981
+UniRef90_R9HQS4|g__Bacteroides.s__Bacteroides_vulgatus	1.7452006981
+UniRef90_R6HFX1	1.7436791630
+UniRef90_R6HFX1|g__Bacteroides.s__Bacteroides_vulgatus	1.7436791630
+UniRef90_R6HPY0	1.7429193900
+UniRef90_R6HPY0|g__Bacteroides.s__Bacteroides_dorei	1.7429193900
+UniRef90_I9FKN0	1.7406440383
+UniRef90_I9FKN0|g__Bacteroides.s__Bacteroides_dorei	1.7406440383
+UniRef90_A6L635	1.7361111111
+UniRef90_A6L635|g__Bacteroides.s__Bacteroides_vulgatus	1.7361111111
+UniRef90_D4VCY6	1.7361111111
+UniRef90_D4VCY6|g__Bacteroides.s__Bacteroides_vulgatus	1.7361111111
+UniRef90_R6HKZ5	1.7361111111
+UniRef90_R6HKZ5|g__Bacteroides.s__Bacteroides_dorei	1.7361111111
+UniRef90_R7NNG9	1.7361111111
+UniRef90_R7NNG9|g__Bacteroides.s__Bacteroides_vulgatus	1.7361111111
+UniRef90_R9HKA6	1.7361111111
+UniRef90_R9HKA6|g__Bacteroides.s__Bacteroides_vulgatus	1.7361111111
+UniRef90_A6L057	1.7331022530
+UniRef90_A6L057|g__Bacteroides.s__Bacteroides_vulgatus	1.7331022530
+UniRef90_K6AXK2	1.7316017316
+UniRef90_K6AXK2|g__Bacteroides.s__Bacteroides_dorei	1.7316017316
+UniRef90_R6HYQ9	1.7316017316
+UniRef90_R6HYQ9|g__Bacteroides.s__Bacteroides_dorei	1.7316017316
+UniRef90_R6IKU1	1.7316017316
+UniRef90_R6IKU1|g__Bacteroides.s__Bacteroides_dorei	1.7316017316
+UniRef90_R6SUV2	1.7316017316
+UniRef90_R6SUV2|g__Bacteroides.s__Bacteroides_dorei	1.7316017316
+UniRef90_A6KXR1	1.7275331185
+UniRef90_A6KXR1|g__Bacteroides.s__Bacteroides_dorei	0.8771929825
+UniRef90_A6KXR1|g__Bacteroides.s__Bacteroides_vulgatus	0.8503401361
+UniRef90_A6L2R7	1.7271157168
+UniRef90_A6L2R7|g__Bacteroides.s__Bacteroides_dorei	1.7271157168
+UniRef90_A6L4K9	1.7271157168
+UniRef90_A6L4K9|g__Bacteroides.s__Bacteroides_dorei	1.7271157168
+UniRef90_A6L577	1.7271157168
+UniRef90_A6L577|g__Bacteroides.s__Bacteroides_vulgatus	1.7271157168
+UniRef90_I8XX00	1.7271157168
+UniRef90_I8XX00|g__Bacteroides.s__Bacteroides_dorei	1.7271157168
+UniRef90_I9RE41	1.7271157168
+UniRef90_I9RE41|g__Bacteroides.s__Bacteroides_dorei	1.7271157168
+UniRef90_R6II57	1.7271157168
+UniRef90_R6II57|g__Bacteroides.s__Bacteroides_dorei	1.7271157168
+UniRef90_C3RB98	1.7226528854
+UniRef90_C3RB98|g__Bacteroides.s__Bacteroides_vulgatus	1.7226528854
+UniRef90_I9GA79	1.7226528854
+UniRef90_I9GA79|g__Bacteroides.s__Bacteroides_dorei	1.7226528854
+UniRef90_A0A015XGT9	1.7182130584
+UniRef90_A0A015XGT9|g__Bacteroides.s__Bacteroides_dorei	1.7182130584
+UniRef90_A6L704	1.7182130584
+UniRef90_A6L704|g__Bacteroides.s__Bacteroides_dorei	1.7182130584
+UniRef90_Q64S73	1.7182130584
+UniRef90_Q64S73|g__Bacteroides.s__Bacteroides_dorei	1.7182130584
+UniRef90_R5R7C8	1.7182130584
+UniRef90_R5R7C8|g__Bacteroides.s__Bacteroides_dorei	0.8591065292
+UniRef90_R5R7C8|g__Bacteroides.s__Bacteroides_vulgatus	0.8591065292
+UniRef90_R9HCI8	1.7182130584
+UniRef90_R9HCI8|g__Bacteroides.s__Bacteroides_vulgatus	1.7182130584
+UniRef90_E4VR67	1.7137960583
+UniRef90_E4VR67|g__Bacteroides.s__Bacteroides_dorei	1.7137960583
+UniRef90_I9G2M3	1.7137960583
+UniRef90_I9G2M3|g__Bacteroides.s__Bacteroides_dorei	1.7137960583
+UniRef90_A6L4R7	1.7094017094
+UniRef90_A6L4R7|g__Bacteroides.s__Bacteroides_dorei	1.7094017094
+UniRef90_C3Q267	1.7094017094
+UniRef90_C3Q267|g__Bacteroides.s__Bacteroides_dorei	1.7094017094
+UniRef90_R6IHW0	1.7094017094
+UniRef90_R6IHW0|g__Bacteroides.s__Bacteroides_dorei	1.7094017094
+UniRef90_A6L1X1	1.7050298380
+UniRef90_A6L1X1|g__Bacteroides.s__Bacteroides_dorei	1.7050298380
+UniRef90_A6L525	1.7050298380
+UniRef90_A6L525|g__Bacteroides.s__Bacteroides_dorei	1.7050298380
+UniRef90_C6Z4R3	1.7050298380
+UniRef90_C6Z4R3|g__Bacteroides.s__Bacteroides_vulgatus	1.7050298380
+UniRef90_I8WVI8	1.7050298380
+UniRef90_I8WVI8|g__Bacteroides.s__Bacteroides_vulgatus	1.7050298380
+UniRef90_A6L1J5	1.7006802721
+UniRef90_A6L1J5|g__Bacteroides.s__Bacteroides_dorei	1.7006802721
+UniRef90_A6L5A4	1.7006802721
+UniRef90_A6L5A4|g__Bacteroides.s__Bacteroides_vulgatus	1.7006802721
+UniRef90_D4V749	1.7006802721
+UniRef90_D4V749|g__Bacteroides.s__Bacteroides_dorei	1.7006802721
+UniRef90_Q64SA1	1.7006802721
+UniRef90_Q64SA1|g__Bacteroides.s__Bacteroides_dorei	1.7006802721
+UniRef90_R6HSV4	1.7006802721
+UniRef90_R6HSV4|g__Bacteroides.s__Bacteroides_dorei	1.1337868481
+UniRef90_R6HSV4|g__Bacteroides.s__Bacteroides_vulgatus	0.5668934240
+UniRef90_R7P332	1.7006802721
+UniRef90_R7P332|g__Bacteroides.s__Bacteroides_vulgatus	1.7006802721
+UniRef90_R9H4Q9	1.7006802721
+UniRef90_R9H4Q9|g__Bacteroides.s__Bacteroides_vulgatus	1.7006802721
+UniRef90_R6HV52	1.6963528414
+UniRef90_R6HV52|g__Bacteroides.s__Bacteroides_dorei	1.6963528414
+UniRef90_A6KWX6	1.6920473773
+UniRef90_A6KWX6|g__Bacteroides.s__Bacteroides_vulgatus	1.6920473773
+UniRef90_A6L7N3	1.6920473773
+UniRef90_A6L7N3|g__Bacteroides.s__Bacteroides_vulgatus	1.6920473773
+UniRef90_Q5LD58	1.6920473773
+UniRef90_Q5LD58|g__Bacteroides.s__Bacteroides_vulgatus	1.6920473773
+UniRef90_R6HPY5	1.6920473773
+UniRef90_R6HPY5|g__Bacteroides.s__Bacteroides_dorei	1.6920473773
+UniRef90_R7NUP1	1.6920473773
+UniRef90_R7NUP1|g__Bacteroides.s__Bacteroides_dorei	1.3536379019
+UniRef90_R7NUP1|g__Bacteroides.s__Bacteroides_vulgatus	0.3384094755
+UniRef90_A6KZW9	1.6891891892
+UniRef90_A6KZW9|g__Bacteroides.s__Bacteroides_vulgatus	1.6891891892
+UniRef90_R6HUH8	1.6835016835
+UniRef90_R6HUH8|g__Bacteroides.s__Bacteroides_dorei	1.6835016835
+UniRef90_R6HVP4	1.6835016835
+UniRef90_R6HVP4|g__Bacteroides.s__Bacteroides_dorei	1.6835016835
+UniRef90_A6L329	1.6792611251
+UniRef90_A6L329|g__Bacteroides.s__Bacteroides_vulgatus	1.6792611251
+UniRef90_A6L022	1.6750418760
+UniRef90_A6L022|g__Bacteroides.s__Bacteroides_dorei	1.2562814070
+UniRef90_A6L022|g__Bacteroides.s__Bacteroides_vulgatus	0.4187604690
+UniRef90_R9HNY2	1.6750418760
+UniRef90_R9HNY2|g__Bacteroides.s__Bacteroides_vulgatus	1.6750418760
+UniRef90_A6L791	1.6708437761
+UniRef90_A6L791|g__Bacteroides.s__Bacteroides_dorei	0.8354218881
+UniRef90_A6L791|g__Bacteroides.s__Bacteroides_vulgatus	0.8354218881
+UniRef90_R6HFR1	1.6708437761
+UniRef90_R6HFR1|g__Bacteroides.s__Bacteroides_dorei	1.6708437761
+UniRef90_R6HIF6	1.6708437761
+UniRef90_R6HIF6|g__Bacteroides.s__Bacteroides_vulgatus	1.6708437761
+UniRef90_R6IE27	1.6708437761
+UniRef90_R6IE27|g__Bacteroides.s__Bacteroides_dorei	1.6708437761
+UniRef90_A6L0I0	1.6666666667
+UniRef90_A6L0I0|g__Bacteroides.s__Bacteroides_vulgatus	1.6666666667
+UniRef90_A6L698	1.6666666667
+UniRef90_A6L698|g__Bacteroides.s__Bacteroides_vulgatus	1.6666666667
+UniRef90_R6HW10	1.6666666667
+UniRef90_R6HW10|g__Bacteroides.s__Bacteroides_dorei	1.6666666667
+UniRef90_R6IB44	1.6666666667
+UniRef90_R6IB44|g__Bacteroides.s__Bacteroides_vulgatus	1.6666666667
+UniRef90_A6L6B0	1.6583747927
+UniRef90_A6L6B0|g__Bacteroides.s__Bacteroides_dorei	1.6583747927
+UniRef90_E1WT29	1.6583747927
+UniRef90_E1WT29|g__Bacteroides.s__Bacteroides_vulgatus	1.6583747927
+UniRef90_R6HX89	1.6583747927
+UniRef90_R6HX89|g__Bacteroides.s__Bacteroides_vulgatus	1.6583747927
+UniRef90_R7NJF0	1.6583747927
+UniRef90_R7NJF0|g__Bacteroides.s__Bacteroides_vulgatus	1.6583747927
+UniRef90_R6HIR7	1.6542597188
+UniRef90_R6HIR7|g__Bacteroides.s__Bacteroides_vulgatus	1.6542597188
+UniRef90_R6HMB5	1.6542597188
+UniRef90_R6HMB5|g__Bacteroides.s__Bacteroides_dorei	1.6542597188
+UniRef90_A6KWI1	1.6501650165
+UniRef90_A6KWI1|g__Bacteroides.s__Bacteroides_vulgatus	1.6501650165
+UniRef90_A6L532	1.6501650165
+UniRef90_A6L532|g__Bacteroides.s__Bacteroides_vulgatus	1.6501650165
+UniRef90_R6HVF9	1.6501650165
+UniRef90_R6HVF9|g__Bacteroides.s__Bacteroides_vulgatus	1.6501650165
+UniRef90_R6HVU6	1.6501650165
+UniRef90_R6HVU6|g__Bacteroides.s__Bacteroides_dorei	1.6501650165
+UniRef90_R6IE33	1.6501650165
+UniRef90_R6IE33|g__Bacteroides.s__Bacteroides_vulgatus	1.6501650165
+UniRef90_R6III1	1.6501650165
+UniRef90_R6III1|g__Bacteroides.s__Bacteroides_vulgatus	1.6501650165
+UniRef90_I9R844	1.6474464580
+UniRef90_I9R844|g__Bacteroides.s__Bacteroides_dorei	1.6474464580
+UniRef90_A6KXK1	1.6460905350
+UniRef90_A6KXK1|g__Bacteroides.s__Bacteroides_dorei	0.8230452675
+UniRef90_A6KXK1|g__Bacteroides.s__Bacteroides_vulgatus	0.8230452675
+UniRef90_I9R3R3	1.6460905350
+UniRef90_I9R3R3|g__Bacteroides.s__Bacteroides_dorei	1.6460905350
+UniRef90_R9H521	1.6420361248
+UniRef90_R9H521|g__Bacteroides.s__Bacteroides_vulgatus	1.6420361248
+UniRef90_A6KZ33	1.6393442623
+UniRef90_A6KZ33|g__Bacteroides.s__Bacteroides_dorei	1.6393442623
+UniRef90_E6SNI8	1.6380016380
+UniRef90_E6SNI8|g__Bacteroides.s__Bacteroides_dorei	1.6380016380
+UniRef90_A6L0E5	1.6339869281
+UniRef90_A6L0E5|g__Bacteroides.s__Bacteroides_dorei	1.6339869281
+UniRef90_E6SQQ3	1.6339869281
+UniRef90_E6SQQ3|g__Bacteroides.s__Bacteroides_dorei	1.6339869281
+UniRef90_R6I0X6	1.6339869281
+UniRef90_R6I0X6|g__Bacteroides.s__Bacteroides_dorei	1.6339869281
+UniRef90_R9H4A1	1.6339869281
+UniRef90_R9H4A1|g__Bacteroides.s__Bacteroides_vulgatus	1.6339869281
+UniRef90_R9HGI1	1.6339869281
+UniRef90_R9HGI1|g__Bacteroides.s__Bacteroides_vulgatus	1.6339869281
+UniRef90_R9HT45	1.6339869281
+UniRef90_R9HT45|g__Bacteroides.s__Bacteroides_vulgatus	1.6339869281
+UniRef90_R9HH06	1.6307893020
+UniRef90_R9HH06|g__Bacteroides.s__Bacteroides_vulgatus	1.6307893020
+UniRef90_A6KWS9	1.6299918500
+UniRef90_A6KWS9|g__Bacteroides.s__Bacteroides_dorei	1.6299918500
+UniRef90_R6HU95	1.6260162602
+UniRef90_R6HU95|g__Bacteroides.s__Bacteroides_dorei	1.6260162602
+UniRef90_A6L408	1.6181229773
+UniRef90_A6L408|g__Bacteroides.s__Bacteroides_vulgatus	1.6181229773
+UniRef90_R7P1F5	1.6181229773
+UniRef90_R7P1F5|g__Bacteroides.s__Bacteroides_dorei	1.6181229773
+UniRef90_R9I6T8	1.6181229773
+UniRef90_R9I6T8|g__Bacteroides.s__Bacteroides_vulgatus	1.6181229773
+UniRef90_G5SSR9	1.6142050040
+UniRef90_G5SSR9|g__Bacteroides.s__Bacteroides_dorei	1.6142050040
+UniRef90_P94316	1.6142050040
+UniRef90_P94316|g__Bacteroides.s__Bacteroides_vulgatus	1.6142050040
+UniRef90_R5U4F7	1.6142050040
+UniRef90_R5U4F7|g__Bacteroides.s__Bacteroides_vulgatus	1.6142050040
+UniRef90_R6HZX7	1.6142050040
+UniRef90_R6HZX7|g__Bacteroides.s__Bacteroides_dorei	1.6142050040
+UniRef90_A6L174	1.6103059581
+UniRef90_A6L174|g__Bacteroides.s__Bacteroides_vulgatus	1.6103059581
+UniRef90_A6L2S1	1.6103059581
+UniRef90_A6L2S1|g__Bacteroides.s__Bacteroides_vulgatus	1.6103059581
+UniRef90_A6L3W9	1.6103059581
+UniRef90_A6L3W9|g__Bacteroides.s__Bacteroides_dorei	1.6103059581
+UniRef90_A6L6Z1	1.6103059581
+UniRef90_A6L6Z1|g__Bacteroides.s__Bacteroides_vulgatus	1.6103059581
+UniRef90_C6Z829	1.6103059581
+UniRef90_C6Z829|g__Bacteroides.s__Bacteroides_dorei	1.6103059581
+UniRef90_K5ZSD9	1.6103059581
+UniRef90_K5ZSD9|g__Bacteroides.s__Bacteroides_vulgatus	1.6103059581
+UniRef90_R7P0D4	1.6103059581
+UniRef90_R7P0D4|g__Bacteroides.s__Bacteroides_dorei	0.8051529791
+UniRef90_R7P0D4|g__Bacteroides.s__Bacteroides_vulgatus	0.8051529791
+UniRef90_A6KXW6	1.6025641026
+UniRef90_A6KXW6|g__Bacteroides.s__Bacteroides_vulgatus	1.0683760684
+UniRef90_A6KXW6|g__Bacteroides.s__Bacteroides_dorei	0.5341880342
+UniRef90_C6Z207	1.6025641026
+UniRef90_C6Z207|g__Bacteroides.s__Bacteroides_vulgatus	1.6025641026
+UniRef90_C3REH4	1.5987210232
+UniRef90_C3REH4|g__Bacteroides.s__Bacteroides_dorei	1.5987210232
+UniRef90_R6HHG3	1.5987210232
+UniRef90_R6HHG3|g__Bacteroides.s__Bacteroides_dorei	1.5987210232
+UniRef90_A6KX57	1.5979546181
+UniRef90_A6KX57|g__Bacteroides.s__Bacteroides_dorei	1.5979546181
+UniRef90_I9UCI8	1.5974440895
+UniRef90_I9UCI8|g__Bacteroides.s__Bacteroides_vulgatus	1.5974440895
+UniRef90_A6L437	1.5948963317
+UniRef90_A6L437|g__Bacteroides.s__Bacteroides_dorei	1.5948963317
+UniRef90_I8WPF9	1.5948963317
+UniRef90_I8WPF9|g__Bacteroides.s__Bacteroides_dorei	1.5948963317
+UniRef90_R6HKR7	1.5948963317
+UniRef90_R6HKR7|g__Bacteroides.s__Bacteroides_dorei	1.5948963317
+UniRef90_A6KXJ6	1.5910898966
+UniRef90_A6KXJ6|g__Bacteroides.s__Bacteroides_vulgatus	1.5910898966
+UniRef90_R6IKM7	1.5910898966
+UniRef90_R6IKM7|g__Bacteroides.s__Bacteroides_vulgatus	1.5910898966
+UniRef90_A6KYF6	1.5873015873
+UniRef90_A6KYF6|g__Bacteroides.s__Bacteroides_dorei	1.5873015873
+UniRef90_I9PIC1	1.5873015873
+UniRef90_I9PIC1|g__Bacteroides.s__Bacteroides_vulgatus	1.5873015873
+UniRef90_R7NYR8	1.5873015873
+UniRef90_R7NYR8|g__Bacteroides.s__Bacteroides_vulgatus	1.5873015873
+UniRef90_C6Z9X8	1.5835312747
+UniRef90_C6Z9X8|g__Bacteroides.s__Bacteroides_vulgatus	1.5835312747
+UniRef90_A6L0G3	1.5797788310
+UniRef90_A6L0G3|g__Bacteroides.s__Bacteroides_dorei	1.5797788310
+UniRef90_A6L651	1.5797788310
+UniRef90_A6L651|g__Bacteroides.s__Bacteroides_dorei	1.5797788310
+UniRef90_R9HPF7	1.5797788310
+UniRef90_R9HPF7|g__Bacteroides.s__Bacteroides_vulgatus	1.5797788310
+UniRef90_R7NYS3	1.5772870662
+UniRef90_R7NYS3|g__Bacteroides.s__Bacteroides_dorei	1.5772870662
+UniRef90_A6L0S0	1.5760441292
+UniRef90_A6L0S0|g__Bacteroides.s__Bacteroides_vulgatus	1.5760441292
+UniRef90_R6HMM4	1.5760441292
+UniRef90_R6HMM4|g__Bacteroides.s__Bacteroides_dorei	1.5760441292
+UniRef90_R6HSA7	1.5760441292
+UniRef90_R6HSA7|g__Bacteroides.s__Bacteroides_dorei	0.7880220646
+UniRef90_R6HSA7|g__Bacteroides.s__Bacteroides_vulgatus	0.7880220646
+UniRef90_R6HRZ7	1.5723270440
+UniRef90_R6HRZ7|g__Bacteroides.s__Bacteroides_dorei	1.5723270440
+UniRef90_R6ILU0	1.5686274510
+UniRef90_R6ILU0|g__Bacteroides.s__Bacteroides_dorei	0.7843137255
+UniRef90_R6ILU0|g__Bacteroides.s__Bacteroides_vulgatus	0.7843137255
+UniRef90_Q64SD4	1.5649452269
+UniRef90_Q64SD4|g__Bacteroides.s__Bacteroides_dorei	1.5649452269
+UniRef90_R6HSV5	1.5649452269
+UniRef90_R6HSV5|g__Bacteroides.s__Bacteroides_dorei	1.5649452269
+UniRef90_A6L6T1	1.5631299249
+UniRef90_A6L6T1|g__Bacteroides.s__Bacteroides_dorei	0.7843137255
+UniRef90_A6L6T1|g__Bacteroides.s__Bacteroides_vulgatus	0.7788161994
+UniRef90_Q64SE9	1.5612802498
+UniRef90_Q64SE9|g__Bacteroides.s__Bacteroides_dorei	1.5612802498
+UniRef90_A6KXX2	1.5576323988
+UniRef90_A6KXX2|g__Bacteroides.s__Bacteroides_vulgatus	1.5576323988
+UniRef90_Q8AA38	1.5576323988
+UniRef90_Q8AA38|g__Bacteroides.s__Bacteroides_vulgatus	1.5576323988
+UniRef90_R6HY37	1.5576323988
+UniRef90_R6HY37|g__Bacteroides.s__Bacteroides_dorei	1.5576323988
+UniRef90_R6HKA3	1.5521924719
+UniRef90_R6HKA3|g__Bacteroides.s__Bacteroides_dorei	0.7760962359
+UniRef90_R6HKA3|g__Bacteroides.s__Bacteroides_vulgatus	0.7760962359
+UniRef90_A0A015TXS0	1.5503875969
+UniRef90_A0A015TXS0|g__Bacteroides.s__Bacteroides_dorei	1.5503875969
+UniRef90_Q89YJ1	1.5503875969
+UniRef90_Q89YJ1|g__Bacteroides.s__Bacteroides_dorei	1.5503875969
+UniRef90_R6IGL3	1.5503875969
+UniRef90_R6IGL3|g__Bacteroides.s__Bacteroides_vulgatus	1.5503875969
+UniRef90_R6III8	1.5503875969
+UniRef90_R6III8|g__Bacteroides.s__Bacteroides_dorei	1.5503875969
+UniRef90_R9H4H5	1.5503875969
+UniRef90_R9H4H5|g__Bacteroides.s__Bacteroides_vulgatus	1.5503875969
+UniRef90_I8ZF58	1.5432098765
+UniRef90_I8ZF58|g__Bacteroides.s__Bacteroides_dorei	1.5432098765
+UniRef90_R6HRP8	1.5432098765
+UniRef90_R6HRP8|g__Bacteroides.s__Bacteroides_vulgatus	1.5432098765
+UniRef90_R6HXY9	1.5432098765
+UniRef90_R6HXY9|g__Bacteroides.s__Bacteroides_dorei	1.5432098765
+UniRef90_R6I0S8	1.5432098765
+UniRef90_R6I0S8|g__Bacteroides.s__Bacteroides_dorei	1.5432098765
+UniRef90_R7NYV3	1.5432098765
+UniRef90_R7NYV3|g__Bacteroides.s__Bacteroides_vulgatus	1.5432098765
+UniRef90_A6L7M6	1.5360983103
+UniRef90_A6L7M6|g__Bacteroides.s__Bacteroides_dorei	1.5360983103
+UniRef90_R6HQR8	1.5360983103
+UniRef90_R6HQR8|g__Bacteroides.s__Bacteroides_dorei	1.5360983103
+UniRef90_Q07719	1.5325670498
+UniRef90_Q07719|g__Bacteroides.s__Bacteroides_vulgatus	1.5325670498
+UniRef90_R5RWB0	1.5325670498
+UniRef90_R5RWB0|g__Bacteroides.s__Bacteroides_dorei	0.7662835249
+UniRef90_R5RWB0|g__Bacteroides.s__Bacteroides_vulgatus	0.7662835249
+UniRef90_R9HFU6	1.5325670498
+UniRef90_R9HFU6|g__Bacteroides.s__Bacteroides_vulgatus	1.5325670498
+UniRef90_R6HSG5	1.5290519878
+UniRef90_R6HSG5|g__Bacteroides.s__Bacteroides_vulgatus	0.9174311927
+UniRef90_R6HSG5|g__Bacteroides.s__Bacteroides_dorei	0.6116207951
+UniRef90_A6L3R8	1.5255530130
+UniRef90_A6L3R8|g__Bacteroides.s__Bacteroides_vulgatus	1.5255530130
+UniRef90_R6HJN4	1.5255530130
+UniRef90_R6HJN4|g__Bacteroides.s__Bacteroides_dorei	1.5255530130
+UniRef90_Q64SF4	1.5220700152
+UniRef90_Q64SF4|g__Bacteroides.s__Bacteroides_dorei	1.5220700152
+UniRef90_R6HW57	1.5186028853
+UniRef90_R6HW57|g__Bacteroides.s__Bacteroides_vulgatus	1.5186028853
+UniRef90_A6KX23	1.5151515152
+UniRef90_A6KX23|g__Bacteroides.s__Bacteroides_vulgatus	1.5151515152
+UniRef90_I8WIF2	1.5151515152
+UniRef90_I8WIF2|g__Bacteroides.s__Bacteroides_dorei	1.5151515152
+UniRef90_I8WPJ0	1.5151515152
+UniRef90_I8WPJ0|g__Bacteroides.s__Bacteroides_dorei	1.5151515152
+UniRef90_D4V3H5	1.5128593041
+UniRef90_D4V3H5|g__Bacteroides.s__Bacteroides_vulgatus	1.0085728694
+UniRef90_D4V3H5|g__Bacteroides.s__Bacteroides_dorei	0.5042864347
+UniRef90_I8W0W9	1.5082956259
+UniRef90_I8W0W9|g__Bacteroides.s__Bacteroides_dorei	1.5082956259
+UniRef90_R6HU33	1.5082956259
+UniRef90_R6HU33|g__Bacteroides.s__Bacteroides_dorei	1.5082956259
+UniRef90_R6HX13	1.5082956259
+UniRef90_R6HX13|g__Bacteroides.s__Bacteroides_vulgatus	1.5082956259
+UniRef90_R5REA9	1.5060240964
+UniRef90_R5REA9|g__Bacteroides.s__Bacteroides_vulgatus	1.0040160643
+UniRef90_R5REA9|g__Bacteroides.s__Bacteroides_dorei	0.5020080321
+UniRef90_R6Z7L2	1.5037593985
+UniRef90_R6Z7L2|g__Bacteroides.s__Bacteroides_dorei	1.5037593985
+UniRef90_A6L1S2	1.5015015015
+UniRef90_A6L1S2|g__Bacteroides.s__Bacteroides_vulgatus	1.5015015015
+UniRef90_R6HHT4	1.5015015015
+UniRef90_R6HHT4|g__Bacteroides.s__Bacteroides_dorei	1.5015015015
+UniRef90_R6HFQ1	1.4981273408
+UniRef90_R6HFQ1|g__Bacteroides.s__Bacteroides_dorei	1.4981273408
+UniRef90_I9RD01	1.4947683109
+UniRef90_I9RD01|g__Bacteroides.s__Bacteroides_dorei	1.4947683109
+UniRef90_Q8ABZ0	1.4914243102
+UniRef90_Q8ABZ0|g__Bacteroides.s__Bacteroides_vulgatus	1.4914243102
+UniRef90_K6BA88	1.4880952381
+UniRef90_K6BA88|g__Bacteroides.s__Bacteroides_dorei	1.4880952381
+UniRef90_R7P1Z1	1.4880952381
+UniRef90_R7P1Z1|g__Bacteroides.s__Bacteroides_vulgatus	1.4880952381
+UniRef90_I8WTY2	1.4847809948
+UniRef90_I8WTY2|g__Bacteroides.s__Bacteroides_dorei	0.7423904974
+UniRef90_I8WTY2|g__Bacteroides.s__Bacteroides_vulgatus	0.7423904974
+UniRef90_A0A015YDJ3	1.4814814815
+UniRef90_A0A015YDJ3|g__Bacteroides.s__Bacteroides_dorei	1.4814814815
+UniRef90_C6IQE1	1.4814814815
+UniRef90_C6IQE1|g__Bacteroides.s__Bacteroides_vulgatus	1.4814814815
+UniRef90_D4V723	1.4814814815
+UniRef90_D4V723|g__Bacteroides.s__Bacteroides_vulgatus	1.4814814815
+UniRef90_Q8ABY5	1.4814814815
+UniRef90_Q8ABY5|g__Bacteroides.s__Bacteroides_dorei	1.4814814815
+UniRef90_R6HFX7	1.4814814815
+UniRef90_R6HFX7|g__Bacteroides.s__Bacteroides_vulgatus	1.4814814815
+UniRef90_R6IGH4	1.4814814815
+UniRef90_R6IGH4|g__Bacteroides.s__Bacteroides_vulgatus	1.4814814815
+UniRef90_R7P3A9	1.4814814815
+UniRef90_R7P3A9|g__Bacteroides.s__Bacteroides_dorei	1.4814814815
+UniRef90_A6L592	1.4781966001
+UniRef90_A6L592|g__Bacteroides.s__Bacteroides_vulgatus	1.4781966001
+UniRef90_A6KXS9	1.4749262537
+UniRef90_A6KXS9|g__Bacteroides.s__Bacteroides_vulgatus	1.4749262537
+UniRef90_R6HJG0	1.4749262537
+UniRef90_R6HJG0|g__Bacteroides.s__Bacteroides_dorei	0.7374631268
+UniRef90_R6HJG0|g__Bacteroides.s__Bacteroides_vulgatus	0.7374631268
+UniRef90_R9H976	1.4749262537
+UniRef90_R9H976|g__Bacteroides.s__Bacteroides_vulgatus	1.4749262537
+UniRef90_R6IIV3	1.4716703458
+UniRef90_R6IIV3|g__Bacteroides.s__Bacteroides_dorei	1.4716703458
+UniRef90_R6HH18	1.4684287812
+UniRef90_R6HH18|g__Bacteroides.s__Bacteroides_dorei	1.4684287812
+UniRef90_R9HEN7	1.4684287812
+UniRef90_R9HEN7|g__Bacteroides.s__Bacteroides_vulgatus	1.4684287812
+UniRef90_A6L7B8	1.4662756598
+UniRef90_A6L7B8|g__Bacteroides.s__Bacteroides_dorei	1.4662756598
+UniRef90_A6KWE5	1.4619883041
+UniRef90_A6KWE5|g__Bacteroides.s__Bacteroides_vulgatus	1.4619883041
+UniRef90_A6L0U4	1.4619883041
+UniRef90_A6L0U4|g__Bacteroides.s__Bacteroides_vulgatus	1.4619883041
+UniRef90_A6L093	1.4587892050
+UniRef90_A6L093|g__Bacteroides.s__Bacteroides_dorei	1.4587892050
+UniRef90_A6L3H9	1.4556040757
+UniRef90_A6L3H9|g__Bacteroides.s__Bacteroides_vulgatus	1.4556040757
+UniRef90_R6HKB5	1.4556040757
+UniRef90_R6HKB5|g__Bacteroides.s__Bacteroides_dorei	1.4556040757
+UniRef90_R6HZS1	1.4556040757
+UniRef90_R6HZS1|g__Bacteroides.s__Bacteroides_vulgatus	1.4556040757
+UniRef90_R6HSI1	1.4524328250
+UniRef90_R6HSI1|g__Bacteroides.s__Bacteroides_vulgatus	1.4524328250
+UniRef90_A6L7M9	1.4492753623
+UniRef90_A6L7M9|g__Bacteroides.s__Bacteroides_vulgatus	1.4492753623
+UniRef90_I8W186	1.4430014430
+UniRef90_I8W186|g__Bacteroides.s__Bacteroides_dorei	1.4430014430
+UniRef90_Q64SC7	1.4430014430
+UniRef90_Q64SC7|g__Bacteroides.s__Bacteroides_dorei	1.4430014430
+UniRef90_R9HZS0	1.4398848092
+UniRef90_R9HZS0|g__Bacteroides.s__Bacteroides_dorei	1.4398848092
+UniRef90_R6IFM6	1.4367816092
+UniRef90_R6IFM6|g__Bacteroides.s__Bacteroides_vulgatus	1.4367816092
+UniRef90_R7P072	1.4367816092
+UniRef90_R7P072|g__Bacteroides.s__Bacteroides_vulgatus	1.4367816092
+UniRef90_R7P1C0	1.4367816092
+UniRef90_R7P1C0|g__Bacteroides.s__Bacteroides_vulgatus	1.4367816092
+UniRef90_R6IIS1	1.4367816092
+UniRef90_R6IIS1|g__Bacteroides.s__Bacteroides_dorei	1.4367816092
+UniRef90_R9HGN7	1.4357501795
+UniRef90_R9HGN7|g__Bacteroides.s__Bacteroides_vulgatus	1.4357501795
+UniRef90_A0A016CX89	1.4306151645
+UniRef90_A0A016CX89|g__Bacteroides.s__Bacteroides_dorei	1.4306151645
+UniRef90_C6ZBW8	1.4306151645
+UniRef90_C6ZBW8|g__Bacteroides.s__Bacteroides_dorei	1.4306151645
+UniRef90_R6HM22	1.4306151645
+UniRef90_R6HM22|g__Bacteroides.s__Bacteroides_dorei	1.4306151645
+UniRef90_R6HQ23	1.4306151645
+UniRef90_R6HQ23|g__Bacteroides.s__Bacteroides_vulgatus	1.4306151645
+UniRef90_R7NRL3	1.4306151645
+UniRef90_R7NRL3|g__Bacteroides.s__Bacteroides_dorei	1.4306151645
+UniRef90_R7NUE2	1.4306151645
+UniRef90_R7NUE2|g__Bacteroides.s__Bacteroides_vulgatus	1.4306151645
+UniRef90_R9HK29	1.4306151645
+UniRef90_R9HK29|g__Bacteroides.s__Bacteroides_vulgatus	1.4306151645
+UniRef90_I8VEK0	1.4275517488
+UniRef90_I8VEK0|g__Bacteroides.s__Bacteroides_dorei	1.4275517488
+UniRef90_R6HKI6	1.4275517488
+UniRef90_R6HKI6|g__Bacteroides.s__Bacteroides_vulgatus	1.4275517488
+UniRef90_R7NWE2	1.4275517488
+UniRef90_R7NWE2|g__Bacteroides.s__Bacteroides_dorei	1.4275517488
+UniRef90_R7NXC2	1.4275517488
+UniRef90_R7NXC2|g__Bacteroides.s__Bacteroides_dorei	1.4275517488
+UniRef90_A6KZJ8	1.4245014245
+UniRef90_A6KZJ8|g__Bacteroides.s__Bacteroides_dorei	1.4245014245
+UniRef90_A6L220	1.4245014245
+UniRef90_A6L220|g__Bacteroides.s__Bacteroides_dorei	1.4245014245
+UniRef90_D1K5A6	1.4245014245
+UniRef90_D1K5A6|g__Bacteroides.s__Bacteroides_dorei	1.4245014245
+UniRef90_R6HRD2	1.4214641080
+UniRef90_R6HRD2|g__Bacteroides.s__Bacteroides_vulgatus	1.4214641080
+UniRef90_A6KXP4	1.4184397163
+UniRef90_A6KXP4|g__Bacteroides.s__Bacteroides_vulgatus	1.4184397163
+UniRef90_A6L428	1.4184397163
+UniRef90_A6L428|g__Bacteroides.s__Bacteroides_vulgatus	1.4184397163
+UniRef90_F9Z5Q0	1.4184397163
+UniRef90_F9Z5Q0|g__Bacteroides.s__Bacteroides_vulgatus	1.4184397163
+UniRef90_Q64SD7	1.4184397163
+UniRef90_Q64SD7|g__Bacteroides.s__Bacteroides_dorei	1.4184397163
+UniRef90_R6HI55	1.4184397163
+UniRef90_R6HI55|g__Bacteroides.s__Bacteroides_dorei	1.4184397163
+UniRef90_R7P1T2	1.4154281670
+UniRef90_R7P1T2|g__Bacteroides.s__Bacteroides_dorei	1.4154281670
+UniRef90_I8VY13	1.4124293785
+UniRef90_I8VY13|g__Bacteroides.s__Bacteroides_dorei	1.4124293785
+UniRef90_R6IIQ7	1.4124293785
+UniRef90_R6IIQ7|g__Bacteroides.s__Bacteroides_dorei	1.4124293785
+UniRef90_R6IJX7	1.4124293785
+UniRef90_R6IJX7|g__Bacteroides.s__Bacteroides_vulgatus	1.4124293785
+UniRef90_R9HMS0	1.4124293785
+UniRef90_R9HMS0|g__Bacteroides.s__Bacteroides_vulgatus	1.4124293785
+UniRef90_A6L0E8	1.4094432699
+UniRef90_A6L0E8|g__Bacteroides.s__Bacteroides_vulgatus	1.4094432699
+UniRef90_A6L6T5	1.4094432699
+UniRef90_A6L6T5|g__Bacteroides.s__Bacteroides_vulgatus	1.4094432699
+UniRef90_I9FRB2	1.4094432699
+UniRef90_I9FRB2|g__Bacteroides.s__Bacteroides_dorei	1.4094432699
+UniRef90_C3QU78	1.4064697609
+UniRef90_C3QU78|g__Bacteroides.s__Bacteroides_dorei	1.4064697609
+UniRef90_R9HXH6	1.4064697609
+UniRef90_R9HXH6|g__Bacteroides.s__Bacteroides_vulgatus	1.4064697609
+UniRef90_I9QHX7	1.4035087719
+UniRef90_I9QHX7|g__Bacteroides.s__Bacteroides_dorei	1.4035087719
+UniRef90_R6IKM1	1.4035087719
+UniRef90_R6IKM1|g__Bacteroides.s__Bacteroides_dorei	1.4035087719
+UniRef90_C3R6R5	1.4005602241
+UniRef90_C3R6R5|g__Bacteroides.s__Bacteroides_vulgatus	1.4005602241
+UniRef90_I7BNP5	1.4005602241
+UniRef90_I7BNP5|g__Bacteroides.s__Bacteroides_dorei	1.4005602241
+UniRef90_R6IKP2	1.4005602241
+UniRef90_R6IKP2|g__Bacteroides.s__Bacteroides_dorei	1.4005602241
+UniRef90_I8XWD6	1.3976240391
+UniRef90_I8XWD6|g__Bacteroides.s__Bacteroides_dorei	0.6988120196
+UniRef90_I8XWD6|g__Bacteroides.s__Bacteroides_vulgatus	0.6988120196
+UniRef90_I9QBS1	1.3976240391
+UniRef90_I9QBS1|g__Bacteroides.s__Bacteroides_dorei	1.3976240391
+UniRef90_A6KZ31	1.3917884482
+UniRef90_A6KZ31|g__Bacteroides.s__Bacteroides_dorei	1.3917884482
+UniRef90_A6KYR2	1.3888888889
+UniRef90_A6KYR2|g__Bacteroides.s__Bacteroides_dorei	1.3888888889
+UniRef90_A6L2Q3	1.3888888889
+UniRef90_A6L2Q3|g__Bacteroides.s__Bacteroides_vulgatus	1.3888888889
+UniRef90_I8VRU4	1.3888888889
+UniRef90_I8VRU4|g__Bacteroides.s__Bacteroides_dorei	1.3888888889
+UniRef90_R9HT40	1.3888888889
+UniRef90_R9HT40|g__Bacteroides.s__Bacteroides_vulgatus	1.3888888889
+UniRef90_A6L2Y0	1.3860013860
+UniRef90_A6L2Y0|g__Bacteroides.s__Bacteroides_vulgatus	1.3860013860
+UniRef90_C3RDI9	1.3860013860
+UniRef90_C3RDI9|g__Bacteroides.s__Bacteroides_dorei	1.3860013860
+UniRef90_R7NV88	1.3860013860
+UniRef90_R7NV88|g__Bacteroides.s__Bacteroides_vulgatus	1.3860013860
+UniRef90_R9I2K5	1.3850415512
+UniRef90_R9I2K5|g__Bacteroides.s__Bacteroides_vulgatus	1.3850415512
+UniRef90_C3R9Y0	1.3845621322
+UniRef90_C3R9Y0|g__Bacteroides.s__Bacteroides_dorei	1.3845621322
+UniRef90_A6L2L1	1.3831258645
+UniRef90_A6L2L1|g__Bacteroides.s__Bacteroides_vulgatus	1.3831258645
+UniRef90_R7NZ87	1.3831258645
+UniRef90_R7NZ87|g__Bacteroides.s__Bacteroides_vulgatus	1.3831258645
+UniRef90_R6HI33	1.3802622498
+UniRef90_R6HI33|g__Bacteroides.s__Bacteroides_dorei	1.3802622498
+UniRef90_C3R541	1.3774104683
+UniRef90_C3R541|g__Bacteroides.s__Bacteroides_dorei	1.3774104683
+UniRef90_R7P1I2	1.3774104683
+UniRef90_R7P1I2|g__Bacteroides.s__Bacteroides_dorei	1.3774104683
+UniRef90_R7P011	1.3755158184
+UniRef90_R7P011|g__Bacteroides.s__Bacteroides_vulgatus	1.3755158184
+UniRef90_I8WEJ4	1.3745704467
+UniRef90_I8WEJ4|g__Bacteroides.s__Bacteroides_dorei	1.3745704467
+UniRef90_I9A6R3	1.3661202186
+UniRef90_I9A6R3|g__Bacteroides.s__Bacteroides_vulgatus	1.3661202186
+UniRef90_R9H4J8	1.3661202186
+UniRef90_R9H4J8|g__Bacteroides.s__Bacteroides_vulgatus	1.3661202186
+UniRef90_I9FT82	1.3605442177
+UniRef90_I9FT82|g__Bacteroides.s__Bacteroides_dorei	1.3605442177
+UniRef90_I9QUM5	1.3605442177
+UniRef90_I9QUM5|g__Bacteroides.s__Bacteroides_dorei	1.3605442177
+UniRef90_R9H4C0	1.3577732519
+UniRef90_R9H4C0|g__Bacteroides.s__Bacteroides_vulgatus	1.3577732519
+UniRef90_I8UUN1	1.3550135501
+UniRef90_I8UUN1|g__Bacteroides.s__Bacteroides_dorei	1.3550135501
+UniRef90_I8VTH8	1.3550135501
+UniRef90_I8VTH8|g__Bacteroides.s__Bacteroides_dorei	1.3550135501
+UniRef90_Q64SA9	1.3550135501
+UniRef90_Q64SA9|g__Bacteroides.s__Bacteroides_dorei	1.3550135501
+UniRef90_A6L080	1.3495276653
+UniRef90_A6L080|g__Bacteroides.s__Bacteroides_vulgatus	1.3495276653
+UniRef90_A6L0C7	1.3495276653
+UniRef90_A6L0C7|g__Bacteroides.s__Bacteroides_vulgatus	1.3495276653
+UniRef90_A6L1H9	1.3495276653
+UniRef90_A6L1H9|g__Bacteroides.s__Bacteroides_vulgatus	1.3495276653
+UniRef90_R9H4Z4	1.3495276653
+UniRef90_R9H4Z4|g__Bacteroides.s__Bacteroides_vulgatus	1.3495276653
+UniRef90_A6L0F4	1.3440860215
+UniRef90_A6L0F4|g__Bacteroides.s__Bacteroides_vulgatus	1.3440860215
+UniRef90_R7NTR2	1.3440860215
+UniRef90_R7NTR2|g__Bacteroides.s__Bacteroides_dorei	1.3440860215
+UniRef90_A6KXN2	1.3400335008
+UniRef90_A6KXN2|g__Bacteroides.s__Bacteroides_dorei	1.3400335008
+UniRef90_A6KXB4	1.3386880857
+UniRef90_A6KXB4|g__Bacteroides.s__Bacteroides_dorei	1.3386880857
+UniRef90_C3REY1	1.3386880857
+UniRef90_C3REY1|g__Bacteroides.s__Bacteroides_dorei	1.3386880857
+UniRef90_R6HXU4	1.3386880857
+UniRef90_R6HXU4|g__Bacteroides.s__Bacteroides_vulgatus	1.3386880857
+UniRef90_R9HGM4	1.3360053440
+UniRef90_R9HGM4|g__Bacteroides.s__Bacteroides_vulgatus	1.3360053440
+UniRef90_A6L1E9	1.3333333333
+UniRef90_A6L1E9|g__Bacteroides.s__Bacteroides_vulgatus	1.3333333333
+UniRef90_I9R3P1	1.3333333333
+UniRef90_I9R3P1|g__Bacteroides.s__Bacteroides_dorei	1.3333333333
+UniRef90_R9HFX7	1.3333333333
+UniRef90_R9HFX7|g__Bacteroides.s__Bacteroides_vulgatus	1.3333333333
+UniRef90_R7NY65	1.3320013320
+UniRef90_R7NY65|g__Bacteroides.s__Bacteroides_vulgatus	1.3320013320
+UniRef90_R6HF32	1.3297872340
+UniRef90_R6HF32|g__Bacteroides.s__Bacteroides_vulgatus	1.3297872340
+UniRef90_R6HTK2	1.3280212483
+UniRef90_R6HTK2|g__Bacteroides.s__Bacteroides_dorei	1.3280212483
+UniRef90_R6HWE3	1.3280212483
+UniRef90_R6HWE3|g__Bacteroides.s__Bacteroides_dorei	1.3280212483
+UniRef90_R9H4E4	1.3280212483
+UniRef90_R9H4E4|g__Bacteroides.s__Bacteroides_vulgatus	1.3280212483
+UniRef90_Q5L7N5	1.3253810471
+UniRef90_Q5L7N5|g__Bacteroides.s__Bacteroides_dorei	1.3253810471
+UniRef90_I9F0U3	1.3227513228
+UniRef90_I9F0U3|g__Bacteroides.s__Bacteroides_dorei	1.3227513228
+UniRef90_R9H3M5	1.3227513228
+UniRef90_R9H3M5|g__Bacteroides.s__Bacteroides_vulgatus	1.3227513228
+UniRef90_R6HSI7	1.3201320132
+UniRef90_R6HSI7|g__Bacteroides.s__Bacteroides_dorei	1.3201320132
+UniRef90_Q8A8P9	1.3175230567
+UniRef90_Q8A8P9|g__Bacteroides.s__Bacteroides_vulgatus	1.3175230567
+UniRef90_R6HXR8	1.3175230567
+UniRef90_R6HXR8|g__Bacteroides.s__Bacteroides_dorei	1.3175230567
+UniRef90_R9HK13	1.3175230567
+UniRef90_R9HK13|g__Bacteroides.s__Bacteroides_vulgatus	1.3175230567
+UniRef90_I9IXT6	1.3123359580
+UniRef90_I9IXT6|g__Bacteroides.s__Bacteroides_vulgatus	1.3123359580
+UniRef90_R6HRB2	1.3106159895
+UniRef90_R6HRB2|g__Bacteroides.s__Bacteroides_dorei	1.3106159895
+UniRef90_A6KXE8	1.3097576948
+UniRef90_A6KXE8|g__Bacteroides.s__Bacteroides_vulgatus	1.3097576948
+UniRef90_R6IEJ0	1.3097576948
+UniRef90_R6IEJ0|g__Bacteroides.s__Bacteroides_vulgatus	1.3097576948
+UniRef90_R6HSY4	1.3071895425
+UniRef90_R6HSY4|g__Bacteroides.s__Bacteroides_dorei	1.3071895425
+UniRef90_E5UPI7	1.3046314416
+UniRef90_E5UPI7|g__Bacteroides.s__Bacteroides_dorei	0.6523157208
+UniRef90_E5UPI7|g__Bacteroides.s__Bacteroides_vulgatus	0.6523157208
+UniRef90_A0A016AWW1	1.3020833333
+UniRef90_A0A016AWW1|g__Bacteroides.s__Bacteroides_dorei	1.3020833333
+UniRef90_I9QGR8	1.3020833333
+UniRef90_I9QGR8|g__Bacteroides.s__Bacteroides_dorei	1.3020833333
+UniRef90_R5W3T1	1.3020833333
+UniRef90_R5W3T1|g__Bacteroides.s__Bacteroides_vulgatus	1.3020833333
+UniRef90_R5MIX2	1.2995451592
+UniRef90_R5MIX2|g__Bacteroides.s__Bacteroides_vulgatus	1.2995451592
+UniRef90_R6IIK1	1.2919896641
+UniRef90_R6IIK1|g__Bacteroides.s__Bacteroides_dorei	1.2919896641
+UniRef90_R7P4B4	1.2919896641
+UniRef90_R7P4B4|g__Bacteroides.s__Bacteroides_vulgatus	1.2919896641
+UniRef90_R6HUF0	1.2894906512
+UniRef90_R6HUF0|g__Bacteroides.s__Bacteroides_dorei	1.2894906512
+UniRef90_R6HWD3	1.2894906512
+UniRef90_R6HWD3|g__Bacteroides.s__Bacteroides_dorei	0.6447453256
+UniRef90_R6HWD3|g__Bacteroides.s__Bacteroides_vulgatus	0.6447453256
+UniRef90_R7NZI1	1.2886597938
+UniRef90_R7NZI1|g__Bacteroides.s__Bacteroides_vulgatus	1.2886597938
+UniRef90_D4V4X5	1.2870012870
+UniRef90_D4V4X5|g__Bacteroides.s__Bacteroides_vulgatus	1.2870012870
+UniRef90_I9A2S6	1.2870012870
+UniRef90_I9A2S6|g__Bacteroides.s__Bacteroides_vulgatus	1.2870012870
+UniRef90_R6DC54	1.2870012870
+UniRef90_R6DC54|g__Bacteroides.s__Bacteroides_vulgatus	1.2870012870
+UniRef90_R6HTX3	1.2870012870
+UniRef90_R6HTX3|g__Bacteroides.s__Bacteroides_dorei	1.2870012870
+UniRef90_I8VXH7	1.2820512821
+UniRef90_I8VXH7|g__Bacteroides.s__Bacteroides_dorei	1.2820512821
+UniRef90_R7ECK7	1.2820512821
+UniRef90_R7ECK7|g__Bacteroides.s__Bacteroides_dorei	1.2820512821
+UniRef90_T4HXA1	1.2820512821
+UniRef90_T4HXA1|g__Bacteroides.s__Bacteroides_dorei	1.2820512821
+UniRef90_R7P0U6	1.2795905310
+UniRef90_R7P0U6|g__Bacteroides.s__Bacteroides_vulgatus	1.2795905310
+UniRef90_A6L3Y8	1.2771392082
+UniRef90_A6L3Y8|g__Bacteroides.s__Bacteroides_dorei	1.2771392082
+UniRef90_A6KZM4	1.2746972594
+UniRef90_A6KZM4|g__Bacteroides.s__Bacteroides_dorei	1.2746972594
+UniRef90_A6L6V3	1.2722646310
+UniRef90_A6L6V3|g__Bacteroides.s__Bacteroides_vulgatus	1.2722646310
+UniRef90_R7P2Q1	1.2722646310
+UniRef90_R7P2Q1|g__Bacteroides.s__Bacteroides_vulgatus	1.2722646310
+UniRef90_A6L535	1.2674271229
+UniRef90_A6L535|g__Bacteroides.s__Bacteroides_dorei	1.2674271229
+UniRef90_A6L7C8	1.2674271229
+UniRef90_A6L7C8|g__Bacteroides.s__Bacteroides_vulgatus	1.2674271229
+UniRef90_B3CD11	1.2674271229
+UniRef90_B3CD11|g__Bacteroides.s__Bacteroides_vulgatus	1.2674271229
+UniRef90_K1FTX5	1.2674271229
+UniRef90_K1FTX5|g__Bacteroides.s__Bacteroides_dorei	1.2674271229
+UniRef90_Q64SI8	1.2674271229
+UniRef90_Q64SI8|g__Bacteroides.s__Bacteroides_dorei	1.2674271229
+UniRef90_R9H7J3	1.2674271229
+UniRef90_R9H7J3|g__Bacteroides.s__Bacteroides_vulgatus	1.2674271229
+UniRef90_A6KYM0	1.2651360201
+UniRef90_A6KYM0|g__Bacteroides.s__Bacteroides_dorei	0.6385696041
+UniRef90_A6KYM0|g__Bacteroides.s__Bacteroides_vulgatus	0.6265664160
+UniRef90_R7NYG6	1.2650221379
+UniRef90_R7NYG6|g__Bacteroides.s__Bacteroides_vulgatus	1.2650221379
+UniRef90_R9H6R7	1.2626262626
+UniRef90_R9H6R7|g__Bacteroides.s__Bacteroides_vulgatus	1.2626262626
+UniRef90_S0FBR1	1.2626262626
+UniRef90_S0FBR1|g__Bacteroides.s__Bacteroides_dorei	1.2626262626
+UniRef90_A6KX81	1.2578616352
+UniRef90_A6KX81|g__Bacteroides.s__Bacteroides_vulgatus	1.2578616352
+UniRef90_C6Z3G4	1.2578616352
+UniRef90_C6Z3G4|g__Bacteroides.s__Bacteroides_dorei	0.6289308176
+UniRef90_C6Z3G4|g__Bacteroides.s__Bacteroides_vulgatus	0.6289308176
+UniRef90_R7P1T9	1.2554927809
+UniRef90_R7P1T9|g__Bacteroides.s__Bacteroides_vulgatus	1.2554927809
+UniRef90_R9HER8	1.2531328321
+UniRef90_R9HER8|g__Bacteroides.s__Bacteroides_vulgatus	1.2531328321
+UniRef90_R6HXX4	1.2507817386
+UniRef90_R6HXX4|g__Bacteroides.s__Bacteroides_vulgatus	1.2507817386
+UniRef90_R6IJE7	1.2507817386
+UniRef90_R6IJE7|g__Bacteroides.s__Bacteroides_dorei	0.6253908693
+UniRef90_R6IJE7|g__Bacteroides.s__Bacteroides_vulgatus	0.6253908693
+UniRef90_R6IGP6	1.2496094970
+UniRef90_R6IGP6|g__Bacteroides.s__Bacteroides_dorei	0.6248047485
+UniRef90_R6IGP6|g__Bacteroides.s__Bacteroides_vulgatus	0.6248047485
+UniRef90_A6KX84	1.2437810945
+UniRef90_A6KX84|g__Bacteroides.s__Bacteroides_dorei	0.6218905473
+UniRef90_A6KX84|g__Bacteroides.s__Bacteroides_vulgatus	0.6218905473
+UniRef90_A0A015V1U6	1.2391573730
+UniRef90_A0A015V1U6|g__Bacteroides.s__Bacteroides_dorei	1.2391573730
+UniRef90_D4V8W2	1.2391573730
+UniRef90_D4V8W2|g__Bacteroides.s__Bacteroides_vulgatus	1.2391573730
+UniRef90_R6IF57	1.2391573730
+UniRef90_R6IF57|g__Bacteroides.s__Bacteroides_dorei	1.2391573730
+UniRef90_R7NU19	1.2391573730
+UniRef90_R7NU19|g__Bacteroides.s__Bacteroides_vulgatus	1.2391573730
+UniRef90_C3QU71	1.2345679012
+UniRef90_C3QU71|g__Bacteroides.s__Bacteroides_dorei	1.2345679012
+UniRef90_I8W4J7	1.2345679012
+UniRef90_I8W4J7|g__Bacteroides.s__Bacteroides_dorei	1.2345679012
+UniRef90_A6L4F5	1.2322858903
+UniRef90_A6L4F5|g__Bacteroides.s__Bacteroides_dorei	1.2322858903
+UniRef90_R6I173	1.2322858903
+UniRef90_R6I173|g__Bacteroides.s__Bacteroides_vulgatus	1.2322858903
+UniRef90_I8WID7	1.2300123001
+UniRef90_I8WID7|g__Bacteroides.s__Bacteroides_dorei	1.2300123001
+UniRef90_R7P4E9	1.2300123001
+UniRef90_R7P4E9|g__Bacteroides.s__Bacteroides_dorei	1.2300123001
+UniRef90_I8WBQ4	1.2277470841
+UniRef90_I8WBQ4|g__Bacteroides.s__Bacteroides_dorei	1.2277470841
+UniRef90_A6L7U0	1.2254901961
+UniRef90_A6L7U0|g__Bacteroides.s__Bacteroides_dorei	1.2254901961
+UniRef90_C3QUG1	1.2254901961
+UniRef90_C3QUG1|g__Bacteroides.s__Bacteroides_dorei	1.2254901961
+UniRef90_R9HBT1	1.2254901961
+UniRef90_R9HBT1|g__Bacteroides.s__Bacteroides_vulgatus	1.2254901961
+UniRef90_I9RCZ8	1.2210012210
+UniRef90_I9RCZ8|g__Bacteroides.s__Bacteroides_dorei	1.2210012210
+UniRef90_D4VMX4	1.2187690433
+UniRef90_D4VMX4|g__Bacteroides.s__Bacteroides_dorei	1.2187690433
+UniRef90_R6HT46	1.2187690433
+UniRef90_R6HT46|g__Bacteroides.s__Bacteroides_vulgatus	1.2187690433
+UniRef90_R6IM44	1.2187690433
+UniRef90_R6IM44|g__Bacteroides.s__Bacteroides_dorei	1.2187690433
+UniRef90_A6KXZ8	1.2165450122
+UniRef90_A6KXZ8|g__Bacteroides.s__Bacteroides_dorei	1.2165450122
+UniRef90_C6Z3K9	1.2165450122
+UniRef90_C6Z3K9|g__Bacteroides.s__Bacteroides_vulgatus	1.2165450122
+UniRef90_R6HWK0	1.2165450122
+UniRef90_R6HWK0|g__Bacteroides.s__Bacteroides_vulgatus	1.2165450122
+UniRef90_R6IF93	1.2165450122
+UniRef90_R6IF93|g__Bacteroides.s__Bacteroides_dorei	1.2165450122
+UniRef90_R6LHU5	1.2165450122
+UniRef90_R6LHU5|g__Bacteroides.s__Bacteroides_dorei	1.2165450122
+UniRef90_A6L2E5	1.2121212121
+UniRef90_A6L2E5|g__Bacteroides.s__Bacteroides_dorei	1.2121212121
+UniRef90_R6HR92	1.2121212121
+UniRef90_R6HR92|g__Bacteroides.s__Bacteroides_vulgatus	1.2121212121
+UniRef90_A6KZ76	1.2077294686
+UniRef90_A6KZ76|g__Bacteroides.s__Bacteroides_vulgatus	1.2077294686
+UniRef90_E5X0C2	1.2077294686
+UniRef90_E5X0C2|g__Bacteroides.s__Bacteroides_dorei	1.2077294686
+UniRef90_I8WK51	1.2077294686
+UniRef90_I8WK51|g__Bacteroides.s__Bacteroides_dorei	1.2077294686
+UniRef90_I9E8J1	1.2077294686
+UniRef90_I9E8J1|g__Bacteroides.s__Bacteroides_vulgatus	1.2077294686
+UniRef90_R6HIB2	1.2077294686
+UniRef90_R6HIB2|g__Bacteroides.s__Bacteroides_dorei	1.2077294686
+UniRef90_R6HWH4	1.2055455093
+UniRef90_R6HWH4|g__Bacteroides.s__Bacteroides_dorei	1.2055455093
+UniRef90_R9HR23	1.2033694344
+UniRef90_R9HR23|g__Bacteroides.s__Bacteroides_vulgatus	1.2033694344
+UniRef90_C6IR38	1.1968880910
+UniRef90_C6IR38|g__Bacteroides.s__Bacteroides_vulgatus	1.1968880910
+UniRef90_R6HTS6	1.1947431302
+UniRef90_R6HTS6|g__Bacteroides.s__Bacteroides_dorei	0.5973715651
+UniRef90_R6HTS6|g__Bacteroides.s__Bacteroides_vulgatus	0.5973715651
+UniRef90_A6KXB3	1.1904761905
+UniRef90_A6KXB3|g__Bacteroides.s__Bacteroides_dorei	1.1904761905
+UniRef90_R5W221	1.1904761905
+UniRef90_R5W221|g__Bacteroides.s__Bacteroides_vulgatus	1.1904761905
+UniRef90_R6I038	1.1904761905
+UniRef90_R6I038|g__Bacteroides.s__Bacteroides_dorei	1.1904761905
+UniRef90_R7P0P1	1.1904761905
+UniRef90_R7P0P1|g__Bacteroides.s__Bacteroides_vulgatus	1.1904761905
+UniRef90_A6L4D5	1.1876484561
+UniRef90_A6L4D5|g__Bacteroides.s__Bacteroides_vulgatus	1.1876484561
+UniRef90_I9QS55	1.1862396204
+UniRef90_I9QS55|g__Bacteroides.s__Bacteroides_dorei	1.1862396204
+UniRef90_Q5L8Z8	1.1862396204
+UniRef90_Q5L8Z8|g__Bacteroides.s__Bacteroides_vulgatus	1.1862396204
+UniRef90_R6HFY6	1.1862396204
+UniRef90_R6HFY6|g__Bacteroides.s__Bacteroides_dorei	1.1862396204
+UniRef90_A6L2H5	1.1834319527
+UniRef90_A6L2H5|g__Bacteroides.s__Bacteroides_vulgatus	1.1834319527
+UniRef90_R6HSJ7	1.1778563015
+UniRef90_R6HSJ7|g__Bacteroides.s__Bacteroides_dorei	1.1778563015
+UniRef90_D1K6Q1	1.1757789536
+UniRef90_D1K6Q1|g__Bacteroides.s__Bacteroides_dorei	1.1757789536
+UniRef90_A6KYP8	1.1737089202
+UniRef90_A6KYP8|g__Bacteroides.s__Bacteroides_vulgatus	1.1737089202
+UniRef90_R6HTC4	1.1737089202
+UniRef90_R6HTC4|g__Bacteroides.s__Bacteroides_dorei	0.5868544601
+UniRef90_R6HTC4|g__Bacteroides.s__Bacteroides_vulgatus	0.5868544601
+UniRef90_C3R7J0	1.1695906433
+UniRef90_C3R7J0|g__Bacteroides.s__Bacteroides_dorei	1.1695906433
+UniRef90_I9F748	1.1695906433
+UniRef90_I9F748|g__Bacteroides.s__Bacteroides_dorei	1.1695906433
+UniRef90_R6HY19	1.1675423234
+UniRef90_R6HY19|g__Bacteroides.s__Bacteroides_dorei	1.1675423234
+UniRef90_A6L023	1.1655011655
+UniRef90_A6L023|g__Bacteroides.s__Bacteroides_vulgatus	1.1655011655
+UniRef90_I8W4I9	1.1655011655
+UniRef90_I8W4I9|g__Bacteroides.s__Bacteroides_dorei	1.1655011655
+UniRef90_I9Q8J8	1.1655011655
+UniRef90_I9Q8J8|g__Bacteroides.s__Bacteroides_dorei	1.1655011655
+UniRef90_R0JG28	1.1655011655
+UniRef90_R0JG28|g__Bacteroides.s__Bacteroides_vulgatus	1.1655011655
+UniRef90_R7NV52	1.1614401858
+UniRef90_R7NV52|g__Bacteroides.s__Bacteroides_dorei	1.1614401858
+UniRef90_I8WF93	1.1594202899
+UniRef90_I8WF93|g__Bacteroides.s__Bacteroides_dorei	1.1594202899
+UniRef90_I9U6P8	1.1574074074
+UniRef90_I9U6P8|g__Bacteroides.s__Bacteroides_vulgatus	1.1574074074
+UniRef90_R6HSX5	1.1554015020
+UniRef90_R6HSX5|g__Bacteroides.s__Bacteroides_dorei	1.1554015020
+UniRef90_P30899	1.1534025375
+UniRef90_P30899|g__Bacteroides.s__Bacteroides_dorei	1.1534025375
+UniRef90_A6KZ99	1.1494252874
+UniRef90_A6KZ99|g__Bacteroides.s__Bacteroides_dorei	0.5747126437
+UniRef90_A6KZ99|g__Bacteroides.s__Bacteroides_vulgatus	0.5747126437
+UniRef90_C3QU70	1.1494252874
+UniRef90_C3QU70|g__Bacteroides.s__Bacteroides_dorei	1.1494252874
+UniRef90_I8VEU7	1.1441647597
+UniRef90_I8VEU7|g__Bacteroides.s__Bacteroides_dorei	1.1441647597
+UniRef90_A6L5U4	1.1376564278
+UniRef90_A6L5U4|g__Bacteroides.s__Bacteroides_dorei	1.1376564278
+UniRef90_C3R531	1.1376564278
+UniRef90_C3R531|g__Bacteroides.s__Bacteroides_dorei	1.1376564278
+UniRef90_I9F0F6	1.1376564278
+UniRef90_I9F0F6|g__Bacteroides.s__Bacteroides_dorei	1.1376564278
+UniRef90_I9TW17	1.1376564278
+UniRef90_I9TW17|g__Bacteroides.s__Bacteroides_dorei	0.5688282139
+UniRef90_I9TW17|g__Bacteroides.s__Bacteroides_vulgatus	0.5688282139
+UniRef90_R9H5F8	1.1337868481
+UniRef90_R9H5F8|g__Bacteroides.s__Bacteroides_vulgatus	1.1337868481
+UniRef90_A6L622	1.1299435028
+UniRef90_A6L622|g__Bacteroides.s__Bacteroides_vulgatus	1.1299435028
+UniRef90_C6Z205	1.1299435028
+UniRef90_C6Z205|g__Bacteroides.s__Bacteroides_vulgatus	1.1299435028
+UniRef90_D1K0Z5	1.1299435028
+UniRef90_D1K0Z5|g__Bacteroides.s__Bacteroides_dorei	1.1299435028
+UniRef90_R7NYJ2	1.1299435028
+UniRef90_R7NYJ2|g__Bacteroides.s__Bacteroides_dorei	1.1299435028
+UniRef90_R9H126	1.1299435028
+UniRef90_R9H126|g__Bacteroides.s__Bacteroides_vulgatus	1.1299435028
+UniRef90_F0R8Z7	1.1261261261
+UniRef90_F0R8Z7|g__Bacteroides.s__Bacteroides_dorei	1.1261261261
+UniRef90_R6HM14	1.1261261261
+UniRef90_R6HM14|g__Bacteroides.s__Bacteroides_vulgatus	1.1261261261
+UniRef90_R9H7P9	1.1261261261
+UniRef90_R9H7P9|g__Bacteroides.s__Bacteroides_vulgatus	1.1261261261
+UniRef90_R6HR50	1.1242270939
+UniRef90_R6HR50|g__Bacteroides.s__Bacteroides_dorei	0.5621135469
+UniRef90_R6HR50|g__Bacteroides.s__Bacteroides_vulgatus	0.5621135469
+UniRef90_R9HCW9	1.1242270939
+UniRef90_R9HCW9|g__Bacteroides.s__Bacteroides_vulgatus	1.1242270939
+UniRef90_A6L727	1.1223344557
+UniRef90_A6L727|g__Bacteroides.s__Bacteroides_dorei	1.1223344557
+UniRef90_Q89YI7	1.1204481793
+UniRef90_Q89YI7|g__Bacteroides.s__Bacteroides_dorei	1.1204481793
+UniRef90_D4VE41	1.1185682327
+UniRef90_D4VE41|g__Bacteroides.s__Bacteroides_vulgatus	1.1185682327
+UniRef90_I9QYN6	1.1185682327
+UniRef90_I9QYN6|g__Bacteroides.s__Bacteroides_vulgatus	1.1185682327
+UniRef90_Q64SC4	1.1166945840
+UniRef90_Q64SC4|g__Bacteroides.s__Bacteroides_dorei	1.1166945840
+UniRef90_A6L675	1.1148272018
+UniRef90_A6L675|g__Bacteroides.s__Bacteroides_dorei	1.1148272018
+UniRef90_A6L7M8	1.1148272018
+UniRef90_A6L7M8|g__Bacteroides.s__Bacteroides_dorei	1.1148272018
+UniRef90_R6F8D9	1.1148272018
+UniRef90_R6F8D9|g__Bacteroides.s__Bacteroides_vulgatus	1.1148272018
+UniRef90_R6HHI0	1.1148272018
+UniRef90_R6HHI0|g__Bacteroides.s__Bacteroides_dorei	1.1148272018
+UniRef90_A6KXZ9	1.1111111111
+UniRef90_A6KXZ9|g__Bacteroides.s__Bacteroides_dorei	1.1111111111
+UniRef90_R6HFN1	1.1092623405
+UniRef90_R6HFN1|g__Bacteroides.s__Bacteroides_dorei	1.1092623405
+UniRef90_A6KY06	1.1074197121
+UniRef90_A6KY06|g__Bacteroides.s__Bacteroides_vulgatus	1.1074197121
+UniRef90_I9R1R1	1.1074197121
+UniRef90_I9R1R1|g__Bacteroides.s__Bacteroides_dorei	1.1074197121
+UniRef90_R9H3C3	1.1037527594
+UniRef90_R9H3C3|g__Bacteroides.s__Bacteroides_vulgatus	1.1037527594
+UniRef90_R7CW30	1.1001100110
+UniRef90_R7CW30|g__Bacteroides.s__Bacteroides_vulgatus	1.1001100110
+UniRef90_R6IIW9	1.0964912281
+UniRef90_R6IIW9|g__Bacteroides.s__Bacteroides_dorei	1.0964912281
+UniRef90_R7NYV0	1.0964912281
+UniRef90_R7NYV0|g__Bacteroides.s__Bacteroides_dorei	1.0964912281
+UniRef90_C3RB95	1.0928961749
+UniRef90_C3RB95|g__Bacteroides.s__Bacteroides_dorei	1.0928961749
+UniRef90_R6IJ85	1.0928961749
+UniRef90_R6IJ85|g__Bacteroides.s__Bacteroides_vulgatus	1.0928961749
+UniRef90_A6L175	1.0893246187
+UniRef90_A6L175|g__Bacteroides.s__Bacteroides_dorei	1.0893246187
+UniRef90_D1QNX9	1.0893246187
+UniRef90_D1QNX9|g__Bacteroides.s__Bacteroides_dorei	1.0893246187
+UniRef90_R6HVH2	1.0893246187
+UniRef90_R6HVH2|g__Bacteroides.s__Bacteroides_vulgatus	1.0893246187
+UniRef90_R9H1D0	1.0875475802
+UniRef90_R9H1D0|g__Bacteroides.s__Bacteroides_vulgatus	1.0875475802
+UniRef90_A6L5E2	1.0857763301
+UniRef90_A6L5E2|g__Bacteroides.s__Bacteroides_dorei	1.0857763301
+UniRef90_R6HKL8	1.0857763301
+UniRef90_R6HKL8|g__Bacteroides.s__Bacteroides_vulgatus	1.0857763301
+UniRef90_R6HQ86	1.0857763301
+UniRef90_R6HQ86|g__Bacteroides.s__Bacteroides_vulgatus	1.0857763301
+UniRef90_R6JB47	1.0857763301
+UniRef90_R6JB47|g__Bacteroides.s__Bacteroides_vulgatus	1.0857763301
+UniRef90_R7NZS1	1.0840108401
+UniRef90_R7NZS1|g__Bacteroides.s__Bacteroides_dorei	1.0840108401
+UniRef90_R0HEY5	1.0787486516
+UniRef90_R0HEY5|g__Bacteroides.s__Bacteroides_dorei	1.0787486516
+UniRef90_R9HPD9	1.0770059235
+UniRef90_R9HPD9|g__Bacteroides.s__Bacteroides_vulgatus	1.0770059235
+UniRef90_A0A017P703	1.0752688172
+UniRef90_A0A017P703|g__Bacteroides.s__Bacteroides_dorei	1.0752688172
+UniRef90_A6L2W0	1.0718113612
+UniRef90_A6L2W0|g__Bacteroides.s__Bacteroides_vulgatus	1.0718113612
+UniRef90_D4V6T9	1.0683760684
+UniRef90_D4V6T9|g__Bacteroides.s__Bacteroides_dorei	1.0683760684
+UniRef90_I8WMN8	1.0683760684
+UniRef90_I8WMN8|g__Bacteroides.s__Bacteroides_dorei	1.0683760684
+UniRef90_A6KZU9	1.0649627263
+UniRef90_A6KZU9|g__Bacteroides.s__Bacteroides_dorei	1.0649627263
+UniRef90_I8W6X7	1.0649627263
+UniRef90_I8W6X7|g__Bacteroides.s__Bacteroides_dorei	1.0649627263
+UniRef90_I8W9N7	1.0649627263
+UniRef90_I8W9N7|g__Bacteroides.s__Bacteroides_dorei	1.0649627263
+UniRef90_A6KZM2	1.0632642212
+UniRef90_A6KZM2|g__Bacteroides.s__Bacteroides_dorei	1.0632642212
+UniRef90_R9H3T5	1.0624169987
+UniRef90_R9H3T5|g__Bacteroides.s__Bacteroides_vulgatus	1.0624169987
+UniRef90_A6L7H6	1.0615711253
+UniRef90_A6L7H6|g__Bacteroides.s__Bacteroides_dorei	1.0615711253
+UniRef90_C3PZ91	1.0615711253
+UniRef90_C3PZ91|g__Bacteroides.s__Bacteroides_vulgatus	1.0615711253
+UniRef90_C3R6S6	1.0482180294
+UniRef90_C3R6S6|g__Bacteroides.s__Bacteroides_vulgatus	1.0482180294
+UniRef90_R6HWZ4	1.0482180294
+UniRef90_R6HWZ4|g__Bacteroides.s__Bacteroides_dorei	1.0482180294
+UniRef90_D1JZ96	1.0449320794
+UniRef90_D1JZ96|g__Bacteroides.s__Bacteroides_vulgatus	1.0449320794
+UniRef90_I8W3H0	1.0384215992
+UniRef90_I8W3H0|g__Bacteroides.s__Bacteroides_dorei	1.0384215992
+UniRef90_R5V8R4	1.0384215992
+UniRef90_R5V8R4|g__Bacteroides.s__Bacteroides_dorei	1.0384215992
+UniRef90_A6L4N4	1.0321129317
+UniRef90_A6L4N4|g__Bacteroides.s__Bacteroides_vulgatus	0.5216484090
+UniRef90_A6L4N4|g__Bacteroides.s__Bacteroides_dorei	0.5104645227
+UniRef90_A6L7I9	1.0303967027
+UniRef90_A6L7I9|g__Bacteroides.s__Bacteroides_vulgatus	1.0303967027
+UniRef90_A6L786	1.0256410256
+UniRef90_A6L786|g__Bacteroides.s__Bacteroides_vulgatus	1.0256410256
+UniRef90_R6IFR3	1.0227860095
+UniRef90_R6IFR3|g__Bacteroides.s__Bacteroides_vulgatus	0.5200208008
+UniRef90_R6IFR3|g__Bacteroides.s__Bacteroides_dorei	0.5027652086
+UniRef90_A6L752	1.0224948875
+UniRef90_A6L752|g__Bacteroides.s__Bacteroides_dorei	1.0224948875
+UniRef90_R7NZQ3	1.0209290454
+UniRef90_R7NZQ3|g__Bacteroides.s__Bacteroides_dorei	0.5104645227
+UniRef90_R7NZQ3|g__Bacteroides.s__Bacteroides_vulgatus	0.5104645227
+UniRef90_A6L332	1.0131712259
+UniRef90_A6L332|g__Bacteroides.s__Bacteroides_vulgatus	1.0131712259
+UniRef90_E5USP5	1.0131712259
+UniRef90_E5USP5|g__Bacteroides.s__Bacteroides_dorei	1.0131712259
+UniRef90_R6IEX5	1.0131712259
+UniRef90_R6IEX5|g__Bacteroides.s__Bacteroides_dorei	1.0131712259
+UniRef90_A6L024	1.0101010101
+UniRef90_A6L024|g__Bacteroides.s__Bacteroides_dorei	1.0101010101
+UniRef90_A6L746	1.0101010101
+UniRef90_A6L746|g__Bacteroides.s__Bacteroides_vulgatus	1.0101010101
+UniRef90_I8WMW4	1.0101010101
+UniRef90_I8WMW4|g__Bacteroides.s__Bacteroides_dorei	1.0101010101
+UniRef90_A6KWV9	1.0040160643
+UniRef90_A6KWV9|g__Bacteroides.s__Bacteroides_dorei	1.0040160643
+UniRef90_R9HKW8	1.0040160643
+UniRef90_R9HKW8|g__Bacteroides.s__Bacteroides_vulgatus	1.0040160643
+UniRef90_R6HMT9	0.9965122073
+UniRef90_R6HMT9|g__Bacteroides.s__Bacteroides_vulgatus	0.9965122073
+UniRef90_A6L3X6	0.9950248756
+UniRef90_A6L3X6|g__Bacteroides.s__Bacteroides_dorei	0.9950248756
+UniRef90_I8XV65	0.9935419771
+UniRef90_I8XV65|g__Bacteroides.s__Bacteroides_dorei	0.9935419771
+UniRef90_R9HL12	0.9920634921
+UniRef90_R9HL12|g__Bacteroides.s__Bacteroides_vulgatus	0.9920634921
+UniRef90_R6HKH4	0.9891196835
+UniRef90_R6HKH4|g__Bacteroides.s__Bacteroides_dorei	0.9891196835
+UniRef90_K5ZYK8	0.9832841691
+UniRef90_K5ZYK8|g__Bacteroides.s__Bacteroides_dorei	0.9832841691
+UniRef90_R6HN73	0.9832841691
+UniRef90_R6HN73|g__Bacteroides.s__Bacteroides_dorei	0.9832841691
+UniRef90_R7NV23	0.9760858956
+UniRef90_R7NV23|g__Bacteroides.s__Bacteroides_dorei	0.9760858956
+UniRef90_I8WB73	0.9746588694
+UniRef90_I8WB73|g__Bacteroides.s__Bacteroides_dorei	0.9746588694
+UniRef90_R6IIH4	0.9746588694
+UniRef90_R6IIH4|g__Bacteroides.s__Bacteroides_dorei	0.9746588694
+UniRef90_C6Z206	0.9718172983
+UniRef90_C6Z206|g__Bacteroides.s__Bacteroides_vulgatus	0.9718172983
+UniRef90_I8VM84	0.9718172983
+UniRef90_I8VM84|g__Bacteroides.s__Bacteroides_dorei	0.9718172983
+UniRef90_I9R0J7	0.9718172983
+UniRef90_I9R0J7|g__Bacteroides.s__Bacteroides_dorei	0.9718172983
+UniRef90_I9RBV3	0.9718172983
+UniRef90_I9RBV3|g__Bacteroides.s__Bacteroides_dorei	0.9718172983
+UniRef90_R6IGB6	0.9718172983
+UniRef90_R6IGB6|g__Bacteroides.s__Bacteroides_dorei	0.9718172983
+UniRef90_R7P4I6	0.9704027171
+UniRef90_R7P4I6|g__Bacteroides.s__Bacteroides_dorei	0.7278020378
+UniRef90_R7P4I6|g__Bacteroides.s__Bacteroides_vulgatus	0.2426006793
+UniRef90_A6L650	0.9689922481
+UniRef90_A6L650|g__Bacteroides.s__Bacteroides_dorei	0.9689922481
+UniRef90_C3R7K0	0.9689922481
+UniRef90_C3R7K0|g__Bacteroides.s__Bacteroides_dorei	0.9689922481
+UniRef90_E5UWG2	0.9689922481
+UniRef90_E5UWG2|g__Bacteroides.s__Bacteroides_vulgatus	0.9689922481
+UniRef90_I9PIK8	0.9689922481
+UniRef90_I9PIK8|g__Bacteroides.s__Bacteroides_vulgatus	0.9689922481
+UniRef90_A6L7I1	0.9661835749
+UniRef90_A6L7I1|g__Bacteroides.s__Bacteroides_vulgatus	0.9661835749
+UniRef90_A6KX54	0.9606147935
+UniRef90_A6KX54|g__Bacteroides.s__Bacteroides_dorei	0.9606147935
+UniRef90_I8WC73	0.9606147935
+UniRef90_I8WC73|g__Bacteroides.s__Bacteroides_dorei	0.9606147935
+UniRef90_D2ET35	0.9578544061
+UniRef90_D2ET35|g__Bacteroides.s__Bacteroides_dorei	0.9578544061
+UniRef90_R6IQ39	0.9578544061
+UniRef90_R6IQ39|g__Bacteroides.s__Bacteroides_vulgatus	0.9578544061
+UniRef90_R6HSX1	0.9551098376
+UniRef90_R6HSX1|g__Bacteroides.s__Bacteroides_dorei	0.9551098376
+UniRef90_I8VR47	0.9537434430
+UniRef90_I8VR47|g__Bacteroides.s__Bacteroides_dorei	0.9537434430
+UniRef90_R6HUN8	0.9510223490
+UniRef90_R6HUN8|g__Bacteroides.s__Bacteroides_vulgatus	0.9510223490
+UniRef90_R6IIQ1	0.9469696970
+UniRef90_R6IIQ1|g__Bacteroides.s__Bacteroides_dorei	0.9469696970
+UniRef90_R9H447	0.9442870633
+UniRef90_R9H447|g__Bacteroides.s__Bacteroides_vulgatus	0.9442870633
+UniRef90_A6L4P7	0.9429514380
+UniRef90_A6L4P7|g__Bacteroides.s__Bacteroides_vulgatus	0.9429514380
+UniRef90_A6L7A2	0.9416195857
+UniRef90_A6L7A2|g__Bacteroides.s__Bacteroides_vulgatus	0.9416195857
+UniRef90_I8ZFY6	0.9416195857
+UniRef90_I8ZFY6|g__Bacteroides.s__Bacteroides_vulgatus	0.9416195857
+UniRef90_R6HJ71	0.9416195857
+UniRef90_R6HJ71|g__Bacteroides.s__Bacteroides_vulgatus	0.9416195857
+UniRef90_A6L3T6	0.9376465073
+UniRef90_A6L3T6|g__Bacteroides.s__Bacteroides_vulgatus	0.9376465073
+UniRef90_A6L4N9	0.9285051068
+UniRef90_A6L4N9|g__Bacteroides.s__Bacteroides_dorei	0.9285051068
+UniRef90_A6L7I0	0.9285051068
+UniRef90_A6L7I0|g__Bacteroides.s__Bacteroides_dorei	0.9285051068
+UniRef90_D4V912	0.9285051068
+UniRef90_D4V912|g__Bacteroides.s__Bacteroides_dorei	0.9285051068
+UniRef90_Q8ABZ1	0.9272137228
+UniRef90_Q8ABZ1|g__Bacteroides.s__Bacteroides_dorei	0.9272137228
+UniRef90_C3Q1A6	0.9259259259
+UniRef90_C3Q1A6|g__Bacteroides.s__Bacteroides_dorei	0.9259259259
+UniRef90_R6HJW2	0.9208103131
+UniRef90_R6HJW2|g__Bacteroides.s__Bacteroides_vulgatus	0.9208103131
+UniRef90_R7P066	0.9182736455
+UniRef90_R7P066|g__Bacteroides.s__Bacteroides_vulgatus	0.9182736455
+UniRef90_I9UCZ0	0.9170105456
+UniRef90_I9UCZ0|g__Bacteroides.s__Bacteroides_vulgatus	0.9170105456
+UniRef90_R9H7T5	0.9144947417
+UniRef90_R9H7T5|g__Bacteroides.s__Bacteroides_vulgatus	0.9144947417
+UniRef90_C3QUE2	0.9132420091
+UniRef90_C3QUE2|g__Bacteroides.s__Bacteroides_dorei	0.9132420091
+UniRef90_I9QSX4	0.9119927041
+UniRef90_I9QSX4|g__Bacteroides.s__Bacteroides_dorei	0.9119927041
+UniRef90_R7P5Q2	0.9057971014
+UniRef90_R7P5Q2|g__Bacteroides.s__Bacteroides_dorei	0.9057971014
+UniRef90_R9H497	0.9033423668
+UniRef90_R9H497|g__Bacteroides.s__Bacteroides_vulgatus	0.9033423668
+UniRef90_A6KX38	0.9021199820
+UniRef90_A6KX38|g__Bacteroides.s__Bacteroides_vulgatus	0.9021199820
+UniRef90_R9HFQ4	0.9021199820
+UniRef90_R9HFQ4|g__Bacteroides.s__Bacteroides_vulgatus	0.9021199820
+UniRef90_R7NUQ4	0.9009009009
+UniRef90_R7NUQ4|g__Bacteroides.s__Bacteroides_vulgatus	0.9009009009
+UniRef90_A6L5B0	0.8996851102
+UniRef90_A6L5B0|g__Bacteroides.s__Bacteroides_vulgatus	0.8996851102
+UniRef90_I8VGE8	0.8978675645
+UniRef90_I8VGE8|g__Bacteroides.s__Bacteroides_dorei	0.8978675645
+UniRef90_A6KWQ7	0.8960573477
+UniRef90_A6KWQ7|g__Bacteroides.s__Bacteroides_dorei	0.8960573477
+UniRef90_D6D607	0.8912655971
+UniRef90_D6D607|g__Bacteroides.s__Bacteroides_dorei	0.8912655971
+UniRef90_R9HL20	0.8912655971
+UniRef90_R9HL20|g__Bacteroides.s__Bacteroides_vulgatus	0.8912655971
+UniRef90_A6KWR8	0.8877052818
+UniRef90_A6KWR8|g__Bacteroides.s__Bacteroides_dorei	0.8877052818
+UniRef90_R6HPZ6	0.8818342152
+UniRef90_R6HPZ6|g__Bacteroides.s__Bacteroides_dorei	0.8818342152
+UniRef90_A6L5B4	0.8795074758
+UniRef90_A6L5B4|g__Bacteroides.s__Bacteroides_vulgatus	0.8795074758
+UniRef90_R6IJG9	0.8646779075
+UniRef90_R6IJG9|g__Bacteroides.s__Bacteroides_dorei	0.8646779075
+UniRef90_R6HNP7	0.8613264427
+UniRef90_R6HNP7|g__Bacteroides.s__Bacteroides_vulgatus	0.8613264427
+UniRef90_R6IM56	0.8591065292
+UniRef90_R6IM56|g__Bacteroides.s__Bacteroides_dorei	0.8591065292
+UniRef90_R6HHH6	0.8557980317
+UniRef90_R6HHH6|g__Bacteroides.s__Bacteroides_dorei	0.8557980317
+UniRef90_A6KZH8	0.8547008547
+UniRef90_A6KZH8|g__Bacteroides.s__Bacteroides_vulgatus	0.8547008547
+UniRef90_Q8ABY7	0.8525149190
+UniRef90_Q8ABY7|g__Bacteroides.s__Bacteroides_vulgatus	0.8525149190
+UniRef90_A6KXE5	0.8514261388
+UniRef90_A6KXE5|g__Bacteroides.s__Bacteroides_vulgatus	0.8514261388
+UniRef90_D6D3B0	0.8481764207
+UniRef90_D6D3B0|g__Bacteroides.s__Bacteroides_dorei	0.8481764207
+UniRef90_C6ZA44	0.8454872120
+UniRef90_C6ZA44|g__Bacteroides.s__Bacteroides_dorei	0.8454872120
+UniRef90_A6L6C3	0.8449514153
+UniRef90_A6L6C3|g__Bacteroides.s__Bacteroides_dorei	0.8449514153
+UniRef90_A6L3I8	0.8428150021
+UniRef90_A6L3I8|g__Bacteroides.s__Bacteroides_dorei	0.4214075011
+UniRef90_A6L3I8|g__Bacteroides.s__Bacteroides_vulgatus	0.4214075011
+UniRef90_R6IM84	0.8333333333
+UniRef90_R6IM84|g__Bacteroides.s__Bacteroides_vulgatus	0.8333333333
+UniRef90_A6L0W5	0.8291873964
+UniRef90_A6L0W5|g__Bacteroides.s__Bacteroides_vulgatus	0.8291873964
+UniRef90_E4VQV4	0.8291873964
+UniRef90_E4VQV4|g__Bacteroides.s__Bacteroides_dorei	0.8291873964
+UniRef90_R7NWP4	0.8291873964
+UniRef90_R7NWP4|g__Bacteroides.s__Bacteroides_dorei	0.8291873964
+UniRef90_R7NWW8	0.8250825083
+UniRef90_R7NWW8|g__Bacteroides.s__Bacteroides_dorei	0.8250825083
+UniRef90_I9QJZ8	0.8230452675
+UniRef90_I9QJZ8|g__Bacteroides.s__Bacteroides_dorei	0.8230452675
+UniRef90_R6HHQ8	0.8230452675
+UniRef90_R6HHQ8|g__Bacteroides.s__Bacteroides_dorei	0.8230452675
+UniRef90_A6L0N6	0.8220304151
+UniRef90_A6L0N6|g__Bacteroides.s__Bacteroides_vulgatus	0.8220304151
+UniRef90_A6L6Q7	0.8210180624
+UniRef90_A6L6Q7|g__Bacteroides.s__Bacteroides_vulgatus	0.8210180624
+UniRef90_Q5LCV9	0.8210180624
+UniRef90_Q5LCV9|g__Bacteroides.s__Bacteroides_dorei	0.8210180624
+UniRef90_K5ZAB8	0.8190008190
+UniRef90_K5ZAB8|g__Bacteroides.s__Bacteroides_vulgatus	0.8190008190
+UniRef90_A6L157	0.8149959250
+UniRef90_A6L157|g__Bacteroides.s__Bacteroides_vulgatus	0.8149959250
+UniRef90_R6HGG5	0.8110300081
+UniRef90_R6HGG5|g__Bacteroides.s__Bacteroides_dorei	0.8110300081
+UniRef90_A6KWM8	0.8032128514
+UniRef90_A6KWM8|g__Bacteroides.s__Bacteroides_dorei	0.8032128514
+UniRef90_A6L7U6	0.8032128514
+UniRef90_A6L7U6|g__Bacteroides.s__Bacteroides_vulgatus	0.8032128514
+UniRef90_A6L599	0.7993605116
+UniRef90_A6L599|g__Bacteroides.s__Bacteroides_dorei	0.7993605116
+UniRef90_R6HI12	0.7984031936
+UniRef90_R6HI12|g__Bacteroides.s__Bacteroides_dorei	0.7984031936
+UniRef90_C3Q3D8	0.7917656374
+UniRef90_C3Q3D8|g__Bacteroides.s__Bacteroides_vulgatus	0.7917656374
+UniRef90_R7NZ09	0.7880220646
+UniRef90_R7NZ09|g__Bacteroides.s__Bacteroides_vulgatus	0.7880220646
+UniRef90_R7P6I7	0.7880220646
+UniRef90_R7P6I7|g__Bacteroides.s__Bacteroides_vulgatus	0.7880220646
+UniRef90_R6HT86	0.7833920877
+UniRef90_R6HT86|g__Bacteroides.s__Bacteroides_dorei	0.7833920877
+UniRef90_A6KZL0	0.7824726135
+UniRef90_A6KZL0|g__Bacteroides.s__Bacteroides_vulgatus	0.7824726135
+UniRef90_R9HFT2	0.7788161994
+UniRef90_R9HFT2|g__Bacteroides.s__Bacteroides_vulgatus	0.7788161994
+UniRef90_A6KWN7	0.7770007770
+UniRef90_A6KWN7|g__Bacteroides.s__Bacteroides_vulgatus	0.7770007770
+UniRef90_A6KYL8	0.7770007770
+UniRef90_A6KYL8|g__Bacteroides.s__Bacteroides_vulgatus	0.7770007770
+UniRef90_I9FRX6	0.7742934572
+UniRef90_I9FRX6|g__Bacteroides.s__Bacteroides_dorei	0.7742934572
+UniRef90_R6HJM3	0.7724990344
+UniRef90_R6HJM3|g__Bacteroides.s__Bacteroides_dorei	0.7724990344
+UniRef90_C3R782	0.7698229407
+UniRef90_C3R782|g__Bacteroides.s__Bacteroides_dorei	0.7698229407
+UniRef90_R6HUU0	0.7698229407
+UniRef90_R6HUU0|g__Bacteroides.s__Bacteroides_vulgatus	0.7698229407
+UniRef90_R6IGZ3	0.7662835249
+UniRef90_R6IGZ3|g__Bacteroides.s__Bacteroides_vulgatus	0.7662835249
+UniRef90_A6L0T7	0.7593014427
+UniRef90_A6L0T7|g__Bacteroides.s__Bacteroides_vulgatus	0.7593014427
+UniRef90_D1JYZ2	0.7593014427
+UniRef90_D1JYZ2|g__Bacteroides.s__Bacteroides_dorei	0.7593014427
+UniRef90_A6KWF7	0.7587253414
+UniRef90_A6KWF7|g__Bacteroides.s__Bacteroides_dorei	0.7587253414
+UniRef90_A6KZI6	0.7558578987
+UniRef90_A6KZI6|g__Bacteroides.s__Bacteroides_vulgatus	0.7558578987
+UniRef90_R6IEK0	0.7515971439
+UniRef90_R6IEK0|g__Bacteroides.s__Bacteroides_dorei	0.7515971439
+UniRef90_C6Z134	0.7490636704
+UniRef90_C6Z134|g__Bacteroides.s__Bacteroides_dorei	0.7490636704
+UniRef90_R6HK29	0.7473841555
+UniRef90_R6HK29|g__Bacteroides.s__Bacteroides_vulgatus	0.7473841555
+UniRef90_B6W4M4	0.7468259895
+UniRef90_B6W4M4|g__Bacteroides.s__Bacteroides_dorei	0.7468259895
+UniRef90_C3PZ55	0.7423904974
+UniRef90_C3PZ55|g__Bacteroides.s__Bacteroides_vulgatus	0.7423904974
+UniRef90_Q64S81	0.7358351729
+UniRef90_Q64S81|g__Bacteroides.s__Bacteroides_dorei	0.7358351729
+UniRef90_R9H527	0.7358351729
+UniRef90_R9H527|g__Bacteroides.s__Bacteroides_vulgatus	0.7358351729
+UniRef90_R6HI47	0.7350238883
+UniRef90_R6HI47|g__Bacteroides.s__Bacteroides_dorei	0.7350238883
+UniRef90_R6HK46	0.7334066740
+UniRef90_R6HK46|g__Bacteroides.s__Bacteroides_dorei	0.7334066740
+UniRef90_A6KYQ7	0.7326007326
+UniRef90_A6KYQ7|g__Bacteroides.s__Bacteroides_vulgatus	0.7326007326
+UniRef90_A6KZH6	0.7309941520
+UniRef90_A6KZH6|g__Bacteroides.s__Bacteroides_vulgatus	0.7309941520
+UniRef90_I9FG38	0.7309941520
+UniRef90_I9FG38|g__Bacteroides.s__Bacteroides_dorei	0.7309941520
+UniRef90_R6I130	0.7293946025
+UniRef90_R6I130|g__Bacteroides.s__Bacteroides_dorei	0.7293946025
+UniRef90_D4V8A6	0.7262164125
+UniRef90_D4V8A6|g__Bacteroides.s__Bacteroides_vulgatus	0.7262164125
+UniRef90_I9G2K1	0.7254261879
+UniRef90_I9G2K1|g__Bacteroides.s__Bacteroides_dorei	0.7254261879
+UniRef90_C3PWE3	0.7230657990
+UniRef90_C3PWE3|g__Bacteroides.s__Bacteroides_vulgatus	0.7230657990
+UniRef90_A6L5I2	0.7183908046
+UniRef90_A6L5I2|g__Bacteroides.s__Bacteroides_dorei	0.7183908046
+UniRef90_F9Z7G7	0.7183908046
+UniRef90_F9Z7G7|g__Bacteroides.s__Bacteroides_vulgatus	0.7183908046
+UniRef90_A6L6E8	0.7153075823
+UniRef90_A6L6E8|g__Bacteroides.s__Bacteroides_dorei	0.7153075823
+UniRef90_A6L1L2	0.7145409075
+UniRef90_A6L1L2|g__Bacteroides.s__Bacteroides_vulgatus	0.7145409075
+UniRef90_R6ILR7	0.7122507123
+UniRef90_R6ILR7|g__Bacteroides.s__Bacteroides_dorei	0.7122507123
+UniRef90_I8ZT74	0.7062146893
+UniRef90_I8ZT74|g__Bacteroides.s__Bacteroides_vulgatus	0.7062146893
+UniRef90_R6HJI6	0.7032348805
+UniRef90_R6HJI6|g__Bacteroides.s__Bacteroides_dorei	0.7032348805
+UniRef90_R6HJ84	0.7002801120
+UniRef90_R6HJ84|g__Bacteroides.s__Bacteroides_dorei	0.7002801120
+UniRef90_I8WPF1	0.6973500697
+UniRef90_I8WPF1|g__Bacteroides.s__Bacteroides_dorei	0.6973500697
+UniRef90_R6I175	0.6968641115
+UniRef90_R6I175|g__Bacteroides.s__Bacteroides_vulgatus	0.6968641115
+UniRef90_R6HJL3	0.6958942241
+UniRef90_R6HJL3|g__Bacteroides.s__Bacteroides_vulgatus	0.6958942241
+UniRef90_R9H4V5	0.6958942241
+UniRef90_R9H4V5|g__Bacteroides.s__Bacteroides_vulgatus	0.6958942241
+UniRef90_A6KXE9	0.6887052342
+UniRef90_A6KXE9|g__Bacteroides.s__Bacteroides_dorei	0.6887052342
+UniRef90_A6KZC6	0.6872852234
+UniRef90_A6KZC6|g__Bacteroides.s__Bacteroides_dorei	0.6872852234
+UniRef90_R6HWZ1	0.6788866259
+UniRef90_R6HWZ1|g__Bacteroides.s__Bacteroides_vulgatus	0.6788866259
+UniRef90_R9H303	0.6788866259
+UniRef90_R9H303|g__Bacteroides.s__Bacteroides_dorei	0.6788866259
+UniRef90_C3RF19	0.6740815639
+UniRef90_C3RF19|g__Bacteroides.s__Bacteroides_vulgatus	0.6740815639
+UniRef90_R9H4S0	0.6734006734
+UniRef90_R9H4S0|g__Bacteroides.s__Bacteroides_vulgatus	0.6734006734
+UniRef90_C3RFH8	0.6706908115
+UniRef90_C3RFH8|g__Bacteroides.s__Bacteroides_dorei	0.6706908115
+UniRef90_R7NVK1	0.6680026720
+UniRef90_R7NVK1|g__Bacteroides.s__Bacteroides_dorei	0.6680026720
+UniRef90_C3RCI2	0.6626905235
+UniRef90_C3RCI2|g__Bacteroides.s__Bacteroides_dorei	0.6626905235
+UniRef90_A6KZV6	0.6613756614
+UniRef90_A6KZV6|g__Bacteroides.s__Bacteroides_vulgatus	0.6613756614
+UniRef90_R6HUT5	0.6600660066
+UniRef90_R6HUT5|g__Bacteroides.s__Bacteroides_vulgatus	0.6600660066
+UniRef90_R6HZ28	0.6600660066
+UniRef90_R6HZ28|g__Bacteroides.s__Bacteroides_dorei	0.6600660066
+UniRef90_R6HSW5	0.6472491909
+UniRef90_R6HSW5|g__Bacteroides.s__Bacteroides_dorei	0.6472491909
+UniRef90_R6HHG0	0.6447453256
+UniRef90_R6HHG0|g__Bacteroides.s__Bacteroides_dorei	0.6447453256
+UniRef90_I9IJN0	0.6422607579
+UniRef90_I9IJN0|g__Bacteroides.s__Bacteroides_vulgatus	0.6422607579
+UniRef90_A6L1H2	0.6410256410
+UniRef90_A6L1H2|g__Bacteroides.s__Bacteroides_vulgatus	0.6410256410
+UniRef90_R6HHZ5	0.6410256410
+UniRef90_R6HHZ5|g__Bacteroides.s__Bacteroides_dorei	0.6410256410
+UniRef90_R7P064	0.6283380459
+UniRef90_R7P064|g__Bacteroides.s__Bacteroides_vulgatus	0.6283380459
+UniRef90_R6HY39	0.6277463905
+UniRef90_R6HY39|g__Bacteroides.s__Bacteroides_dorei	0.6277463905
+UniRef90_R9H3B8	0.6265664160
+UniRef90_R9H3B8|g__Bacteroides.s__Bacteroides_vulgatus	0.6265664160
+UniRef90_D4VAA3	0.6178560395
+UniRef90_D4VAA3|g__Bacteroides.s__Bacteroides_vulgatus	0.6178560395
+UniRef90_I8VJA2	0.6138735421
+UniRef90_I8VJA2|g__Bacteroides.s__Bacteroides_dorei	0.6138735421
+UniRef90_R7P010	0.5957700328
+UniRef90_R7P010|g__Bacteroides.s__Bacteroides_dorei	0.5957700328
+UniRef90_R7NZU3	0.5889281508
+UniRef90_R7NZU3|g__Bacteroides.s__Bacteroides_vulgatus	0.5889281508
+UniRef90_R6HLC4	0.5712653528
+UniRef90_R6HLC4|g__Bacteroides.s__Bacteroides_dorei	0.5712653528
+UniRef90_C3RCJ1	0.5688282139
+UniRef90_C3RCJ1|g__Bacteroides.s__Bacteroides_dorei	0.5688282139
+UniRef90_C3REY0	0.5621135469
+UniRef90_C3REY0|g__Bacteroides.s__Bacteroides_dorei	0.5621135469
+UniRef90_R9HNV3	0.5574136009
+UniRef90_R9HNV3|g__Bacteroides.s__Bacteroides_vulgatus	0.5574136009
+UniRef90_R9ILG9	0.5420054201
+UniRef90_R9ILG9|g__Bacteroides.s__Bacteroides_vulgatus	0.5420054201
+UniRef90_A6KY14	0.5216484090
+UniRef90_A6KY14|g__Bacteroides.s__Bacteroides_dorei	0.5216484090
+UniRef90_I8WHD1	0.5167958656
+UniRef90_I8WHD1|g__Bacteroides.s__Bacteroides_dorei	0.5167958656
+UniRef90_A6KZH7	0.5148005148
+UniRef90_A6KZH7|g__Bacteroides.s__Bacteroides_dorei	0.5148005148
+UniRef90_E5UXW6	0.5120327701
+UniRef90_E5UXW6|g__Bacteroides.s__Bacteroides_vulgatus	0.5120327701
+UniRef90_A6KXQ8	0.5096839959
+UniRef90_A6KXQ8|g__Bacteroides.s__Bacteroides_vulgatus	0.5096839959
+UniRef90_A6L536	0.4642525534
+UniRef90_A6L536|g__Bacteroides.s__Bacteroides_vulgatus	0.4642525534
+UniRef90_J9F9P5	0.4547521601
+UniRef90_J9F9P5|g__Bacteroides.s__Bacteroides_dorei	0.4547521601
+UniRef90_R7P1T3	0.4438526409
+UniRef90_R7P1T3|g__Bacteroides.s__Bacteroides_vulgatus	0.4438526409
+UniRef90_R6IJZ8	0.4251700680
+UniRef90_R6IJZ8|g__Bacteroides.s__Bacteroides_vulgatus	0.4251700680
+UniRef90_C3RF26	0.4145936982
+UniRef90_C3RF26|g__Bacteroides.s__Bacteroides_dorei	0.4145936982
+UniRef90_A6L3C1	0.3766478343
+UniRef90_A6L3C1|g__Bacteroides.s__Bacteroides_dorei	0.3766478343
+UniRef90_C6Z3L0	0.3144654088
+UniRef90_C6Z3L0|g__Bacteroides.s__Bacteroides_dorei	0.3144654088
+UniRef90_I9RGY5	0.2213368747
+UniRef90_I9RGY5|g__Bacteroides.s__Bacteroides_dorei	0.2213368747
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/demo_pathabundance.tsv	Mon Mar 13 12:37:33 2017 -0400
@@ -0,0 +1,29 @@
+# Pathway	demo_Abundance
+UNMAPPED	1548.1865983490
+UNINTEGRATED	6378.3363291102
+UNINTEGRATED|g__Bacteroides.s__Bacteroides_vulgatus	2909.3950875399
+UNINTEGRATED|g__Bacteroides.s__Bacteroides_dorei	1957.0469180460
+UNINTEGRATED|unclassified	46.5907339353
+PWY-5423: oleoresin monoterpene volatiles biosynthesis	13.7815543238
+PWY-5423: oleoresin monoterpene volatiles biosynthesis|unclassified	13.7815543238
+PWY-6305: putrescine biosynthesis IV	12.3568523173
+PWY-6305: putrescine biosynthesis IV|unclassified	12.3568523173
+PWY490-3: nitrate reduction VI (assimilatory)	10.9962495261
+PWY490-3: nitrate reduction VI (assimilatory)|unclassified	10.9962495261
+PWY-1269: CMP-3-deoxy-D-manno-octulosonate biosynthesis I	10.6471569863
+PWY-1269: CMP-3-deoxy-D-manno-octulosonate biosynthesis I|unclassified	8.9740635174
+COA-PWY-1: coenzyme A biosynthesis II (mammalian)	6.3694267516
+COA-PWY-1: coenzyme A biosynthesis II (mammalian)|g__Bacteroides.s__Bacteroides_vulgatus	4.7961630695
+PWY-6700: queuosine biosynthesis	5.5726434156
+PWY-6700: queuosine biosynthesis|g__Bacteroides.s__Bacteroides_dorei	3.4037771853
+PWY-6700: queuosine biosynthesis|g__Bacteroides.s__Bacteroides_vulgatus	1.4512868417
+PWY-7111: pyruvate fermentation to isobutanol (engineered)	3.1668118122
+PWY-7111: pyruvate fermentation to isobutanol (engineered)|g__Bacteroides.s__Bacteroides_vulgatus	2.3731126339
+VALSYN-PWY: L-valine biosynthesis	3.1668118122
+VALSYN-PWY: L-valine biosynthesis|g__Bacteroides.s__Bacteroides_vulgatus	2.3731126339
+PWY-5695: urate biosynthesis/inosine 5'-phosphate degradation	2.8720157961
+PWY-5097: L-lysine biosynthesis VI	2.6664127226
+PWY-2942: L-lysine biosynthesis III	2.5305778153
+PWY-2942: L-lysine biosynthesis III|g__Bacteroides.s__Bacteroides_dorei	1.7857142857
+PWY-7219: adenosine ribonucleotides de novo biosynthesis	2.4290890774
+PWY-7219: adenosine ribonucleotides de novo biosynthesis|g__Bacteroides.s__Bacteroides_dorei	1.2474418751
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/demo_pathcoverage.tsv	Mon Mar 13 12:37:33 2017 -0400
@@ -0,0 +1,29 @@
+# Pathway	demo_Coverage
+UNMAPPED	1.0000000000
+UNINTEGRATED	1.0000000000
+UNINTEGRATED|g__Bacteroides.s__Bacteroides_dorei	1.0000000000
+UNINTEGRATED|g__Bacteroides.s__Bacteroides_vulgatus	1.0000000000
+UNINTEGRATED|unclassified	1.0000000000
+PWY-5423: oleoresin monoterpene volatiles biosynthesis	0.9874950891
+PWY-5423: oleoresin monoterpene volatiles biosynthesis|unclassified	0.8805252394
+PWY-6305: putrescine biosynthesis IV	0.9518375285
+PWY-6305: putrescine biosynthesis IV|unclassified	0.7234100116
+PWY490-3: nitrate reduction VI (assimilatory)	0.9568614047
+PWY490-3: nitrate reduction VI (assimilatory)|unclassified	0.7290147297
+PWY-1269: CMP-3-deoxy-D-manno-octulosonate biosynthesis I	0.9392767343
+PWY-1269: CMP-3-deoxy-D-manno-octulosonate biosynthesis I|unclassified	0.5431316496
+COA-PWY-1: coenzyme A biosynthesis II (mammalian)	0.7609346153
+COA-PWY-1: coenzyme A biosynthesis II (mammalian)|g__Bacteroides.s__Bacteroides_vulgatus	0.8557878872
+PWY-6700: queuosine biosynthesis	0.6918160989
+PWY-6700: queuosine biosynthesis|g__Bacteroides.s__Bacteroides_dorei	0.7183078347
+PWY-6700: queuosine biosynthesis|g__Bacteroides.s__Bacteroides_vulgatus	0.3826190602
+PWY-7111: pyruvate fermentation to isobutanol (engineered)	0.3826032161
+PWY-7111: pyruvate fermentation to isobutanol (engineered)|g__Bacteroides.s__Bacteroides_vulgatus	0.5877696572
+VALSYN-PWY: L-valine biosynthesis	0.3826032161
+VALSYN-PWY: L-valine biosynthesis|g__Bacteroides.s__Bacteroides_vulgatus	0.5877696572
+PWY-5695: urate biosynthesis/inosine 5'-phosphate degradation	0.3368670323
+PWY-5097: L-lysine biosynthesis VI	0.2856160532
+PWY-2942: L-lysine biosynthesis III	0.2651956314
+PWY-2942: L-lysine biosynthesis III|g__Bacteroides.s__Bacteroides_dorei	0.4389950257
+PWY-7219: adenosine ribonucleotides de novo biosynthesis	0.2181895299
+PWY-7219: adenosine ribonucleotides de novo biosynthesis|g__Bacteroides.s__Bacteroides_dorei	0.3040136356
\ No newline at end of file
Binary file test-data/g__Bacteroides.s__Bacteroides_stercoris.centroids.v0.1.1.ffn.gz has changed
Binary file test-data/g__Bacteroides.s__Bacteroides_thetaiotaomicron.centroids.v0.1.1.ffn.gz has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/input_sequences.fasta	Mon Mar 13 12:37:33 2017 -0400
@@ -0,0 +1,155 @@
+>r2|637000026.fna|5753889|5754040|_from_ |NC_004663_Bacteroides_thetaiotaomicron_VPI-5482,_c|_ln383_#0/1
+CTCCGTCCGCTGGTAGAACGTCTGGTAGAAGCTCAAAAAGCATTGGCAACCAAATACCTTTCCGAAGCCAAACGACTGATTGCCTCCAACGACAAGAAGGAAGTGGAAGAAGGATTCCTTGCCCTTTATCGTAGCCACAAGTGTCTTCCGA
+>r3|637000026.fna|1749333|1749484|_from_ |NC_004663_Bacteroides_thetaiotaomicron_VPI-5482,_c|_ln165_#0/1
+AAGTAAAAGTCTACACACAGGAAGGAACGATAATGGAAAGTACGATTGAAGTAAATCGTCCGATGGAGATAGCAGGATGGAAAATTTATCAGCTTAGTTATGATGAGTCGAAAGGTCGCTGGAGCGATATCAGTGTCTTTGAGCTGGTTCG
+>r8|637000026.fna|2991814|2991965|_from_ |NC_004663_Bacteroides_thetaiotaomicron_VPI-5482,_c|_ln402_#0/1
+AGAAAGTTTTGATCAAAGCATGGGATGCTGAAAACGGACCGGTAATTATCGACTCAGGAGAAAGTACCTACAACACAACCGCCAAAAAGTTCAGCCTCAAATATACGATCGGTAACACGCTATATGAAGAGCAACTGACCAAAGAAAAAGA
+>r24|641736196.fna|214158|214309|_from_ |NZ_ABFZ02000018_Bacteroides_stercoris_ATCC_43183,|_ln388_#0/1
+CAGATACGAGTACCAATTGGCCGTCAACGACTATTGGAAGGAAGTCGGCGGATTGCAGATGCTGCCCGGAACCAACCGCTCCAGCGACCGCTTTGTACGCGCGTCATTCTACATTCATGCCATTCCGCAGACAGCAGACGCGGCGATTGCA
+>r32|637000026.fna|4140951|4141102|_from_ |NC_004663_Bacteroides_thetaiotaomicron_VPI-5482,_c|_ln422_#0/1
+TATTCTCAGGGGACTAATTGGTGATATAGTGCTCGATTATGATAGAGGTGAAGGAATTATGTCCTTTAAGACTCAAAAGGTAGGTTATATATCAGGATATTATTTGGGATGTACTACATATTGTTATGCCATGGGATTTTATCCTACATAT
+>r55|637000026.fna|6212867|6213018|_from_ |NC_004663_Bac